Jian Liu,1 Li Wang,1 Xiao Yu Tian,1 Limei Liu,2 Wing Tak Wong,3 Yang Zhang,1

Quan-Bin Han,4 Hing-Man Ho,4 Nanping Wang,5 Siu Ling Wong,1 Zhen-Yu Chen,6

Jun Yu,7 Chi-Fai Ng,8 Xiaoqiang Yao,1 and Yu Huang1

Unconjugated Bilirubin Mediates HemeOxygenase-1–Induced VascularBenefits in Diabetic MiceDiabetes 2015;64:1564–1575 | DOI: 10.2337/db14-1391

Heme oxygenase-1 (HO-1) exerts vasoprotectiveeffects. Such benefit in diabetic vasculopathy, however,remains unclear. We hypothesize that bilirubin mediatesHO-1–induced vascular benefits in diabetes. Diabeticdb/db mice were treated with hemin (HO-1 inducer) for2 weeks, and aortas were isolated for functional andmolecular assays. Nitric oxide (NO) production wasmeasured in cultured endothelial cells. Hemin treatmentaugmented endothelium-dependent relaxations (EDRs)and elevated Akt and endothelial NO synthase (eNOS)phosphorylation in db/db mouse aortas, which were re-versed by the HO-1 inhibitor SnMP or HO-1 silencingvirus. Hemin treatment increased serum bilirubin, andex vivo bilirubin treatment improved relaxations in dia-betic mouse aortas, which was reversed by the Akt in-hibitor. Biliverdin reductase silencing virus attenuatedthe effect of hemin. Chronic bilirubin treatment im-proved EDRs in db/db mouse aortas. Hemin and biliru-bin reversed high glucose–induced reductions in Aktand eNOS phosphorylation and NO production. The ef-fect of hemin but not bilirubin was inhibited by biliverdinreductase silencing virus. Furthermore, bilirubin aug-mented EDRs in renal arteries from diabetic patients.In summary, HO-1–induced restoration of endothelialfunction in diabetic mice is most likely mediated bybilirubin, which preserves NO bioavailability throughthe Akt/eNOS/NO cascade, suggesting bilirubin as apotential therapeutic target for clinical intervention ofdiabetic vasculopathy.

Cardiovascular disease is the leading cause of death anddisability for patients with diabetes (1). Hyperglycemiaand insulin resistance reduce nitric oxide (NO) bioavail-ability and diminish the antiatherogenic capacity of theendothelium, resulting in platelet aggregation, increasedvascular contractility, and accelerated atherosclerosis.Thus, strategies that preserve endothelial function mayhelp alleviate diabetic vasculopathy (2).

Heme oxygenase (HO) catalyzes heme to form carbonmonoxide (CO), Fe2+, and biliverdin; the latter is con-verted into unconjugated bilirubin by biliverdin reductase(BVR) (3). Two distinct isoforms of HO have been iden-tified: heme oxygenase 1 (HO-1) and heme oxygenase 2(HO-2). Although HO-2 is constitutively expressed, theexpression of HO-1 is normally low, but inducible. HO-1can be upregulated by stimuli, such as lipopolysaccharideand H2O2, in various cells or organs (4,5). Limited studiesshow an altered HO-1 expression under metabolic condi-tions. HO-1 expression and activity is increased in humanumbilical vein endothelial cells (HUVECs) when exposedto 10 mmol/L glucose for 48 h compared with 5.5 mmol/Lglucose but remains unchanged when exposed to 20 mmol/Lglucose for 48 h (6). HO-1 mRNA is downregulated inskeletal muscle of diabetic patients but is increased inthe liver and visceral fat of obese patients (7,8), suggest-ing that HO-1 expression can be differently regulated inmajor metabolic organs under different disease states.

1Institute of Vascular Medicine, Shenzhen Research Institute, and Li Ka ShingInstitute of Health Sciences, Chinese University of Hong Kong, Hong Kong, China2Department of Physiology and Pathophysiology, Peking University Health Sci-ence Center, Beijing, China3Department of Cardiovascular Sciences, Houston Methodist Research Institute,Houston, TX4School of Chinese Medicine, Hong Kong Baptist University, Hong Kong, China5Institute of Cardiovascular Science, Peking University, Beijing, China6School of Life Sciences, Chinese University of Hong Kong, Hong Kong, China7Department of Medicine and Therapeutics, Chinese University of Hong Kong, HongKong, China

8Department of Surgery, Chinese University of Hong Kong, Hong Kong, China

Corresponding author: Yu Huang, yu-huang@cuhk.edu.hk.

Received 10 September 2014 and accepted 26 November 2014.

This article contains Supplementary Data online at http://diabetes.diabetesjournals.org/lookup/suppl/doi:10.2337/db14-1391/-/DC1.

© 2015 by the American Diabetes Association. Readers may use this article aslong as the work is properly cited, the use is educational and not for profit, andthe work is not altered.

See accompanying article, p. 1506.

1564 Diabetes Volume 64, May 2015

METABOLISM

Growing evidence suggests HO-1 is a potential targetfor intervention of diabetes. Induction of HO-1 in obesemice increases plasma adiponectin, improves insulin sen-sitivity, and decreases visceral and abdominal adiposityand plasma proinflammatory cytokines (9). HO-1 overex-pression reduces lymphocytic infiltration in Langerhansislets and retards the progression of type 1 diabetes (10).HO-1 also protects against high glucose (HG)–induced im-pairment of endothelial-dependent relaxations (EDRs) inrat aortas (11) and HG-induced endothelial cell apoptosis(6,12). These studies indicate that HO-1 induction mayserve as a potential therapeutic strategy to treat diabeticvascular complications. However, the precise intracellularmechanisms mediating the vasoprotective benefits of HO-1remain largely unexplored.

Bilirubin is converted from biliverdin by BVR. Clinicalstudies show an inverse association between the serumbilirubin concentration with the incidences of myocardialinfarction, peripheral artery disease, and stroke (13–16),and the serum bilirubin level is lower in diabetic patients(17). Of note, Gilbert syndrome patients, who have higherlevels of serum unconjugated bilirubin, are less prone tomajor adverse cardiovascular events (18), and individualswith higher serum bilirubin were better protected fromdeveloping metabolic disorders in a 4-year retrospec-tive longitudinal study (19). Bilirubin is a potent anti-oxidant, and efforts have been directed to determinewhether bilirubin can be used to treat diseases associ-ated with oxidative stress. Indeed, atazanavir, a drugthat raises unconjugated bilirubin levels, enhances plasmaantioxidant capacity and improves EDRs in diabeticpatients (20).

This study examined the hypothesis that unconjugatedbilirubin mediates the vascular benefits of HO-1 inductionto restore impaired endothelial function in diabetic db/dbmice and investigated the possible mechanisms involved.The present new findings support the clinical observationthat bilirubin is vasoprotective in diabetes.

RESEARCH DESIGN AND METHODS

Animal care and the experimental protocol were ap-proved by the Chinese University of Hong Kong (CUHK)Animal Research Ethics Committee in compliance withthe Guide for the Care and Use of Laboratory Animals(National Institutes of Health Publication No. 85-23,revised 1996).

Animals and ReagentsTwelve-week-old male diabetic db/db mice on a C57BL/KsJ background and nondiabetic littermates db/m+ micewere supplied by the CUHK Animal Service Center, keptin a temperature-controlled room (;23°C) with a 12-hlight/dark cycle, and fed a standard diet and water adlibitum. The db/db mice were treated with vehicle, hemin(HO-1 inducer, 25 mg/kg body weight [BW], three timesweekly intraperitoneally [i.p.]), hemin+SnMP (HO-1inhibitor; 20 mg/kg BW, three times weekly i.p.),

hemin+scramble virus (109 plaque-forming units [pfu]),hemin+HO-1 short hairpin (sh)RNA virus (109 pfu), orbilirubin (5 mg/kg BW, three times weekly i.p.). The db/m+

mice were treated with vehicle or hemin (25 mg/kg BW,three times weekly i.p.).

Diet-induced obese (DIO) mice were generated byfeeding 6-week-old C57BL/6J mice a high-fat rodent dietwith 45% kcal% fat (D12451; Research Diets Inc., NewBrunswick, NJ) for 10 weeks. Mice were then treated withhemin or vehicle for 2 weeks (25 mg/kg BW, three timesweekly i.p.).

SnMP was purchased from Frontier Scientific (Logan,UT), and all other reagents were from Sigma-Aldrich (St.Louis, MO), unless otherwise stated.

Vessel PreparationAfter mice were killed, thoracic aortas were removed,placed in ice-cold Krebs solution (in mmol/L: 119 NaCl,4.7 KCl, 2.5 CaCl2, 1 MgCl2, 25 NaHCO3, 1.2 KH2PO4, and11 D-glucose), and cut into ring segments. Changes inisometric tension in aortic rings were recorded by MultiMyograph System (Danish Myo Technology A/S, AarhusN, Denmark) (21). The baseline tension was set at 3 mN,and all rings were equilibrated for 60 min before the startof the experiments.

Functional StudyAortic rings were contracted by 1 mmol/L phenylephrine(Phe) to induce a sustained tension before acetylcholine(ACh) (1028 to 1025 mol/L) was added cumulatively totrigger EDRs. EDRs induced by the NO donor sodium nitro-prusside (SNP) (1028 to 1025 mol/L) were compared inarteries from different groups.

Organ Culture of Aortic RingsMouse aortas were cultured for 24 h at 37°C in DMEM(Gibco, Gaithersburg, MD) supplemented with 10% FBS(Gibco) and 100 IU/mL penicillin plus 100 mg/mL strep-tomycin, as previously described (22). The db/db mouseaortas were treated with 5 mmol/L hemin or 1 mmol/Lunconjugated bilirubin, in control and in the presenceof 30 mmol/L SnMP or 5 mmol/L Akt inhibitor V.

For ex vivo viral transduction, mouse aortas werecultured with 109 pfu BVR shRNA or GFP shRNA adeno-virus for 24 h and then treated with hemin or unconju-gated bilirubin for another 24 h.

Human Artery SpecimensThe use of human specimens was approved by the JointChinese University of Hong Kong-New Territories EastCluster Clinical Research Ethics Committee. Human renalarteries were obtained after informed consent frompatients without cardiometabolic complications andfrom diabetic patients undergoing nephrectomy due toneoplasm at ages between 50 and 80 years. Diabetes inpatients was defined as a fasting plasma glucose level$7.0 mmol/L.

diabetes.diabetesjournals.org Liu and Associates 1565

Oral Glucose Tolerance Test and IntraperitonealInsulin Tolerance TestMice were loaded with glucose (1.2 g/kg BW) for the oralglucose tolerance test after an 8-h fast. For the insulintolerance test, mice were injected with insulin at 0.75 units/kgBW after a 2-h fast. Blood glucose was measured at 0, 15, 30,60, and 120 min with an Ascensia ELITE glucometer (BayerHealthCare, Mishawaka, IN).

Plasma Insulin Level and Lipid ProfilePlasma insulin levels were assayed by enzyme immuno-assay (Mercodia AB, Uppsala, Sweden). Plasma levels oftotal cholesterol, triglyceride, HDL, and non-HDL weredetermined using enzymatic methods (Stanbio Labora-tory, Boerne, TX).

Liquid Chromatography–Mass SpectrometryMeasurement of Unconjugated BilirubinA total of 400 mL of 60% (v/v) acetonitrile in 0.01 mol/Lphosphate buffer (pH 8.0) was added to 100 mL serumor culture medium, vortexed for 30 seconds, and centri-fuged for 5 min at 1,000 rpm (23). Supernatant (100 mL)was applied on the Agilent 6460 Triple QuadrupoleMass Spectrometer (Agilent Technologies, Santa Clara,CA) with ultra-high-performance liquid chromato-graphic (UPLC) tandem mass spectroscopy (MS). Thechromatographic separation was performed on anACQUITY UPLC BEH C18 column (2.1 mm 3 100 mm,ID, 1.7-mm particle size; Waters, Milford, MA) at 4°C,with the mobile phase consisting of A) 0.1% formicacid in water and B) 0.1% formic acid in acetonitrileby a gradient elution method (55–100% of B from0 to 12.5 min, 100% of B from 12.5 to 13 min, and55% of B from 13.1 to 16 min). The injection volumewas 3 mL, and the flow rate was 0.4 mL/min. The elutionwas directed to the MS without splitting. The tempera-ture of the autosampler was set at 4°C throughout theanalysis. The MS, which was equipped with an ion sourceof electrospray ionization (Agilent Jet Stream) in nega-tive ion mode, was used for bilirubin detection. Thesource parameters were set as gas temperature, 300°C;gas flow, 8 L/min; nebulizer, 30 c; sheath gas tempera-ture, 350°C; sheath gas flow, 10 L/min; capillary voltage,3,500 V; and nozzle voltage, 1,000 V. The MS recordingswere done in multiple reactions monitoring mode. Nitrogenwas used as the collision gas, and the monitor ion andcollision energy were m/z 583.2 → 285.2 and 20 eV,respectively.

Measurement of Nitrite in Mouse AortasMouse aortas were treated with hemin (5 mmol/L) orbilirubin (1 mmol/L) for 24 h, followed by the additionof 10 mmol /L ACh (10 min) to stimulate NO generationwith the presence of nitrate reductase to reduce nitrate tonitrite. Aortas were homogenized, and the nitrite level inthe supernatants was measured by a Griess reagent kit(Molecular Probes, Eugene, OR) and normalized by theprotein content.

Construction of HO-1 shRNA Adeno-Associated VirusshRNA sequence targeting mouse HO-1 was obtainedfrom Sigma-Aldrich (TRCN0000234077). The 59-GATCCACAGTGGCAGTGGGAATTTATCTCGAGATAAATTCCCACTGCCACTGTTTTTTA-39 and 59-AGCTTAAAAAACAGTGGCAGTGGGAATTTATCTCGAGATAAATTCCCACTGCCACTGTG-39 were annealed and cloned into the pAAV-ZsGreen -shRNA (YRGene) shuttle vector to constructpAAV-ZsGreen-HO-1 shRNA plasmid, and then it wascotransfected into HEK-293T with RGDLRVS-AAV9 capplasmid (a gift of Dr. O.J. Müller, University HospitalHeidelberg, Heidelberg, Germany) (24) and pHelper(Stratagene, La Jolla, CA). Adeno-associated virus (AAV)viral particles were harvested as previously reported (25).Mice were injected with 109 pfu HO-1 shRNA or scramble(empty vector) virus via tail vein. The knockdown effi-ciencies were confirmed by Western blotting.

Knockdown of BVR by Adenoviral shRNA TransductionThe U6 promoter and 1.9-kb stuffer sequence wereexcised from pLKO.1 (Addgene, Cambridge, MA) withNotI/XhoI and cloned into pShuttle. shRNA targetingmouse BLVRA (Sigma-Aldrich, TRCN0000042128) wasgenerated similarly to the pLKO.1 system (26). Briefly,the forward (CCGGGCCAAATGTAGGAGTCAATAACTCGAGTTATTGACTCCTACATTTGGCTTTTTG) and reverse (TCGAGAAAAAGCCAAATGTAGGAGTCAATAACTCGAGTTATTGACTCCTACATTTGGC) oligos were annealed and ligatedto pShuttle-U6 predigested with AgeI and XhoI. The pAd-U6-shBLVRA plasmid was produced as reported previously(27) and linearized by PacI and transfected to Hek-293 cellsto produce the viral particle.

Overexpression of HO-1 by Adenoviral TransductionThe db/db mice were injected with HO-1 overexpressingadenovirus (109 pfu, a gift from Dr. Jun Yu, Prince of WalesHospital, Hong Kong) through the tail vein and kept for 4days before being killed.

Knockdown of Akt in HUVECsHUVECs were purchased from Lonza (San Diego, CA) andcultured in Endothelial Cell Growth Medium (EGM,Lonza) supplemented with 10% FBS plus 1% penicillin/streptomycin. HUVECs were transfected with a dominant-negative Akt construct (DN-Akt) by electroporation usingthe Nucleofector II machine (Amaxa/Lonza, Walkersville,MD) according to the manufacturer’s instruction.

Measurement of NO and Reactive Oxygen SpeciesGeneration in HUVECsNO production in HUVECs was measured by FluoviewFV1000 laser scanning confocal system (Olympus, Tokyo,Japan) using 4-amino-5-methylamino-29,79-difluorofluoresceindiacetate (DAF-DA, Invitrogen, Carlsbad, CA) as the indicator.The amount of NO produced in response to A23187(100 nmol/L) was evaluated by measuring fluorescenceintensity at excitation 488 nm and emission 515 nm.Changes in [NO]i were displayed as a ratio of fluorescence

1566 Bilirubin and Endothelial Function in db/db Mice Diabetes Volume 64, May 2015

intensity after (F1) and before (F0) the addition of A23187(F1-to-F0). For reactive oxygen species (ROS) measure-ment, HUVECs were incubated for 30 min in 5 mmol/LCM-29,79-dichlorodihydrofluorescein diacetate (Invitro-gen) and measured using Fluoview FV1000 confocal sys-tem at excitation 488 nm and emission 520 nm. To detectthe NO-mediated antioxidant capacity of bilirubin,NO scavenger–oxidized hemoglobin (20 mmol/L) wasused together with bilirubin in HG-treated HUVECs.HUVECs were incubated with 5 mmol/L dihydroethidium

(Invitrogen) for 30 min, and fluorescence intensity wasmeasured using the Fluoview FV1000 confocal system atexcitation 515 nm and emission 585 nm (Olympus).

Western BlottingProtein lysates from mouse aortas or HUVECs wereseparated by electrophoresis and transferred onto anImmobilon-P polyvinylidene difluoride membrane (Milli-pore Corp., Bedford, MA). The blots were blocked with 1%BSA in 0.05% Tween-20 PBS for 1 h and incubated with

Figure 1—Effects of hemin, SnMP, HO-1 overexpression, and HO-1 silencing on EDRs in mouse aortas. A: The impaired EDRs of db/dbmouse aortas were rescued by hemin (HO-1 inducer, 25 mg/kg, three times weekly for 2 weeks i.p.), which was antagonized bycotreatment with SnMP (HO-1 inhibitor, 20 mg/kg, three times weekly for 2 weeks i.p.). *P < 0.05 vs. db/m+; #P < 0.05 vs. db/db;†P < 0.05 vs. db/db+hemin. B: Hemin treatment increased HO-1 expression in mouse aortas. White bars indicate db/m+ mice; blackbars indicate db/db mice. *P < 0.05 vs. db/m+; #P < 0.05 vs. db/db. C: Ex vivo hemin treatment (5 mmol/L for 24 h) improved EDRs indb/db mouse aortas, which was inhibited by SnMP (30 mmol/L). *P < 0.05 vs. control; #P < 0.05 vs. hemin. D: HO-1 overexpressingadenovirus (AdV) transduction augmented EDRs of db/db mouse aortas. GFP or HO-1 AdV was injected via tail vein 4 days before micewere killed. *P < 0.05 vs. GFP AdV. E: HO-1 shRNA virus transduction inhibited hemin-induced improvement in EDRs in db/db mouseaortas. *P < 0.05 vs. db/db; #P < 0.05 vs. db/db+hemin+scramble. F: HO-1 shRNA virus transduction suppressed hemin-inducedHO-1 expression in db/db mouse aortas. White bar indicates db/m+ mice; black bars indicate db/db mice. *P < 0.05 vs. db/db;#P < 0.05 vs. db/db+hemin+scramble. Data are means 6 SEM of four to six experiments.

diabetes.diabetesjournals.org Liu and Associates 1567

primary antibodies overnight at 4°C, including poly-clonal anti-eNOS (1:500; Abcam, Cambridge, U.K.),anti–phospho (p)-eNOS Ser1177 (1:1,000; Abcam), poly-clonal anti–HO-1 (1:1,000; Assay Designs, Ann Arbor,MI), monoclonal anti–p-Akt Thr308 (1:1,000; Cell Signal-ing, Danvers, MA), monoclonal anti-Akt1 (1:1,000; CellSignaling), and polyclonal anti-insulin receptor substrate1 (1:1,000; Cell Signaling). Blots were washed and incu-bated with horseradish peroxidase (HRP)–conjugatedsecondary antibody (DakoCytomation, Carpinteria, CA).Protein expression was normalized by monoclonal anti-GAPDH (1:10,000; Ambion, Austin, TX). Protein expres-sion was determined by a Flurochem densitometer (AlphaInnotech Corp., San Leandro, CA).

Immunohistochemical Staining of BVRHuman renal arteries were frozen in optimal cuttingtemperature compound (Sakura Finetek, Torrance, CA),cut into 10-mm sections on a microtome (Leica Micro-systems, Wetzlar, Germany), and fixed with 4% parafor-maldehyde. Sections were washed in PBS, blocked in 5%normal donkey serum (Jackson ImmunoResearch, WestGrove, PA), and incubated with anti-BVR antibody(1:200; Enzo Life Sciences, Farmingdale, NY) or PBSovernight at 4°C. Biotin-conjugated goat anti-rabbit sec-ondary antibodies (1:500; Jackson ImmunoResearch),streptavidin-HRP conjugate (1:500; Zymed Laboratories,South San Francisco, CA), and DAB substrate (Vector Lab-oratories, Burlingame, CA) were used to visualize positive

Figure 2—PI3K/Akt/eNOS mediates the beneficial effect of HO-1 in db/db mouse aortas. A and B: Chronic hemin treatment increasedp-Akt (Thr308) and p-eNOS (Ser1177). White bars indicate db/m+ mice; black bars indicate db/db mice. *P < 0.05 vs. db/m+; #P < 0.05vs. db/db; †P < 0.05 vs. db/db+hemin. C–E: HO-1 shRNA virus transduction suppressed Akt (Thr308) and eNOS (Ser1177) phosphor-ylation after hemin treatment. White bars indicate db/m+ mice; black bars indicate db/db mice. *P < 0.05 vs. db/m+; #P < 0.05 vs.db/db; †P < 0.05 vs. db/db+hemin+scramble. F: Improved EDRs in aortas from hemin-treated db/db mice were attenuated bywortmannin (100 nmol/L for 24 h) or Akt inhibitor V (5 mmol/L for 24 h). *P < 0.05 vs. control. Data are means 6 SEM of four to sixexperiments.

1568 Bilirubin and Endothelial Function in db/db Mice Diabetes Volume 64, May 2015

staining. Photomicrographs were taken under a Nikon TI-Smicroscope (Tokyo, Japan).

Statistical AnalysisResults are means 6 SEM of n experiments. EDR wasexpressed as percentage reduction in Phe-induced contrac-tion. Concentration-response curves were constructed us-ing GraphPad Prism 4.0 software (GraphPad Software, Inc.,San Diego, CA). Statistical significance was determined bytwo-tailed Student t test or one-way ANOVA, followed byBonferroni post hoc tests when more than two treatmentswere compared. P , 0.05 indicates statistical significance.

RESULTS

HO-1 Induction Restored EDRs in Diabetic MiceACh-induced EDRs were impaired in aortas of diabeticdb/db mice compared with those from db/m+ mice. Hemin

treatment for 2 weeks restored EDRs in db/db mouse aor-tas, which were reversed by cotreatment with the HO-1inhibitor SnMP (Fig. 1A). By contrast, SNP-inducedendothelium-independent relaxations were similar inall groups (Supplementary Fig. 1). Hemin treatment in-duced an approximately threefold increase of HO-1 expres-sion in aortas from db/db and db/m+ mice, which wasunaffected by SnMP (Fig. 1B). Ex vivo treatment withhemin (5 mmol/L for 24 h) or tail vein injection of HO-1overexpressing adenovirus (4 days) also improved EDRs indb/db mouse aortas (Fig. 1C and D) and elevated HO-1expression (Supplementary Fig. 2A and B). The effect ofhemin was again reversed by cotreatment with 30 mmol/LSnMP (Fig. 1C). To confirm that HO-1 mediates vascularbenefits of hemin in db/db mice, HO-1 shRNA AAV wasconstructed and injected into db/db mice via tail vein, and

Figure 3—The effect of unconjugated bilirubin on EDRs. A: Hemin administration increased the level of serum unconjugated bilirubin indb/db mice. *P < 0.05 vs. db/m+; #P < 0.05 vs. db/db; †P < 0.05 vs. db/db+hemin. White bars indicate db/m+ mice; black bars indicatedb/db mice. B: Ex vivo treatment with bilirubin (1 mmol/L for 24 h) improved EDRs in db/db mouse aortas, with or without Akt inhibitor V (5mmol/L) or SnMP (30 mmol/L). *P < 0.05 vs. control; #P < 0.05 vs. bilirubin. C and D: Mouse aortas were exposed to GFP shRNA or BVRshRNA adenovirus for 24 h and then treated with hemin (5 mmol/L) or bilirubin (1 mmol/L) for another 24 h before functional assay. *P< 0.05vs. control; #P < 0.05 vs. BVR shRNA+hemin. E and F: Successful suppression of BVR expression by BVR shRNA was shown by Westernblotting and immunohistochemistry. EC, endothelial cell; SMC, smooth muscle cell. *P < 0.05 vs. GFP shRNA. Data are means 6 SEM offour to six experiments.

diabetes.diabetesjournals.org Liu and Associates 1569

these mice were treated with hemin for 2 weeks. Comparedwith scramble virus, HO-1 shRNA AAV reversed the effect ofhemin on EDRs and HO-1 expression (Fig. 1E and F). Inaddition, we also used DIO mice to confirm the findings indb/db mice. Hemin administration for 2 weeks augmentedEDRs and HO-1 expression in DIOmouse aortas (Supplemen-tary Fig. 3A and B), suggesting HO-1 is most likely to mediatehemin-induced improvement of EDRs in diabetic mice.

Phosphatidylinositide 3-Kinase/Akt/eNOS Contributedto Vascular Benefits of HO-1 Induction in Diabetic MiceThe phosphorylation levels of Akt (Thr308) and eNOS(Ser1177) in aortas were lower in db/db mice than in db/m+ mice. In vivo hemin treatment restored the diminishedphosphorylation of Akt and eNOS, and such effects werereversed by cotreatment with SnMP (Fig. 2A and B).Chronic hemin treatment also increased phosphorylationof Akt and eNOS in DIO mouse aortas (SupplementaryFig. 3C and D). HO-1 shRNA AAV transduction inhibitedhemin-stimulated phosphorylation of Akt and eNOS (Fig.2C–E). The hemin-improved EDRs were reversed by thephosphatidylinositide 3-kinase (PI3K) inhibitor wortman-nin (100 nmol/L) or Akt inhibitor V (5 mmol/L) (Fig. 2F).However, neither inhibitor affected ACh-induced relaxa-tions of db/m+ mouse aortas (data not shown).

Bilirubin Improved EDRs in db/db Mouse AortasThe serum concentration of unconjugated bilirubin was77.5 6 7.8 nmol/L in db/db mice and 350.0 6 3.9 nmol/Lin db/m+ mice. Hemin treatment increased bilirubin to201.4 6 13.6 nmol/L, which was inhibited by SnMP (Fig.3A). Ex vivo bilirubin treatment (1 mmol/L for 24 h)

improved EDRs in db/db mouse aortas, and this effectwas inhibited by coincubation with Akt inhibitor V(5 mmol/L) but not by SnMP (30 mmol/L) (Fig. 3B). To in-vestigate whether bilirubin mediated the beneficial effect ofHO-1, BVR shRNA adenovirus was constructed and it re-versed the vascular benefit of hemin (Fig. 3C) but not thatof bilirubin (Fig. 3D). Successful inhibition of BVR expressionby shRNA adenovirus was shown by Western blotting(Fig. 3E) and immunohistochemical staining (Fig. 3F). Next,we treated db/db mice with bilirubin for 2 weeks. Chronicbilirubin administration improved EDRs in db/db mouse aor-tas (Fig. 4A), accompanied by increased phosphorylation ofAkt (Thr308) and eNOS (Ser1177) (Fig. 4B–D). These resultsfurther indicate that bilirubin is most likely to mediate theeffect of HO-1 induction to improve endothelial function.

Hemin and Unconjugated Bilirubin Restored NOProduction in HUVECsHG for 36 h reduced Ca2+ ionophore A23187 (100 nmol/L)–stimulated NO elevation detected by DAF-DA in HUVECscompared with normal glucose (NG) (Fig. 5A and B).Hemin or bilirubin restored the HG-impaired NO pro-duction (Fig. 5A, B, and C). Ex vivo treatment with he-min and bilirubin also raised the nitrite level (whichreflects tissue NO level) in db/db mouse aortas (Supple-mentary Fig. 4). Akt inhibitor V (5 mmol/L) abolished theeffect of hemin and bilirubin, whereas SnMP only inhibitedthe effect of hemin on NO production (Fig. 5B and C).Inhibition of Akt activity by Ad-DN-Akt, the plasmidexpressing DN Akt, abolished the effect of both heminand bilirubin (Fig. 5D). In addition, treatment with hemin

Figure 4—Effect of chronic bilirubin treatment on EDRs in db/db mouse aortas. A: Oral administration of bilirubin to db/db mice (5 mg/kg,three times weekly for 2 weeks i.p.) augmented EDRs in aortas. *P < 0.05 vs. db/m+; #P < 0.05 vs. db/db. B–D: Chronic bilirubin treatmentincreased p-Akt (Thr308) and p-eNOS (Ser1177) in db/dbmouse aortas. *P< 0.05 vs. db/m+; #P< 0.05 vs. db/db. Data are means6 SEM offour to six experiments.

1570 Bilirubin and Endothelial Function in db/db Mice Diabetes Volume 64, May 2015

or bilirubin increased phosphorylation of Akt and eNOS inHG-treated HUVECs. Again, the effect of hemin was abol-ished by SnMP, whereas the effect of hemin and bilirubinwas reversed by Akt inhibitor V (Fig. 5E–H).

Downregulation of BVR Diminished the Effect of Heminin HUVECsGFP shRNA adenovirus served as the control virus. He-min increased the bilirubin level in the medium culturing

HUVECs, which was diminished by BVR shRNA adenovirus(Supplementary Fig. 5A). The stimulatory effect of heminon Akt and eNOS phosphorylation in HG-treated HUVECswas reversed by BVR shRNA adenovirus (Fig. 6A–C). Like-wise, hemin-stimulated NO production in HUVECs wasinhibited by BVR shRNA adenovirus (Supplementary Fig.5B and C). By contrast, the effect of bilirubin remainedunchanged by BVR shRNA virus (Fig. 6D–F and Supple-mentary Fig. 5B and C).

Figure 5—The effects of hemin, bilirubin, or Akt activity inhibition on NO production in HUVECs. A: Representative images of DAF-DAfluorescence signal in response to A23187 (100 nmol/L) in HUVECs. The fluorescence before (F0) and after (F1) the addition of A23187 wasanalyzed. B and C: Summarized results show the levels of NO production in HUVECs treated for 36 hours with hemin (5 mmol/L) or bilirubin (1mmol/L) in the presence or absence of SnMP (30 mmol/) or Akt inhibitor V (5 mmol/L) after exposure to normal glucose (NG) or high glucose(HG). *P< 0.05 vs. NG; #P< 0.05 vs. HG; †P< 0.05 vs. HG+hemin/bilirubin. D: Effects of DN-Akt on NO production in HUVECs coincubatedwith hemin (5 mmol/L) or bilirubin (1 mmol/L). *P < 0.05 vs. NG. E and F: p-Akt and p-eNOS in HUVECs treated with hemin (5 mmol/L), with orwithout SnMP (30 mmol/L) exposed to NG or HG (30 mmol/L for 36 h). White bars indicate normal glucose; black bars indicate high glucose.*P< 0.05 vs. NG; #P< 0.05 vs. HG; †P< 0.05 vs. HG+hemin.G and H: Bilirubin (1 mmol/L) increased p-Akt and p-eNOS in HUVECs exposedto HG (30 mmol/L for 36 h). The effect was abrogated by Akt inhibitor V. White bars indicate normal glucose; black bars indicate high glucose.*P < 0.05 vs. NG; #P < 0.05 vs. HG; †P < 0.05 vs. HG+bilirubin. Data are means 6 SEM of four to six experiments.

diabetes.diabetesjournals.org Liu and Associates 1571

Bilirubin Improved EDRs in Renal Arteries FromDiabetic PatientsThe HbA1c concentrations in diabetic patients are presentedin Supplementary Table 1. Compared with renal arteriesfrom patients without cardiometabolic complications (con-trol), EDRs in renal arteries from diabetic patients wereimpaired, which were augmented after 24-h exposure tobilirubin (1 mmol/L) (Fig. 7A and B). BVR expression wasdetected in the endothelium in human renal arteries byimmunohistochemistry (Fig. 7C).

DISCUSSION

Although HO-1 is known to benefit vascular function,whether such beneficial effects are directly or indirectlyinduced by HO-1 remains poorly understood. HO-1degrades heme to form biliverdin, CO, and Fe2+; theformer is further converted into unconjugated bilirubin.Bilirubin is increasingly recognized to be vasoprotectivein cardiometabolic diseases (18,20), and the totalplasma bilirubin concentration is lower in diabeticpatients (17). The current study also shows a reducedserum level of unconjugated bilirubin in db/db mice,which is increased after 2 weeks of hemin treatment.Importantly, ex vivo treatment with unconjugated bili-rubin at 1 mmol/L (a concentration comparable to thatdetected in the serum of nondiabetic mice) and intra-peritoneal administration of bilirubin to db/db mice for

2 weeks resulted in vascular benefits similar to those ofhemin to restore EDRs. More definitely, silencing BVR usingshRNA adenovirus reverses ex vivo hemin-induced improve-ment of EDRs in db/db mouse aortas and hemin-stimulatedNO production in HUVECs. By contrast, the beneficialeffects of bilirubin were unaffected by BVR shRNA. Takentogether, bilirubin is the most likely mediator of the vaso-protective action of HO-1 induction. Likewise, bilirubinis also reported to mediate the antiatherogenic action ofHO-1 through inhibiting vascular inflammation (28).

The current study provides the first piece of evidenceshowing that ex vivo treatment with bilirubin improvesEDRs in renal arteries from diabetic patients, furthersuggesting that bilirubin is vasoprotective in humans. Itshould be noted that the renal vascular response tobilirubin in the diabetic patients might have been influ-enced by the presence of renal carcinoma and by thedifferent duration of diabetes and HbA1c levels (Supplemen-tary Table 1). Also, it will be important in the future toinvestigate whether bilirubin produces similar vascularbenefit in other arteries, such as coronary arteries, ca-rotid arteries, and femoral arteries, which are more clin-ically relevant.

PI3K/Akt signaling is important to preserve endo-thelial function in diabetic mice by increasing eNOSphosphorylation at Ser1177 (22) and endothelial progenitorcell regenerative capacity (29,30). The current study reveals

Figure 6—The effects of BVR shRNA on p-Akt and p-eNOS in HUVECs. A–C: BVR shRNA reversed the effect of hemin (5 mmol/L) on p-Aktand p-eNOS phosphorylation. White bars indicate normal glucose (NG); black bars indicate high glucose (HG). *P < 0.05 vs. NG; #P < 0.05vs. HG; †P< 0.05 vs. HG+hemin. D–F: BVR shRNA virus suppressed BVR expression and did not influence the effect of bilirubin (1 mmol/L) onp-Akt and p-eNOS. White bars indicate normal glucose; black bars indicate high glucose. #P< 0.05 vs. HG; †P< 0.05 vs. HG+bilirubin. Dataare means 6 SEM of four to six experiments.

1572 Bilirubin and Endothelial Function in db/db Mice Diabetes Volume 64, May 2015

a critical role of Akt signaling in mediating the vascularbenefits of hemin and bilirubin, because inhibition of Aktactivity abolishes the ability of hemin and bilirubin to im-prove EDRs in db/db mice and to restore the impaired NOproduction in HG-treated HUVECs.

The biological action of bilirubin has long been con-sidered due to its antioxidant property (31,32). Bilirubinscavenges peroxyl radicals and reduces lipid peroxidation invitro (33), and also downregulates NAD(P)H oxidase ac-tivity and protects against diabetic nephropathy in rodentsin vivo (34). Bilirubin also mediated the effect of HO-1 toreduce ROS and nitrogen species in lipopolysaccharide-treated HUVECs (35). Reduced ROS contribute to theimproved EDRs; therefore, the antioxidant activity of bili-rubin may partially account for its vascular benefits. Thecurrent study shows that bilirubin also increases NO pro-duction. NO can interact with superoxide anions to lowerROS levels. Our results show that bilirubin inhibitedHG-stimulated ROS generation in HUVECs, whichwas attenuated by Akt inhibitor V and NO scavengeroxidized–hemoglobin (Supplementary Fig. 6), suggestingthat increased NO is likely to mediate a significant partof the effect of bilirubin to reduce ROS in endothelialcells. Thus, the increased NO bioavailability may directlycontribute to bilirubin-induced improvement in EDRsand also indirectly by reducing ROS.

CO, one of the metabolic products of heme degrada-tion, is reported to affect vascular reactivity, causing eitherendothelium-independent relaxations (36) or contractions(37). Most studies show that CO inhibits NO-mediatedvasodilatation or NO production in endothelial cells

(38,39). Unlike hemin or bilirubin, ex vivo treatment withthe CO-releasing molecule tricarbonyl-dichloro-rutheniumdimmer does not improve EDRs in db/db mouse aortas(Supplementary Fig. 7). Taken together with results fromexperiments using BVR shRNA virus and chronic bilirubintreatment, the present results suggest a minimal involve-ment of CO in hemin-induced endothelial protection indiabetic mice.

It is worthwhile to note that HO-1 induction in vivomoderately reduced fasting glucose and insulin levels indb/db mice and also improved insulin sensitivity (Sup-plementary Fig. 8). Improved insulin sensitivity is morelikely a systematic effect, because HO-1 induction in-creased expression of insulin receptor substrate 1 andAkt phosphorylation in liver, adipose tissue, and skeletalmuscle, which play an important role in regulating in-sulin sensitivity (Supplementary Fig. 9). Previous studiesalso showed that HO-1 induction improves insulin sen-sitivity and reduces adiposity in diabetic mice and rats,which is associated with increased adiponectin release(9,40). Thus, the metabolic benefit may also contribute,albeit to a lesser degree, to the restoration of endothelialfunction in hemin-treated diabetic mice through HO-1upregulation in adipose tissues (40,41).

In summary, the current study provides novel ex-perimental evidence that bilirubin mediates HO-1induction–induced vascular benefits through activationof the PI3K/Akt/eNOS signaling cascade in diabeticmice. The present findings enhance the prospects ofusing HO-1 inducers or bilirubin to ameliorate diabeticvasculopathy.

Figure 7—The effect of bilirubin on EDRs in renal arteries from diabetic patients. A and B: Bilirubin treatment (1 mmol/L for 24 h) improvedEDRs in renal arteries from diabetic (DM) patients. C: Immunohistochemistry staining showing the expression of BVR in the endothelium inhuman renal arteries. EC, endothelial cell; SMC, smooth muscle cell. *P < 0.05 vs. control, #P < 0.05 vs. DM. Data are means 6 SEM ofthree experiments.

diabetes.diabetesjournals.org Liu and Associates 1573

Funding. This study was supported by the Hong Kong Research GrantsCouncil (CUHK2/CRF/12G, T12-402/13-N, T12-705/11), the National Basic Re-search Program of China (2012CB517805), and the Natural Science Foundationof China (91339117).Duality of Interest. No potential conflicts of interest relevant to this articlewere reported.Author Contributions. J.L. designed and conducted the experiments,analyzed the data, and prepared the manuscript. L.W., L.L., Y.Z., and S.L.W.conducted the experiments and analyzed the data. X.Y.T., W.T.W., and Y.H.designed the experiments and prepared the manuscript. Q.-B.H. and H.-M.H.performed bioassays. N.W., Z.-Y.C., J.Y., and X.Y. conducted biochemical assays,provided plasmids, and assisted with discussion. C.-F.N. provided the humanspecimen. Y.H. is the guarantor of this work and, as such, had full access to allthe data in the study and takes responsibility for the integrity of the data and theaccuracy of the data analysis.

References1. Donner T, Muñoz M. Update on insulin therapy for type 2 diabetes. J ClinEndocrinol Metab 2012;97:1405–14132. Wong WT, Wong SL, Tian XY, Huang Y. Endothelial dysfunction: the com-mon consequence in diabetes and hypertension. J Cardiovasc Pharmacol 2010;55:300–3073. Cao J, Inoue K, Li X, Drummond G, Abraham NG. Physiological significanceof heme oxygenase in hypertension. Int J Biochem Cell Biol 2009;41:1025–10334. Keyse SM, Tyrrell RM. Both near ultraviolet radiation and the oxidizing agenthydrogen peroxide induce a 32-kDa stress protein in normal human skin fibro-blasts. J Biol Chem 1987;262:14821–148255. Malaguarnera L, Imbesi R, Di Rosa M, et al. Action of prolactin, IFN-gamma,TNF-alpha and LPS on heme oxygenase-1 expression and VEGF release in hu-man monocytes/macrophages. Int Immunopharmacol 2005;5:1458–14696. Iori E, Pagnin E, Gallo A, et al. Heme oxygenase-1 is an important modulatorin limiting glucose-induced apoptosis in human umbilical vein endothelial cells.Life Sci 2008;82:383–3927. Bruce CR, Carey AL, Hawley JA, Febbraio MA. Intramuscular heat shockprotein 72 and heme oxygenase-1 mRNA are reduced in patients with type 2diabetes: evidence that insulin resistance is associated with a disturbed anti-oxidant defense mechanism. Diabetes 2003;52:2338–23458. Jais A, Einwallner E, Sharif O, et al. Heme oxygenase-1 drives meta-flammation and insulin resistance in mouse and man. Cell 2014;158:25–409. Li M, Kim DH, Tsenovoy PL, et al. Treatment of obese diabetic mice witha heme oxygenase inducer reduces visceral and subcutaneous adiposity, in-creases adiponectin levels, and improves insulin sensitivity and glucose toler-ance. Diabetes 2008;57:1526–153510. Li M, Peterson S, Husney D, et al. Interdiction of the diabetic state in NODmice by sustained induction of heme oxygenase: possible role of carbon mon-oxide and bilirubin. Antioxid Redox Signal 2007;9:855–86311. Fang XD, Yang F, Zhu L, Shen YL, Wang LL, Chen YY. Curcumin ameliorateshigh glucose-induced acute vascular endothelial dysfunction in rat thoracic aorta.Clin Exp Pharmacol Physiol 2009;36:1177–118212. Abraham NG, Rezzani R, Rodella L, et al. Overexpression of human hemeoxygenase-1 attenuates endothelial cell sloughing in experimental diabetes. Am JPhysiol Heart Circ Physiol 2004;287:H2468–H247713. Hunt SC, Kronenberg F, Eckfeldt JH, Hopkins PN, Myers RH, Heiss G. Asso-ciation of plasma bilirubin with coronary heart disease and segregation of bilirubin asa major gene trait: the NHLBI family heart study. Atherosclerosis 2001;154:747–75414. Kimm H, Yun JE, Jo J, Jee SH. Low serum bilirubin level as an independentpredictor of stroke incidence: a prospective study in Korean men and women.Stroke 2009;40:3422–342715. Perlstein TS, Pande RL, Creager MA, Weuve J, Beckman JA. Serum totalbilirubin level, prevalent stroke, and stroke outcomes: NHANES 1999-2004. Am JMed 2008;121:781–788, e1

16. Perlstein TS, Pande RL, Beckman JA, Creager MA. Serum total bilirubin

level and prevalent lower-extremity peripheral arterial disease: National Health

and Nutrition Examination Survey (NHANES) 1999 to 2004. Arterioscler Thromb

Vasc Biol 2008;28:166–17217. Dullaart RP, de Vries R, Lefrandt JD. Increased large VLDL and small LDL

particles are related to lower bilirubin in type 2 diabetes mellitus. Clin Biochem

2014;47:170–17518. Lin JP, O’Donnell CJ, Schwaiger JP, et al. Association between the

UGT1A1*28 allele, bilirubin levels, and coronary heart disease in the Framingham

Heart Study. Circulation 2006;114:1476–148119. Lee MJ, Jung CH, Kang YM, et al. Serum bilirubin as a predictor of incident

metabolic syndrome: a 4-year retrospective longitudinal study of 6205 initially

healthy Korean men. Diabetes Metab 2014;40:305–30920. Dekker D, Dorresteijn MJ, Pijnenburg M, et al. The bilirubin-increasing drug

atazanavir improves endothelial function in patients with type 2 diabetes mellitus.

Arterioscler Thromb Vasc Biol 2011;31:458–46321. Wong WT, Tian XY, Xu A, et al. Angiotensin II type 1 receptor-dependent

oxidative stress mediates endothelial dysfunction in type 2 diabetic mice. Antioxid

Redox Signal 2010;13:757–76822. Tian XY, Wong WT, Wang N, et al. PPARd activation protects endothelial

function in diabetic mice. Diabetes 2012;61:3285–329323. Onishi S, Isobe K, Itoh S, Kawade N, Sugiyama S. Demonstration of

a geometric isomer of bilirubin-IX alpha in the serum of a hyperbilirubinaemic

newborn infant and the mechanism of jaundice phototherapy. Biochem J 1980;

190:533–53624. Varadi K, Michelfelder S, Korff T, et al. Novel random peptide libraries

displayed on AAV serotype 9 for selection of endothelial cell-directed gene

transfer vectors. Gene Ther 2012;19:800–80925. Grieger JC, Choi VW, Samulski RJ. Production and characterization of adeno-

associated viral vectors. Nat Protoc 2006;1:1412–142826. Moffat J, Grueneberg DA, Yang X, et al. A lentiviral RNAi library for human

and mouse genes applied to an arrayed viral high-content screen. Cell 2006;124:

1283–129827. He TC, Zhou S, da Costa LT, Yu J, Kinzler KW, Vogelstein B. A simplified

system for generating recombinant adenoviruses. Proc Natl Acad Sci U S A 1998;

95:2509–251428. Kawamura K, Ishikawa K, Wada Y, et al. Bilirubin from heme oxygenase-1

attenuates vascular endothelial activation and dysfunction. Arterioscler Thromb

Vasc Biol 2005;25:155–16029. He T, Smith LA, Lu T, Joyner MJ, Katusic ZS. Activation of peroxisome

proliferator-activated receptor-delta enhances regenerative capacity of human

endothelial progenitor cells by stimulating biosynthesis of tetrahydrobiopterin.

Hypertension 2011;58:287–29430. Han JK, Kim HL, Jeon KH, et al. Peroxisome proliferator-activated receptor-

d activates endothelial progenitor cells to induce angio-myogenesis through

matrix metallo-proteinase-9-mediated insulin-like growth factor-1 paracrine

networks. Eur Heart J 2013;34:1755–176531. Jangi S, Otterbein L, Robson S. The molecular basis for the immunomodulatory

activities of unconjugated bilirubin. Int J Biochem Cell Biol 2013;45:2843–285132. Sticova E, Jirsa M. New insights in bilirubin metabolism and their clinical

implications. World J Gastroenterol 2013;19:6398–640733. Stocker R, Yamamoto Y, McDonagh AF, Glazer AN, Ames BN. Bilirubin is

an antioxidant of possible physiological importance. Science 1987;235:1043–104634. Fujii M, Inoguchi T, Sasaki S, et al. Bilirubin and biliverdin protect rodents

against diabetic nephropathy by downregulating NAD(P)H oxidase. Kidney Int

2010;78:905–91935. Jansen T, Hortmann M, Oelze M, et al. Conversion of biliverdin to bilirubin by

biliverdin reductase contributes to endothelial cell protection by heme oxygenase-

1-evidence for direct and indirect antioxidant actions of bilirubin. J Mol Cell Cardiol

2010;49:186–195

1574 Bilirubin and Endothelial Function in db/db Mice Diabetes Volume 64, May 2015

36. Achouh PE, Simonet S, Fabiani JN, Verbeuren TJ. Carbon monoxide inducesrelaxation of human internal thoracic and radial arterial grafts. Interact CardiovascThorac Surg 2008;7:959–96237. Ndisang JF, Zhao W, Wang R. Selective regulation of bloodpressure by heme oxygenase-1 in hypertension. Hypertension 2002;40:315–32138. Ishikawa M, Kajimura M, Adachi T, et al. Carbon monoxide fromheme oxygenase-2 Is a tonic regulator against NO-dependent vasodilatationin the adult rat cerebral microcirculation. Circ Res 2005;97:e104–e114

39. Samora JB, Goodwill AG, Frisbee JC, Boegehold MA. Growth-dependentchanges in the contribution of carbon monoxide to arteriolar function. J Vasc Res2010;47:23–3440. Nicolai A, Li M, Kim DH, et al. Heme oxygenase-1 induction remodelsadipose tissue and improves insulin sensitivity in obesity-induced diabetic rats.Hypertension 2009;53:508–51541. Burgess A, Li M, Vanella L, et al. Adipocyte heme oxygenase-1 inductionattenuates metabolic syndrome in both male and female obese mice. Hyper-tension 2010;56:1124–1130

diabetes.diabetesjournals.org Liu and Associates 1575