NEUROSCIENCE Endothelial Dab1 signaling orchestrates neuro … · RESEARCH ARTICLE NEUROSCIENCE...

RESEARCH ARTICLE SUMMARY◥

NEUROSCIENCE

Endothelial Dab1 signaling orchestratesneuro-glia-vessel communicationin the central nervous systemMarta Segarra*, Maria R. Aburto*, Florian Cop*, Cecília Llaó-Cid, Ricarda Härtl,Miriam Damm, Ioanna Bethani, Marta Parrilla, Dewi Husainie, Anne Schänzer,Hannah Schlierbach, Till Acker, Laura Mohr, Laia Torres-Masjoan,Mathias Ritter, Amparo Acker-Palmer†

INTRODUCTION: The function of the brainrelies on communication among the complexnetwork of cells that constitute this organ.Vascularization of the central nervous system(CNS) ensures adequate delivery of oxygen andnutrients to build up andmaintain homeostasisof neuronal networks. Thus, it is not surprisingthat blood vessels and neuronal cells sharemultiple parallelisms orchestrating their develop-ment in synchrony and in a mutually dependentmanner in the CNS. Despite the essential role ofthe endothelium in brain function, the means bywhich signaling at the interface of endothelialcells, glial cells, and neurons is integrated tem-porally and spatially for proper brain devel-opment has remained largely unexplored.

RATIONALE: Integration of signaling path-ways and cellular responses among endothelialcells, glial cells, and neurons is needed to en-sure proper architecture of the brain. Reelin(Reln), a large secreted glycoprotein, inducesDisabled 1 (Dab1)–dependent responses in neu-rons to guide theirmigration in all layered brainstructures. Secretion of reelin by Cajal-Retziuscells in the marginal zone of the cortex timelycoincides with active sprouting of pial vessels

ingrowing perpendicularly into the marginalzone and forming a complex vascular networkneeded to support brain development andfunction. Therefore, reelin might be in theperfect position to perform a bivalent func-tion to timely and spatially orchestrate bothneuronal migration and CNS vascularization.We reasoned that blood vessels might instructthe process of neuronal migration by a cell-autonomous function of Dab1 on endothelialcells. To investigate this, we deleted the expres-sion of vascular Dab1 in mice and investigatedthe effects on CNS vascularization, neuroglialorganization, and neurovascular unit function.

RESULTS: We found that reelin/Dab1 signal-ing is conserved in endothelial cells and exertspotent proangiogenic effects in the developingvasculature of the CNS by controlling endo-thelial cell proliferation and active filopodiaextension of the vascular network. The inter-action of the reelin receptor ApoER2 (apolipo-protein E receptor 2) and VEGFR2 (vascularendothelial growth factor receptor 2) mediatedthe proangiogenic roles of Dab1 in endothelialcells. Surprisingly, deletion of Dab1 exclusivelyin the vascular system induced changes in the

position of postmitotic pyramidal neurons inthe cortical layers of the cerebral cortex. At thecellular level, depletion of vascularDab1 reducedthe docking of the radial glia processes to thepial surface at embryonic and postnatal stagesand altered the differentiation of glial cells toastrocytes. The defects in neuronal migrationpersisted in adultmutant animals, where stereo-typical attachment of the astrocytes to penetrat-ing vessels in the glia limitans superficialiswas also found to be aberrant. The functionality

of the neurovascular unit[blood-brain barrier (BBB)integrity]was also affectedin reelinknockoutanimals,and we could attributethose defects to the lackof Dab1 signaling exclu-

sively in endothelial cells. The increased BBBpermeability was again associated with an in-sufficient coverage of the brain vasculature byastrocyticendfeet.Mechanistically,wedeterminedthat the astroglial attachment to the vasculatureis mediated by reelin-induced deposition oflaminin-a4 by endothelial cells to the extra-cellular compartment,which in turn enables thebinding of the glial processes to the CNS vascula-ture via the activation of integrin-b1 in glial cells.

CONCLUSION: Our results shed new light onthe function of the vasculature in CNS develop-ment and homeostasis—in particular, how sig-nals from the endothelium orchestrate thecommunication among vessels, glial cells, andneurons, and how specific changes in themolecular signature of the endothelium affecta plethora of processes such as CNS vascular-ization, extracellular matrix composition, neu-roglial cytoarchitecture, andBBBdevelopment.▪

RESEARCH

Segarra et al., Science 361, 767 (2018) 24 August 2018 1 of 1

The list of author affiliations is available in the full article online.*These authors contributed equally to this work.†Corresponding author. Email: [email protected] this article as M. Segarra et al., Science 361, eaao2861(2018). DOI: 10.1126/science.aao2861

Instructive functions of vascular Dab1 in the neurovascular interface. (A) ApoER2 and Dab1 control endothelial cell proliferation and tip cellfilopodia extension during CNS vascularization by cross-talking to the VEGFR2 pathway. (B and C) Vascular Dab1 also instructs radial gliaorganization and neuronal migration in the developing cerebral cortex (B) and the development of the blood-brain barrier (C). In both cases, Dab1signaling in the vasculature regulates the deposition of laminin-a4 and, in turn, the activation of integrin-b1 in glial cells.

ON OUR WEBSITE◥

Read the full articleat http://dx.doi.org/10.1126/science.aao2861..................................................

on July 19, 2020

http://science.sciencemag.org/

Dow

nloaded from


RESEARCH ARTICLE◥

NEUROSCIENCE

Endothelial Dab1 signaling orchestratesneuro-glia-vessel communicationin the central nervous systemMarta Segarra1*, Maria R. Aburto1,2*, Florian Cop1*, Cecília Llaó-Cid1, Ricarda Härtl1,Miriam Damm1,2, Ioanna Bethani1, Marta Parrilla1,3, Dewi Husainie1,3, Anne Schänzer4,Hannah Schlierbach4, Till Acker4, Laura Mohr1, Laia Torres-Masjoan1,Mathias Ritter1, Amparo Acker-Palmer1,2,3†

The architecture of the neurovascular unit (NVU) is controlled by the communication of neurons,glia, and vascular cells.We found that the neuronal guidance cue reelin possesses proangiogenicactivities that ensure the communication of endothelial cells (ECs) with the glia to controlneuronal migration and the establishment of the blood-brain barrier in the mouse brain.Apolipoprotein E receptor 2 (ApoER2) and Disabled1 (Dab1) expressed in ECs are required forvascularization of the retina and the cerebral cortex. Deletion of Dab1 in ECs leads to a reducedsecretion of laminin-a4 and decreased activation of integrin-b1 in glial cells, which in turn controlneuronal migration and barrier properties of the NVU.Thus, reelin signaling in the endotheliumis an instructive and integrative cue essential for neuro-glia-vascular communication.

Vascularization of the central nervous sys-tem (CNS) ensures adequate delivery ofoxygen and nutrients to build up andmain-tain homeostasis of neuronal networks(1). Apart from these metabolic functions,

vessels have also been suggested to serve asniches and scaffolds for neuronal migration bothduring development and during adult neuro-genesis (2). The orchestration of a perfect ar-chitecture of the neurovascular unit (NVU) isfundamental for brain function. Previous studieshave examined the relation of the vasculatureto the neuroglial components. It has been shownthat the radial glia scaffold is necessary for an-giogenesis because ablation of radial glia cellsinduces regression of cortical vessels (3), and thatthe expression of integrin-b8 by glial cells reg-ulates developmental vascularization of the brain(4). Additionally, besides the well-establishedsupport of neuroblast migration by the radialglia during corticogenesis (5), it has been reportedthat the vasculature also contributes to neuronalnavigation and positioning; for example, peri-ventricular endothelial cells (ECs), which releaseg-aminobutyric acid (GABA), guide the tangentialmigration of GABAergic neurons during embryo-genesis (6, 7). However, despite these emerging

studies, the means by which signaling at theinterface of neurons, ECs, and glial cells is in-tegrated for proper brain development remainslargely unexplored.Reelin, a well-known guidance cue for migrat-

ing neurons, regulates lamination of brain re-gions during development and synaptic plasticityin the adult brain (8). Binding of reelin to theapolipoprotein E receptor 2 (ApoER2) and to thevery low density lipoprotein receptor (VLDLR)triggers a signaling cascade required for neuronalmigration that involves the adaptor protein Dis-abled1 (Dab1) (9–13). Reelin knockout or Dab1knockout mice exhibit aberrant cortical, hippo-campal, and cerebellar architecture (14, 15). No-tably, reelin signaling also has an impact on theblood and lymphatic vasculature (16–18). Inhumans, reelin mutations cause severe devel-opmental defects (19) and are associated withseveral neurological diseases (20–22). Whileneurons are migrating and colonizing the layersin the mouse cortex guided by the expression ofreelin in the marginal zone (8), pial vessels startto sprout perpendicular to the cortical marginalzone and grow into the cortex to form the com-plex vascular network needed to support braindevelopment and function (23).

Reelin induces angiogenic responses

Our ex vivo culture technique allows quantifica-tion of acute EC responses and the guidance oftip cells during angiogenic sprouting in themouseretina (24). Stimulation of explanted retinas withexogenous reelin (Reln) resulted in an increaseof filopodia extensions per vessel length (Fig. 1,A and B). In vitro, stimulation of ECs with ex-ogenous reelin promoted EC tube formation

(fig. S1, A to C) and Dab1 phosphorylation (Fig. 1,C to E, and fig. S1, D and E). In the mouse retinavascularizationmodel (25), Reln–/– andApoER2–/–

mice both showed defective extension of thesuperficial vascular network at postnatal day 2(P2) (Fig. 1, F and G, and fig. S1, F and G) and astrong decrease in filopodia extensions at thevascular front at P7 (Fig. 1, H and I, and fig. S1,H and I). Reelin’s proangiogenic effects are me-diated by its receptor ApoER2, because retinasexplanted from ApoER2–/–mice failed to increasefilopodia extensions after reelin stimulation (Fig. 1,J and K).Early postnatal retinal vascularization and

endothelial tip cell formation are regulated byastrocytes within the ganglion cell layer, whichproduce the vascular chemotactic factor VEGF(vascular endothelial growth factor) (26, 27).Moreover, in cortical neurons in culture, VEGFand reelin pathways cross-talk to regulate thephosphorylation of the NR2 subunit of theN-methyl-D-aspartate (NMDA) receptor (28).Wefound that ApoER2 coimmunoprecipitated andcoclustered with VEGF receptor 2 (VEGFR2) inECs, and that such interaction was induced byVEGF-A and by reelin (Fig. 2, A to C, and fig. S2, Aand B). VEGF-A activated VEGFR2 and inducedDab1 phosphorylation in ECs (Fig. 2, D to F).VEGF-C, another ligand for VEGFR2 (29), alsoinducedDab1 phosphorylation (fig. S2C), support-ing the idea that VEGFR2 activation occurs up-stream of Dab1 signaling. Reciprocally, reelinalso activated VEGFR2 (fig. S2D). Costimulationwith VEGF and reelin synergistically increasedDab1 phosphorylation (fig. S2, E and F) and filopo-dia extension in the ex vivo retina assay (Fig. 2G).Moreover, ApoER2–/– vessels were unable to re-spond to VEGF-mediated tip cell sprouting (Fig. 2,H and I), indicating the presence of functionalcross-talk between the two receptors.

Dab1 regulates vascular morphogenesiscell-autonomously

The retinal ganglion cell layer, underneath theastrocytes and the vessel bed, appeared as themajor source of reelin (fig. S3, A and B). BothApoER2 and Dab1 are expressed in retinal vessels(fig. S3, C and D). To uncouple the function ofDab1 in the vasculature from its function in neu-ronal cells, we generated inducible endothelial-specific Dab1 loss-of-function mice (Dab1iDEC) bycrossing Dab1flox/flox mice to the tamoxifen-induciblevascular-specific Cre deleter line Cdh5(PAC)creERT2. Tamoxifen injection for three con-secutive days efficiently induced the vascular-specific genetic recombination and loss of Dab1expression in ECs (fig. S4, A to C). Dab1 deletionfrom P1 to P3 impaired vascular radial growthin Dab1iDEC retinas at P3 to P4 (Fig. 3, A and B).This reduction in vessel growth was persistentat P7 (fig. S4, D and E) and recovered at adultstages (fig. S4, F and G). Moreover, EC prolifera-tion and vascular network complexity were alsodecreased in the Dab1iDEC postnatal retinas (Fig. 3,C and D, and fig. S4, H and I). A reduced numberof filopodia per vessel length and a reduced tip/stalk cell ratio were also observed in Dab1iDEC

RESEARCH

Segarra et al., Science 361, eaao2861 (2018) 24 August 2018 1 of 15

1Institute of Cell Biology and Neuroscience and BuchmannInstitute for Molecular Life Sciences, University of Frankfurt,D-60438 Frankfurt am Main, Germany. 2Focus ProgramTranslational Neurosciences, University of Mainz, D-55131Mainz, Germany. 3Max Planck Institute for Brain Research,D-60438 Frankfurt am Main, Germany. 4Institute ofNeuropathology, University of Giessen, D-35392 Giessen,Germany.*These authors contributed equally to this work.†Corresponding author. Email: [email protected]

on July 19, 2020


Dow

nloaded from


mice (Fig. 3, E to H). Expression of VEGF orreelin was not changed in Dab1iDEC or ApoER2mutants (fig. S4J).In the cerebral cortex, reelin is secreted by

Cajal-Retzius cells during developmental stages(30) and regulates the migration of neurons dur-ing their correct positioning in the different cor-tical layers (8, 31). Cortical vessels expressed bothApoER2 andDab1, and brain ECs also respondedto reelin by phosphorylating Dab1 (fig. S5, A toC). The embryonic brain is vascularized by thepial and periventricular vessels (32), with sproutsfrom the pial vessels penetrating into the neuraltube from the perineural vascular plexus around

embryonic day 10.5 (E10.5) by sprouting angio-genesis and forming columnar vascular structuresperpendicular to the meninges (23, 33). In theabsence of reelin, vascularization of the embry-onic neocortexwas aberrant (Fig. 3, I and J). FromE11.5 on, we found fewer sprouts penetratingfrom the pial vessels into the neocortex and con-necting to the periventricular vessels (Fig. 3I,arrows). In control animals, penetrating vesselsfrom the pia at E14.5 started branching directlybelow the marginal zone, but this pattern waslost in the Reln–/– mutants (Fig. 3I, dashed line).Vessels were also less branched at E13.5 andE14.5, which later resulted in a reduction of

vessel density as quantified at E17.5 (Fig. 3J).The same aberrant phenotypewas observedwhendeleting Dab1 exclusively from the vessels at E10.5to E12.5 and analyzing the cortical vasculatureat E17.5 (Fig. 3, K and L); this finding supportedthe cell-autonomous function of Dab1 observedin the retina. Dab1 deletion at early postnatalstages from P1 to P3 and analysis at P7 to P8 alsounraveled a defective vessel architecture (Fig. 3M)reflected by a reduction in vessel density (Fig. 3N),vessel length (Fig. 3O), and number of branchpoints (Fig. 3P) as well as a preferential orienta-tion at an 80° to 90° angle with respect to thepial surface (Fig. 3Q). Thesemorphological defects


Fig. 1. Reelin pathway isproangiogenic in endothelialcells. (A) Isolectin B4 (IB4)whole-mount staining ofwild-type retinal explants after4 hours of reelin (Reln)stimulation. (B) Quantificationof the number of filopodia(green dots) at the vascularfront (areas outlined in red)depicted in (A) (n = 9 to15 images, 3 explants percondition). (C) Immuno-fluorescence of phospho-Dab1(pDab1) in human umbilicalvein endothelial cells(HUVECs) after 30 min ofReln stimulation. (D) Quanti-fication of (C) (n = 56 to66 images, 6 experiments).(E) Western blot analysis ofDab1 phosphorylation inHUVECs after Reln stimula-tion. Actin was used as aloading control. (F) IB4whole-mount staining ofwild-type (WT) andApoER2–/– mutant vascularnetworks at P2. (G) Quantifi-cation of the vessel radiallength in (F) (n = 20 or21 retinas, 10 or 11 animalsper genotype). (H) ApoER2–/–

retinas at P7. (I) Quantifica-tion of filopodia extensionsin (H) (n = 5 retinas, 3 to5 animals per genotype).(J) Reln stimulation of retinalexplant cultures for 4 hoursincreases filopodia sproutingat the vascular front in WTexplants but not in ApoER2–/–

explants. (K) Quantification ofthe number of filopodiarelated to (J) (n = 10 to18 images, 3 explants percondition). Data werenormalized to correspondingcontrols. Scale bars,30 mm [(A), (H), and (J)], 10 mm (C), 200 mm (F). Data are means ± SEM. *P < 0.05, ***P < 0.001; ns, not significant.

RESEARCH | RESEARCH ARTICLEon July 19, 2020


Dow

nloaded from


did not impair vessel perfusion (fig. S5, D and E).As in the retina, the morphological vascular de-fects in the cortex were compensated at adultstages (fig. S5, F to J).

Dab1 in the endothelium is requiredfor proper migration of neuronsduring cortical layering

The absence of reelin expression by Cajal-Retziuscells in themarginal zone (MZ) aswell as the lackof Dab1 signaling in neurons leads to manydefects in cortical lamination (8, 15, 34, 35), suchas projection neurons invading theMZ or layer I.We hypothesized that the cell-autonomous func-tion of reelin signaling in the vasculature couldalso contribute to the propermigration of neuronsduring cortical lamination. Examination of thegeneral cortical cytoarchitecture of the early em-bryonic deleted (E10.5 to E12.5) Dab1iDEC mutantsanalyzed at E17.5 revealed a poorly defined sep-aration of cortical layers as well as a remark-able invasion of cells in themarginal zone (Fig. 4A)recapitulating some of the defects observed inReln–/– mice (35). Markers for deeper and upperlayers—Tbr1+ and Cux1+, respectively—showed

aberrant positioning of early- and late-born neu-rons at E17.5 (Fig. 4, B to E). Positioning andnumbers of Pax6+ apical progenitors and Tbr2+

intermediate (basal) neuronal progenitors werenot affected by embryonic Dab1 vascular deletion(fig. S6, A to D), indicating that the defects inneuronal positioning in the Dab1iDECmutants arenot a consequence of a deficient neurogenic pool.We then focused on analyzing the neuronal mi-gration defects in more detail. At perinatal days,later-born neurons, which are destined to uppercortical layers, are still navigating along theradial glia processes before translocating intolayers II/III (36). Neuronal distribution analysisin the Dab1iDEC mice at P7–P8 revealed invasionof postmitotic neurons in layer I after perinatalDab1 deletion (Fig. 4, F and G). Immunostainingfor Cux1 confirmed that later-born neurons en-tered into layer I (Fig. 4, H and I). Additionally,we found an increased number of Cux1+ cellsbelow layer IV (Fig. 4, H and J). Birth-datingneuronswith bromodeoxyuridine (BrdU) injectedat E15.5 and analyzed at P8 after perinatal dele-tion of Dab1 confirmed the presence of later-born neurons in the lower cortical layers as well

as a delayed migration of E15-born neurons intothe upper layers (fig. S6, E to G). General defectsin brain size were not observed in the Dab1iDEC

mice (fig. S7, A to F).

Endothelial Dab1 is required forvessel-glia communication

Apical radial glial cells (RGCs) extend a singlebasal process (radial fiber) that reaches the me-ningeal basement membrane (BM) and anchorsvia bulb endfeet structures making frequent con-tact with the pial vessels (5, 37). Such endfeet-BMinteractions are thought to contribute to the finalplacement of migrating neurons in the cortex(38–40). Analysis of E17.5 Dab1iDEC mice (tamox-ifen administration E10.5 to E12.5) and E17.5Reln–/– mice revealed a reduction of dockingendfeet of RGCs to the BM (Fig. 5, A and B, andfig. S8, A and B). The same results were ob-served after perinatal removal of vascular Dab1(Fig. 5, C and D). Deletion of VEGFR2 in thevessels reduced vascularization but did not re-capitulate the same defects in glia anchoring(fig. S8, C to F), which suggests that the effectsofDab1 in glia-EC communication are independent


Fig. 2. Reelin pathwaycross-talks with VEGFsignaling in endothelialcells. (A) Immuno-precipitation (IP) ofVEGFR2 from HUVEClysates and Western blotfor VEGFR2 and ApoER2.TL, total lysates.(B) ApoER2/VEGFR2clusters (white punctae)upon 10 min of stimula-tion with VEGF-A inHUVECs. PLA, proximityligation assay. (C) Quan-tification of ApoER2/VEGFR2 clusters in (B)(n = 108 to 110 cells,3 experiments). (D) Westernblot of phosphorylationof Dab1 (pDab1) andVEGFR2 (pVEGFR2) afterVEGF-A stimulation ofHUVECs. (E) Immuno-fluorescence staining witha phospho-specific Dab1antibody in HUVECsshowing increased pDab1after VEGF-A stimulation.(F) Quantification of pDab1in (E) (n = 26 to30 images, 3 experiments).(G) WT retinal explantsexposed to a combinationof Reln and VEGF-A for4 hours show increasednumber of filopodia whencompared to single stimulation conditions and to the control (n = 13 to 21 images, 4 or 5 explants per condition). (H) VEGF-A stimulation of WT andApoER2–/– retinal explants. (I) Quantification of (H) (n = 9 or 10 images, 3 explants per condition). Stimulation is normalized to each control condition.Scale bars, 30 mm [(B) and (H)], 10 mm (E). Data are means ± SEM. *P < 0.05, **P < 0.01, ***P < 0.001.



Dow

nloaded from



Fig. 3. EndothelialDab1 is essential forretina and cortexvascularization.(A) IB4 staining ofDab1iDEC retinas atP3–P4 after tamoxifen(TMX) administrationfrom P1 to P3.(B) Quantification ofvessel radial lengthshown in (A) (n = 6to 12 retinas, 3 to7 animals per genotype).(C) Vascular prolifera-tion (phospho–histoneH3, pHH3) in Dab1iDEC

animals at P3–P4after TMX administra-tion from P1 to P3.(D) Quantification ofthe number of pHH3+

ECs in (C) (n = 9 to15 retinas, 5 to9 animals per geno-type). (E) Filopodiaextensions at thevascular front ofDab1iDEC retinas at P7.(F) Quantification of(E) (n = 5 retinas,3 animals per genotype).(G) ETS-related gene(ERG) and IB4 stainingin Dab1iDEC retinas atP7 after TMX adminis-tration from P1 to P3.(H) Quantification ofthe relative number oftip cells versus stalkcells at the vascularfront shown in (G)(n = 6 to 10 retinas,5 or 6 animals pergenotype). (I) Devel-opment of the vascu-lature of control andReln–/– embryosstained with IB4.Arrows point todefects in ingrowingsprouts from the pialvessel and branchingdefects in the neo-cortex below themarginal zone.Dashed line delineatesthe marginal zone. (J) Quantification of vessel density in E17.5 cortices in(I) (n = 3 animals per genotype). (K andM) Dab1iDEC cortices stained with IB4at E17.5 (K) or P7–P8 (M) after TMX administration at the indicated timepoints. The vascularization of the upper cortex is reduced in the mutantanimals, with decreased area covered by vessels and fewer vascularintersections. (L) Quantification of vessel density in (K) (n = 5 or 6 animals

per genotype). (N to Q) Quantification of vessel density (N) (n = 8 or9 animals per genotype), vessel length (O) (n = 5 animals per genotype),branch points (P) (n = 5 animals per genotype), and vessel orientation inrelation to the pial surface (Q) (n = 5 or 6 animals per genotype) shown in(M). Scale bars, 200 mm (A), 100 mm [(C), (I), (K), (M)], 20 mm (E),75 mm (G). Data are means ± SEM. *P < 0.05, **P < 0.01, ***P < 0.001.



Dow

nloaded from


of VEGF/VEGFR2 signaling and distinct fromthe effects of reelin/Dab1 signaling on vesselgrowth (Figs. 1 to 3).Later in postnatal stages, RGCs differentiate

into mature astrocytes after retracting their con-tacts from the pial and ventricular surfaces (41).We also observed a distortion of the columnarmorphology of RGCs in vascular Dab1 mutantsat P4 (Fig. 5E, left panels). This was accompaniedby a premature morphological change of thebipolar radial glial cells toward stellate-shapedcells characteristic of mature astrocytes (GFAP+)(Fig. 5E, right panels). Moreover, analysis ofDab1iDEC mice at 4 to 7 weeks of age after peri-natal deletion revealed that the invasion of neu-rons in layer I persisted in adult stages (Fig. 5, Fand G). The astrocytic organization at the glialimitans superficialis, with astrocytes closely seal-ing the meningeal surface, is characterized byGFAP+ fibrillary processes radially distributed

along the interhemispheric vasculature and thepenetrating vessels. This organization was dis-turbed in the Dab1iDEC mice denoted by GFAP+

astrocytic processes detaching from the pial sur-face and its penetrating vessels (Fig. 5H).

Vascular Dab1 is necessary to form afunctional blood-brain barrier

In the CNS, blood vessels are central componentsof the NVU that regulate homeostatic functionsof the brain: the blood-brain barrier (BBB) and theneurovascular coupling (42, 43). Extravasation ofthe BBB-impermeable fluorescent tracer AlexaFluor 555 cadaverine was observed in postnataland adult mice after perinatal deletion of vas-cular Dab1 (Fig. 6, A to F) and in the Reln–/–

mutants (Fig. 6, G to I), indicating compromisedBBB integrity. Electron microscopy analysis re-vealed anatomically defective tight junctionsas well as a functionally augmented rate of trans-

cytosis (Fig. 6, J to L). Reln–/– vessels exposedunsealed tight junctions with an altered align-ment in relation to the vessel lumen (Fig. 6, Jand K). Moreover, a significantly increased num-ber of cytoplasmic vesicles filled with the tracerhorseradish peroxidase was observed in the Reln–/–

endothelium (Fig. 6, J and L). The blood-retinalbarrier was also impaired at P7 in Dab1iDEC mice(Fig. 6, M to O), and defects were compensatedafter 4weeks of age (fig. S9, A to C).We performeda late acute removal of Dab1 by using the Cdh5(PAC)creERT2 deleter mice and injecting tamox-ifen for three consecutive days starting at P25and evaluating the BBB permeability at P30. Inthis setting, removal of Dab1 in mature vesselsdid not seem to significantly affect the BBBmaintenance (fig. S9, D to H). We also founda down-regulation of Dab1 expression at P30relative to postnatal stages (fig. S9I). Overall,this suggests that Dab1 function is important


Fig. 4. Vascularreelin signalingmediates neuronalpositioning inthe neocortex.(A to C) DAPI (A),Tbr1 (B), and Cux1(C) staining ofDab1iDEC cortices atE17.5 after TMXadministration fromE10.5 to E12.5.(D) Quantification ofthe number of Tbr1+

cells in upper layersin (B) (n = 10 to13 images, 2 or3 animals per geno-type). (E) Quantifi-cation of Cux1+ cellsin the marginal zonein (C) (n = 30 to37 images,5 animals per geno-type). (F) NeuNstaining of Dab1iDEC

cortices at P7–P8after TMX adminis-tration from P1 toP3. (G) Quantifica-tion of NeuN+ cellsin layer I in (F)(n = 29 to34 images, 5 or6 animals per geno-type). (H) Cux1staining of Dab1iDEC

cortices at P7–P8after TMX adminis-tration from P1 toP3. (I and J) Quan-tification of Cux1+

neurons in layer I (n = 19 images, 4 animals per genotype) (I) and below layer IV (n = 40 to 57 images, 7 to 10 animals per genotype) (J). Scale bars,100 mm [(A) and (F)], 50 mm [(B), (C), and (H)]. MZ, marginal zone; CP, cortical plate; VI, layer VI; SP, subplate; L, layer. Data are means ± SEM.*P < 0.05, **P < 0.01, ***P < 0.001.



Dow

nloaded from


for BBB etiology but not for physiological barriermaintenance.

Vascular Dab1 is necessary forlaminin-a4 secretion and astrocyticintegrin-b1 activation

Analysis of the NVU cellular components inDab1iDEC and Reln–/– mice revealed a prominentreduction of the coverage of cerebral vessels bythe endfeet water channel aquaporin4 (Aqp4)(Fig. 7, A and B, and fig. S10, A and B). Total

levels of Aqp4 were not changed, which sug-gested an uncoupling of astrocytic endfeet tothe NVU (Fig. 7C and fig. S10C). We confirmedthat pericyte ensheathment, also important forBBB integrity (44, 45), was not significantlyaffected in our mutants (fig. S11, A to D).The extracellular matrix (ECM) network be-

tween perivascular astrocytic endfeet and ECsregulates barrier properties of the cerebral vas-culature (46). Laminins are major componentsof the gliovascular lamina (47). Albumin extra-

vasation from vessels in the Reln–/– mice coin-cided with an impaired deposition of laminin-a4(Lama-4, produced by endothelium) and a de-crease in laminin-a2 [Lama-2, expressed at theendfeet (48)] (Fig. 7D). Moreover, deposition ofLama-4 coincided with sites of accumulation ofAqp4 staining in control animals (Fig. 7E, upperpanels, arrows), which suggests that Aqp4-enrichedendfeet dock on sites of endothelial Lama-4 ac-cumulation. In agreement with this, Reln–/– mu-tants showed decreased Lama-4 deposition in


Fig. 5. Vascular reelinsignaling mediatesradial glial attach-ment to the pialsurface. (A) Nestinstaining of Dab1iDEC

cortices at E17.5 afterTMX administrationfrom E10.5 to E12.5.White dots indicateradial glial cell (RGC)contacts to the pia.(B) Quantification ofRGC contact points in(A) determined bycounting the RGCendfoot docking sitesalong the pial surface,as detailed in thehigh-magnificationinset in (A) (n =4 animals per genotype).(C) Nestin staining ofDab1iDEC cortices atP7–P8 after TMXadministration from P1to P3. (D) Quantifica-tion of RGC contactpoints in (C) (n = 3 or4 animals per geno-type). (E) Representa-tive confocal images ofNestin, DAPI, GFAP(astrocytes), and IB4staining in P4 cortices.RGCs show an aber-rant morphology and apremature astrocyticdifferentiation inDab1iDEC cortices rela-tive to control litter-mates. (F) NeuNstaining of Dab1iDEC

cortices 4 to 7 weeksafter TMX administra-tion from P1 to P3.(G) Quantification ofNeuN+ cells in layer Iin (F) (n = 12 or13 images, 3 animalsper genotype). (H)Podocalyxin (Pdx),GFAP, and NeuN stain-ing of the interhemispheric fissure in 4- to 7-week-old Dab1iDEC mice after TMX administration from P1 to P3. Scale bars, 50 mm [(A), (C), (E), zoom (F),and (H)], 100 mm (F), 25 mm [zoom (H)]. Data are means ± SEM. **P < 0.01, ***P < 0.001.



Dow

nloaded from


correlation with the absence of Aqp4 staining(Fig. 7E, lower panels, arrowheads). Correlativeaccumulation of Aqp4 and Lama-4 can be ap-preciated in higher-magnification pictures andin the corresponding line intensity profile of thestaining (Fig. 7F).Lama-4 in the ECM binds to its cognate re-

ceptors integrin-a3b1 and integrin-a6b1, which

are expressed by astrocytes and whose activa-tion is required for endfeet anchorage (49, 50).Disrupted deposition of Lama-4 fromECs in vivoin Reln–/– and vascular Dab1 mutants also hadan effect on the functional activation of integrin-b1.Analysis of the ratio of staining at the vesselwall versus the intracellular compartment of theendothelium revealed that Lama-4 accumulated

at the vessel wall, and that such accumulationcorrelated with sites of integrin-b1 activationin control but not in Reln–/– or Dab1iDEC mice(Fig. 8, A and B). Integrin-b1 is expressed bymultiple cell types of the CNS, including vesselsand astrocytes (51). Integrin-b1 activation also ac-cumulated at the astrocytic endfeet, as evidencedby colocalization with the endfeet marker Aqp4


Fig. 6. Endothelial Dab1regulates NVU integrity.(A) Fluorescent whole-brain images of Dab1iDEC

and control littermatesinjected with Alexa Fluor555 cadaverine (Cad-A555)at P7. (B) Quantification offluorescence intensity in(A) (n = 6 animals pergenotype). (C) Cad-A555and podocalyxin (Pdx)staining of P7 Dab1iDEC

cortices. (D) Fluorescentwhole-brain images of adultDab1iDEC and controllittermates injected withCad-A555. (E) Quantifica-tion of fluorescenceintensity in (D) (n = 5 to7 animals per genotype).(F) Cad-A555 and Pdxstaining of 4- to 7-week-oldDab1iDEC cortices. (G) Fluo-rescent whole-brain imagesof 3- to 4-week-old Reln–/–

and control littermatesinjected with Cad-A555.(H) Quantification offluorescence intensity in(G) (n = 3 animals pergenotype). (I) Cad-A555and Pdx staining of Reln–/–

cortices. (J) Transmissionelectron microscopyimages of control andReln–/– cortical vessels.(K) Quantification of thedistribution of the tightjunction (TJ) angle in (J)(n = 3 animals per geno-type). (L) Quantification ofthe number of horseradishperoxidase (HRP)–filledvesicles relative to thelumen length in (J) (n =3 animals per genotype).(M) Fluorescent whole-retina images of P7Dab1iDEC and control litter-mates after intravenousinjection of Cad-A555.(N) Quantification offluorescence intensitycorresponding to (M)n = 6 to 8 retinas, 5 animals per genotype). (O) Representative confocal images showing an elevated cadaverine extravasation in Dab1iDEC retinas fromthe blood vessels (IB4). Scale bars, 5 mm [(A), (D), and (G)], 50 mm [(C), (F), and (I)], 100 nm (J), 2 mm (M), 75 mm (O). Data are means ± SEM. *P <0.05, **P < 0.01, ***P < 0.001.



Dow

nloaded from


in control animals, and its coexpression was dim-mer in the mouse mutants (Fig. 8C). Vascularsignaling downstream of endothelial integrin-b1 has been shown to be important for the properlocalization of VE-cadherin, and inactivation ofendothelial integrin-b1 signaling leads to aberrantVE-cadherin distribution and extensive hemor-rhaging in retinas (52). Reln–/– and Dab1iDEC didnot show any alteration in VE-cadherin arrange-ments in the vessels (fig. S11E), which suggeststhat the lack of Lama-4 deposition in the reelinsignaling mutants preferentially affected theendfeet’s integrin-b1 activation.Direct stimulation of brain ECs with exogenous

reelin led to a specific increase in Lama-4 secre-

tion (Fig. 8, D and E) without changes in totalmRNA transcript and protein levels (fig. S12, AandB). Conversely, Lama-5,which is also expressedby brain ECs, was not affected by reelin stimula-tion (fig. S12, C to F). Also, total protein levels forendothelial laminins were not affected in vivo(fig. S12, G to J). Reelin-induced secretion ofLama-4 had a direct impact on the attachmentof primary astrocytes tomonolayers of brain ECs.Stimulation of brain ECs with reelin led to asignificant increase in the attachment of seededastrocytes; however, pretreating primary astro-cytes with a blocking antibody against integrin-b1 (53) impaired the adhesion of the astrocytesonto the ECmonolayer in a dose-dependentman-

ner (Fig. 8F and fig. S13). Furthermore, an in vitroBBB model using a coculture of ECs apposed toastrocytes showed that reelin stimulation of theendothelial compartment significantly increasedthe tightness of the barrier and such effect wasblocked when astrocytic integrin-b1 was inhibited(Fig. 8G), mimicking the leakiness we observed inthe reelin signaling mutants in vivo. These resultsindicate that Lama-4 is required for integrin-b1–dependent astrocytic adhesion and barriergenesis.The same defects in Lama-4 secretion were

recapitulated at the missing contacts of theradial glia endfeet with the pial vessels duringembryonic development (Fig. 8, H to J) that re-sulted in impaired neuronal migration (Figs. 4


Fig. 7. Astrocyticendfeet attachment isreduced in reelinsignaling mutants.(A) Aquaporin4 (Aqp4),Pdx, and Cad-A555staining of 4- to 7-week-old Dab1iDEC cortices.Defects in Aqp4 cover-age are detected inlarger vessels (arrow)as well as smallercapillaries (arrowhead).(B) Aqp4 vessel cover-age quantification aspercentage of vesselarea covered by Aqp4staining in (A). Vesselsof wide-ranging diame-ter were included in thequantifications (n = 3 to6 animals per geno-type). (C) Western blotfor Aqp4 in brain lysatesfrom Dab1iDEC mutants.Pan-cadherin (pan-Cadh)was used as a loadingcontrol. (D) Laminin-a4(Lama-4), laminin-a2(Lama-2), and albuminstaining of 3- to 4-week-old Reln–/– cortices.(E) Lama-4 and Aqp4staining of Reln–/–

cortices. Arrows indicatesites of colocalizationof Lama-4 with Aqp4,which are decreased inthe mutant (arrowheads).Boxes indicate magnifi-cation areas in (F).(F) Magnified picturesfrom (E) and line intensityprofiles of staining inten-sity for Lama-4 (blacklines) and Aqp4 (purplelines). Note the co-incident distribution ofstaining in the controlvessels, which is lost in Reln–/– vessels. Scale bars, 50 mm [(A), (D), (E), (F)]. Data are means ± SEM. ***P < 0.001.

D

Rel

n -/-

Con

trol

Albumin / Lama-4 / Lama-2

3-4 wks

Lama-4 / Aqp4E

1

2

1

2

120100 80

604020

010 20 30

Inte

nsity

(%)

1

Distance (au)

Con

trol

Rel

n -/-

2

10 20 303

4

F Lama-4 / Aqp4

3 4

Distance (au)

Control Reln -/-

Aqp4Pdx Pdx / Aqp4 Cad-A555

Aqp

4 co

vera

ge (%

)

0

A B

40

80

120

***

Dab1

i∆EC

Ctrl

Con

trol

TMX, P1-P3 4-7 wks

Dab

1i∆E

C

Control

Aqp4

pan-Cadh130

35

Dab1i∆EC

C

Con

trol

1

Rel

n -/-

3-4 wks

3

4

120100 80

604020

0

120100 80

604020

0

120100 80604020

0

Inte

nsity

(%)

Inte

nsity

(%)

10 20 30Distance (au)

10 20 30Distance (au)

Inte

nsity

(%)



Dow

nloaded from



Fig. 8. Dab1instructive roles onastrocytic endfeetattachment aremediated by vascularlaminin-a4 secretionand astrocyticintegrin-b1 activa-tion. (A) Lama-4 andactivated integrin-b1(b1-Int) staining ofReln–/– and Dab1iDEC

cortices. Arrowsindicate areas ofLama-4 and b1-Intenhanced colocaliza-tion. (B) Quantifica-tion of Lama-4 andb1-Int relative signalat the vessel wall in(A) [n = 3 (Reln–/–),n = 3 or 4 (Dab1iDEC)animals per geno-type]. (C) Represent-ative pictures ofb1-Int and Apq4costaining, showingthe activation ofb1-Int in the astro-cytic endfeet.(D) Lama-4 stainingin reelin-stimulatedbrain ECs (bEND.3).(E) Representativequantification ofLama-4 fluorescentsignal in (D) (n = 7 or8 images per condi-tion, 3 experiments).(F) Representativeexperiment ofattachment ofprimary astrocytes toreelin-stimulatedbEND.3 cells. Theadhesion of astro-cytes to the ECmonolayer isimpaired afterblocking astrocyticb1-Int (n = 5 mea-surements per condi-tion, 3 experiments).(G) Permeabilityassay based on anin vitro BBB model ofcocultured ECs andastrocytes (n =3 experiments).bEND.3 cells in theluminal compartmentwere stimulated with reelin 24 hours before astrocytic seeding in the abluminal compartment of the insert. (H) Lama-4 and brain lipid binding protein(BLBP) staining of the pial region of Dab1iDEC embryos at E17.5 after TMX administration from E10.5 to E12.5. (I) Quantification of Lama-4 relative signalat the vessel wall in (H) (n = 3 animals per genotype). (J) Quantification of BLBP+ cells contacting pial vessels in (H) (n = 3 animals per genotype).Scale bars, 50 mm (A), 25 mm [(C) and (D)], 10 mm (H). Data are means ± SEM. *P < 0.05, **P < 0.01, ***P < 0.001.



Dow

nloaded from


and 5). These findings suggest that the samemechanism applies to the instructive role ofvascular Dab1 in neuronal migration.

Discussion

Our study provides precise mechanistic insightsinto an important function of the vasculaturethat goes beyond the supply of oxygen and nu-trients and extends into an instructive structuralrole in building up functional architecture in thebrain. Dab1 expressed in ECs is necessary toinstruct the communication of vessels with theglia for the proper positioning of neurons dur-ing cortical development as well as for thecorrect communication at theNVU.We describedhow different neurovascular processes are syn-chronically regulated by the convergence onvascular Dab1 signaling. On one hand, reelin/ApoER2/Dab1 signaling regulates angiogenesisin the CNS by cross-talking to the VEGF/VEGFR2pathway; on the other hand, vascular Dab1 reg-ulates the deposition of Lama-4 and the dockingof the radial glia/astrocytes on the vasculature,consequently affecting the neuronalmigration atdevelopmental stages and the etiology of BBBintegrity.Reelin in the vasculature exerts proangiogenic

functions during development via the interac-tion with VEGF/VEGFR2 pathway. This functionof Dab1 in ECs regulates proliferation and tip/stalk cell fate. The vascular growth defects ob-served during embryonic and postnatal stagesare recovered during adulthood both in the retinaland in the cortical vessels. This suggests that othercompensatory mechanisms are in place to correctfor such defects in the vasculature. Dab2, a relativeprotein to Dab1, has been shown to be involvedin developmental angiogenesis by controllingVEGFR2 endocytosis (54) and therefore couldbe a good candidate to compensate for the lackof Dab1 in the vessels. In agreement with this,we observed a down-regulation of Dab1 in theadult vessels, whereas Dab2 continues to be ex-pressed during adulthood (55).However, the neuronal defects provoked by

the loss of function of Dab1 in the embryonicand early postnatal vasculature persist to adult-hood and have a severe impact on neuronalpositioning and BBB function. Dab1 in neuronsis essential to guide correct neuronal positioningin the cortex during development (36, 56). Dab1cell-autonomous function in neurons seems tobe involved specifically in the somal translocationprocess during radial neuronal migration but notin glia-mediated locomotion (36). We have shownthat Dab1 in the vessels is essential for both themaintenance of the RGC scaffold supportingmigration of later-born neurons and their propernavigation toward the correct cortical layer dur-ing somal translocation. Dab1 deficiency in thevessels leads to detachment of the glial processesobserved during both embryonic and early post-natal developmental stages, when the endfeet ofthe RGCs are anchored to the pial basementmembrane and later when the mature corticalastrocytes extend their endfeet to surround thevessels and form a functional BBB. In agreement

with our results, several studies have shown thatRGC detachment of the pial surface inducesdeficiencies in neuronal positioning (39, 40, 57).Notably, neuroglial integrin-b1 conditionalmutantmice showed important layering defects, includingneuronal invasion to themarginal zone, originatedby the deficient anchorage of radial glia processesto the meningeal surface (39), which we haveshown to be recapitulated by the Dab1 endothelial-specific mutant mice. Furthermore, it has alsobeen shown that proper neuronal migration inthe cortex requires the selective expression ofintegrin-b1 by RGCs but not by neurons (58),hence the activation of integrin-b1 in glial cellsis crucial for proper corticogenesis.The basement membrane components Lama-2

and Lama-4 are involved in the attachment of theradial glia processes to themeningeal surface (59).In line with these studies, we found that vascularreelin signaling regulates the secretion of Lama-4by ECs, which in turn has an impact on radial gliaattachment to the pial surface and regulates neu-ronal migration. Although the regulatory mech-anisms of Lama-4 deposition are still largelyunknown, it has been reported that Lama-4 isaccumulated in focal adhesions (60), whichmight also be influenced by reelin signaling (61).Defects in Lama-4 deposition and integrin-

b1 activation also altered the assembly of theastrocytic endfeet ensheathment on the vascu-lature and consequently resulted in increasedBBBpermeability. Astrocytes exert a crucial func-tion in maintaining the BBB in different physio-logical and pathological conditions (62) throughtheir endfeet anchorage to the basal lamina pro-teins, which are relevant elements regulatingBBB function in health and disease (46). Interest-ingly, Lama-4 null mice suffer from multiplehemorrhages starting at embryonic stages (63).Although the severe defects derived from thecomplete abrogation of Lama-4 expression arenot comparable to the local defects in Lama-4deposition observed in ourmutants, it is remark-able that both animal models show a loss of BBBintegrity.Changes in Lama-4 secretion could regulate

both endothelial and glial integrin-b1 activation.However, our vascular Dab1 loss-of-functionmu-tants phenocopy the defects shown by severalreports after neuroglial deletion of integrin-b1 (39, 58, 59). Conversely, vascular loss ofintegrin-b1 has rather divergent phenotypesrelative to those seen with vascular Dab1 dele-tion, such as hyperproliferation, sprouting, oraltered VE-cadherin patterning (52, 64). In addi-tion, we have shown that astrocytic adhesion toendothelial cells and astrocytic-induced barrierproperties are dependent on reelin signaling onECs and that astroglial integrin-b1 activation isindispensable for such processes. Hence, on thebasis of previous literature and our observations,we deduce that astroglial integrin-b1 activationplays a relevant role in endothelial-astroglialinteraction.Together, our findings constitute a fundamental

example of the integration of the neurovascularsignaling that converges in the organization of the

neuronal-(astro)glial-vascular elements that reg-ulate the development and homeostasis of theCNS. Such integrative signaling might explain,at the molecular level, the comorbidity of neuro-pathological conditions and vascular dysfunction.

Materials and methodsGenetically modified miceand treatments

Dab1flox/flox mice carrying loxP sites flankingexon 2 for the Dab1 gene (36) (kindly providedby U. Mueller) were crossed with Cdh5(PAC)-CreERT2 (65) (kindly provided by R. Adams) togenerate endothelial cell–specific Dab1 knockoutmice (Dab1iDEC). VEGFR2flox/flox mice (66) (kindlyprovided by E. Wagner) were crossed with Cdh5(PAC)-CreERT2 (65) to generate endothelial cell–specific VEGFR2 knockout mice (VEGFR2iDEC).Cre activity was induced by intraperitoneal injec-tion of 0.1 ml of tamoxifen (1 mg/ml) or 4-hydroxytamoxifen (4-OHT) (1 mg/ml) each dayfor 3 days (P1 to P3) for postnatal analysis at P3–P4, P7–P8, and postnatal weeks 4 to 7. For adultinduction, 0.1 ml of 4-OHT (5 mg/ml) was intra-peritoneally injected for 3 consecutive days (P25to P27) for analysis at P30. For embryonic in-duction, pregnant females were injected intra-peritoneally with 0.2 ml of 4-OHT (10 mg/ml)each day for 3 days (E10.5 to E12.5). Tamoxifeninjectable solution was prepared in ethanol andpeanut oil as described (67). Cre-negative an-imals were used as controls. Additionally, theCdh5(PAC)-CreERT2 line was crossed with theROSA26R(EYFP) reporter strain and genetic re-combination was induced as described for theDab1iDEC mice. Reelin knockout (Reln–/–) andROSA26R(EYFP)micewere obtained fromJacksonLaboratories; ApoER2 knockout (ApoER2–/–) micewere kindly provided by J. Herz (68). For Reln–/–

mice, bothwild-type and heterozygous littermateswere used as controls, except as mentioned. Wild-type C57BL/6J animals were used for fluorescentin situ hybridization (FISH) analysis, isolation ofprimary cell cultures, and retinal explant cultures.Both males and females were used for all ex-periments indistinctively.All animals were genotyped by PCR. Protocols

and primer sequences were used as described bythe distributor or donating investigator.For intravenous Alexa Fluor 555 cadaverine

tracer injection and detection, mice were deep-ly anesthetized by injection of ketamine andxylazine at 180mg/kg and 10mg/kg of bodyweight,respectively; 50 ml of Alexa Fluor 555 cadaverine(1 mg/ml) was injected into the retro-orbitalvenous sinus in 4- to 7-week-old (Dab1iDEC) or3- to 4-week-old (Reln–/–) mice as described (69).For postnatal mice (P7), 40 ml of Alexa Fluor 555cadaverine (1 mg/ml)was injected intraperitoneally.Cadaverine was allowed to circulate for 20 min inadult mice and for 2 hours in postnatal mice,respectively.Micewere then perfused intracardiallywith 4% paraformaldehyde (PFA) in phosphate-buffered saline (PBS). Eyes from P7 animals werefixed in 4% PFA for 2 hours at room temperature(RT) before retina isolation in PBS. Eyes from 4-to 7-week-old adult mice were fixed in 4% PFA




Dow

nloaded from


for 10min prior to retina isolation in 4%PFA andpost-fixed overnight (4% PFA, 4°C). Brains werepost-fixed at RT in 4% PFA for 3 hours. Forcadaverine detection, whole brains and isolatedretinas (mounted in PBS) were imaged using adissecting microscope with an attached fluores-cent lamp and aTexasRed filter and subsequentlyprocessed for immunostaining. Cadaverine leak-age was quantified by measuring mean fluores-cence intensity of whole-brain pictures.For BrdU experiments, pregnant females were

injected intraperitoneally with 0.2 ml of BrdUsolution (10 mg/ml) dissolved in sterile PBS atE15.5. Brains from the offspring were collectedand analyzed at P8.For intravenous peroxidase injection, horse-

radish peroxidase Type II (HRP) was dissolvedat 100 mg/ml in sterile PBS, injected at 10 mgper 20 g body weight in deeply anaesthetizedmice, and let to circulate for 30 min. Mice wereperfused with 0.3 M HEPES, 1.5% PFA, and1.5% glutaraldehyde (GDA) and processed forhistochemistry.For intracardiac isolectin B4 (IB4), mice were

processed the same way as for regular perfusion.Prior to the PBS/4% PFA perfusion, 1 ml of IB4(20 ng/ml) was intracardially injected.All animal experiments were approved by

the Regierungspräsidium of Darmstadt andthe Veterinäramt of Frankfurt am Main.

Cell culture and treatment

For isolation of primarymouse brain endothelialcells, mouse brain microvascular fragments wereprocessed as described (70). Briefly, capillaryfragments were seeded on collagen I–coatedwellsand cultured in DMEM (Dulbecco’s modifiedEagle’s medium) with 20% fetal bovine serum(FBS) supplemented with heparin (100 mg/ml)and EC growth supplement (ECGS; 5 mg/ml).After 2 days of puromycin selection (4 mg/ml), cellswere cultured for two more days without puro-mycin before their experimental use.Mouse primary lung endothelial cells (MLECs)

were isolated as described (27). Lungs were iso-lated into dissection buffer (HBSS supplementedwith 10% FBS) and treated with collagenasetype II. Filtered tissue pellets were resuspendedin dissection buffer and incubated with anti-ratIgG–coated magnetic beads, pre-coupled with ratanti-mouse CD31. Beads were resuspended inendothelial cellmediumconsisting of high-glucoseDMEM GlutaMAX-I, penicillin (100 U/ml), strep-tomycin (100 mg/ml), 20% FBS, 0.4% endothelialcell growth supplement with heparin and platedonto gelatin-coated plates.For isolation of mouse primary astrocytes,

brains of P2–P5 mice were isolated into dissec-tion buffer (DMEM) and subsequently incubatedin 0.25% trypsin/EDTA for 20 to 30 min at 37°C.Digested tissue was homogenized with a fire-polished Pasteur pipette and centrifuged. Pelletedcells were resuspended in astrocytemedium con-sisting of high-glucose DMEM GlutaMAX-I,penicillin (100 U/ml), streptomycin (100 mg/ml),10% FBS, 1% MITO+ Serum Extender and platedonto flasks. After the cultures were confluent, the

astrocytes were purified by shaking the flasks ona rotator at 250 rpm at 37°C for 2 days to detachall other cell types.Pooled human umbilical vein endothelial cells

(HUVECs) were cultured in endothelial basalmedium(EGM) supplementedwithhydrocortisone(1 mg/ml), bovine brain extract (3mg/ml), gentamicinsulfate (30 mg/ml), amphotericin B (50 mg/ml),EGF (10 mg/ml), and 10% FBS on gelatin-coatedculture dishes at 37°C, 5% CO2.For the detection of phospho-Dab1 (pDab1) by

immunostainingupon reelin stimulation,HUVECswere starved in DMEM containing 2% FBS over-night. Stimulationwas performedby adding 150 mlof reelin supernatant or green fluorescent protein(GFP) supernatant for 45min. For the detection ofpDab1 by immunostaining upon VEGF-A stimula-tion, HUVECswere starved in serum-freemedium(EGM) for 4 hours prior to stimulation with re-combinant VEGF-A (50 ng/ml) for 30 min. Forcostimulation with VEGF-A and reelin, HUVECswere stimulatedwith 40-fold concentrated reelinsupernatant and recombinant VEGF-A (50 ng/ml)for 30 min. Mouse primary brain endothelial cell(MBEC) cultures were starved with Opti-MEMserum reduced medium at 37°C, 2 hours prior tostimulation. For stimulation,MBECswere treatedwith 40-fold concentrated reelin supernatant orGFP supernatant. For the detection of pDab1,cultureswere stimulated for 15min at 37°C. Dab1phosphorylationwas assessed bymeasuring pDab1fluorescence intensity (HUVECs andMLECs) or bymeasuring the area covered by pDab1 fluorescence(MBECs).ForWestern blot analysis, cells were starved in

EGM for 1 hour prior to stimulation. Stimulationwas performed by adding recombinant VEGF-A(50 ng/ml), recombinant VEGF-C (100 ng/ml),recombinant reelin fragment (100 ng/ml unlessmentioned otherwise) for 15 min or reelin super-natant for 30 min.The immortalized mouse brain microvascular

endothelial cell line bEND.3was grown inDMEMsupplemented with 10% FBS and antibiotics.For the detection of Lama-4 and Lama-5 by im-munostaining upon reelin stimulation, bEND.3cells were starved inminimumessentialmedium(MEM) containing penicillin/streptomycin (100 mg/ml) for 2 hours. Stimulation was performed byadding recombinant reelin fragment (100 ng/ml)overnight. Cells were fixedwith 4%TCA for 10minat RT and processed for immunostaining. Forquantifications, % of area covered by positivepixels of Lama-4 staining was measured usingImageJ and normalized to the number of cells(number of DAPI+ nuclei) per field. Fisher’scompared t-values test was used to estimatethe significance among the biological replicates.

Preparation of reelin-containing andcontrol supernatants

To obtain reelin-enriched supernatants and GFPcontrol supernatants, incubationmedium [DMEM,penicillin (100 U/ml), streptomycin (100 mg/ml),G418 (0.360 g/liter), 10% FBS] from reelin-transfected 293-HEK cells or GFP-transfectedcontrol 293-HEK cells (a gift fromM. Goetz) was

replaced by serum-free medium containingpenicillin/streptomycin (100 mg/ml) and cellswere incubated for 2 days at 37°C, 5% CO2. Theconditioned medium was collected and concen-trated 40-fold by centrifugation using filter units.Reelin content, as well as its absence in controlcell supernatants, was confirmed by Westernblotting using mouse anti-reelin antibody 1:1000(Millipore; MAB5364).

Tube formation assay

Tube formation assays were performed usingm-slides angiogenesis. Experimental settings wereset up as suggested by the manufacturer withminor modifications. Briefly, 2 × 104 HUVECswere cultured on growth factor–reducedMatrigelat 37°C in a humidified incubator supplied with5% CO2 for 6 to 8 hours in the presence of con-centrated reelin supernatant or control GFPsupernatant. The tubular network was quanti-fied by counting the number of branch pointsand by measuring total tube length.

Mouse retinal organotypic explants

Retinal explant experiments were performed asdescribed (24). In short, eyes were enucleatedfrom newborn pups (P3–P5) and transferred toFBS-free DMEMmedium. Retinas were dissectedfrom eyecups and vitreous bodies were removed.Retinas were flat-mounted onto the hydrophilicpolytetrafluoroethylene (PTFE) membrane of cul-ture plate inserts with the nerve fiber layer facingthemembrane. DMEMwith 10% FBSwas layeredunderneath the membrane and dropped on theretinas to prevent dryness. Retina explants wereincubated at 35°C in a humidified incubator with5% CO2 for 2 to 4 hours before stimulation. Forstimulation of retina endothelial tip cells, VEGF-Awas diluted inDMEMorOpti-MEMI and 3%FBSto a final concentration of 1 mg/ml and layeredunderneath the insertmembrane anddropped onthe explants. 40-fold concentrated reelin and con-trol GFP supernatants were used for reelin stimu-lation experiments. For the combined VEGF-A/reelin stimulationexperiments,VEGF-A (100ng/ml)was diluted in the concentrated reelin or GFPsupernatants. Stimulation was carried out at 35°Cin a humidified incubator with 5%CO2 for 4 hours.Explants were fixed with 4% PFA at RT for 30minand stained with IB4 (1:200). For quantifications,numbers of filopodia at the vascular front werecounted and normalized against 100 mm vessellength.

Proximity ligation assay

Endothelial cells were fixed with 4% PFA in PBSfor 10 min at RT and permeabilized using 0.1%Triton X‐100 in PBS for 4 min on ice. Sub-sequently, the cells were washed with PBS, andblocking solution (2% BSA, 4% NDS in PBS)was applied for 30 min at 37°C in a humidifiedchamber. Proximity ligation assay was performedas suggested by the manufacturer. All incubationperiods were performed at 37°C. In brief, primaryantibodies against ApoER2 1:80 (Abcam; ab86548)and VEGFR2 1:80 (R&D Systems; AF644) inblocking solution were added for 30 min. The




Dow

nloaded from


cells were incubatedwith the corresponding PLAprobes for 60 min. Phalloidin-FITC 1:500 wasadded to visualize actin filaments. Ligation andamplification of the probes was performed for30 min and 100 min, respectively. Cells wereincubated with DAPI, washed, and mounted.Incubation times with antibodies occurred at4°C and overnight for the primary antibodiesand 1 hour at 37°C for the PLA probe antibodies.For quantification, the number of PLA probepunctae per cell was counted.

Immunohistochemistry,immunocytochemistry, and FISH

All samples frommutant and littermate controlsin an experiment were always processed andstained at the same conditions.Brains were dissected and post-fixed for 3 hours

in 4% PFA or 10% TCA at RT for immunostainingsor overnight in 4% PFA at 4°C for FISH. Forimmunostainings, brainswere sectioned coronallyat 80 mm using a vibratome. For FISH, retinasand brains were cryoprotected by consecutiveimmersions in 15%and 30% sucrose in PBS at 4°C.Sampleswere then embedded inTissue-TekO.C.T.compound and frozen on dry ice. Coronal sectionswith a thickness of 16 mmwere generated using acryostat microtome. For retinal whole-mountstaining, eyes were collected frommutant miceand their control littermates and fixed in 4%PFAsolution overnight at 4°C or for 2 hours at RT.Embryonic, postnatal, adult brain, and retina

sections were incubated with primary antibodiesafter 30 min or 1 hour of blocking and perme-abilization with 5 to 10% normal donkey serum(NDS), 0.5% Triton X-100 in PBS, respectively.For BrdU immunodetection, 80 mm vibratomesections were pretreatedwith 2NHCl for 30minand subsequently neutralized with sodium tetra-borate (Na2B4O7, 0.1 M).For immunostaining of whole retinas, retinas

were isolated, blocked, and permeabilized in 5%NDS and 0.5% Triton X-100 in PBS at RT for1 hour. Primary antibodies were diluted in 5%NDS in PBS. Incubations were performed over-night at 4°C. For retinal vessel visualization,retinas were incubated with IB4 (1:200) in 1%Triton X-100 in PBS.Primary brain endothelial and bEND.3 cells

were fixed in cold 10% TCA for 10 min and in-cubated with primary antibodies in 2% NDS inPBS for 2 hours at RT after 15 min of blockingand permeabilizing with 5%NDS and 0.1% TritonX-100 in PBS.HUVEC and MLEC cultures were fixed with

4% PFA for 20 min, incubated with NH4Cl for10 min at RT, blocked and permeabilized with4% NDS, 0.2% Triton X-100 and 2% bovineserum albumin (BSA) in PBS for 30 min. Cellswere incubated with the primary antibody inblocking solution for 1 hour at RT.The following primary antibodies were used:

rabbit anti-Cux1 1:100 (Santa Cruz; SC-13024),rabbit anti-aquaporin4 1:100 (Millipore; AB2218),mouse anti-BrdU 1:200 (Millipore;MAB3424), rab-bit anti-ERG 1:200 (Abcam; ab92513), rabbit anti-phospho-Histone H3 1:200 (Millipore; 06-570),

rat anti-mouse CD29 (activated integrin-b1) 1:100(BD Pharmingen; 550531), rabbit anti–brainlipid binding protein (BLBP) 1:100 (Millipore;ABN14), rabbit anti-Glut1 1:200 (07-1401; Milli-pore), rat anti-laminin a-2 1:100 (abcam; ab11576),goat anti-laminin a-4 1:100 (R&D; AF3837), rab-bit anti-laminin a-5 1:100 (Novus Biologicals;NBP1-18714), mouse anti-NeuN 1:200 (Milli-pore; MAB377B), rabbit anti-NeuN 1:200 (Mil-lipore; ABN78), rabbit anti-Pax6 1:200 (Covance;PRB-278P), rabbit anti-Tbr1 1:200 (Abcam;ab31940), rabbit anti-Tbr2 1:200 (Abcam; ab183991),goat anti-PDGFRb 1:200 (Neuromics; GT15065-100),rabbit anti-phospho-Dab1 (Y232) 1:200 (Cell Sig-naling Technology; 3325S), rat anti-VE-cadherin1:100 (BD Pharmingen; 555289) and goat anti-reelin 1:100 (R&DSystems;AF3820). After primaryantibody incubation, samples were washed withPBS (cells and retinas) or TBS-T (150 mM NaCl,25 mM Tris base, 0.1% Tween 20; pH 7.6; brainsections) for three times and incubated with theappropriate fluorophore-coupled secondary anti-bodies for 1 hour atRT (cells andpostnatal retinas)or overnight (brain sections and adult retinas).The secondary antibodies were Alexa Fluor 488-,555-, 568- and 647-conjugated donkey anti-rabbit/mouse/goat 1:200 (Life Technologies) or anti-rabbit-Cy3 secondary antibody 1:200 (JacksonImmunoresearch). Nuclei were counterstainedwith DAPI. Sections were washed with PBS orTBS-T before mounting them using fluorescencemounting medium. Proliferating endothelial cellswere quantified as described (71). The tip cell/stalk cell ratio was assessed as suggested byothers (72, 73). Retinal tip cell filopodia quan-tification was performed as described (27). Thenumber of branch points in the retina vasculaturewas assessed by counting the number of branchpoints between artery and vein and normalizingagainst the selected area. Vascular density in adultretinas was assessed by thresholding and mea-suring the area covered by IB4 signal in all threelayers of the adult retina. Brain vascular pa-rameters (vessel density, total vessel length, vesselorientation, and number of branch points) wereanalyzed in the cortical area using AngioTool (74)and ImageJ software (75). Aqp4 coverage wasquantified by measuring the area of the vesselcovered with staining. The area of Aqp4 stain-ingwas normalized to the vessel area (podocalyxinstaining). Lama-4 and integrin-b1 signals werequantified bymeasuring the immunofluorescenceintensity at the vascular walls normalized to theintracellular compartment. Metamorph softwarewas used for these morphometric analyses.For FISH, whole C57BL/6 adult mice brains

were dissected, and RNA was extracted usingTRIzol reagent. RNA was reverse-transcribedinto cDNA using High Capacity cDNA ReverseTranscription Kit and the resulting cDNA usedto obtain the PCRproducts. The primer sequencesused for each probe are: Dab1-probe1-Fw AAC-CTGTTATCCTGGACTTGA, ISH:Dab1-probe1-RvTGAACAAGGGGCTGCTGGCC, ISH:Dab1-probe2-Fw, GTCCATAAATCATGGGACTGGT, ISH: Dab1-probe2-Rv, TGGAGAGACTCAGATAGCCACA, ISH:ApoER2-Fw,TCTACTGGACAGACTCAGGCAAand

ISH:ApoER2-Rv,CGGTAGCATCTCTTCATGTCTG.Probes for Dab1-probe2 and ApoER2 were ob-tained fromAllen Brain Atlas: http://developing-mouse.brain-map.org/experiment/show/79762299;http://developingmouse.brain-map.org/experiment/show/100045438. PCR conditions, PCR productpurification, cloning, transformation, and plas-mid amplification were done as described (76).Plasmids with the right sequencewere linearizedusing restriction enzymes andpurifiedwithWizardSV Gel and PCR Clean-Up System. Finally, linearplasmidswere transcribed intoRNAprobes labeledwith digoxigenin (DIG). FISH was performed asdescribed (76) with minor modifications: (i) slicesof P7-8 brains and retinas were incubated inproteinase K solution (12 mg/ml) at 37°C for 12min,(ii) Dab1 detection was performed by mixing twodifferent riboprobes mixed together, (iii) anti-DIG-alkaline phosphatase was incubated togetherwith goat anti-podocalyxin 1:200 (R&D Systems;AF1556), (iv) signal of DIG was detected usingHNPP/Fast Red andpodocalyxinwithAlexa Fluor647-conjugated donkey anti-goat, 1:250 (LifeTechnologies).Images were taken using a laser scanning

confocal spectral microscope. Brightness andcontrast of the images were adjusted usingthe software Adobe Photoshop CS6 or ImageJ.Figures were prepared using Adobe IllustratorCS5.1.

Transmission electron microscopy (TEM)

For assessing the rate of transcytosis, HRP-diaminobenzidine histochemistry was performedon brain vibratome sections from animals injectedwith HRP (see above). Sections were incubatedwith 3,3′-diaminobenzidine tetrahydrochloride(DAB) for 30 min at RT and washed with PBS.Subsequently, samples were processed for TEMimaging.Tissue was post-fixed with 6% glutaraldehyde/

0.4 M PBS for 24 hours at RT and subsequentlywashed 5 times in 0.1 M Epon-PBS. Small tissuesamples were cut out from the parasagittal areaand processed with a tissue processor with 1%osmium tetroxide. Dehydration steps were fol-lowed by using increasing ethanol concentrations(25%, 35%, 50%, 70%, 75%, 85%, 100%). Prior toembedding, tissue combined with resin (Agar100 Resin Kit) was dehydrated in an exsiccatorfor 24 hours. After embedding, the samples werekept in a steaming cabinet at 60°C for minimumof 4 days.From the resin-embedded tissue, ultrathin

sections (0.23 mm) were cut with a microtomeand placed at 200 mesh copper grids (3.05 mm).Ultrathin sections were then contrastedwith EMAC20 (0.5% uranyl acetate/Ultrostain I and 3%lead citrate/Ultrostain II). Sampleswere examinedwith a transmission electronmicroscope equippedwith a Slowscan-2K-CCD-digital camera (2K-wide-angle). Morphometric analyses were performedwith ImageSp software. For quantifications, num-bers of HRP-filled vesicles were normalized perlength of vascular lumen, and the angle of tightjunction in relation to the lumen surface wasmeasured with ImageJ software.




Dow

nloaded from

http://developingmouse.brain-map.org/experiment/show/79762299





Quantitative real-time PCRWhole C57BL/6 adult mice brains were dis-sected, and RNA was extracted using TRIzolreagent. RNAwas reverse-transcribed into cDNAusing High Capacity cDNA Reverse Transcrip-tion Kit. Quantitative PCR assays were performedusing an ABI 7500 Fast Real-Time PCR Systemusing TaqMan Fast Universal PCR mastermix and TaqMan Gene Expression probes formouse Dab1 (Mm01256039_m1), mouse Reelin(Mm00465200_m1),mouseVegf (Mm00437306_m1),mouse Laminin-a4 (Mm01193660_m1), mouseLaminin-a5 (Mm01222029_m1), and mouse b2m(Mm00437762_m1), which served as an endoge-nous control.

PCR for Dab1 gene excision

Genomic DNA was extracted from the tail of theanimals and PCR was performed using 5 ml ofthe DNA extract. The primers used to amplify theexcised Dab1 fragment were: 5′GGTTCAGTGCC-TATCATGTATC3′(Fwd) 5′CCTATACTTTCTAGA-GAATAGGAAC3′ (Rv). PCR was performed withPromega GoTaq Green Master Mix using Tm =54°C and 38 cycles. PCR product was loaded in a3% agarose gel and DNA was stained with 0.01%ethidium bromide. After electrophoresis, gel wasimaged in a transilluminator using a UV lightsource.

Attachment assay

bEND.3 cells were seeded in quintuplicates on a96-well plate. bEND.3 cells were grown over-night at 37°C and were then starved with MEMcontaining penicillin/streptomycin (100 mg/ml)for 2 hours at 37°C. After starvation, bEND.3cells were stimulated with recombinant reelin at100 ng/ml overnight at 37°C in starvingmedium.Primary astrocytes were incubated with 6 mMTexas Red Hydrazide in order to label themfluorescently and with rat anti-mouse integrin-b1 blocking antibody (BD Biosciences; 553715) atthe indicated concentrations (53) for 30 min at37°C. After the stimulation of the bEND.3 cells,astrocytes were pelleted, resuspended in mediumand seeded (40,000/well) onto the bEND.3 cellmonolayer for 3 hours at 37°C. After the attach-ment incubation, non-attached astrocytes werewashed gently 3 timeswith PBS. Finally, 100 ml of1% SDS solution was added per well and fluo-rescent intensitywas read (lex 590nm; lem620nm).

Permeability assay

We used an in vitro model of BBB based in acoculture of endothelial cells and astrocytesseeded in the opposite sides of a prehydrated24-well membrane insert. 40,000 bEND.3 cellswere seeded onto the luminal side of the insertand cultured in bEND.3 medium for 24 hours ina 37°C, 5% CO2 cell culture incubator untilmonolayer was formed. Prior to reelin stimula-tion, bEND.3 cells were washed with PBS andstarved in MEM for 2 hours in an incubator.bEND.3 cells were then stimulated with recom-binant reelin (100 ng/ml) for 24 hours. Shortlyprior to adding astrocytes, reelin was removedand bEND.3 cells were kept in bEND.3 medium.

Primary cortical astrocytes were pre-incubatedwith blocking integrin-b1 antibody for 30 min.Pellet of blocked astrocytes was resuspended inbEND.3 medium. 40,000 astrocyte cells wereseeded on the abluminal side of the insert to letthem attach for 3 hours in the incubator. Priorto permeability assay, both luminal and abluminalsides of the membrane insert were washed withPBS to remove unattached astrocytes and theexcess medium. Insert was transferred to a new24-well plate filled with 500 ml of PBS. In vitroBBB permeability was assessed by adding 200 mlof sodium fluorescein (100 mg/ml) to the luminalside of the insert. After permeation time of 15min,the insert was transferred to a new well andanother permeationwas repeated (in total 4 times).The liquid in the well plate (now containingsodium fluorescein that crossed the cell layers)was thoroughly mixed and 100 ml of this wastransferred to 96-well plate. The plate was readin a fluorescence plate reader (lex 460 nm; lem515 nm).

Western blot

Tissue and cells were lysed in lysis buffer (50mMTris-HCl, pH 7.5; 150mMNaCl; 1% Triton X-100;1 mM sodium orthovanadate; 10 mM NaPPi;20 mM NaF) or RIPA buffer (150 mM sodiumchloride; 1% Triton X-100; 0.5% sodium de-oxycholate; 0.1% SDS; 50 mM Tris, pH 8.0) and1% complete protease inhibitor cocktail (CompleteEDTA-free Proteinase inhibitor cocktail tablets).Protein contentwas determined using Pierce BCAProtein Assay Reagent according to manufac-turer’s instructions and samples were separatedby SDS-PAGE.For immunoprecipitation of VEGFR2, endo-

thelial cells were lysed with NET lysis buffer(50 mM Tris HCl buffer, pH 7.4, 15 mM EDTApH 7.4, 1% NP-40, 150 mM NaCl, 10 mM sodiumpyrophosphate, 20 mM NaF, 1 mM sodium or-thovanadate, and 1% complete protease inhibitorcocktail) for 30min at 4°C, centrifuged at 21,000gfor 15 min and supernatants were collected. Sam-ples were pre-incubated with protein G–Sepharosebeads for 1 hour at 4°C. Beads were removed bycentrifugation at 400g. Supernatants were in-cubated with protein G–Sepharose beads, rabbitanti-VEGFR2 antibody (Cell Signaling; 2479) andTBS/0.1% NP40 for 2 hours at 4°C. Samples werewashed with NENT 300 washing buffer (20 mMTris pH 7.4, 300 mM NaCl, 1 mM EDTA pH 7.4,0.1% NP40, 25% glycerol) and TBS/0.1% NP40.For immunoprecipitation of Dab1, a similar pro-tocol was appliedwithminor changes. Lysis bufferwas used for lysis of MLEC, incubation of lysateswith the antibody (goat anti-Dab1 antibody,Abcam, Ab16674) coupled sepharose beads andwashing of the beads prior to Western blotanalysis.Protein samples from total lysates or IP were

boiled with sample buffer (8% SDS, 200 mMTris-HCl pH6.8, 400mMDTT, 0.4%Bromophenolblue, 40% Glycerol) prior to separation by SDS-PAGEand transferred tonitrocellulosemembranes.Membranes were blocked in TBS-T with skimmedmilk powder (3% or 5%) or BSA (5%), depending

on the antibody manufacturer’s recommenda-tion. The following antibodies were used: rabbitanti-phospho-Dab1 Y232 1:500 (Cell SignalingTechnology; 3325), goat anti-Dab1 1:1000 (Abcam;Ab16674), rabbit anti-VEGFR2 1:1000 (Cell Sig-naling Technology; 2479), rabbit anti-phospho-VEGFR2Y1175 1:1000 (Cell Signaling Technology;2478), rabbit anti-ApoER2 1:1000 (Sigma-Aldrich;A3481), goat anti-laminin-a4 1:1000 (R&D; AF3837),rabbit anti-laminin-a5 1:1000 (Novus Biologicals;NBP1-18714), rabbit anti-aquaporin4 1:1000 (Milli-pore; AB2218). Goat anti-actin, 1:1000 (Santa Cruz;sc-1615) and mouse anti-pan-cadherin 1:1000(Sigma; C1821) were used as a loading controls.Primary antibodies were incubated overnightat 4°C, and membranes were subsequently in-cubated with HRP-conjugated secondary anti-bodies goat anti-rabbit HRP, donkey anti-goatHRP and goat anti-mouse HRP 1:1000 (JacksonImmuno Research Laboratories) in blockingsolution 2 hours at RT. HRP activity was de-tected using enhanced chemiluminescence de-tection reagent (ECL) and the ImageQuant LAS4000 system.

Statistical analysis

Quantifications were normalized to control andrepresented as percentage of control (%), unlessotherwise indicated. Statistical significance wasdetermined using 2-tailed unpaired Student’st-test when comparing 2 variables, unless other-wise indicated. Statistical analysis was performedwith Prism version 5. One-way analysis of var-iance (ANOVA) was performed in Prism Version5 to assess statistical significance of the differencesbetween multiple measurements. All animal ex-periments included animals from at least twolitters. Statistical significance was defined as P <0.05 (*), P < 0.01 (**) and P < 0.001 (***). Allvalues indicate mean ± SEM.

REFERENCES AND NOTES

1. D. Attwell et al., Glial and neuronal control of brain bloodflow. Nature 468, 232–243 (2010). doi: 10.1038/nature09613;pmid: 21068832

2. M. Segarra, B. C. Kirchmaier, A. Acker-Palmer, A vascularperspective on neuronal migration. Mech. Dev. 138, 17–25(2015). doi: 10.1016/j.mod.2015.07.004; pmid: 26192337

3. S. Ma, H. J. Kwon, H. Johng, K. Zang, Z. Huang, Radial glialneural progenitors regulate nascent brain vascularnetwork stabilization via inhibition of Wnt signaling.PLOS Biol. 11, e1001469 (2013). doi: 10.1371/journal.pbio.1001469; pmid: 23349620

4. J. M. Proctor, K. Zang, D. Wang, R. Wang, L. F. Reichardt,Vascular development of the brain requires b8 integrinexpression in the neuroepithelium. J. Neurosci. 25,9940–9948 (2005). doi: 10.1523/JNEUROSCI.3467-05.2005;pmid: 16251442

5. P. Rakic, Mode of cell migration to the superficial layers of fetalmonkey neocortex. J. Comp. Neurol. 145, 61–83 (1972).doi: 10.1002/cne.901450105; pmid: 4624784

6. C. Won et al., Autonomous vascular networks synchronizeGABA neuron migration in the embryonic forebrain.Nat. Commun. 4, 2149 (2013). doi: 10.1038/ncomms3149;pmid: 23857367

7. S. Li et al., Endothelial cell-derived GABA signaling modulatesneuronal migration and postnatal behavior. Cell Res. 28,221–248 (2018). doi: 10.1038/cr.2017.135; pmid: 29086765

8. F. Tissir, A. M. Goffinet, Reelin and brain development.Nat. Rev. Neurosci. 4, 496–505 (2003). doi: 10.1038/nrn1113;pmid: 12778121

9. B. W. Howell, R. Hawkes, P. Soriano, J. A. Cooper, Neuronalposition in the developing brain is regulated by mouse




Dow

nloaded from

http://dx.doi.org/10.1038/nature09613

http://www.ncbi.nlm.nih.gov/pubmed/21068832

http://dx.doi.org/10.1016/j.mod.2015.07.004


http://dx.doi.org/10.1371/journal.pbio.1001469

http://dx.doi.org/10.1371/journal.pbio.1001469


http://dx.doi.org/10.1523/JNEUROSCI.3467-05.2005


http://dx.doi.org/10.1002/cne.901450105


http://dx.doi.org/10.1038/ncomms3149


http://dx.doi.org/10.1038/cr.2017.135


http://dx.doi.org/10.1038/nrn1113



disabled-1. Nature 389, 733–737 (1997). doi: 10.1038/39607;pmid: 9338785

10. T. Hiesberger et al., Direct binding of Reelin to VLDL receptorand ApoE receptor 2 induces tyrosine phosphorylationof disabled-1 and modulates tau phosphorylation. Neuron24, 481–489 (1999). doi: 10.1016/S0896-6273(00)80861-2;pmid: 10571241

11. H. H. Bock, J. Herz, Reelin activates SRC family tyrosinekinases in neurons. Curr. Biol. 13, 18–26 (2003). doi: 10.1016/S0960-9822(02)01403-3; pmid: 12526740

12. A. Sentürk, S. Pfennig, A. Weiss, K. Burk, A. Acker-Palmer,Ephrin Bs are essential components of the Reelin pathway toregulate neuronal migration. Nature 472, 356–360 (2011).doi: 10.1038/nature09874; pmid: 21460838

13. D. S. Rice et al., Disabled-1 acts downstream of Reelin in asignaling pathway that controls laminar organization inthe mammalian brain. Development 125, 3719–3729 (1998).pmid: 9716537

14. D. S. Falconer, Two new mutants, ‘trembler’ and ‘reeler’, withneurological actions in the house mouse (Mus musculus L.).J. Genet. 50, 192–201 (1951). doi: 10.1007/BF02996215;pmid: 24539699

15. M. Sheldon et al., Scrambler and yotari disrupt the disabledgene and produce a reeler-like phenotype in mice. Nature 389,730–733 (1997). doi: 10.1038/39601; pmid: 9338784

16. S. Lutter, S. Xie, F. Tatin, T. Makinen, Smooth muscle-endothelial cell communication activates Reelin signaling andregulates lymphatic vessel formation. J. Cell Biol. 197,837–849 (2012). doi: 10.1083/jcb.201110132; pmid: 22665518

17. Y. Ding et al., Loss of Reelin protects against atherosclerosisby reducing leukocyte-endothelial cell adhesion and lesionmacrophage accumulation. Sci. Signal. 9, ra29 (2016).doi: 10.1126/scisignal.aad5578; pmid: 26980442

18. J. R. Heckenlively et al., Mouse model of subretinalneovascularization with choroidal anastomosis. Retina 23,518–522 (2003). doi: 10.1097/00006982-200308000-00012;pmid: 12972764

19. S. E. Hong et al., Autosomal recessive lissencephaly withcerebellar hypoplasia is associated with human RELNmutations. Nat. Genet. 26, 93–96 (2000). doi: 10.1038/79246;pmid: 10973257

20. F. Impagnatiello et al., A decrease of reelin expression as aputative vulnerability factor in schizophrenia. Proc. Natl. Acad.Sci. U.S.A. 95, 15718–15723 (1998). doi: 10.1073/pnas.95.26.15718; pmid: 9861036

21. A. Botella-López et al., Reelin expression and glycosylationpatterns are altered in Alzheimer’s disease. Proc. Natl. Acad.Sci. U.S.A. 103, 5573–5578 (2006). doi: 10.1073/pnas.0601279103; pmid: 16567613

22. C. A. Haas et al., Role for reelin in the development of granulecell dispersion in temporal lobe epilepsy. J. Neurosci. 22,5797–5802 (2002). doi: 10.1523/JNEUROSCI.22-14-05797.2002; pmid: 12122039

23. J. M. James, Y. S. Mukouyama, Neuronal action onthe developing blood vessel pattern. Semin. Cell Dev. Biol.22, 1019–1027 (2011). doi: 10.1016/j.semcdb.2011.09.010;pmid: 21978864

24. S. Sawamiphak, M. Ritter, A. Acker-Palmer, Preparation ofretinal explant cultures to study ex vivo tip endothelial cellresponses. Nat. Protoc. 5, 1659–1665 (2010). doi: 10.1038/nprot.2010.130; pmid: 20885378

25. A. Stahl et al., The mouse retina as an angiogenesis model.Invest. Ophthalmol. Vis. Sci. 51, 2813–2826 (2010).doi: 10.1167/iovs.10-5176; pmid: 20484600

26. H. Gerhardt et al., VEGF guides angiogenic sproutingutilizing endothelial tip cell filopodia. J. Cell Biol.161, 1163–1177 (2003). doi: 10.1083/jcb.200302047;pmid: 12810700

27. S. Sawamiphak et al., Ephrin-B2 regulates VEGFR2 function indevelopmental and tumour angiogenesis. Nature 465, 487–491(2010). doi: 10.1038/nature08995; pmid: 20445540

28. K. R. Howell, M. N. Hoda, A. Pillai, VEGF activatesNR2B phosphorylation through Dab1 pathway. Neurosci. Lett.552, 30–34 (2013). doi: 10.1016/j.neulet.2013.07.032;pmid: 23916658

29. V. Joukov et al., A novel vascular endothelial growth factor,VEGF-C, is a ligand for the Flt4 (VEGFR-3) and KDR(VEGFR-2) receptor tyrosine kinases. EMBO J. 15, 1751 (1996).pmid: 8612600

30. M. Ogawa et al., The reeler gene-associated antigen on Cajal-Retzius neurons is a crucial molecule for laminar organizationof cortical neurons. Neuron 14, 899–912 (1995). doi: 10.1016/0896-6273(95)90329-1; pmid: 7748558

31. Y. Hirota, K. Nakajima, Control of Neuronal Migration andAggregation by Reelin Signaling in the Developing CerebralCortex. Front. Cell Dev. Biol. 5, 40 (2017). doi: 10.3389/fcell.2017.00040; pmid: 28507985

32. A. Vasudevan, J. E. Long, J. E. Crandall, J. L. Rubenstein,P. G. Bhide, Compartment-specific transcription factorsorchestrate angiogenesis gradients in the embryonic brain.Nat. Neurosci. 11, 429–439 (2008). doi: 10.1038/nn2074;pmid: 18344991

33. T. Wälchli et al., Wiring the Vascular Network with Neural Cues:A CNS Perspective. Neuron 87, 271–296 (2015). doi: 10.1016/j.neuron.2015.06.038; pmid: 26182414

34. V. S. Caviness Jr., Neocortical histogenesis in normal andreeler mice: A developmental study based upon [3H]thymidineautoradiography. Brain Res. 256, 293–302 (1982).doi: 10.1016/0165-3806(82)90141-9; pmid: 7104762

35. C. Lambert de Rouvroit, A. M. Goffinet, The Reeler Mouse as aModel of Brain Development (Springer, 1998). doi: 10.1007/978-3-642-72257-8

36. S. J. Franco, I. Martinez-Garay, C. Gil-Sanz, S. R. Harkins-Perry,U. Müller, Reelin regulates cadherin function via Dab1/Rap1 tocontrol neuronal migration and lamination in the neocortex.Neuron 69, 482–497 (2011). doi: 10.1016/j.neuron.2011.01.003;pmid: 21315259

37. T. Takahashi, J. P. Misson, V. S. Caviness Jr., Glial processelongation and branching in the developing murine neocortex:A qualitative and quantitative immunohistochemical analysis.J. Comp. Neurol. 302, 15–28 (1990). doi: 10.1002/cne.903020103; pmid: 2086612

38. H. E. Beggs et al., FAK deficiency in cells contributing to thebasal lamina results in cortical abnormalities resemblingcongenital muscular dystrophies. Neuron 40, 501–514 (2003).doi: 10.1016/S0896-6273(03)00666-4; pmid: 14642275

39. D. Graus-Porta et al., b1-class integrins regulate thedevelopment of laminae and folia in the cerebral and cerebellarcortex. Neuron 31, 367–379 (2001). doi: 10.1016/S0896-6273(01)00374-9; pmid: 11516395

40. W. Halfter, S. Dong, Y. P. Yip, M. Willem, U. Mayer, A criticalfunction of the pial basement membrane in corticalhistogenesis. J. Neurosci. 22, 6029–6040 (2002).doi: 10.1523/JNEUROSCI.22-14-06029.2002; pmid: 12122064

41. D. E. Schmechel, P. Rakic, A Golgi study of radial glial cells indeveloping monkey telencephalon: Morphogenesis andtransformation into astrocytes. Anat. Embryol. 156, 115–152(1979). doi: 10.1007/BF00300010; pmid: 111580

42. S. J. Tam, R. J. Watts, Connecting vascular and nervoussystem development: Angiogenesis and the blood-brain barrier.Annu. Rev. Neurosci. 33, 379–408 (2010). doi: 10.1146/annurev-neuro-060909-152829; pmid: 20367445

43. B. J. Andreone, B. Lacoste, C. Gu, Neuronal and vascularinteractions. Annu. Rev. Neurosci. 38, 25–46 (2015).doi: 10.1146/annurev-neuro-071714-033835; pmid: 25782970

44. A. Armulik et al., Pericytes regulate the blood-brainbarrier. Nature 468, 557–561 (2010). doi: 10.1038/nature09522; pmid: 20944627

45. R. Daneman, L. Zhou, A. A. Kebede, B. A. Barres, Pericytes arerequired for blood-brain barrier integrity duringembryogenesis. Nature 468, 562–566 (2010). doi: 10.1038/nature09513; pmid: 20944625

46. K. M. Baeten, K. Akassoglou, Extracellular matrix and matrixreceptors in blood-brain barrier formation and stroke.Dev. Neurobiol. 71, 1018–1039 (2011). doi: 10.1002/dneu.20954;pmid: 21780303

47. R. Hallmann et al., Expression and function of lamininsin the embryonic and mature vasculature. Physiol. Rev.85, 979–1000 (2005). doi: 10.1152/physrev.00014.2004;pmid: 15987800

48. M. Sixt et al., Endothelial cell laminin isoforms, laminins8 and 10, play decisive roles in T cell recruitment across theblood-brain barrier in experimental autoimmuneencephalomyelitis. J. Cell Biol. 153, 933–946 (2001).doi: 10.1083/jcb.153.5.933; pmid: 11381080

49. H. Fujiwara, Y. Kikkawa, N. Sanzen, K. Sekiguchi, Purificationand characterization of human laminin-8. Laminin-8 stimulatescell adhesion and migration through a3b1 and a6b1 integrins.J. Biol. Chem. 276, 17550–17558 (2001). doi: 10.1074/jbc.M010155200; pmid: 11278628

50. G. J. del Zoppo, R. Milner, Integrin-matrix interactions in thecerebral microvasculature. Arterioscler. Thromb. Vasc. Biol. 26,1966–1975 (2006). doi: 10.1161/01.ATV.0000232525.65682.a2; pmid: 16778120

51. R. Milner, I. L. Campbell, The integrin family of cell adhesionmolecules has multiple functions within the CNS.

J. Neurosci. Res. 69, 286–291 (2002). doi: 10.1002/jnr.10321;pmid: 12125070

52. H. Yamamoto et al., Integrin b1 controls VE-cadherinlocalization and blood vessel stability. Nat. Commun. 6, 6429(2015). doi: 10.1038/ncomms7429; pmid: 25752958

53. M. Lenter et al., A monoclonal antibody against an activationepitope on mouse integrin chain b1 blocks adhesion oflymphocytes to the endothelial integrin a6b1. Proc. Natl. Acad.Sci. U.S.A. 90, 9051–9055 (1993). doi: 10.1073/pnas.90.19.9051; pmid: 7692444

54. M. Nakayama et al., Spatial regulation of VEGF receptorendocytosis in angiogenesis. Nat. Cell Biol. 15, 249–260(2013). doi: 10.1038/ncb2679; pmid: 23354168

55. M. Vanlandewijck et al., A molecular atlas of cell types andzonation in the brain vasculature. Nature 554, 475–480(2018). doi: 10.1038/nature25739; pmid: 29443965

56. K. Sekine et al., Reelin controls neuronal positioning bypromoting cell-matrix adhesion via inside-out activation ofintegrin a5b1. Neuron 76, 353–369 (2012). doi: 10.1016/j.neuron.2012.07.020; pmid: 23083738

57. N. Haubst, E. Georges-Labouesse, A. De Arcangelis, U. Mayer,M. Götz, Basement membrane attachment is dispensable forradial glial cell fate and for proliferation, but affects positioningof neuronal subtypes. Development 133, 3245–3254 (2006).doi: 10.1242/dev.02486; pmid: 16873583

58. R. Belvindrah, D. Graus-Porta, S. Goebbels, K. A. Nave,U. Müller, b1 integrins in radial glia but not in migratingneurons are essential for the formation of cell layers in thecerebral cortex. J. Neurosci. 27, 13854–13865 (2007).doi: 10.1523/JNEUROSCI.4494-07.2007; pmid: 18077697

59. R. Radakovits, C. S. Barros, R. Belvindrah, B. Patton, U. Müller,Regulation of radial glial survival by signals from the meninges.J. Neurosci. 29, 7694–7705 (2009). doi: 10.1523/JNEUROSCI.5537-08.2009; pmid: 19535581

60. M. Gonzales et al., Structure and function of a vimentin-associated matrix adhesion in endothelial cells. Mol. Biol. Cell12, 85–100 (2001). doi: 10.1091/mbc.12.1.85; pmid: 11160825

61. M. Frotscher, S. Zhao, S. Wang, X. Chai, Reelin SignalingInactivates Cofilin to Stabilize the Cytoskeleton of MigratingCortical Neurons. Front. Cell. Neurosci. 11, 148 (2017).doi: 10.3389/fncel.2017.00148; pmid: 28588454

62. N. J. Abbott, L. Rönnbäck, E. Hansson, Astrocyte-endothelialinteractions at the blood-brain barrier. Nat. Rev. Neurosci. 7,41–53 (2006). doi: 10.1038/nrn1824; pmid: 16371949

63. J. Thyboll et al., Deletion of the laminin a4 chain leads toimpaired microvessel maturation. Mol. Cell. Biol. 22, 1194–1202(2002). doi: 10.1128/MCB.22.4.1194-1202.2002;pmid: 11809810

64. D. Stenzel et al., Endothelial basement membrane limitstip cell formation by inducing Dll4/Notch signalling in vivo.EMBO Rep. 12, 1135–1143 (2011). doi: 10.1038/embor.2011.194;pmid: 21979816

65. I. Sörensen, R. H. Adams, A. Gossler, DLL1-mediated Notchactivation regulates endothelial identity in mouse fetal arteries.Blood 113, 5680–5688 (2009). doi: 10.1182/blood-2008-08-174508; pmid: 19144989

66. U. Mühlner et al., Formation of transformed endothelialcells in the absence of VEGFR-2/Flk-1 by Polyoma middleT oncogene. Oncogene 18, 4200–4210 (1999). doi: 10.1038/sj.onc.1203014; pmid: 10435633

67. M. E. Pitulescu, I. Schmidt, R. Benedito, R. H. Adams, Induciblegene targeting in the neonatal vasculature and analysis ofretinal angiogenesis in mice. Nat. Protoc. 5, 1518–1534 (2010).doi: 10.1038/nprot.2010.113; pmid: 20725067

68. M. Trommsdorff et al., Reeler/Disabled-like disruption ofneuronal migration in knockout mice lacking the VLDL receptorand ApoE receptor 2. Cell 97, 689–701 (1999). doi: 10.1016/S0092-8674(00)80782-5; pmid: 10380922

69. T. Yardeni, M. Eckhaus, H. D. Morris, M. Huizing,S. Hoogstraten-Miller, Retro-orbital injections in mice.Lab Anim. 40, 155–160 (2011). doi: 10.1038/laban0511-155;pmid: 21508954

70. S. Liebner, U. Kniesel, H. Kalbacher, H. Wolburg, Correlation oftight junction morphology with the expression of tightjunction proteins in blood-brain barrier endothelial cells.Eur. J. Cell Biol. 79, 707–717 (2000). doi: 10.1078/0171-9335-00101; pmid: 11089919

71. K. Wilhelm et al., FOXO1 couples metabolic activity and growthstate in the vascular endothelium. Nature 529, 216–220(2016). doi: 10.1038/nature16498; pmid: 26735015

72. E. Kur et al., Temporal modulation of collective cell behaviorcontrols vascular network topology. eLife 5, e13212 (2016).doi: 10.7554/eLife.13212; pmid: 26910011




Dow

nloaded from

http://dx.doi.org/10.1038/39607


http://dx.doi.org/10.1016/S0896-6273(00)80861-2


http://dx.doi.org/10.1016/S0960-9822(02)01403-3

http://dx.doi.org/10.1016/S0960-9822(02)01403-3





http://dx.doi.org/10.1007/BF02996215

http://dx.doi.org/10.1007/BF02996215

http://dx.doi.org/10.1038/39601


http://dx.doi.org/10.1083/jcb.201110132


http://dx.doi.org/10.1126/scisignal.aad5578


http://dx.doi.org/10.1097/00006982-200308000-00012


http://dx.doi.org/10.1038/79246


http://dx.doi.org/10.1073/pnas.95.26.15718



http://dx.doi.org/10.1073/pnas.0601279103

http://dx.doi.org/10.1073/pnas.0601279103


http://dx.doi.org/10.1523/JNEUROSCI.22-14-05797.2002



http://dx.doi.org/10.1016/j.semcdb.2011.09.010


http://dx.doi.org/10.1038/nprot.2010.130



http://dx.doi.org/10.1167/iovs.10-5176


http://dx.doi.org/10.1083/jcb.200302047




http://dx.doi.org/10.1016/j.neulet.2013.07.032



http://dx.doi.org/10.1016/0896-6273(95)90329-1

http://dx.doi.org/10.1016/0896-6273(95)90329-1


http://dx.doi.org/10.3389/fcell.2017.00040

http://dx.doi.org/10.3389/fcell.2017.00040


http://dx.doi.org/10.1038/nn2074


http://dx.doi.org/10.1016/j.neuron.2015.06.038



http://dx.doi.org/10.1016/0165-3806(82)90141-9


http://dx.doi.org/10.1007/978-3-642-72257-8

http://dx.doi.org/10.1007/978-3-642-72257-8






http://dx.doi.org/10.1016/S0896-6273(03)00666-4


http://dx.doi.org/10.1016/S0896-6273(01)00374-9

http://dx.doi.org/10.1016/S0896-6273(01)00374-9




http://dx.doi.org/10.1007/BF00300010


http://dx.doi.org/10.1146/annurev-neuro-060909-152829











http://dx.doi.org/10.1002/dneu.20954


http://dx.doi.org/10.1152/physrev.00014.2004


http://dx.doi.org/10.1083/jcb.153.5.933


http://dx.doi.org/10.1074/jbc.M010155200

http://dx.doi.org/10.1074/jbc.M010155200


http://dx.doi.org/10.1161/01.ATV.0000232525.65682.a2

http://dx.doi.org/10.1161/01.ATV.0000232525.65682.a2


http://dx.doi.org/10.1002/jnr.10321


http://dx.doi.org/10.1038/ncomms7429





http://dx.doi.org/10.1038/ncb2679







http://dx.doi.org/10.1242/dev.02486







http://dx.doi.org/10.1091/mbc.12.1.85


http://dx.doi.org/10.3389/fncel.2017.00148


http://dx.doi.org/10.1038/nrn1824


http://dx.doi.org/10.1128/MCB.22.4.1194-1202.2002


http://dx.doi.org/10.1038/embor.2011.194


http://dx.doi.org/10.1182/blood-2008-08-174508

http://dx.doi.org/10.1182/blood-2008-08-174508


http://dx.doi.org/10.1038/sj.onc.1203014

http://dx.doi.org/10.1038/sj.onc.1203014




http://dx.doi.org/10.1016/S0092-8674(00)80782-5

http://dx.doi.org/10.1016/S0092-8674(00)80782-5


http://dx.doi.org/10.1038/laban0511-155


http://dx.doi.org/10.1078/0171-9335-00101

http://dx.doi.org/10.1078/0171-9335-00101




http://dx.doi.org/10.7554/eLife.13212



73. M. Hellström et al., Dll4 signalling through Notch1 regulatesformation of tip cells during angiogenesis. Nature 445,776–780 (2007). doi: 10.1038/nature05571; pmid: 17259973

74. E. Zudaire, L. Gambardella, C. Kurcz, S. Vermeren, Acomputational tool for quantitative analysis of vascularnetworks. PLOS ONE 6, e27385 (2011). doi: 10.1371/journal.pone.0027385; pmid: 22110636

75. C. A. Schneider, W. S. Rasband, K. W. Eliceiri, NIH Image toImageJ: 25 years of image analysis. Nat. Methods 9, 671–675(2012). doi: 10.1038/nmeth.2089; pmid: 22930834

76. M. Parrilla, I. Chang, A. Degl’Innocenti, M. Omura, Expression ofhomeobox genes in the mouse olfactory epithelium.J. Comp. Neurol. 524, 2713–2739 (2016). doi: 10.1002/cne.24051; pmid: 27243442

ACKNOWLEDGMENTS

We thank U. Müller, J. Herz, E. Wagner, and R. Adams for providingmouse strains; S. Sawamiphak for initial help in the project;

U. Bauer, K. Hammer, S. Seidel, D. Schmelzer, and T. Belefkih fortechnical support; and A. Frangakis and H. Zimmermann for helpfuldiscussions. Funding: Supported by ERC_AdG_Neurovessel(project 669742); Deutsche Forschungsgemeinschaft grants SFB834, SFB1080, FOR2325, EXC 115, and EXC 147; the Max PlanckFellow Program and Gutenberg Research College (GRC) atJohannes Gutenberg University Mainz (A.A.-P.); and the Marie Curie–CIG293902 (M.S.). Author contributions: M.S. performed initialexperiments and designed and supervised the project; M.R.A.designed, performed, and supervised experiments in the vascular-gliaand BBB parts; F.C. designed, performed, and supervised experimentsin the vascular part; C.L.-C. performed experiments in thevascular-glia and BBB parts; R.H. and I.B. performed experimentsin the vascular part; M.D. performed PLA assays and VEGFR2cortex analysis; M.P. performed in situ hybridizations; D.H.performed astrocyte and BBB permeability experiments anddesigned the model cartoons; A.S., H.S., and T.A. designed,performed, and supervised the electron microscopy; L.M. and

M.R. performed initial experiments in the vascular part; L.T.-M.performed astrocyte binding assays; A.A.-P. analyzed dataand designed and supervised all stages of the project; M.S. andA.A.-P. wrote the manuscript with contributions from M.R.A. andF.C.; and all authors discussed and interpreted the data and gaveinput to the written manuscript. Competing interests: Theauthors declare no competing interests. Data and materialsavailability: All data needed to evaluate the conclusions in thispaper are present either in the main text or the supplementarymaterials. The Dab1 floxed mice are available from U. Müller undera material agreement with The Scripps Research Institute.

SUPPLEMENTARY MATERIALS

www.sciencemag.org/content/361/6404/eaao2861/suppl/DC1Figs. S1 to S13

4 July 2017; accepted 5 July 201810.1126/science.aao2861




Dow

nloaded from



http://dx.doi.org/10.1371/journal.pone.0027385

http://dx.doi.org/10.1371/journal.pone.0027385


http://dx.doi.org/10.1038/nmeth.2089





http://www.sciencemag.org/content/361/6404/eaao2861/suppl/DC1


nervous systemEndothelial Dab1 signaling orchestrates neuro-glia-vessel communication in the central

Acker-PalmerAmparoDewi Husainie, Anne Schänzer, Hannah Schlierbach, Till Acker, Laura Mohr, Laia Torres-Masjoan, Mathias Ritter and

Marta Segarra, Maria R. Aburto, Florian Cop, Cecília Llaó-Cid, Ricarda Härtl, Miriam Damm, Ioanna Bethani, Marta Parrilla,

DOI: 10.1126/science.aao2861 (6404), eaao2861.361Science

, this issue p. eaao2861; see also p. 754Scienceneurovascular unit required for blood-brain barrier integrity in the mature brain.positioning of neurons during cortical development. This integration is also important for correct communication at the cells and neurons facilitates the communication between vessels, glia, and neurons that is necessary for the correctare also expressed in endothelial cells (see the Perspective by Thomas). The integration of reelin signaling in endothelial

found that Dab1 and ApoER2et al.ApoER2 receptors respond to a guidance cue called reelin. Studying mice, Segarra functional neuro-glia-vascular units in the central nervous system. During cortical development, neuronal Dab1 and

During development, signals need to be dynamically integrated by endothelial cells, neurons, and glia to achieveDeveloping the bloodbrain barrier

ARTICLE TOOLS http://science.sciencemag.org/content/361/6404/eaao2861

MATERIALSSUPPLEMENTARY http://science.sciencemag.org/content/suppl/2018/08/22/361.6404.eaao2861.DC1

CONTENTRELATED http://science.sciencemag.org/content/sci/361/6404/754.full

REFERENCES

http://science.sciencemag.org/content/361/6404/eaao2861#BIBLThis article cites 75 articles, 21 of which you can access for free

PERMISSIONS http://www.sciencemag.org/help/reprints-and-permissions

Terms of ServiceUse of this article is subject to the

is a registered trademark of AAAS.ScienceScience, 1200 New York Avenue NW, Washington, DC 20005. The title (print ISSN 0036-8075; online ISSN 1095-9203) is published by the American Association for the Advancement ofScience

Science. No claim to original U.S. Government WorksCopyright © 2018 The Authors, some rights reserved; exclusive licensee American Association for the Advancement of

on July 19, 2020


Dow

nloaded from

http://science.sciencemag.org/content/361/6404/eaao2861

http://science.sciencemag.org/content/suppl/2018/08/22/361.6404.eaao2861.DC1

http://science.sciencemag.org/content/sci/361/6404/754.full

http://science.sciencemag.org/content/361/6404/eaao2861#BIBL

http://www.sciencemag.org/help/reprints-and-permissions

http://www.sciencemag.org/about/terms-service


NEUROSCIENCE Endothelial Dab1 signaling orchestrates neuro … · RESEARCH ARTICLE NEUROSCIENCE...

Documents

Transcript of NEUROSCIENCE Endothelial Dab1 signaling orchestrates neuro … · RESEARCH ARTICLE NEUROSCIENCE...