AURELIE PREYNAT

INTERACTIONS ACIDE FOLIQUE-VITAMINE B12-MÉTHIONINE : EFFETS SUR LE MÉTABOLISME

HÉPATIQUE ET LA PRODUCTIVITÉ DES VACHES LAITIÈRES

Thèse de doctorat présentée à la Faculté des études supérieures de l’Université Laval

dans le cadre du programme de doctorat en Sciences animales pour l’obtention du grade de Philosophiae Doctor (Ph.D.)

DÉPARTEMENT DES SCIENCES ANIMALES FACULTÉ DES SCIENCES DE L’AGRICULTURE ET DE L’ALIMENTATION

UNIVERSITÉ LAVAL QUÉBEC

2009 © Aurélie Preynat, 2009

II

A Matt,

A mes parents,

III

RÉSUMÉ

Le but du présent travail était de déterminer si les effets d’une

supplémentation en acide folique sur les performances de lactation étaient dus à une

amélioration de la méthylnéogénèse et si l’apport en vitamine B12 pouvait interférer

avec cette voie métabolique. Dans cette éventualité, la supplémentation en

méthionine, une importante source de groupements méthyles préformés, devrait

réduire les besoins en ces vitamines. Soixante vaches multipares recevaient soit une

alimentation calculée pour couvrir 76% des besoins en méthionine (M-) soit la même

alimentation supplémentée avec 18g de méthionine protégée de la dégradation

ruminale (M+). À l’intérieur de chaque niveau de méthionine, les vaches recevaient

soit aucun supplément vitaminique (B9-B12-), soit des injections intramusculaires

hebdomadaires de 160mg d’acide folique seules (B9+B12-) ou combinées avec 10mg

de vitamine B12 (B9+B12+), de 3 semaines avant jusqu’à 16 semaines après le vêlage.

À 12 semaines de lactation, des cinétiques de glucose et de méthionine ont été

mesurées par dilution d’isotopes en infusant du D-[U13-C]glucose, [13C]NaHCO3 et de

la L-[1-13C, 2H3]méthionine à 24 vaches des traitements M-B9-B12-, M-B9+B12+, M+

B9-B12- et M+B9+B12+. Des échantillons de lait, de sang et de foie ont été collectés

pour mesurer les performances de lactation, différents métabolites et l’expression

génique d’enzymes clés du métabolisme énergétique et du cycle des méthylations.

Parallèlement à une augmentation des concentrations en folates et en vitamine B12

dans le lait, le plasma et le foie, l’administration conjointe de ces vitamines

augmentait la production laitière. Les suppléments de méthionine ont modifié

l’abondance en ARNm d’enzymes clés du cycle des méthylations alors que la

supplémentation en acide folique diminuait les concentrations plasmatiques

d'homocystéine sans effet sur les performances des animaux. Le supplément d’acide

folique et de vitamine B12 augmentait les flux corporels de glucose d’une amplitude

quantitativement similaire à l’augmentation du rendement en lactose ainsi que

l’expression du gène de la méthylmalonyl-CoA mutase, une enzyme essentielle pour

l’entrée du propionate dans le cycle de Krebs. Les effets du supplément d'acide

folique et vitamine B12 sur les performances de lactation étaient probablement dus à

IV

une augmentation de l’efficacité du métabolisme du glucose plutôt qu’à un effet sur la

méthylnéogénèse.

Mots-clés : vache laitière, acide folique, vitamine B12, méthionine protégée de la

dégradation ruminale

V

ABSTRACT

The aim of the present study was to determine if the effects of supplementary

folic acid on lactational performance were due to improved methylneogenesis and if

the supply in vitamin B12 could interfere with this metabolic pathway. In this

eventuality, supplementary methionine, a major source of preformed methyl groups,

should reduce the requirement for these vitamins. Sixty multiparous cows were fed

either a diet calculated to supply 76% of methionine requirement (M-) or the same

diet supplemented with 18 g of rumen-protected methionine (M+). Within each level

of methionine, cows received either no vitamin supplement (B9-B12-), weekly

intramuscular injections of 160 mg of folic acid alone (B9+B12-) or combined with 10

mg of vitamin B12 (B9+B12+), from 3 wk before to 16 wk after calving. At 12 week of

lactation, glucose and methionine kinetics were measured by isotope dilution using

infusions of D-[U13C]glucose, [13C]NaHCO3 and L-[1-13C, 2H3]methionine on 24

cows in treatments M-B9-B12-, M-B9+B12+, M+ B9-B12- et M+B9+B12+. Milk, blood

and liver samples were collected to measure lactational performance, different

metabolites and gene expression of key enzymes of energy metabolism and

methylation cycle. The results showed that, in parallel with an increase in folates and

vitamin B12 concentrations in milk, plasma and liver, administration of folic acid and

vitamin B12 together increased milk production. The supplements of methionine

affected methylation cycle by acting on mRNA abundance of key enzymes of this

cycle whereas supplementary folic acid decreased plasma concentrations of

homocysteine without any effect on animal performance. Intramuscular injections of

folic acid and vitamin B12 increased whole body flux of glucose with a similar

quantitative magnitude as the observed increment in milk lactose yield. Vitamin

supplements increased also gene expression of the methylmalonyl-CoA mutase, an

essential enzyme for the entry of propionate in the Krebs cycle. These results indicate

that the effects of the combined supplements of folic acid and vitamin B12 on

lactational performance are probably due to an improved efficiency of glucose

metabolism rather than an effect on methylneogenesis.

Key words: dairy cow, folic acid, vitamin B12, rumen-protected methionine

VI

AVANT-PROPOS

Je tiens à exprimer mes plus sincères remerciements à Madame Christiane Girard qui m’a accueillie au sein de son équipe et encadrée durant ces années. Elle a su faire preuve de disponibilité et d’une profonde gentillesse au quotidien, et sa culture scientifique a permis de répondre à mes nombreuses questions. Je lui suis profondément reconnaissante pour la formation à la recherche qu’elle m’a apportée, sa bonne humeur, la confiance qu’elle m’a accordée et surtout son soutien et ces encouragements constants qui m’ont permis de réaliser cette thèse. Merci infiniment…

Je tiens à remercier sincèrement les membres du jury de cette thèse :

Professeur Michel Lefrançois qui me fait l’honneur de présider ce jury, Docteurs Mesdames Carole Thivierge, Antonella Baldi et Christiane Girard ainsi qu’aux docteurs Messieurs Benoît Graulet et Jean Bernier qui ont acceptés de participer à ce jury,

Je leur suis très reconnaissante pour le temps et l’énergie consacrés à l’évaluation de ce travail. J’adresse aussi mes sincères remerciements à tous les co-auteurs impliqués dans la réalisation de cette thèse :

A Hélène Lapierre, merci beaucoup de m’avoir donné l’opportunité de travailler avec toi, pour le temps que tu m’as consacré et nos nombreuses discussions. A Carole Thivierge, Marie-France Palin et Jacques Matte, pour le temps que vous avez consacré à chaque réunion, pour vos conseils et pour avoir répondu à mes questions. A André Desrochers.

Je remercie aussi tout le personnel du centre de recherche sur le bovin laitier et le porc de Lennoxville, scientifiques, personnels techniques des laboratoires et de l’étable ainsi que l’administration pour leur gentillesse et tous les bons moments agréables passés ensemble.

VII

Un merci particulier aux personnes du laboratoire 218 : A Chrystiane Plante et Véronique Roy, qui m’ont beaucoup aidée pour les nombreux dosages et les diverses mises au point grâce à leur efficacité et leur rigueur scientifique, A Michelle Guillette et Isabelle Audet, pour leur bonne humeur quotidienne et leurs précieux conseils artistiques, A Debora Santschi et Alexandre Castellano, avec qui nous avons partagés de bons moments au café, les midis… Enfin un immense merci à mes parents, qui n’ont cessé de m’encourager et valoriser mon travail durant toutes ces années et à mon frère et Bryonie, qui m’ont aidée dans la relecture de mes articles. Et puis, merci à Matt pour m’avoir soutenue, pour ta patience et pour chaque jour passé avec toi…

VIII

SOMMAIRE

RÉSUMÉ..............................................................................................................................III

ABSTRACT ...........................................................................................................................V

AVANT-PROPOS ................................................................................................................. VI

SOMMAIRE.......................................................................................................................VIII

TABLE DES ILLUSTRATIONS............................................................................................. XIV

LISTE DES ABRÉVIATIONS.............................................................................................XVIII

CHAPITRE I : INTRODUCTION 1

CHAPITRE II : REVUE DES TRAVAUX ANTÈRIEURS 6

II-1 LE GLUCOSE...................................................................................................................7

II-1.1 Absorption intestinale ..........................................................................................7 II-1.2 La néoglucogenèse:...............................................................................................7

II-1.2.1 Réactions enzymatiques................................................................................8 II-1.2.2 Contrôle à court et moyen termes .................................................................8 II-1.2.3 Les substrats néoglucoformateurs...............................................................10 II-1.2.4 Adaptation du métabolisme lors de la période péripartum.........................13 II-1.2.5 Méthodologies de mesure de la néoglucogenèse........................................14

II-1.2.5.1 Méthodes in vitro et in vivo ................................................................... 14 II-1.2.5.2 Définition des concepts pour les mesures de métabolisme.................... 15 II-1.2.5.3 Les différents types d’infusion .............................................................. 16 II-1.2.5.4 Choix de la méthode d’analyse et de l’isotope ...................................... 17

II-1.3 Utilisation du glucose : ......................................................................................18 II-1.3.1 Source de glycérol et d’énergie ..................................................................19 II-1.3.2 La synthèse de lactose.................................................................................19

II-2 LES LIPIDES .................................................................................................................20

II-2.1 Métabolisme des lipides......................................................................................20 II-2.1.1 Origine des acides gras ................................................................................20

II-2.1.1.1 La synthèse de novo ............................................................................... 21 II-2.1.1.2 Les lipoprotéines.................................................................................... 22

II-2.1.2 La synthèse et l’hydrolyse des triglycérides ...............................................24 II-2.1.3 L’importance du glucose ............................................................................26

IX

......................................................................................................................................27 II-2.2 Pathologies liées au métabolisme des lipides ....................................................27

II-2.2.1 La cétogenèse..............................................................................................28 II-2.2.2 La stéatose hépatique ..................................................................................28

II-3 LES PROTÉINES.............................................................................................................30

II-3.1 Métabolisme des acides aminés..........................................................................30 II-3.1.1 Rôles des acides aminés...............................................................................30 ..................................................................................................................................32 II-3.1.2 Contrôle du métabolisme des acides aminés au niveau des tissus périphériques.............................................................................................................32

II-3.2 « Turnover » protéique ......................................................................................33 II-3.2.1 Une plasticité métabolique...........................................................................33 II-3.2.2 Équilibre entre synthèse et dégradation protéique.......................................35 II-3.2.3 Mesure du dynamisme protéique................................................................36

II-4 VITAMINES DU COMPLEXE B........................................................................................38

II-4.1 Synthèse dans le rumen et absorption intestinale ...............................................38 II-4.2 Implication dans les grandes voies métaboliques ...............................................38 II-4.3 Définition des besoins.........................................................................................40

II-5 ACIDE FOLIQUE, VITAMINE B12 ET MÉTHIONINE ...........................................................42

II-5.1 Acide folique.......................................................................................................42 II-5.1.1 Structure et définition ..................................................................................42 II-5.1.2 Données nutritionnelles : sources alimentaires et besoins...........................44 II-5.1.3 Biodisponibilité et métabolisme : absorption intestinale, distribution, transport, stockage et excrétion ............................................................44

II-5.1.3.1 Absorption intestinale (Figure 15) :........................................................ 44 II-5.1.3.2 Folates sanguins (Figure 15) :................................................................. 45 II-5.1.3.3 Transport et distribution tissulaire (Figure 15) : ..................................... 45 II-5.1.3.4 Excrétion :............................................................................................... 46

II-5.1.4 Métabolisme cellulaire.................................................................................46 II-5.2 Vitamine B12 .......................................................................................................51

II-5.2.1 Structure et définition ..................................................................................51 II-5.2.2 Données nutritionnelles : sources alimentaires, besoins, carences..............52 II-5.2.3 Métabolisme : absorption intestinale, distribution, transport, stockage et excrétion.................................................................................................53

II-5.2.3.1 Absorption intestinale ............................................................................. 53 II-5.2.3.2 Transport sanguin ................................................................................... 55 II-5.2.3.3 Entrée et distribution tissulaire ............................................................... 55 II-5.2.3.4 Excrétion................................................................................................. 57

II-5.2.4 Métabolisme cellulaire.................................................................................57 II-5.3 Méthionine ..........................................................................................................58

II-5.3.1 Structure et définition ..................................................................................58 II-5.3.2 Méthionine dans la synthèse protéique........................................................59 II-5.3.3 S-adénosylméthionine et les réactions de méthylation ................................60

X

II-5.3.4 Le métabolisme de la méthionine ................................................................61 II-5.3.4.1 Les voies métaboliques........................................................................... 61 II-5.3.4.2 Les régulations........................................................................................ 62

II-6 CAS PARTICULIER DE LA VACHE LAITIÈRE....................................................................64

II-6.1 Caractéristiques du cycle des méthylations ........................................................64 II-6.2 Effet d’apports en acide folique et vitamine B12.................................................65

II-7 HYPOTHÈSES DE TRAVAIL ET OBJECTIFS ......................................................................69

II-8 RÉFÉRENCES BIBLIOGRAPHIQUES.................................................................................71

CHAPITRE III : LACTATIONAL PERFORMANCE OF DAIRY COWS

ACCORDING TO FOLIC ACID AND VITAMIN B12 SUPPLY AND

METHIONINE PROVISION 83

III-1 RÉSUMÉ......................................................................................................................84

III-2 ABSTRACT ..................................................................................................................85

III-3 INTRODUCTION ...........................................................................................................86

III-4 MATERIALS AND METHODS.........................................................................................87

III-4.1 Cows and treatments..........................................................................................87 III-4.2 Sampling procedures .........................................................................................88

III-4.2.1 Feed ............................................................................................................88 III-4.2.2 Body weight................................................................................................88 III-4.2.3 Milk ............................................................................................................89 III-4.2.4 Blood ..........................................................................................................89

III-4.3 Laboratory analyses...........................................................................................89 III-4.3.1 Folates and vitamin B12 ..............................................................................89 III-4.3.2 Plasma biotin and vitamin B6 .....................................................................90 III-4.3.3 Plasma urea, NEFA, glucose and BHB......................................................90 III-4.3.4 Total homocysteine, total cysteine and methionine in plasma ...................90 III-4.3.5 Amino acids in plasma ..............................................................................91

III-4.4 Statistical analyses.............................................................................................91 III-5 RESULTS .....................................................................................................................91

III-4.5.1 Lactational performance.............................................................................91 III-4.5.2 Plasma variables .........................................................................................93

III-4.5.2.1 B-vitamins ............................................................................................. 93 III-4.5.2.2 Glucose, NEFA, BHBA and Urea......................................................... 94 III-4.5.2.3 Amino acids........................................................................................... 94

XI

III-6 DISCUSSION ................................................................................................................95

III-7 CONCLUSION ..............................................................................................................98

III-8 ACKNOWLEDGMENTS .................................................................................................99

III-9 REFERENCES.............................................................................................................109

CHAPITRE IV : EFFECTS OF SUPPLEMENTS OF FOLIC ACID,

VITAMIN B12 AND RUMEN-PROTECTED METHIONINE ON

WHOLE BODY METABOLISM OF METHIONINE AND GLUCOSE IN

LACTATING DAIRY COWS 112

IV-1 RÉSUMÉ ...................................................................................................................113

IV-2 ABSTRACT ................................................................................................................114

IV-3 INTRODUCTION.........................................................................................................115

IV-4 MATERIALS AND METHODS ......................................................................................116

IV-4.1 Cows and Treatments ......................................................................................116 IV-4.2 Forage and milk analyses ................................................................................117 IV-4.3 Blood sampling procedure ..............................................................................118 IV-4.4 Blood plasma analyses ....................................................................................119

IV-4.4.1 Folates and vitamin B12 ............................................................................119 IV-4.4.2 Urea, NEFA, Glucose and BHBA............................................................119 IV-4.4.3 Amino acids..............................................................................................119

IV-4.5 Kinetic measurements .....................................................................................120 IV-4.5.1 Infusion and blood sampling ....................................................................120 IV-4.5.2 Isotopic enrichment analyses ...................................................................121 IV-4.5.3 Calculations..............................................................................................122

IV-4.6 Statistical analyses...........................................................................................124 IV-5 RESULTS...................................................................................................................124

IV-5.1 Production data................................................................................................124 IV-5.2 Plasma variables..............................................................................................125 IV-5.3 Whole body kinetics........................................................................................126

IV-6 DISCUSSION..............................................................................................................127

IV-6.1 Glucose kinetics ..............................................................................................128 IV-6.2 Methionine kinetics .........................................................................................130

IV-7 CONCLUSION ............................................................................................................132

XII

IV-8 ACKNOWLEDGMENTS ...............................................................................................133

IV-9 REFERENCES.............................................................................................................144

CHAPITRE V : HEPATIC METABOLISM OF DAIRY COWS

ACCORDING TO FOLIC ACID AND VITAMIN B12 SUPPLY AND

METHIONINE PROVISION. 148

V-1 RÉSUMÉ.....................................................................................................................149

V-2 ABSTRACT .................................................................................................................150

V-3 INTRODUCTION ..........................................................................................................151

V-4 MATERIALS AND METHODS........................................................................................152

V-4.1 Animals, diets and experimental design ...........................................................152 V-4.2 Sampling procedure..........................................................................................153 V-4.3 Laboratory analyses..........................................................................................153

V-4.3.1 Folates and vitamin B12 .............................................................................153 V-4.3.2 Biotin .........................................................................................................153 V-4.3.3 Lipid fractions (cholesterol ester, triglycerides, diglycerides, cholesterol, phosphatidylethanolamine and phosphatidylcholine) in liver.............154 V-4.3.4 RNA extraction and cDNA synthesis........................................................154 V-4.3.5 Cloning and Sequencing of 5,10-Methylene-tetrahydrofolate Reductase, Betaïne Homocysteine Methyltransferase and Methionine Synthase Reductase Bovine Genes .........................................................................155 V-4.3.6 5’- and 3’- RACE of MTHFR, BHMT, MTRR and Methionine Synthase Bovine Genes. .........................................................................................156 V-4.3.7 Selected bovine genes mRNA levels.........................................................156 V-4.3.8 Liver incubations .......................................................................................157

V-4.4 Statistical analyses............................................................................................159 V-5 RESULTS ....................................................................................................................159

V-5.1 B-vitamins ........................................................................................................159 V-5.2 Lipids ................................................................................................................160 V-5.3 Gene expression of BHMT, GNMT, MS, MTHFR, MTP, MTRR, MMCoA and PEMT ...................................................................................................160 V-5.4 Gluconeogenesis and protein synthesis ............................................................161

V-6 DISCUSSION ...............................................................................................................162

V-6.1 B-vitamin status................................................................................................162 V-6.2 The methylation cycle ......................................................................................162 V-6.3 Gluconeogenesis, energy and protein metabolism ...........................................166

XIII

V-7 CONCLUSION .............................................................................................................169

V-8 ACKNOWLEDGMENTS ................................................................................................170

V-9 REFERENCES ..............................................................................................................180

CHAPITRE VI : DISCUSSION ET CONCLUSION GÉNÉRALE 184

VI-1 DISCUSSION ..............................................................................................................185

VI-2 CONCLUSION GÉNÉRALE ..........................................................................................187

VI-3 RÉFÉRENCES BIBLIOGRAPHIQUES .............................................................................187

XIV

TABLE DES ILLUSTRATIONS

Les figures :

Figure 1 : Évolution du rendement en lait, de la prise alimentaire et de l’énergie

nette de lactation de 1980 à 2003 (Adapté d’Eastridge, 2006). 3 Figure 2 : Production laitière, ingestion nette d’énergie et bilan énergétique des

vaches laitières pendant la lactation (Adapté de Bauman et Currie, 1980). 3 Figure 3 : Réactions enzymatiques de la néoglucogenèse et de la glycolyse

(Adapté des notes de cours « Nutrition et physiologie des ruminants » de Yvan Chouinard). 9

Figure 4 : Voie métabolique empruntée par le propionate pour permettre la

synthèse de glucose via la néoglucogenèse (Tiré de Voet et Voet, 1998). 11 Figure 5 : Utilisation du glucose dans la voie des pentoses-phosphates permettant

de fournir du NADPH (Tiré de Voet et Voet, 1998). 19 Figure 6 : Utilisation du glucose dans la glande mammaire bovine (Adapté des

valeurs tirées de Chaiyabutr et al., 1980). 20 Figure 7 : Les mécanismes de la lipogenèse (Voet et Voet, 1998) 23 Figure 8 : Métabolisme hépatique des acides gras chez les ruminants (Adapté de

Vernon, 2005). 24 Figure 9 : Représention schématique du système carnitine permettant le transfert

des acides gras à longue chaîne dans la matrice mitochondriale (Tiré de Zammit, 1990). 25

Figure 10 : Étapes clés de l’utilisation du glucose dans la synthèse des acides gras

(Tiré de Neville et Picciano, 1997). 27 Figure 11 : Intermédiaires glucogéniques et cétogéniques produits suite au

catabolisme des acides aminés dans le foie (Tiré de Voet et Voet, 1998). 32 Figure 12 : Pourcentage de contribution de différents tissus à la masse protéique,

la synthèse protéique et à l’utilisation nette d’oxygène indicateur de l’énergie utilisée au niveau corporel chez le bouvillon (Adapté de Lobley, 2003). 35

Figure 13 : Fonctions métaboliques des vitamines B (Adapté de Le Grusse et

Watier, 1993). 40

XV

Figure 14 : Structure chimique de l’acide folique (ou acide ptéroylglutamique) 43 Figure 15 : Absorption, métabolisme, stockage et excrétion des folates. 47 Figure 16 : Métabolisme des unités monocarbonées dépendant de l’acide folique

(Adapté de Lucock, 2000). 50 Figure 17 : Structure chimique de la vitamine B12. 52 Figure 18 : Mécanismes d’absorption de la vitamine B12 (Tiré de Le Grusse et

Watier, 1993). 54 Figure 19 : Implication des protéines de transport de la vitamine B12 dans les

mécanismes d’absorption intestinale et d’entrée de la vitamine dans les cellules (Adapté de Seetharam et al., 1999). 56

Figure 20 : Métabolisme cellulaire de la vitamine B12 (Adapté de Le Grusse et

Watier, 1993). 58 Figure 21 : Structures chimiques de la méthionine et de son dérivé : la S-

Adénosylméthionine. 59 Figure 22 : Le métabolisme de la méthionine (d’après Brosnan et al., 2007). 65 Figure 23 : Voies métaboliques impliquant l’acide folique et la vitamine B12 et

leurs régulations. 67 Figure 24. Effects of intramuscular injections of folic acid (B9) and vitamin B12

(B12) given to dairy cows from 3 wk before calving to 16 wk of lactation on milk production. 106

Figure 25. Effects of intramuscular injections of folic acid (B9) and vitamin B12

(B12) given to dairy cows from 3 wk before calving to 16 wk of lactation on milk protein yields. 107

Figure 26. Effects of intramuscular injections of folic acid (B9) and vitamin B12

(B12) given to dairy cows from 3 wk before calving to 16 wk of lactation on plasma concentrations of folates. 108

Figure 27. A schematic pathway of L-[1-13C,2H3]methionine with its

components: transmethylation (TM), remethylation (RM) and transsulfuration (TS) (adapted from Mercier et al., 2006). 142

Figure 28. Effects of dietary supplements of rumen-protected methionine (M)

and intramuscular injections of folic acid (B9) and vitamin B12 (B12) given to dairy cows from 3 wk before calving to 12 wk of lactation on plasma concentration of cysteine and methionine oxidation on wk 12 of lactation. 143

XVI

Figure 29. Folate and vitamin B12-dependent pathways and methylation cycle. 176 Figure 30. Effects of dietary supplements of rumen-protected methionine (M)

and intramuscular injections of folic acid (B9) and vitamin B12 (B12) given to dairy cows from 3 wk before calving to 16 wk of lactation on liver concentrations of folates. 178

Figure 31. Effects of dietary supplements of rumen-protected methionine (M)

and intramuscular injections of folic acid (B9) and vitamin B12 (B12) given to dairy cows from 3 wk before calving to 16 wk of lactation on GNMT relative mRNA abundance. 179

Les tableaux : Tableau 1 : Bilan des apports (synthèse ruminale et alimentation) et besoins

corporels estimés (tissus et production laitière) en vitamines B chez une vache laitière de 650 kg produisant 35 kg de lait par jour (Tiré de NRC, 2001). 41

Tableau 2 : Principaux folates ayant une activité biologique (selon Bollheimer et

al., 2005). 43 Tableau 3. Ingredients and nutrient composition of the diets fed to dairy cows 100 Tableau 4. Effects of dietary supplements of rumen-protected Met (M) and

intramuscular injections of folic acid (B9) and vitamin B12 (B12) given to dairy cows from 3 wk before calving to 16 wk of lactation on dry matter intake, milk production and composition. 102

Tableau 5. Effects of dietary supplements of rumen-protected Met (M) and

intramuscular injections of folic acid (B9) and vitamin B12 (B12) given to dairy cows from 3 wk before calving to 16 wk of lactation on plasma concentrations of some B-vitamins, glucose, urea, NEFA, BHBA and AA. 104

Tableau 6. Ingredients and nutrient composition of the diets fed to dairy cows. 134 Tableau 7. Binary gradient mobile phase composition used to analyze plasma AA

by HPLC. 136 Tableau 8. Effects of dietary supplements of rumen-protected methionine (M)

and intramuscular injections of folic acid (B9) and vitamin B12 (B12) given to dairy cows on production variables at 12 wk of lactation. 137

XVII

Tableau 9. Effects of dietary supplements of rumen-protected Met (M) and intramuscular injections of folic acid (B9) and vitamin B12 (B12) given to dairy cows on plasma variables at 12 wk of lactation. 138

Tableau 10. Effects of dietary supplements of rumen-protected Met (M) and

intramuscular injections of folic acid (B9) and vitamin B12 (B12) given to dairy cows on whole body glucose kinetics at 12 wk of lactation. 140

Tableau 11. Effects of dietary supplements of rumen-protected Met (M) and

intramuscular injections of folic acid (B9) and vitamin B12 (B12) given to dairy cows on whole body Met kinetics at 12 wk of lactation. 141

Tableau 12. Primer sequences and optimal conditions for PCR of bovine selected

genes. 171 Tableau 13. Effects of dietary supplements of rumen-protected methionine (M)

and intramuscular injections of folic acid (B9) and vitamin B12 (B12) given to dairy cows from 3 wk before calving to 16 wk of lactation on liver concentrations of B vitamins, lipid fractions and relative mRNA abundance of selected genes. 173

Tableau 14. In vitro estimation of the capacity of cow liver for gluconeogenesis

by the conversion of [2-14C]-propionate to glucose and protein synthesis by incorporation of [35S]-cysteine according to Met (M), folic acid (B9) and vitamin B12 (B12) supplements given from 3 wk before calving to 16 wk of lactation. 175

XVIII

LISTE DES ABRÉVIATIONS

(FRANÇAISES ET ANGLAISES)

AA Amino acid(s) ACP Acyl carrier protein ADF Acid detergent fiber AICAR Aminoimidazol-4-carboxamide ribonucléotide apABG Acétamidobenzoylglutamate ape Atom pourcent excess Apo B Apolipoprotein B BCAA Branched-chain amino acid(s) BHBA Beta-hydroxybutyrate BHMT Bétaïne homocystéine méthyltransférase B9-B12- Aucun supplément vitaminique B9+B12- Injections intramusculaires d’acide folique seul B9+B12+ Injections intramusculaires d’acide folique et de vitamine B12 CH2 Méthylène CH3 Méthyle CP Crude protein CPT Carnitine palmitoyltransférase Cys Cystéine DHF Dihydrofolate DMI Dry matter intake dTMP Désoxythymidylate dUTP Désoxyuridylate EAA Essential amino acid(s) FADP Fatty acid binding protein FBP Folate binding protein FMN Flavine mononucléotide FO Fractional rate of oxidation GCPIV Glutamate carboxypeptidase IV GAMT Guanidinoacetate N-méthyltransférase GAR Glycinamide ribonucléotide GC-MS Gaz chromatography-mass spectrometry γGH γ-glutamyl hydrolase Gly Glycine GNMT Glycine N-méthyltransférase GPAT Glycérol-3-phosphate déshydrogénase

XIX

Hcy Homocystéine IDL Intermediary density lipoprotein IGF-1 Insulin-like growth factor-1 ILR Irreversible loss rate IE Isotopic enrichment LDL Low density lipoprotein M- Pas de supplément de méthionine M+ Supplément alimentaire de méthionine Met Méthionine MMCoA Méthylmalonyl-CoA mutase MS Méthionine synthase MTHFR Méthylène tétrahydrofolate réductase NADPH Nicotinamide adénine dinucléotide phosphate NDF Neutral detergent fiber NEAA Non essential amino acids NEFA Non-esterified fatty acids PABA Acide p-aminobenzoïque pABG(n) Para-aminobenzoylpoly(ou mono)glutamate PC Phosphatidylcholine PE Phosphatidyléthanolamine PEMT Phosphatidyléthanolamine méthyltransférase PEPCK Phosphoénolpyruvate carboxykinase RFC Reduced folate carrier RM Reméthylation RPM Rumen-protected methionine SAH S-adénosylhomocystéine SAM S-adénosylméthionine Ser Sérine SHMT Sérine hydroxyméthyltransférase TAA Total amino acid(s) THF Tétrahydrofolate TM Transméthylation TMR Total mixed ration TS Transsulfuration U-glucose Glucose uniformément marqué VLDL Very low density lipoprotein

XX

5-MTHF 5-méthyl-tétrahydrofolate

CHAPITRE I

INTRODUCTION

2

Il y a 100 ans, les vaches produisaient assez de lait pour nourrir un veau, c’est-à-dire un

maximum de 2 à 10 litres par jour. Aujourd’hui, le nombre et la demande des consommateurs

ayant augmenté, la recherche de rentabilité et de la diminution de la charge de travail des

producteurs ont poussé les efforts en direction de la sélection génétique pour augmenter la

production par vache. Ainsi une vache laitière moderne produit beaucoup plus suite à une

sélection génétique et une modification des pratiques d’élevage (alimentation et gestion).

Veerkamp et al. (1998) rapportent que cette sélection génétique pour l’amélioration du rendement

en lait est corrélée à une augmentation de la prise alimentaire (coefficient de corrélation = 0.46 à

0,65). Cependant, ces auteurs soulignent que les corrélations génétiques entre le bilan énergétique

et le rendement en lait sont toujours très négatives (-0,70). Ainsi, l’amélioration du potentiel

génétique accentue le problème de déficit énergétique rencontré pendant la période critique

entourant le vêlage. Avec l’augmentation des performances des vaches laitières (+ 35% pour la

production laitière en 23 ans) et une prise alimentaire limitée (augmentation de seulement 19% de

1980 à 2003) (Figure 1), la densité énergétique des rations est augmentée afin de soutenir cette

hausse de production (l’énergie nette de lactation d’une ration a évolué, en moyenne, de 1,23 à

1,36 Mcal/kg de matière sèche ingérée) (Eastridge, 2006). De plus, de nombreuses études ces

dernières années ont cherché à optimiser la qualité de l’alimentation en équilibrant les rations

entre les fractions de protéines non dégradables et dégradables au rumen. Une attention

particulière a également été portée sur les sources de protéines afin, si besoin est, d’enrichir

l’alimentation en acides aminés essentiels, particulièrement, la méthionine et la lysine.

Même si la prise alimentaire augmente en début de lactation, elle atteint son maximum

après le pic de la production de lait. Face à l’incapacité d’ajuster assez vite leur métabolisme pour

subvenir à leurs besoins, les vaches se retrouvent donc en bilan d’énergie négatif pendant les

premiers mois après la parturition (Figure 2). Le bilan énergétique peut-être défini comme la

différence entre l’entrée d’énergie nette moins la dépense de cette énergie nette pour l’entretien et

la production laitière (Van Knelgsel et al., 2005). En d’autres termes, les animaux ne mangent pas

suffisamment pour pallier à cette demande énergétique, caractéristique des 15 semaines qui

suivent le vêlage (Coppock et al., 1974) alors que le pic de lactation se produit 4 à 8 semaines

après le vêlage.

3

Figure 1 : Évolution du rendement en lait ( ), de la prise alimentaire ( ) et de l’énergie nette de lactation ( ) de 1980 à 2003 (Adapté d’Eastridge, 2006).

Figure 2 : Production laitière, ingestion nette d’énergie et bilan énergétique des vaches laitières pendant la lactation (Adapté de Bauman et Currie, 1980).

40

30

20

10

0

-10 0 4 8 12 16 20 24 28 32 36 40 44

Semaines postpartum

Production laitière Ingestion nette d’énergie Bilan énergétique

kg/jour

Mcal/jour Mcal/jour

Prise alimentaire, kg/jour Energie nette de lactation, Mcal/jour Rendement en lait,

kg/lactation

Années

4

Durant le premier mois de lactation, un tiers des besoins énergétiques de la vache sont

fournis par les réserves adipeuses : pour chaque kilo de poids vif mobilisé, l’énergie disponible

permet la production de 7 kg de lait (Moe et al., 1971). Drackley et al. (2001) font également état

d’une activité métabolique du tissu hépatique doublée après la parturition qui accentuerait les

besoins énergétiques.

Même si les changements dans la condition corporelle durant la lactation sont normaux

chez les mammifères (Robinson, 1986), l’adaptation de leur métabolisme général et l’utilisation

de leurs réserves en début de lactation rendent les vaches plus susceptibles aux diverses maladies

métaboliques et à des problèmes de reproduction et fertilité (Butler et Smith, 1989). Des études

ont mis en évidence plusieurs relations significatives entre le bilan énergétique négatif, dû aux

rendements en lait élevés, et diverses pathologies : fourbures, problèmes de pattes, mammites et

désordres métaboliques tels que acétonémie, acidose ruminale ou déplacement de l’abomasum

(Collard et al., 2000).

Bauman et Currie (1980) insistent sur l’importance des lipides corporels pour améliorer

l’efficacité d’adaptation du métabolisme énergétique des ruminants pendant cette période où les

apports sont faibles et les exigences de production élevées. Par contre, ils soulignent également le

rôle clé des nutriments suivants : glucose, protéines et minéraux. L’implication des vitamines,

notamment des vitamines B9 et B12, dans le métabolisme énergétique se révèle aussi essentielle

car une supplémentation permettrait d’augmenter la production laitière (d’environ 10%) et

améliorerait l’efficacité d’utilisation des nutriments chez les vaches multipares (Girard et Matte,

1998; Girard et Matte, 2005a; Girard et al., 2005).

Face aux nouvelles exigences de production, les besoins en nutriments majeurs des vaches

laitières ont donc été révisés au cours des années (NRC, 1944 à 2001) tandis que ceux pour les

nutriments mineurs, tels que les vitamines, n’ont été que peu actualisés. Dans sa revue, Eastridge

(2006) rapporte que les principales recherches sur le rôle bénéfique des vitamines chez la vache

laitière depuis les années 1980 portent, pour la majorité, sur les vitamines E et D pour leur

implication dans les métabolismes du sélénium et du calcium respectivement et leur relation avec

les mammites (pour la vitamine E) et la fièvre du lait (pour la vitamine D). Les bénéfices d’une

supplémentation en bêta-carotène dans les phénomènes de reproduction ont été mitigés. Et enfin,

les études sur les vitamines hydrosolubles ont mis l’accent surtout sur la niacine, qui préviendrait

5

l’acétonémie, et la biotine, qui améliorerait la santé des sabots et la production laitière (Majee et

al., 2003). Bien que ne répondant pas à la définition stricte des vitamines, la choline est

considérée comme une quasi-vitamine (Comb, 1998). D’ailleurs, de nombreux travaux, utilisant

de la choline protégée de la dégradation ruminale, rapportent qu’une supplémentation pourrait

augmenter la production laitière, améliorer le transport des lipides et réduire l’incidence de

acétonémie (Piepenbrink et Overton, 2003; Baldi and Pinotti, 2006; Janovick Guretzky et al.,

2006). Mais peu de recherches se sont intéressées aux besoins en acide folique et vitamine B12

pour les vaches laitières hautes productrices.

Le but de la présente thèse a été d’apporter de nouvelles informations sur les effets, d’une

part, d’un apport en vitamine B9 sur les performances de lactation chez la vache laitière en début

de lactation et, d’autre part, d’identifier les voies métaboliques impliquées en modifiant les

apports en vitamine B12 et méthionine.

La revue bibliographique présentée dans ce rapport décrit les grandes voies des

métabolismes du glucose, des lipides et des protéines pouvant être régulées directement ou non

par l’acide folique et la vitamine B12. Elle souligne aussi les interactions entre ces vitamines B et

la méthionine chez la vache laitière. Le protocole d’étude suivi au cours de cette thèse ainsi que

les résultats obtenus sont présentés sous forme de trois publications. Enfin, les conclusions tirées

de ces travaux sont rassemblées sous la forme d’une discussion générale.

6

CHAPITRE II

REVUE DES TRAVAUX ANTÉRIEURS

7

II-1 LE GLUCOSE

II-1.1 Absorption intestinale

L’absorption du glucose est limitée chez les ruminants (moins de 10% des besoins). Ces

animaux doivent donc produire 90% du glucose qui leur est nécessaire via la néoglucogenèse au

niveau hépatique (Young, 1977).

En effet, seulement 20% de l’amidon atteint intact le duodénum où il va être absorbé

principalement sous forme de glucose (Nocek et Tamminga, 1991). Seulement 35% de la

disparition intestinale de l’amidon peut être expliquée par une absorption nette sous forme de

glucose (Kreikemeier et al., 1991). De plus, l’utilisation par les entérocytes d’environ 50% du

glucose absorbé comme source d’énergie (Britton et Krehbiel, 1993; Lozano et al., 2000)

contribue à restreindre la quantité de glucose apparaissant dans le sang portal. Par contre, selon

Judson et al. (1968), le pourcentage de glucose, synthétisé à partir du propionate ruminal,

diminuerait de 46 à 27% avec l’augmentation des proportions d’amidon alimentaire dans la

ration. Avec des rations riches en grains, une certaine quantité d’amidon, échappant à la

dégradation ruminale, se traduirait par une augmentation de l’absorption intestinale de glucose

qui, par conséquent, réduirait la néoglucogenèse hépatique à partir du propionate. Cette

observation a été confirmée plus récemment (Freetly et Klindt, 1996) et serait régulée suite à une

sécrétion d’insuline (Eisemann et al., 1994) et due à des changements métaboliques induits par

une réorientation des précurseurs néoglucogéniques vers la synthèse des lipides (Thompson et al.,

1975).

II-1.2 La néoglucogenèse:

La néoglucogenèse consiste en une série de réactions biochimiques visant à la synthèse de

glucose à partir de composés non-glucidiques. Les substrats néoglucoformateurs les plus

importants sont le propionate, le lactate, le glycérol et certains acides aminés. La majeure partie

du glucose néoformé (85-90%) est synthétisée dans le foie et les 10-15% restants dans les reins.

Cette voie métabolique est très importante chez les ruminants car les glucides de l’alimentation

sont intensément dégradés par les microorganismes du rumen et leur taux d’absorption intestinal

est faible. Elle assure donc la production de 2 à 2,5 kg de glucose/jour (Danfaer et al., 1995).

8

II-1.2.1 Réactions enzymatiques

La voie principale de la néoglucogenèse est essentiellement l’inverse de la glycolyse sauf

au niveau de trois réactions de la glycolyse qui sont irréversibles : la glucokinase, la

phosphofructokinase et la pyruvate kinase. Pour contourner ces difficultés, la cellule hépatique va

donc faire appel à d’autres réactions thermodynamiquement plus favorables avec la coopération

des mitochondries. En effet, dans les mitochondries, une enzyme, la pyruvate carboxylase, peut,

en présence d’ATP, de CO2 et de biotine, carboxyler le pyruvate en oxaloacétate. Ce dernier va

soit sortir de la mitochondrie en étant réduit en malate, soit suivre le cycle de Krebs.

L’oxaloacétate cytosolique va être successivement transformé en phosphoénolpyruvate,

phosphoglycérate, glycéraldéhyde et fructose-1,6-bisphosphate par des enzymes communes aux

voies glycolytique et de la néoglucogenèse (réactions réversibles). A ce niveau la fructose-1,6-

bisphophatase, enzyme spécifique de la néoglucogenèse, catalyse la conversion du fructose-1,6-

bisphosphate en fructose-6-phosphate qui est ensuite isomérisé en glucose-6-phosphate. Enfin, la

déphosphorylation du glucose-6-phosphate en glucose fait intervenir une troisième enzyme

spécifique : glucose-6-phosphatase (Figure 3).

II-1.2.2 Contrôle à court et moyen termes

La glycolyse et la néoglucogenèse sont deux voies essentielles dans l’homéostasie de la

glycémie, il n’est donc pas étonnant que ces deux voies soient étroitement régulées de telle sorte

que l’une est inhibée lorsque l’autre est active et vice versa (Voet et Voet, 1998). Elles font donc

l’objet de régulations hormonales à court terme (biodisponibilité en substrat, effecteurs

allostériques et changement de l’état de phosphorylation) et à plus long terme (changement dans

l’expression des gènes codants pour les différents enzymes) (Pilkis et Claus, 1991).

9

Figure 3 : Réactions enzymatiques de la néoglucogenèse (à gauche et en rouge) et de la glycolyse (à droite et en bleu). La flèche hachurée indiquant une activation de l’enzyme (Adapté des notes de cours « Nutrition et physiologie des ruminants » de Yvan Chouinard).

Glucose

Glucose-6-P

Pi

H2O

ATP

ADPGlucose-6-Phosphatase Glucokinase

Fructose-6-P

Fructose-1,6-BP

Pi

H2O

ATP

ADP Fructose-1,6-Bisphosphatase Phosphofructokinase

Glycéraldéhyde-3-P Dihydroxyacétone-P NAD+

NADH+H+NAD+

NADH+H

Glycérol-3-P1,3-bisphosphoglycérate

Glycérokinase

3-phosphoglycérate

2-phosphoglycérate

phosphoénolpyruvate

Pyruvate

Oxaloacétate

Pyruvate kinase

Lactate, acides amines (alanine)

Glycérol

NADH+H+ NAD+

ADP + Pi

ATP + CO2

B8 / Mg+2

ATP

ADP

ATP

ADP

ATP

ADP

Pyruvate carboxylase

Acides amines : aspartate

α-cétoglutarate Malate

Fumarate Succinyl-CoA

Cycle de

Krebs

Acides amines : glutamate

MITOCHONDRIE CYTOSOL

Acétyl-CoANAD+

NADH+H+

Propionate

Malate

Oxaloacétate

NAD+

NADH+H+

GTP GDP+CO2

Phosphoénolpyruvate carboxykinase

Acides aminés : phénylalanine, tyrosine

Acides aminés : isoleucine, méthionine, valine

Acétyl-CoA

Pyruvate

10

Le contrôle hormonal de l’homéostasie du glucose a fait l’objet de nombreuses études

(Bassett, 1978; Trenkle, 1981; McDowell, 1983; Drackley et al., 2001) où il ressort que le rapport

insuline/glucagon joue un rôle primordial alors que les autres hormones, telles que l’hormone de

croissance, les catécholamines et les glucocorticoïdes, interviendraient indirectement en modulant

les concentrations d’insuline et de glucagon. Il est bien connu que ces hormones inhibent la

néoglucogenèse pour l’insuline alors que le glucagon a l’effet contraire en agissant sur la

transcription des gènes codants pour les enzymes impliquées dans ces phénomènes, en améliorant

la stabilité des messagers et/ou l’efficacité de traduction des ARNm (Lemaigre et Rousseau,

1994). Des études comparatives ont montré que l’activité des enzymes néoglucogéniques du foie

de ruminants répondaient différemment à celles mesurées chez les non-ruminants (Filsell et al.,

1969). Chez les ruminants, la régulation hormonale du métabolisme du glucose a été beaucoup

moins documentée que chez les monogastriques et se restreint à l’analyse de la pyruvate

carboxylase (PC) et de la phosphoénolpyruvate carboxykinase (PEPCK) (Taylor et al., 1971; She

et al., 1999; Greenfield et al., 2000; Williams et al., 2006). Globalement chez les bovins, il y

aurait peu d’adaptation de l’expression de ces enzymes à différentes conditions physiologiques

(jeûne, alimentation basée sur les concentrés ou seulement avec du foin) (Young et al., 1969).

Young (1977) suggère alors que la nécessité de maintenir une activité néoglucogénique

importante, pour répondre aux besoins constants en glucose de ces animaux, leur évite de

développer des stratégies pour faire fluctuer l’activité de ces enzymes impliquées dans le

processus de la néoglucogenèse.

II-1.2.3 Les substrats néoglucoformateurs

Tous les composants du cycle de Krebs ont un potentiel néoglucogénique. Pour évaluer ce

potentiel, la plupart des études utilisent les techniques in vivo d’infusion de composés marqués au

niveau ruminal ou intraveineux (Danfaer et al., 1995).

Le propionate :

Dans le cas du propionate, il doit tout d’abord être activé en propionyl-CoA grâce à une

thiokinase. Par la suite le propionyl-CoA est carboxylé pour former le D-méthylmalonyl-CoA en

présence de l’enzyme propionyl-CoA carboxylase, de la biotine et de l’ATP. Le D-

11

méthylmalonyl-CoA est transformé en son stéréoisomère, le L-méthylmalonyl-CoA avant son

isomérisation finale en succinyl-CoA. Cette dernière réaction requiert la vitamine B12 comme

coenzyme dont une carence peut entraîner une excrétion accrue de méthylmalonate. Le succinyl-

CoA entre dans le cycle de Krebs pour finalement former du glucose via la néoglucogenèse

(Bergman, 1990; Figure 4).

Figure 4 : Voie métabolique empruntée par le propionate pour permettre la synthèse de glucose via la néoglucogenèse (Tiré de Voet et Voet, 1998).

La plupart des études, qui ont estimé la contribution du propionate à la synthèse de

glucose, ont utilisé la technique de transfert isotopique de composés marqués au 14C. Cette

technique a été critiquée car la conversion du propionate en glucose serait sous-estimée. En effet,

dans le foie, le propionate est métabolisé en oxaloacétate qui ne formera pas seulement du

glucose mais peut être oxydé dans le cycle de Krebs. Une fois dans le cycle, l’oxaloacétate se

combine avec l’acétyl-CoA pour former du citrate qui va perdre deux carbones sous forme de

CO2 pour régénérer l’oxaloacétate. Les 14C perdus sous forme de CO2 peuvent être remplacés

par des 12C en fonction du nombre de « tours » que les intermédiaires vont faire dans le cycle de

Krebs. Le suivi des carbones marqué est donc complexe du fait d’un possible effet de dilution de

l'isotope (Wiltrout et Satter, 1972). C’est pourquoi, des études plus récentes rapportent, qu’après

correction de cette sous-estimation, le propionate pourrait produire jusqu’à 75% des besoins en

glucose chez les ruminants (Bergman, 1990).

12

Le lactate :

Le lactate dérive des fermentations ruminales, du métabolisme des parois du tractus

digestif et du métabolisme musculaire. Il est premièrement transformé en pyruvate dans le

cytosol. Ce dernier pénètre dans la mitochondrie où il est carboxylé en oxaloacétate.

L’oxaloacétate suit toutes les transformations indiquées lors de la néoglucogenèse jusqu’à sa

transformation finale en glucose. Malgré un nombre limité d’études, il apparaîtrait que le

pourcentage de contribution du lactate au flux de glucose serait de l’ordre de 10 à 20% (Danfaer

et al., 1995) et plus faible en début de lactation qu’en fin de gestation (Baird et al., 1983).

Les acides aminés :

Après transamination ou désamination, les acides aminés glucoformateurs forment soit du

pyruvate, soit des composés du cycle de Krebs. Mais la contribution des acides aminés à la

néoglucogenèse varie de 11 à 30% selon le statut nutritionnel et physiologique de l’animal (Wolff

et Bergman, 1972). Reilly et Ford (1971), ayant infusé, en intraveineux, un mélange d’acides

aminés marqués au C14, ont observé que la production de glucose est directement corrélée avec

l’ingestion des protéines alimentaires et le taux d’apport des acides aminés au foie. En accord

avec ces résultats, Bell (1995) rapporte que le muscle squelettique peut servir de réserves

d’acides aminés qui sont mobilisés et acheminés jusqu’au foie pour supporter la néoglucogenèse

lorsque celle-ci est augmentée, par exemple, en début de lactation chez la vache laitière. Le

pouvoir glucoformateur diffère d’un acide aminé à l’autre : l’alanine, le glutamate, l’aspartate et

la glycine se révèlent être les plus efficaces (Wolff et Bergman, 1972) alors que la lysine et la

leucine sont les seuls acides aminés à n’avoir aucun potentiel néoglucogénique.

Le glycérol :

Enfin, lorsque les animaux sont à jeun ou durant une carence énergétique, l’activité

néoglucogénique du glycérol devient importante car celui-ci est libéré à partir des réserves

lipidiques. Le glycérol est d’abord activé en glycérol-3-phosphate par une glycérokinase et de

l’ATP. Le glycérol-3-phosphate est ensuite oxydé en dihydroxyacétone-phosphate qui réagit avec

le glycéraldéhyde-3-phosphate pour former le fructose-1,6-bisphosphate, lequel sera

éventuellement transformé en glucose. Le glycérol peut fournir, s’il est utilisé en totalité pour la

13

néoglucogenèse, 15 à 20% de la demande en glucose dans la période péri-vêlage (Bell, 1995). Il

est évident que l’apport et le potentiel néoglucogénique du glycérol sont dépendants de la

quantité de tissu adipeux mobilisé.

Le lactate, le glycérol et les acides aminés contribuent pour un plus grand pourcentage à

la synthèse de glucose par la néoglucogenèse quand la prise alimentaire ou la disponibilité du

propionate diminuent (Lomax et Baird, 1983; Greenfield et al., 2000). En effet, Overton et al.

(1999) ont montré que le métabolisme énergétique réagissait à ces situations de stress en

augmentant le potentiel néoglucoformateur des acides aminés et notamment de l’alanine

d’environ 60%. Cette étude a été réalisée en utilisant comme modèle des béliers castrés injectés

avec de la phlorizine pour mimer la forte demande en glucose en début de lactation (Overton et

al., 1998). L’utilisation hépatique de ces précurseurs de glucose est plus influencée par le

glucagon et l’insuline que ne l’est le propionate (Bell et Bauman, 1997).

II-1.2.4 Adaptation du métabolisme lors de la période péripartum

Chez la brebis, l’initiation de la lactation augmente la néoglucogenèse hépatique à partir

du propionate de 60% (Wilson et al., 1983). La demande estimée en glucose pour les vaches

Holstein est de 1000 à 1100 g/jour durant les 21 derniers jours de gestation mais augmente à

environ 2500 g/jour à 21 jours post-partum (Drackley et al., 2001). L’initiation de la lactation

augmente non seulement la demande pour la néoglucogenèse mais aussi l’épargne du glucose en

diminuant son oxydation et en favorisant l’utilisation d’autres composés pour satisfaire les

besoins énergétiques. En période pré-vêlage, 34% du glucose sont oxydés en CO2, alors qu’à 7

jours de lactation, l’oxydation de ce nutriment est réduite à seulement 8 à 9% (Bennink et al.,

1972) car le flux de glucose est principalement orienté vers la glande mammaire pour la

production de lait. De plus, l’oxydation dans les tissus tels que les reins, le cœur et les muscles

squelettiques de l’acétate, dérivé de la fermentation ruminale, et du 3-hydroxybutyrate, produit de

l’hydroxylation du butyrate dans l’épithélium ruminal, permet d’épargner du glucose. Ces

produits de fermentation sont également des sources importantes de carbone et de NADPH (par

la voie de l’isocitrate déshydrogénase extra-mitochondriale) pour la lipogenèse dans le tissu

adipeux et la glande mammaire (Bergman, 1990; Lindsay, 1979).

14

En général, l’augmentation de la prise alimentaire augmente la disponibilité des substrats

néoglucoformateurs qui, à leur tour, stimulent la néoglucogenèse (Danfaer et al., 1995). Le

décalage, existant entre l’apport et la demande en nutriments au début de la lactation

particulièrement chez les vaches laitières (Bell, 1995), ne permet pas une synthèse ruminale

suffisante en propionate, substrat majoritaire pour la néoglucogenèse. Il est donc évident que pour

soutenir cette forte demande métabolique en glucose, la contribution des acides aminés (10 à

30%), du lactate (environ 15%) et du glycérol est essentiel (Drackley et al., 2001). Il est

intéressant de noter que le lactate et le glycérol, d’origine endogène, sont dérivés du glucose donc

leur contribution pour la néoglucogenèse ne représente pas un apport net de glucose. Ce qui

signifie que, dans les situations de déficit énergétique prolongé où la prise alimentaire est limitée,

comme en début de lactation, les vaches vont utiliser majoritairement les acides aminés,

mobilisés des protéines corporelles, pour augmenter leur production nette de glucose (Danfaer et

al., 1995).

II-1.2.5 Méthodologies de mesure de la néoglucogenèse

II-1.2.5.1 Méthodes in vitro et in vivo

Le processus de néoglucogenèse a été étudié in vitro à différents niveaux : enzymatique,

cellulaire, tissulaire et corporel. Les techniques de biopsies tissulaires à l’aide d’un trocart se sont

largement développées et, maintenant, guidées par échographie, présentent peu de risque pour

l’animal. Les biopsies deviennent alors avantageuses car elles permettent de réaliser des

prélèvements en série à différents temps sur un même animal sans avoir à le sacrifier quoique les

quantités d’échantillon pouvant être prélevées soient limitées. La culture in vitro des tissus

prélevés a été développée (Donkin et Armentano, 1993) en ajoutant au milieu d’incubation des

composés radioactifs (propionate, lactate, acides aminés) permettant ainsi de mesurer leur

contribution dans la synthèse de glucose (Overton et al., 1999; Williams et al., 2006). Toutefois,

cette méthode reste variable du fait de l’hétérogénéité des biopsies hépatiques extraites et les

nombreux intermédiaires formés entre les composés radioactifs initiaux et le glucose pourraient

être un biais à l’estimation de la néoglucogenèse à cause d’une perte potentielle de notre

marquage.

15

Les méthodes, permettant de quantifier in vivo la néoglucogenèse, requièrent l’utilisation

de glucose ou différents précurseurs néoglucogéniques (propionate, acides aminés, lactate)

possédant un ou plusieurs isotopes, radioactifs ou stables (Coggan, 1999). Selon le type

d’isotopes utilisés, la quantification se fait différemment (Wolfe, 1992). Dans le cas des isotopes

stables, qui sont les plus couramment utilisés, différents paramètres sont à déterminer :

- le type d’infusion

- l’isotope à suivre et sa position sur la molécule d’intérêt

- l’intervalle entre chaque prélèvement sanguin

- et enfin, l’analyse pour calculer l’enrichissement isotopique qui correspond à la différence

entre l’abondance isotopique engendrée par la perfusion et l’abondance isotopique de base

définie avant le début de la perfusion (Wolfe, 1992).

Il est important de noter que chaque modèle de cinétique du glucose incorpore des postulats

spécifiques qui sont liés au marquage de la molécule et de l’objectif spécifique des cinétiques

investiguées.

II-1.2.5.2 Définition des concepts pour les mesures de métabolisme

Quels que soient les paramètres choisis, certaines conditions idéales devraient être

respectées. En premier lieu, le glucose ou autres molécules traceurs ne doivent pas être

biologiquement discriminées de la substance tracée ni affecter le métabolisme de cette dernière

(Wolfe, 1992). Également, le maintien d’un état métabolique stable, c’est-à-dire que la taille

du(des) compartiment(s) choisi(s) ainsi que le taux d’entrée et de sortie demeurent constants

durant la période de mesure, est essentiel pour la validité de cette méthode. Cet état peut être

atteint en alimentant les animaux régulièrement toutes les heures (Waterlow et al., 1978). Le

traceur ne doit pas être recyclé durant la période expérimentale. La durée de la perfusion est

critique. Une durée moyenne inférieure à six heures minimise la réintroduction du traceur dans le

compartiment étudié (Wolfe, 1992), dépendemment du taux de perfusion utilisé ainsi que du

marquage isotopique sélectioné. Enfin, les sites d’infusion et d’échantillonnage doivent être

situés de façon à refléter l’enrichissement isotopique suivant un mélange parfait « traceur-tracé ».

Un compartiment d’un nutriment de petite taille permet l’atteinte rapide de l’équilibre isotopique

(Waterlow et al., 1978). Bien que ne remplissant pas complètement ces conditions, le sang et le

16

plasma sont souvent utilisés comme voie d’accès au « compartiment central » à cause de leur

accessibilité et de leur représentativité du métabolisme de l’organisme entier, i.e. la somme de

tous les tissus de l’organisme.

Cette méthode, par laquelle le métabolisme du glucose est calculé à partir de la dilution

du métabolite marqué, repose sur le concept des pertes irréversibles (Waterlow et al., 1978). Les

pertes irréversibles représentent la somme de toutes les voies de disparition du traceur du

compartiment plasmatique, soit les pertes oxydatives (incluant la formation de métabolites

dérivés du glucose), la glycolyse et la synthèse de divers produits dont le lactose. Ces pertes sont

aussi égales à la somme de toutes les voies d’entrée dans le compartiment : l’absorption, la

dégradation du glycogène et la néoglucogenèse (Wolfe, 1992).

L’approche méthodologique de perfusion continue lors d’un métabolisme stable permet le

prélèvement d’échantillons de façon répétée sans nécessiter l’abattage des animaux. Par contre la

quantité de traceur nécessaire peut rendre cette méthode onéreuse pour les animaux de grande

taille.

II-1.2.5.3 Les différents types d’infusion

Les pertes irréversibles du glucose se déterminent par la mesure de la dilution isotopique

dans le compartiment plasmatique du glucose traceur, qui peut être administré par injection

unique d’une dose ou par infusion constante précédée ou non par une dose d’amorçage

(Waterlow et al., 1978).

Avec une injection unique, la disparition du glucose traceur du compartiment plasmatique

suit plusieurs fonctions exponentielles dont la description doit se faire de façon précise (Wolfe,

1992) afin de calculer les pertes irréversibles du traceur. Cette technique requiert donc le

prélèvement de nombreux échantillons de sang jusqu’au moment où le traceur injecté ait

totalement disparu. Ces mesures répétées permettent d’intégrer l’aire sous la courbe de

l’enrichissement isotopique (Waterlow et al., 1978). Les pertes irréversibles du glucose sont

calculées en divisant la quantité de traceur injecté par l’intégration de l’aire sous la courbe

(Waterlow et al., 1978). Ce mode d’administration permet de recueillir des informations relatives

au volume de distribution, au nombre de compartiments et de la valeur k « rate transfer ».

Contrairement aux infusions continues, les calculs requis sont complexes et l’oxydation du

glucose ne peut être estimée (Wolfe, 1992).

17

La méthode d’infusion constante de glucose traceur par voie intraveineuse est

fréquemment préférée pour sa simplicité technique et mathématique. Ce mode d’administration

permet l’atteinte d’un équilibre isotopique quasi-stable dans le compartiment étudié (central ou

tissulaire). La vitesse d’atteinte de ce plateau est fonction du taux de renouvellement et de la taille

du compartiment et peut être accélérée par l’injection d’une dose d’amorçage (Wolfe, 1992). La

valeur d’enrichissement isotopique atteinte à l’équilibre n’est pas affectée par la dose d’amorçage

administrée (Wolfe, 1992). A l’équilibre, la quantité de glucose marqué quittant le compartiment

de façon irréversible est égale à la quantité entrant (quantité de traceur infusé). Une fois cette

condition remplie, des échantillons sanguins sont prélevés à intervalle fixe pour déterminer

l’enrichissement isotopique permettant, en final, de calculer les pertes irréversibles du glucose.

Celles-ci sont calculées en divisant le taux d’infusion par l’enrichissement isotopique (Wolfe,

1992).

II-1.2.5.4 Choix de la méthode d’analyse et de l’isotope

Dans sa revue Young (1977) insiste sur le fait que le choix de la méthode d’administration

s’effectue en fonction des variables à évaluer. En effet, White et al. (1969) soulignent, qu’à partir

des données issues d’injections uniques, il est possible d’estimer, à 2 ou 3, le nombre de

compartiments dans lesquels se répartit notre métabolite d’intérêt.

Un autre facteur à prendre en compte concerne le type de marquage isotopique utilisé. Le

marquage du glucose offre des possibilités multiples. Des isotopes stables (13C, 2H, 18O) ou

radioactifs (14C, 3H) peuvent être utilisés, et ce, en différentes positions (Coggan, 1999). Le choix

de la molécule marquée à infuser se fait en fonction des objectifs spécifiques du projet de

recherche (et des fonds disponibles). En effet, ces différentes options sont aussi porteuses de

problèmes majeurs auxquels nous sommes confrontés soit :

- le recyclage des carbones marqués dans les composés à trois carbones et la fixation de 13CO2 dans les intermédiaires du cycle de Krebs et qui peuvent revenir sous forme de

glucose par la voie de la néoglucogenèse.

- et les pertes/échanges de deutériums/hydrogènes au cours des processus de

néoglucogenèse et de glycolyse.

18

Les sites, où les pertes de 2H ou 3H sont les plus importantes, se situent au niveau de la

phosphoglucose isomérase (glucose-6-phosphate en fructose-6-phosphate), l’aldolase (fructose-

1,6-biphosphate en glycéraldéhyde-3-phosphate et dihydroacétone phosphate), la pyruvate

carboxylase (pyruvate en oxaloacétate) et dans le cycle de Krebs (malate en fumarate) (Wolfe,

1992). Donc l’utilisation de glucose uniformément marqué avec des carbones treize ([U-13C]glucose) est une alternative plus coûteuse mais permet de réduire certains de ces problèmes

de dilution isotopique tout en mesurant les pertes irréversibles et certaines voies métaboliques du

glucose dont la néoglucogenèse. Comme illustré et détaillé dans le chapitre III, une des difficultés

avec ce type de marquage, c’est que l’activité métabolique suite à une infusion de [U-13C]glucose, enrichi de 6 unités de masse (M+6) par rapport au glucose naturel, conduit à la

formation de glucose de masses isotopiques variées allant de M+1 à M+6 (Wolfe, 1992). Les

isotopomères allant de M+1 à M+5 sont utilisés dans le modèle pour estimer la néoglucogenèse

mais leurs enrichissements isotopiques faibles rendent souvent impossible l’estimation de cette

voie métabolique. L’approche pour réduire la perte de précision de la mesure de la

néoglucogenèse est d’utiliser un taux de perfusion plus élevé afin d’éviter des faibles

enrichissements isotopiques des masses M+1 à M+5, qui peuvent atteindre des valeurs près du

seuil de détection des GC-MS si le taux de perfusion est inadéquat (Haymond et Sunehag, 2000).

Par contre, lorsque des perfusions de traceurs sont pratiquées à des taux élevés pour atteindre des

enrichissements isotopiques supérieurs dans les isotopomères, le postulat de perfusion à des doses

traces est compromis et la pharmacodynamique du nutriment peut être altérée par

l’administration de l’isotope.

II-1.3 Utilisation du glucose :

L’importance de la néoglucogenèse hépatique est indéniable. Chez les vaches laitières

hautes productrices en gestation, les besoins en glucose sont 4 fois plus importants que chez leurs

analogues non-gestantes (Bell et Bauman, 1997) et ces besoins sont encore multipliés par 2,5

quelques jours après le vêlage (Bell, 1995). Ces impératifs mènent à une évolution du

métabolisme du glucose dans les différents tissus de l’organisme qui régulent et réorientent

l’apport et l’utilisation de ce nutriment vers le fœtus et la glande mammaire (Bell et Bauman,

1997).

19

II-1.3.1 Source de glycérol et d’énergie

A la différence des monogastriques (Balmain et al., 1954), le glucose n’est pas le substrat

préférentiel pour la lipogenèse chez les ruminants même si, comme le souligne Smith (1971), le

glucose est une source de glycérol et, suite à son oxydation par la voie des pentoses-phosphates,

peut fournir une partie des NADPH nécessaires pour la synthèse des acides gras (Figure 5).

Figure 5 : Utilisation du glucose dans la voie des pentoses-phosphates permettant de fournir du NADPH (G-6-P, glucose-6-phosphate; 6-P-glucolactone, 6-phospho-glucolactone; 6-P-gluconate, 6-phospho-gluconate; Ru-5-P, Ribulose-5-phosphate) (Tiré de Voet et Voet, 1998).

Le glucose reste une source d’énergie cellulaire indispensable pour le système nerveux et les

érythocytes via son oxydation (Lindsay, 1979; Figure 3).

II-1.3.2 La synthèse de lactose

La lactation est probablement l’activité physiologique ayant besoin de l’apport le plus

élevé en glucose, la synthèse de lactose étant responsable de l’utilisation d’environ 60% du

glucose disponible. Le lactose est le soluté osmorégulateur le plus important du lait donc la

quantité de lactose va déterminer le volume de lait sécrété en attirant l’eau dans le lait (Linzell,

1972). Le reste forme le glycérol des triglycérides ou est oxydé en CO2 (Lindsay, 1971). Les

besoins de glucose pour la production de lait peuvent être évalués selon une captation nette par la

glande mammaire de 0,35-0,40 moles de glucose par kilogramme de lait produit (Danfaer et al.,

1995). Danfaer et al. (1995) ont analysé la relation entre la production laitière (kg/jour) et le flux

de glucose (moles/jour) à partir de 11 études tirées de la littérature. L’analyse par régression

Glucunolactonase

6-P-gluconolactose G-6-P

G-6-P DH

6-P-gluconate

6-P-gluconate

DH

Ru-5-P

20

reflète une étroite relation linéaire (R2 = 0,95) selon l’équation suivante : y = (x – 1,64) / 0,396 où

y et x représentent la production laitière et le flux de glucose, respectivement.

L’utilisation mammaire du glucose a été démontrée dans une étude in vivo sur des chèvres

(Chaiyabutr et al., 1980). Des 83% du [U-14C]glucose, pris par la glande mammaire, 75% ont été

utilisés pour la synthèse de lactose. Les auteurs quantifient d’autres utilisations métaboliques du

glucose : 4.5% pour la synthèse du glycérol et 4% sont oxydés en CO2. Ils estiment également

qu’un tiers du NADPH, nécessaire à la synthèse de novo des acides gras dans la glande

mammaire, provient de la dégradation du glucose via la voie des pentoses-phosphates (Figure 6).

Figure 6 : Utilisation du glucose dans la glande mammaire bovine (Adapté des valeurs tirées de Chaiyabutr et al., 1980).

II-2 LES LIPIDES

II-2.1 Métabolisme des lipides

II-2.1.1 Origine des acides gras

Les principaux sites de métabolisme des acides gras durant la lactation sont le foie, le

tissu adipeux et la glande mammaire. Les acides gras non-estérifiés plasmatiques peuvent être

soit issus d’une synthèse de novo, soit d’une mobilisation des réserves lipidiques et transportés

par l’albumine ou circulants dans les lipoprotéines (Bauman et Griinari, 2003).

60 à 70% pour la synthèse de lactose

20 à 30% pour la voie des pentoses-phosphate

4,5% pour la synthèse de glycérol

3% pour la génération d’énergie

21

II-2.1.1.1 La synthèse de novo

Cette biosynthèse nécessite deux éléments : une source d’acétyl-CoA et un pouvoir

réducteur sous forme de NADPH. Contrairement aux monogastriques, le principal précurseur

d’acétyl-CoA, chez les ruminants, n’est pas le glucose mais l’acétate ou le β-hydroxybutyrate

(Neville et Picciano, 1997; Bauman et Griinari, 2003).

L’importance de la contribution des corps cétoniques, acétoacétate et β-hydroxybutyrate,

au métabolisme reste une spécificité des ruminants. Ces corps cétoniques peuvent être soit

produits au niveau de l’épithélium ruminal (butyrate → β-hydroxybutyrate et acétate →

acétoacétate) (Weigand et al., 1975), soit au niveau hépatique à partir de l’acétyl-CoA dérivé de

la β-oxydation des acides gras (acides gras → acétyl-CoA → acétoacétate → β-hydroxybutyrate)

(Heitmann et al., 1987; Zammit, 1990). De la même façon que l’acétate, 87% des corps

cétoniques utilisés sont oxydés en CO2 par de nombreux tissus permettant ainsi d’épargner du

glucose (Pethick et Lindsay, 1982). Mais dès les années 1940, des chercheurs ont découvert

l’existence d’une différence artério-veineuse de β-hydroxybutyrate à travers la glande mammaire

lors de la lactation chez la vache (2,49 mg / 100 mL de plasma; Shaw et Knodt, 1941) et la

chèvre (3,72 mg / 100 mL de plasma; Barry et al., 1963). Linzell et al. (1967) a démontré que le

β-hydroxybutyrate et l’acétate sont captés par la glande mammaire et utilisés comme précurseurs

pour la synthèse des acides gras à chaîne courte du lait (Kumar et al., 1965). Selon ces derniers

auteurs, près de 60% des 4 carbones du β-hydroxybutyrate seraient directement incorporés dans

les acides gras C4, C8 et C12. Tandis que les 40% restants seraient scindés en unités à 2 carbones

qui seraient utilisées de la même façon que l’acétate avec une préférence pour l’extrémité

carboxyl selon Kumar et al. (1959) (Popjak et al., 1951; Palmquist et al., 1969). A partir de cette

« amorce », l’élongation peut commencer grâce à l’apport de NADPH (provenant du cycle des

pentoses-phosphate), à l’acétyl-CoA carboxylase et l’acide gras synthétase (Vernon, 2005; Figure

7). La première enzyme catalyse la carboxylation de l’acétyl-CoA en malonyl-CoA. Cette étape

est limitante dans la synthèse des acides gras d’où le fait que l’acétyl-CoA carboxylase soit

hautement régulée à différents niveaux : transcriptionnel, traductionnel et par phosphorylation

(Kim, 1997; Tong, 2005). Après la formation de malonyl-CoA, l’acide gras synthétase condense

entre elles les unités à deux carbones jusqu’à l’obtention de chaînes à 16 atomes de carbone. Le

complexe enzymatique de l’acide gras synthase possède une déacylase, thioestérase I, qui termine

l’élongation de la chaîne d’acides gras à 16 carbones en coupant le lien thioester entre l’acide

22

gras et l’ACP (Acyl Carrier Protein). Chez les ruminants, la glande mammaire possède une

deuxième thioestérase, thioestérase II, ayant la capacité de libérer des acides gras à chaîne courte

ou moyenne (Neville et Picciano, 1997). Cette enzyme est responsable de la capacité de la glande

mammaire à synthétiser des acides gras à courtes et moyennes chaînes (4 à 14 carbones)

caractéristiques du gras du lait (Dils, 1986).

Mellenberger et al. (1973) ont démontré que dans le tissu mammaire de vache en période

péripartum, la synthèse d’acides gras à partir de l’acétate augmente avec la lactation. En effet, ils

notent une amélioration de 26, 9 et 35% de l’activité de l’acétyl-CoA synthétase, l’acétyl-CoA

carboxylase et de l’acide gras synthétase entre -7 et +7 jours de lactation respectivement. Ces

mêmes auteurs ont également constaté que dans le profil d’acides gras du lait, les acides gras à

chaîne courte-moyenne (C6 à C12), issus de la synthèse de novo, augmentent significativement

pendant la même période alors que les acides gras à longue chaîne (C14 à C18), d’origine

alimentaire, diminuent.

II-2.1.1.2 Les lipoprotéines

Le transport des lipides aux différents tissus de l’organisme se fait comme chez les

monogastriques grâce aux différentes lipoprotéines. Les chylomicrons et les VLDL (Very Low

Density Lipoprotein) sont des particules riches en triglycérides qui doivent transporter les lipides

alimentaires aux tissus périphériques. La répartition des lipides dans l'une ou l'autre de ces

lipoprotéines varie selon le degré d'insaturation des acides gras présents dans l'alimentation

(Bauchart et al., 1996).

Ces particules sont rapidement métabolisées par la lipoprotéine lipase, enzyme qui est

accrochée à la surface de la membrane cellulaire des capillaires et de nombreux autres tissus.

L’hydrolyse des triglycérides génère des acides gras libres qui vont alors être disponibles pour

différents tissus : tissu adipeux, pour le stockage des lipides, glande mammaire, pour la

production des gras du lait ou les muscles squelettiques, pour la production d’énergie suite à

l’oxydation des lipides. Les VLDL deviennent des IDL (Intermediary Density Lipoprotein) puis

des LDL (Low Density Lipoprotein) au fur et à mesure qu’ils perdent des triglycérides et

s’enrichissent en phospholipides et ester de cholestérol.

23

Les caractéristiques des ruminants concernant ces lipoprotéines ont été très bien

expliquées par Bauchart (1993). En effet, la capacité des bovins à sécréter les VLDL est 5 fois

plus faible que chez l’homme. In vitro, en utilisant des hépatocytes de rat et de chèvre en culture,

il a été démontré que la synthèse des triglycérides était identique chez les deux espèces.

Cependant, le taux de sécrétion des triglycérides par les hépatocytes de la chèvre était 25 fois plus

faible que celui des hépatocytes de rat (Kleppe et al., 1988). La biosynthèse et la disponibilité des

constituants des VLDL pour l’assemblage de ces particules seraient probablement la cause du

déficit de production en VLDL plutôt qu’un problème au niveau de la sécrétion, selon Bauchart

(Bauchart, 1993; Bauchart et al., 1996; Gruffat et al., 1996).

Figure 7 : Les mécanismes de la lipogenèse (Voet et Voet, 1998)

24

II-2.1.2 La synthèse et l’hydrolyse des triglycérides

Le foie a un rôle plus complexe dans le métabolisme des lipides que les tissus adipeux ou

mammaire. Il prend en charge les acides gras non-estérifiés plasmatiques et soit les oxyde en CO2

ou corps cétoniques qui sont ensuite libérés dans le sang, soit les estérifie sur un glycérol pour

former des triglycérides (Figure 8).

Le devenir des acides gras entre oxydation et estérification va dépendre largement des

enzymes glycéro-3-phosphate déshydrogénase (GPAT) et carnitine palmitoyl-transférase-1 (CPT-

1). GPAT catalyse l’étape initiale de l’estérification des acides gras, alors que CPT-1 est une

enzyme localisée dans la membrane externe de la mitochondrie qui régule le transport des acides

gras dans la mitochondrie où a lieu la β-oxydation (Vernon, 2005).

Figure 8 : Métabolisme hépatique des acides gras chez les ruminants. 1- synthèse des acides gras de novo; 2- captation d'acides gras préformés venant de la circulation; 3- estérification des acides gras; 4- β-oxydation. ACC, acetyl CoA carboxylase ; GPAT, glycérol-3-phosphate déshydrogénase ; CPT-1, carnitine palmitoyl transférase 1 ; DAG, diacylglycérol ; TAG, triacylglycérol. Les lignes continues indiquent les voies métaboliques et les lignes en pointillés indiquent les inhibitions allostériques (Adapté de Vernon, 2005).

Il existe deux sites d’oxydation différents : dans les péroxysomes où les acides gras

subissent une oxydation partielle et peuvent ensuite gagner les mitochondries dans lesquelles a

lieu la β-oxydation (Hocquette et Bauchart, 1999).

Acétate

Acétyl-CoA

Malonyl-CoA

Acyl-CoA

Acides gras TG-VLDL

ACC

LPL

DAG TAG VLDL

TAG (stockage) Acyl-

carnitine

Acétyl-CoA

AcétoacétateCO2

CO2 Acétoacétate Β-hydroxybutyrate

Méthylmalonyl-CoA

Glucose

Propionate

GPAT

CPT-1

Mitochondrie

1

2

3 4

25

Les acides gras à courte et moyenne chaîne sont activés en ester CoA dans la matrice

mitochondriale alors que les acides gras à longue chaîne, sous forme d’acyl-CoA, traversent la

membrane externe de la mitochondrie où ils doivent ensuite être pris en charge par un système de

transport dépendant de la carnitine : CPT-1 (Zammit, 1990). Le rôle de cette enzyme est de

catalyser la formation d’acyl-carnitine et de CoA à partir d’acyl-CoA et de L-carnitine libre. Le

CoA est libéré dans le cytoplasme et redevient disponible pour d’autres réactions métaboliques.

L’acyl-carnitine est transportée à travers la membrane interne de la mitochondrie grâce à une

acyl-carnitine translocase en échange de carnitine libre. L’acyl-carnitine est ensuite converti en

acyl-CoA dans la matrice mitochondriale grâce à la CPT-2 localisée au niveau de la membrane

interne (Brady et al., 1993; Hocquette et Bauchart, 1999; Zammit, 1990; Figure 9).

Figure 9 : Représention schématique du système carnitine permettant le transfert des acides gras à longue chaîne dans la matrice mitochondriale; CPT, carnitine palmitoyltransférase (Tiré de Zammit, 1990).

CPT-1

Malonyl-CoA

Méthylmalonyl-CoA

-

Acide gras à longue

Acide gras à longue chaîne

Acyl-CoA synthétase

Acide gras-Coenzyme A

Coenzyme A

Carnitine

Acide gras-Carnitine

Acylcarnitine translocase

Carnitine Carnitine

Acide gras-Carnitine

CPT- 2

Acide gras-Coenzyme A

Coenzyme A

Carnitine

Oxydation

MEMBRANE MITOCHONDRIALE

INTERNE

CYTOSOL

MEMBRANE MITOCHONDRIALE

EXTERNE

MATRICE MITOCHONDRIALE

26

Selon ces auteurs, l’activité de la CPT-1 constitue l’étape limitante de l’oxydation des

acides gras. La CPT-1 est en effet inhibée par le malonyl-CoA (McGarry et Foster, 1980),

premier intermédiaire formé dans la synthèse des gras, et par le méthylmalonyl-CoA,

intermédiaire dans le métabolisme du propionate, dans le foie des ruminants (Brindle et al.,

1985). Cette découverte montre que les changements hormonaux qui accompagnent certaines

conditions physiologiques (déficit énergétique en début de lactation avec une hypoinsulinémie et

une perte d’appétit) peuvent, d’une part, diminuer l’activité de l’acétyl-CoA carboxylase et, par

conséquent, les taux de malonyl-CoA. D’autre part, la perte d’appétit diminue le taux de

production du propionate au niveau ruminal ce qui baisse l’inhibition via le méthylmalonyl-CoA

et mène à une accélération de l’oxydation des acides gras et de la cétogenèse (Zammit, 1990;

Kim, 1997; Hocquette et Bauchart, 1999; Vernon, 2005).

Il est important de noter que, par la formation d’acétyl-CoA suite à la β-oxydation, les

acides gras favorisent indirectement la néoglucogenèse par un apport suffisant d’acétyl-CoA qui

va permettre au pyruvate d’être orienté principalement vers la néoglucogenèse plutôt que d’être

utilisé dans le processus d’oxydation (Herdt et Emery, 1992).

II-2.1.3 L’importance du glucose

Le glucose est un substrat majeur dans la synthèse des acides gras. Une fois à l’intérieur

des cellules alvéolaires mammaires ou adipeuses, le glucose peut avoir 4 destinées (Neville et

Picciano, 1997; Figure 10) :

1- il peut être converti en acétyl CoA à partir du pyruvate et synthétiser du citrate,

fournissant des unités carbonées pour la synthèse des acides gras via le malonyl-CoA.

2- Il peut être converti en ribulose-5-phosphate en suivant la voie métabolique des pentoses-

phosphates, pouvant ainsi générer une partie des NADPH nécessaires pour la synthèse des

acides gras en tant qu’unités réductrices.

3- Le glycéraldéhyde-3-phosphate, issu de la glycolyse peut-être converti en glycérol-3-

phosphate et utilisé pour la formation des triglycérides.

4- Finalement, le glucose peut-être entièrement oxydé en CO2 en empruntant successivement

la glycolyse et le cycle de Krebs (8 et 30 ATP respectivement / molécule de glucose) et

ainsi fournir l’énergie nécessaire à la synthèse des acides gras.

27

Figure 10 : Étapes clés de l’utilisation du glucose dans la synthèse des acides gras. G-6-P, Glucose-6-phosphate ; F-6-P, Fructose-6-phosphate ; PFK-1, phosphofructokinase-1 ; F-1,6-BP, fructose-1,6-biphosphate ; AGS, acide gras synthase ; CoA, coenzyme A. (Tiré de Neville et Picciano, 1997).

II-2.2 Pathologies liées au métabolisme des lipides

Dans la période péripartum où les vaches laitières sont en déficit énergétique, les acides

gras se révèlent être la principale source d’énergie pour la plupart des tissus. Cependant, dans

certaines circonstances, ils peuvent avoir des effets pathologiques qui peuvent réduire la

production laitière, altérer la santé ou l'efficacité reproductive.

Ribulose-5-P

Glucose

Glucose

G-6-P

F-6-P

F-1,6-BP

Glyceraldehyde-3-P

Pyruvate

Pyruvate

Acetyl CoA

Citrate

Citrate

Acetyl CoA

Malonyl CoA

Acetate

Acide gras

Acyl CoA

Glycerol

Glycerol

Glycerol-3-P +

Acide gras Acetate

NADPH

Krebs

Pyruvate deshydrogenase

PFK-1

Hexokinase

ATP citrate liase

Acetyl CoA carboxylase

Triglycerides

AGS

Énergie

4

3

2

1

28

II-2.2.1 La cétogenèse

Chez plusieurs espèces de non-ruminants, la conversion hépatique des acides gras non-

estérifiés en corps cétoniques est considérée comme étant une stratégie d’économie du glucose

pendant les périodes de jeûne pour fournir de l’énergie (Voet et Voet, 1998). Le même

phénomène adaptatif se produit chez les vaches laitières pendant la période de transition pour

diminuer l’oxydation du glucose même si ce taux d’oxydation est déjà faible par rapport aux

animaux non-ruminants (Herdt et Emery, 1992). La cétogenèse se produit dans les mitochondries

des hépatocytes et consiste à la formation d’acétoacétate et β-hydroxybutyrate à partir de deux

acétyl-CoA, issus de la β-oxydation des acides gras (Voet et Voet, 1998). Les corps cétoniques

peuvent être utilisés comme source d’énergie par un grand nombre de tissus chez les ruminants

(le cœur, les reins, le muscle squelettique, la glande mammaire et le tractus gastro-intestinal) en

étant oxydés (Heitmann et al., 1987; Herdt et Emery, 1992) et peuvent servir de substrats pour la

synthèse mammaire d’acides gras.

Herdt et Emery (1992) ont décrit les stratégies adoptées par l’organisme pour réguler

conjointement la cétogenèse et la néoglucogenèse. Cette régulation peut être de deux natures : les

substrats eux-mêmes (corps cétoniques et glucose) et les hormones (insuline et glucagon). Un

dérèglement de ces voies de régulation conduit à une surproduction de corps cétoniques et une

incapacité à maintenir le glucose sanguin menant alors la vache dans un état pathologique appelé

acétonémie. Même si les mécanismes restent à clarifier (Drackley et al., 2001), il se pourrait que

l’excès en corps cétoniques cause l’hypoglycémie suite à une inhibition de la néoglucogenèse

(Mills et al., 1986). Cette réduction de la néoglucogenèse serait due à un manque d’apport en

substrats carbonés permettant la synthèse d’oxaloacétate par les cycles anaplérotiques.

II-2.2.2 La stéatose hépatique

La stéatose ou « foie gras » des vaches laitières se développe, en début de lactation, quand

la concentration plasmatique en acides gras non-estérifiés est élevée à cause d’une réduction de la

prise alimentaire et du tissu adipeux dont l’activité est majoritairement catalytique (Grummer,

1993; Bobe et al., 2004; Ohgi et al., 2005). Dans le foie, les acides gras sont soit oxydés en CO2

ou corps cétoniques, soit estérifiés en triglycérides qui peuvent alors être stockés dans le

cytoplasme des hépatocytes ou sécrétés via les VLDL (Drackley et al., 2001; Vernon, 2005).

29

Mais le taux de synthèse et de sécrétion des VLDL par le foie étant beaucoup plus faible chez les

ruminants que chez les non-ruminants (Graulet et al., 1998; Pullen et al., 1990), cela explique

pourquoi ces animaux accumulent les lipides au niveau hépatique (Drackley et al., 2001;

Grummer, 1993). Pour faire face à cette pathologie qui touche un tiers des vaches laitières hautes

productrices dans la période péripartum (Bobe et al., 2004), les deux grandes stratégies mises en

place sont :

- Une diminution de la mobilisation des acides gras du tissu adipeux principalement en

apportant des suppléments alimentaires de niacine ou de propylène glycol, précurseur de

glucose (Grummer, 1993).

- Une augmentation de l’exportation des triglycérides hépatiques via les VLDL.

Ce dernier point fait l’objet de nombreuses recherches car plusieurs hypothèses ont été avancées

pour expliquer la lenteur de l’exportation des VLDL (Gruffat et al., 1996; Grummer, 1993).

Bauchart (1993) explique ce phénomène par un défaut dans l’assemblage de ces particules

(Bauchart et al, 1996). En effet, il est possible que la microsomal transfer protein, qui catalyse le

transport des triglycérides au site d’assemblage des VLDL, ait une faible activité chez les bovins.

La grosse et la petite sous-unité de cette protéine sont 10 et 2 fois moins concentrées

respectivement dans le foie de veaux que dans celui de rat (Graulet et al., 2004). Une diminution

de la concentration plasmatique et de l’ARNm de l’apoB, apolipoprotéine permettant une bonne

fonctionnalité des VLDL, a été corrélée avec une augmentation de la teneur des triglycérides dans

le foie (Marcos et al., 1990). L’ajout 2,6 g de méthionine / kg de matière sèche à la ration de

veaux pré-ruminants a un impact positif sur l’exportation des VLDL (Auboiron et al., 1995). La

méthionine serait impliquée dans la synthèse des apoprotéines et comme donneur de groupements

méthyles permettant la synthèse de phosphatidylcholine, composant essentiel de l’enveloppe

hydrophile des VLDL (Shibano et Kawamura, 2006). Une dernière stratégie nutritionnelle pour

prévenir et réduire la stéatose hépatique serait l’utilisation de choline protégée de la dégradation

ruminale (Janovick Guretzky et al., 2006) en améliorant notamment le métabolisme des

groupements méthyles (Baldi et Pinotti, 2006).

30

II-3 LES PROTÉINES

II-3.1 Métabolisme des acides aminés

II-3.1.1 Rôles des acides aminés

Lors de leur absorption, 39 et 62% des acides aminés essentiels et non essentiels

respectivement sont utilisés pour le métabolisme gastrointestinal (Berthiaume et al., 2001).

Cependant il existe une grande variation entre les acides aminés quant à leur utilisation au niveau

de l’intestin. En effet la leucine, la lysine et la méthionine sont oxydées par le tube digestif mais

pas la phénylalanine, ni la thréonine (Lobley et Lapierre, 2003). Les acides aminés catabolisés

vont servir de source d’énergie pour le métabolisme du tube digestif mais aussi pour la synthèse

des protéines constitutives de l’intestin qui ont un « turnover » rapide et celles présentes dans les

différentes sécrétions du tube digestif (salive, bile, sécrétions gastrique et pancréatique).

Les acides aminés, absorbés et non métabolisés dans l’épithélium intestinal, circulent sous

forme libre dans le plasma jusqu’au foie et ceux, libérés par cet organe, vont pouvoir être

acheminés vers les tissus périphériques. Les acides aminés peuvent être utilisés pour la synthèse

des protéines (renouvellement protéique ou protéines sécrétées lors de la digestion ou dans le

lait), être catabolisés ou utiliser pour la synthèse de produits spécialisés (neurotransmetteurs,

carnitine,…).

Pour la synthèse protéique, des recommandations, issues du NRC (2001), ont été faites

seulement pour deux acides aminés, la méthionine et la lysine, qui sont fréquemment limitants

pour la production des protéines du lait chez la vache laitière (Schwab et al, 1992; Rulquin et al.,

1993). L’examen des résultats d’essais d’administration postruminale de méthionine et de lysine

montre que les effets sur la production et la composition du lait sont très variables selon la nature

des suppléments d’acides aminés utilisés, le type de régime alimentaire ainsi que son niveau

azoté et enfin du stade de lactation et du niveau de production des animaux (Rulquin, 1992).

Deux études plus récentes supplémentent une ration basée sur de l’ensilage de maïs (17% de

protéines brutes) avec en moyenne 10 g / j de méthionine et de lysine par infusion au duodénum

(Pisulewski et al., 1996) ou dans l’alimentation, protégée de la dégradation ruminale (Socha et

al., 2005) chez la vache laitière. Elles observent une amélioration significative de la teneur en

31

protéines du lait d’environ 4,5% et du rendement de 7 et 4% pour les vaches en début et milieu de

lactation, respectivement.

Le catabolisme des acides aminés peut se produire dans une large gamme de tissus : par

exemple, la leucine peut-être oxydée dans la glande mammaire (Thivierge et al., 2002), à travers

l’intestin (Lapierre et al., 2002), dans les reins, le tissu adipeux et dans le muscle squelettique

(Bergen et al., 1988). Pourtant le foie reste le principal site de catabolisme des acides aminés car

il possède les enzymes oxydatives nécessaires. Dans cet organe, ce catabolisme se traduit par une

déamination des acides aminés en excès suivie par un catabolisme du squelette carboné.

L’ammoniac, issu de la déamination, va permettre la synthèse d’urée alors que le squelette

carboné va fournir des intermédiaires glucogéniques (pyruvate, succinate, α-cétoglutarate,…) ou

cétogéniques (acétyl-CoA ou acétoacétate) et, ainsi, servir aussi de source d’énergie (Chalupa,

1984; Figure 11). Les acides aminés fournissent aussi des groupes amines et méthyles nécessaires

pour les réactions de transamination et transméthylation, respectivement. Ce dernier rôle sera

développé plus en profondeur lors de l’étude de la méthionine dans le métabolisme des unités

monocarbonées (chapitre II-5.3.3).

II-3.1.2 Contrôle du métabolisme des acides aminés au niveau des tissus

périphériques

Le foie est un organe vital dans le maintien de l’homéostasie des acides aminés en

assurant des fonctions duelles encore peu claires. En effet, il serait capable d’extraire et

cataboliser les acides aminés en excès pour éviter les problèmes de toxicité, tout en fournissant

les acides aminés (sous forme d’acides aminés libres ou de protéines exportées, comme

l’albumine) nécessaires pour supporter l’anabolisme au niveau des tissus périphériques. Il n’est

pas encore bien compris comment et par quels mécanismes le foie est capable de réguler ces

actions partagées entre catabolisme et anabolisme. Deux hypothèses ont alors été émises : le foie

pourrait réguler le gain protéique des tissus périphériques en tant que premier organe traversé par

les acides aminés absorbés ou inversement, l’anabolisme des tissus périphériques constituerait un

signal pour le foie (Lapierre et al., 2005).

32

Figure 11 : Intermédiaires glucogéniques (dans les carrés) et cétogéniques (dans les cercles) produits suite au catabolisme des acides aminés dans le foie (Tiré de Voet et Voet, 1998).

D’après de récentes données, le foie n’agirait pas comme un régulateur actif de

l’extraction et du catabolisme des acides aminés mais répondrait plutôt au flux d’acides aminés

qu’il reçoit et cataboliserait les acides aminés non-utilisés par les tissus périphériques (Lobley et

Lapierre, 2003). Cette dernière hypothèse s’appuie sur le fait que le foie reçoit des acides

aminés de deux sources différentes, la veine porte et l’artère hépatique, c’est-à-dire ce qui est

Acétyl-CoA Glucose

Pyruvate CO2

Oxaloacétate Citrate

Isocitrate

α-Cétoglutarate Succinyl-CoA

Fumarate

CO2

CO2

Cycle de l’acide citrique

Asparagine Aspartate

Isoleucine Méthionine Valine

Arginine Glutamate Glutamine Histidine Proline

Phénylalanine Tyrosine

Alanine

Thréonine Tryptophane

Isoleucine Leucine Thréonine

Acétoacétate

Leucine Lysine Phénylalanine Tryptophane Tyrosine

Glycine Cystéine

Sérine

33

absorbé ou recyclé dans le sang périphérique et qui vient de la dégradation des protéines

tissulaires. Le sang ou le plasma sont reconnus pour être les principaux sites de transport des

acides aminés à travers les tissus splanchniques (Lobley et al., 1996). Ce concept a été mis en

évidence dans une étude chez le mouton où les auteurs ont établi que l’extraction des acides

aminés par le foie serait fonction du flux hépatique afférent (absorbé + recyclé) (Lobley et al.,

2001). Donc, selon cette idée, les acides aminés subiraient de multiples passages à travers le foie

avec seulement des petites quantités extraites par cet organe à chaque passage de l’ordre de 1 à

20% des apports hépatiques afférents (Lobley et al, 2001). Le taux d’extraction hépatique de la

plupart des acides aminés reste constant pour un acide aminé donné mais diffère entre les acides

aminés. Par exemple, la méthionine, la phénylalanine, l’histidine, l’alanine, l’arginine, la sérine et

la tyrosine ont les taux d’extraction les plus élevés (entre 35 et 50% de l’absorption portale)

tandis que la lysine et les acides aminés à chaîne ramifiées (leucine, valine et isoleucine) sont très

peu retenus par le foie (Lobley et al., 2001; Lapierre et al., 2005).

II-3.2 « Turnover » protéique

II-3.2.1 Une plasticité métabolique

Chez une vache laitière en fin de lactation produisant moins de 20 kg de lait, 880 g / jour

de protéines sont sécrétées dans le lait et retenues dans les tissus alors que la quantité totale de

protéines produites et dégradées par l’organisme est de 3,5 et 2,6 kg / jour, respectivement

(Lapierre, et al. 2002; Lobley, 2003). Un tel constat pour démontrer que les protéines sont une

composante dynamique de l’organisme. Ainsi le concept du « renouvellement des protéines

corporelles » implique le remplacement d’une quantité de protéines par une quantité équivalente

du même matériel nouvellement synthétisée à partir de précurseurs ou de composés venant de

l’alimentation (Lobley et Lapierre, 2003).

Les principales voies responsables du maintien des protéines corporelles et de

l’homéostasie des acides aminés sont la synthèse protéique, la dégradation protéique, l’oxydation

des acides aminés et la synthèse de novo des acides aminés non-essentiels (Young et Margini,

1990). Les variations dans l’importance de ces voies métaboliques permettent l’ajustement du

dépôt des protéines en fonction de l’état nutritionnel, physiologique ou pathologique de l’animal.

Ce continuel renouvellement des tissus est un processus vital qui permet notamment l’élongation

34

des fibres musculaires de l’utérus durant la gestation ou le développement, la fonctionnalité et

plus tard la régression de la glande mammaire durant le cycle de lactation (Lobley, 2003). Mais

cette plasticité prend toute son importance en début de lactation où la forte demande de la glande

mammaire chez les vaches laitières va être supportée en mobilisant en moyenne 1 kg de protéines

tissulaires par jour (pour les 7 à 10 premiers jours après le vêlage) (Bell et al., 2000). A l’inverse

une accrétion protéique de -69 g à +794 g se produit dans les tissus de brebis en fin de gestation

(110 à 140 jours de gestation) recevant un régime faible (80 g/kg de matière sèche) ou riche (160

g/kg de matière sèche) en protéines (McNeill et al., 1997).

Pour maintenir cette plasticité métabolique, il apparaît nécessaire d’avoir une fraction du

réservoir de protéines qui serait mobile. Dans une expérience avec une phase de déplétion des

protéines labiles suivie d’une ration de réplétion, Botts et al. (1979) ont estimé que la vache

laitière disposait d’une réserve de protéines labiles correspondant à environ 26% des protéines

corporelles. Comme illustré dans la figure tirée de Lobley (2003) (Figure 12) et discuté dans la

revue de Swick et Benevenga (1977), les muscles et la peau sont les principales réserves de

protéines chez les bovins. La mobilisation des protéines constituant ce réservoir est limité. Dans

une étude comparant différents niveaux de protéines métabolisables chez des vaches Holstein en

lactation recevant une alimentation isoazotée et isoénergétique, l’étude de la cinétique de leucine

montre que cet acide aminé est non seulement moins bien retenu dans les tissus (3,4 contre 4,3

mmol/h, respectivement) mais aussi que son oxydation est supérieure de 8,9 mmol/h chez les

vaches avec la ration riche en protéines métabolisables (Lapierre et al., 2002). Il est maintenant

bien admis qu’un excès de protéines alimentaires, donné en début de lactation pour anticiper la

forte demande en nutriments, ne permet pas d’augmenter les réserves mais augmente plutôt

l’oxydation et l’excrétion protéique (Swick et Benevenga, 1977).

35

Figure 12 : Pourcentage de contribution de différents tissus à la masse protéique, la synthèse protéique et à l’utilisation nette d’oxygène indicateur de l’énergie utilisée au niveau corporel chez le bouvillon (Adapté de Lobley, 2003).

II-3.2.2 Équilibre entre synthèse et dégradation protéique

Les acides aminés nécessaires pour subvenir à la synthèse protéique excèdent les

quantités fournies par l’alimentation. Donc la plupart des acides aminés utilisés viennent de la

dégradation des protéines endogènes (environ 60%). Dans sa revue, Lobley (2003) note qu’une

vache laitière consomme 2 kg de protéines digestibles alors qu’elle en synthétise 4 kg / jour.

La synthèse protéique :

La synthèse protéique au niveau corporel est la somme de la synthèse des protéines au

niveau de tous les tissus et organes.

Lobley (2003) reprend de nombreux chiffres tirés de la littérature pour montrer la

contribution majoritaire du tissu gastro-intestinal et du foie à la synthèse corporelle de protéines

(25 à 45% chez la vache laitière, Lapierre et al., 2002), suivi par le tissu mammaire à la hauteur

4-15

25

2

Foie

8-16

15-20

20

Peau

32-45

23

5-7

Intestin 35-45

7-14

3

Glande mammaire

15-20

25-30

50

Muscles

% masse protéique

% synthèse protéique

% utilisation d’oxygène

36

de 35 à 45% (Thivierge et al., 2002) et enfin la synthèse protéique au niveau musculaire qui

représente 15 à 20% chez un animal en croissance (Figure 12). Même si le tube digestif et le foie

peuvent apparaître moins efficaces parce qu’ils ne contribuent pas à former un produit particulier

comme le lait ou la fibre musculaire, ces organes sont néanmoins très actifs car ils synthétisent

des protéines qui sont sécrétées et utilisés dans l’organisme entier : enzymes excrétées pour la

digestion, protéines du système immunitaire ou encore l’albumine et pour assurer le

renouvellement rapide des cellules du tractus gastrointestinal (Lobley, 2003).

La dégradation protéique :

Contrairement à la synthèse protéique qui s’effectue dans le noyau et le cytoplasme des

cellules, la dégradation protéique peut se produire dans différentes composantes cellulaires selon

la voie choisie : lysosomal, majoritairement au niveau hépatique, ou cytoplasmique (système

dépendant du calcium ou système ATP-ubiquitine, principalement au niveau musculaire). Ce

processus permet de fournir des substrats à la synthèse protéique, de maintenir un pool restreint

d’acides aminés libres plasmatiques, l’intégrité enzymatique et de renouveler les protéines

vieillissantes dont les fonctions métaboliques sont affaiblies.

En début de lactation, les vaches laitières sont dans un état de bilan énergétique très

négatif qui impose une forte mobilisation, en priorité, des protéines musculaires pour augmenter

la quantité d’acides aminés libres. Ces acides aminés vont être impliqués dans plusieurs voies

permettant de répondre aux besoins de la glande mammaire et à l’adaptation métabolique exigée.

Tout d’abord ces acides aminés seront utilisés pour la synthèse de glucose via la néoglucogenèse,

pour la synthèse des protéines du lait et enfin comme source d’énergie afin d’épargner le glucose

(Bell et al., 2000). Ces derniers auteurs soulignent par ailleurs que cette mobilisation extrême

serait liée d’une part à une forte diminution de la synthèse protéique et d’autre part à une

augmentation de la dégradation. Ce phénomène pourrait être régulé par des changements

endocrines (IGF-1, insuline et hormone de croissance) (Bell et al., 2000).

II-3.2.3 Mesure du dynamisme protéique

La méthodologie élaborée pour mesurer le dynamisme protéique repose sur l’utilisation

de molécules marquées, appelées « traceurs ». Comme nous l’avons déjà expliqué dans le

37

chapitre II-1.2.5., ces traceurs sont des molécules marquées par un isotope radioactif ou stable qui

doit remplir un certain nombre de conditions et qui permet de suivre et quantifier les voies

métaboliques de divers composés (acides aminés, glucose). Des acides aminés marqués sont

habituellement utilisé pour estimer le métabolisme protéique. Tout comme pour le glucose, les

pertes irréversibles totales (PIT) somment les voies de sorties qui, à l’équilibre, égalent les voies

d’entrée.

Pour un acide aminé essentiel, d’une façon générale, les compartiments suivant sont

utilisés :

PIT = entrée : absorption + AA dérivé de la dégradation protéique

= sortie : oxydation + synthèse protéique

De plus, pour un acide aminé soufré comme la méthionine, en plus des isotopes mentionnés pour

le glucose, les isotopes suivants peuvent aussi être utilisés : 15N (stable) et 35S (radioactif).

Encore une fois, le choix du traceur se fait en fonction des objectifs particuliers du protocole de

recherche. Aussi, pour la méthionine, à cause du cycle de reméthylation à partir de

l’homocystéine (voir paragraphe II-5.3.4), le PIT peut-être défini de la façon suivante :

PIT = entrée : absorption + AA dérivé de la dégradation protéique + reméthylation

= sortie : oxydation + synthèse protéique + formation de SAM*

* SAM = S-Adénosyl Méthionine ; le métabolite actif de la méthionine

L’infusion de méthionine marquée avec une combinaison de deux isotopes va permettre

de générer des enrichissements isotopiques de plusieurs masses qui permettront de suivre cet

acide aminé dans ces différentes voies métaboliques. Ce dernier exemple est détaillée dans le

chapitre IV où l’étude du métabolisme de la méthionine a été suivie suite à l’infusion de L-[1-13C,2H3]méthionine.

38

II-4 VITAMINES DU COMPLEXE B

II-4.1 Synthèse dans le rumen et absorption intestinale

Jusqu'à présent, il est établi que les ruminants adultes n'ont pas besoin de suppléments

alimentaires de vitamines B grâce à la présence des nombreuses bactéries peuplant leur

rumen. En effet, i l a été démontré depuis longtemps que ces microorganismes sont

capables de synthétiser ces composés (Bechdel, 1928). Les ruminants reçoivent donc une

double source de vitamines B: une venant de l'alimentation et l'autre de la synthèse endogène

bactérienne. D’ailleurs Santschi et al. (2005a) a démontré que cette fraction vitaminique, issue

du métabolisme ruminal, est non négligeable. Suite à une étude chez 4 vaches en lactation,

équipées de canules ruminale, duodénale et iléale, une synthèse ruminale apparente de 2213, 21

et 73 mg / jour de niacine totale, folates et vitamine B12 respectivement a été mise en évidence

(Santschi et al., 2005a). Toutefois il a été démontré que cette synthèse endogène variait selon la

composition de la ration (Santschi et al., 2005b; Schwab et al., 2006).

Les travaux de Santschi et al. (2005a) ont permis également de montrer que, malgré une

intense dégradation de ces vitamines, provenant de suppléments alimentaires, par les bactéries du

rumen (de 41 à 99% pour la vitamine B6 et la riboflavine, respectivement), les taux d’absorption

intestinaux sont globalement améliorés par la supplémentation mais sont différents d’une

vitamine à l’autre allant d’environ 15 à 84% pour la vitamine B12 et la niacine totale.

II-4.2 Implication dans les grandes voies métaboliques

Les vitamines B sont impliquées dans deux grands types de fonctions métaboliques : le

transfert de protons et d’électrons et la fonction coenzymatique. De telles fonctions rendent ces

vitamines indispensables pour le bon fonctionnement des métabolismes énergétiques (glucidique

et lipidique) et protéique (Figure 13).

La riboflavine et la niacine sont d’importants co-facteurs dans les réactions d’oxydo-

réductions suite à leur interconversion entre différentes formes : FMN-FMNH-FMNH2 ou FAD-

FADH-FADH2, pour la ribofavine et NAD+-NADH ou NADP+-NADPH, pour la niacine

(Combs, 1998). Ces co-facteurs sont très impliqués dans les voies métaboliques fournissant

l’énergie à l’animal : glycolyse, cycle de Krebs, synthèse et oxydation des acides gras et certains

39

acides aminés ainsi que dans la chaîne respiratoire mitochondriale (Voet et Voet, 1998). L’acide

pantothénique joue aussi un rôle de transfert notamment dans le métabolisme des acides gras car

il est responsable de l’oxydation du coenzyme A.

La fonction coenzymatique est assurée par toutes les vitamines du groupe B. La thiamine

diphosphate est une coenzyme de 3 complexes enzymatiques qui catalyse les réactions de

décarboxylation : la pyruvate déshydrogénase dans le métabolisme des glucides, l’α-cétoglutarate

déshydrogénase dans le cycle de Krebs et la déshydrogénase impliquée dans le métabolisme des

acides aminés à chaîne ramifiée. C’est aussi une coenzyme pour les transcétolases présentes dans

la voie des pentoses phosphates. Sous leurs formes NAD(H)-NADP(H) et FMN-FAD, la niacine

et la riboflavine sont des coenzymes pour un grand nombre de réactions dans les métabolismes

des glucides, lipides et protéines. L’acide pantothénique est le précurseur de la coenzyme A et de

l’ACP qui participent aux réactions du cycle de Krebs, de la synthèse et oxydation des acides

gras, la synthèse de cholestérol et les réactions d’acétylation (Voet et Voet, 1998). La vitamine B6

intervient dans le métabolisme des acides aminés et spécialement dans les réactions de

transamination et de décarboxylation. La biotine est elle essentielle dans l’activation de 4

carboxylases : β-crotonyl-CoA carboxylase (impliquée dans le catabolisme de la leucine),

l’acétyl-CoA carboxylase (intervenant dans la synthèse des acides gras), la propionyl-CoA

carboxylase et la pyruvate carboxylase qui autorisent l’entrée du propionate, d’acides gras à

nombre impair de carbones et certains acides aminés (valine, isoleucine, méthionine et

thréonine), pour la première enzyme, et d’acide lactique et d’acides aminés (alanine, glycine),

pour la seconde, dans le cycle de Krebs. Enfin nous détaillerons plus tard (chapitres II-5.1 et II-

5.2) les fonctions métaboliques de l’acide folique, en tant que donneur d’unités à un carbone, et

de la vitamine B12 dont 3 enzymes sont dépendantes : la méthionine synthase, la méthylmalonyl-

CoA mutase et la leucine aminomutase (Combs, 1998; Voet et Voet, 1998).

40

Figure 13 : Fonctions métaboliques des vitamines B (Adapté de Le Grusse et Watier, 1993).

II-4.3 Définition des besoins

Selon les estimations faites par le NRC (2001), seuls l’acide folique et l’acide

pantothénique seraient limitants et nécessiteraient une supplémentation chez la vache laitière

(Tableau 1). Ces conclusions sont à interpréter avec précaution car, d’une part, les besoins

tissulaires sont évalués à partir de recommandations émises pour une truie en lactation de 175 kg

et réajustées pour une vache laitière de 650 kg produisant 35 kg de lait par jour. Et d’autre part,

les valeurs de la synthèse ruminale et de la quantité de vitamines B du régime échappant aux

dégradations ruminales dérivent d’une étude réalisée sur de jeunes bœufs nourris principalement

de céréales.

Comme nous l’avons déjà mentionné précédemment, les besoins en vitamines B chez la

vache laitière haute productrice sont assurés par une importante synthèse ruminale qui pallie à

l’apparition de signes cliniques de carence. Cependant ces besoins varient beaucoup selon le

stade physiologique, augmentant dans les situations de stress tels que la croissance, la gestation et

PROTEINES GLUCIDES LIPIDES

Acides aminés Glucose Glycérol Acides gras Pentoses phosphates

Glycogène

Purines Pyrimidines

Propionyl-CoA

Acétyl-CoA

Acide pyruvique

Cycle de Krebs

Cholestérol

Propionyl-CoA

ATP

Urée CO2

2 x 2H CHAINE RESPIRATOIRE

H2O

ATP

Acides gras à chaîne impair de

carbones

B1

B1

B1

B1

B1

B2

B2

B2

B3

B3

B3

B3

B5

B5

B5

B5

B6

B6

B6

B5

B8 B8

B8

B9

B9

B9

B12

B8

B8

B12

41

la lactation. Or dans ces conditions, les niveaux nécessaires en ces vitamines pour optimiser la

santé et la production des animaux pourraient excéder les quantités fabriquées dans le rumen. En

effet, dans les premières semaines de lactation où l’exigence en énergie est haute et la prise

alimentaire limitée, les 3 enzymes dépendantes de la biotine et impliquées dans la

néoglucogenèse sont très actives et augmenteraient les besoins en cette vitamine (Majee et al.,

2003).

Tableau 1 : Bilan des apports (synthèse ruminale et alimentation) et besoins corporels estimés (tissus et production laitière) en vitamines B chez une vache laitière de 650 kg produisant 35 kg de lait par jour (Tiré de NRC, 2001).

Estimation des besoins quotidiens

Vitamines tissu

(mg/jour)1 lait

(mg/jour)2total

(mg/jour)

Synthèse ruminale

(mg/jour)3

Vitamine B du régime échappant à

la dégradation ruminale (%)3

thiamine 26 15 41 143 52 riboflavine 95 61 156 261 1

niacine 256 33 289 1804 6 acide

pantothénique 304 121 425 38 22

vitamine B6 26 22 48 96 100 biotine 5 1 6 14 100

acide folique 33 2 35 7 3 vitamine B12 0,4 0,2 0,6 70 10

1 basé sur des besoins d’une truie de 175 kg et ajusté pour une vache laitière de 650 kg. 2 adapté de Jennes (1985) et ajusté pour une production laitière de 35 kg / jour. 3 adapté de Miller et al. (1986) et Zinn et al. (1987).

De même, Girard et Matte (1989) ont montré que les folates sériques diminuaient de 40%

entre 2 mois postpartum et la parturition suivante. Ces auteurs ont aussi constaté que les vaches

supplémentées en acide folique avaient, en début de lactation, un faible statut en vitamine B12 qui

pourrait interférer sur le métabolisme de l’acide folique. Ces résultats laissent également

suspecter un besoin additionnel en vitamine B12 chez ces animaux dans cette période critique

(Girard et Matte, 1999).

Même si les ruminants ont la capacité de synthétiser suffisamment de ces nutriments, des

carences marginales en vitamines B peuvent se produire lorsque les besoins en vitamines B sont

élevés ou que la synthèse microbienne est moins efficace particulièrement chez les vaches

42

laitières hautes productrices. En général, les concentrations plasmatiques sont les premières à

diminuer, suivie par une déplétion des réserves tissulaires. Les organes vitaux (comme le cerveau

et le foie) sont les derniers à perdre leur réserve (Bailey, 1990).

II-5 ACIDE FOLIQUE, VITAMINE B12 ET MÉTHIONINE

II-5.1 Acide folique

II-5.1.1 Structure et définition

L’acide folique a été isolé pour la première fois en 1941 à partir de feuilles d’épinard

(Cossins, 2000). Il est composé d’une base ptéridine, d’une molécule d’acide p-aminobenzoïque

(PABA) et d’une chaîne, plus ou moins longue, formée d’une succession de molécules d’acide

glutamique liées par des liaisons peptidiques, jusqu’à huit résidus glutamate ont été dénombrés

dans cette chaîne (McDowell, 2000; Figure 14).

Le noyau ptéridinique des folates peut exister sous 3 états d’oxydation : totalement oxydé

ou sous les formes réduites 7,8-dihydro (DHF) ou 5,6,7,8-tétrahydrofolate (THF). Les

tétrahydrofolates, sous leurs formes polyglutamates, sont biologiquement actifs, et

majoritairement présents dans la cellule sous la forme pentaglutamate (Bollheimer et al., 2005).

L’unique fonction biochimique de l'acide folique chez les mammifères est d'accepter puis de

libérer des unités monocarbonées. Donc les formes cellulaires des folates peuvent être

différentes selon le type d'unité à un carbone qu'ils transportent sur les atomes d’azote

numérotés 5 et 10 : 5-formyl-THF, 10-formyl-THF, 5,10-méthényl-THF, 5-méthyl-THF

(principale forme circulante) ou 5,10-méthylène-THF (Tableau 2). Ainsi, les différentes

fonctions physiologiques des folates vont découler de cette diversité (Smulders et Stehouwer,

2005).

43

Figure 14 : Structure chimique de l’acide folique (ou acide ptéroylglutamique) (voir le tableau 2 pour la signification de R, X et Y).

Tableau 2 : Principaux folates ayant une activité biologique (selon Bollheimer et al., 2005).

N H

N H2N

O

1 2 3

4 4a

8a 8 N

N

H

R

5 6 7

9CH2

N 10

X

1’2’3’

4’5’ 6’

CO NH CH

COOH

CH2

CH2

C Y

O

2-amino-4-oxo-6-méthylène-ptéridine Acide para-amino-benzoïque

Acide L-glutamique

Acide para-amino-benzoylglutamique

Acide ptéroïque

Acide folique

N

N H

CH2 5 6 7 8

X R Nom

-H sur N10 Acide folique (AF)

-CH3 sur N10 10-méthyl-AF (10-CH3-AF)

-CHO sur N10 10-formyl-AF (10-CHO-AF)

N

N

H H

H

CH2

7 8

6 5 -H sur N10 Acide 7,8-dihydro-

folique (DHF)

-CH3 sur N5 Acide 5-méthyl-DHF (5-CH3-DHF)

H H

H H

H

N

N

CH2

8 7 6

5

-H sur N10 5,6,7,8-tétrahydrofolate (THF)

-CH3 sur N5 5-méthyl-THF (5-CH3-THF)

-CHO sur N5 5-formyl-THF (5-CHO-THF)

-CHO sur N10 10-formyl-THF (10-CHO-THF)

5,10-méthényl-THF (5,10-CH+-THF)

-CH2- sur N5 - N10

5,10-méthylène-THF (5,10-CH2-THF)

-OHmonoglutamate

Y

COOH

CH

CH2

COOH

CH2

NH

diglutamate

CH

CH2

CH2

NH

COOH

CH

CH2

CH2

NH

COOH

CH

CH2

CH2

NH C

O

COOH

polyglutamate

(non diglutamate)

1 < m < 6

CH- sur N5 - N10

44

II-5.1.2 Données nutritionnelles : sources alimentaires et besoins

La plupart des folates, présents dans les aliments, sont sous forme de THF réduits pouvant

porter différents groupes monocarbonés et liés à une chaîne de polyglutamates. Les folates

alimentaires se retrouvent principalement dans les végétaux (épinards, salades, luzerne, grains de

maïs et ses dérivés), les fruits (orange), dans le foie des animaux et dans certaines préparations de

levures ou de bactéries (McDowell, 2000). Nous avons vu que, chez les ruminants, une synthèse

de folates se produit dans le rumen et pourrait ne pas être suffisante dans des conditions

physiologiques particulières telles que la gestation et la lactation qui augmentent les besoins en

cette vitamine (Girard et al., 1995; Girard et Matte, 1998). Mais jusqu’à présent, aucune

recommandation chiffrée n’a été établie pour les ruminants.

II-5.1.3 Biodisponibilité et métabolisme : absorption intestinale, distribution,

transport, stockage et excrétion

Le terme de biodisponibilité est utilisé pour décrire l’efficacité globale de l’utilisation des

folates lors de leur absorption intestinale, transport, métabolisme et excrétion.

II-5.1.3.1 Absorption intestinale (Figure 15) :

Les folates polyglutamates, qui constituent les formes naturellement présentes dans les

aliments, doivent être hydrolysés en leurs formes monoglutamates avant leur absorption par la

muqueuse intestinale (McDowell, 2000; Smulders and Stehouwer, 2005). Cette hydrolyse peut-

être catalysée par 2 types de conjugases, l’une issue des sécrétions pancréatiques (γ-glutamyl

hydrolase, γGH) et l’autre associée à la membrane de la bordure en brosse jéjunale (glutamate

carboxypeptidase IV, GCPIV) (Gregory, 2001). L’absorption des folates monoglutamates se

produit dans le jéjunum (Girard et Remond, 2003) par 2 processus distincts : l’un actif et

saturable à un pH optimum acide (Gregory, 2001) et l’autre par diffusion passive lorsque les

concentrations en acide folique deviennent supérieures à 10 µM (Blair et al., 1974). Une fois

absorbés dans la cellule intestinale et avant d’être libérés dans la veine porte, les folates

monoglutamates sont réduits grâce à la dihydrofolate réductase en THF, et subissent une

45

méthylation (5-méthyltétrahydrofolate, 5-MTHF) ou une formylation (Le Grusse et Watier, 1993;

Smulders and Stehouwer, 2005).

II-5.1.3.2 Folates sanguins (Figure 15) :

La forme 5-MTHF monoglutamate de la vitamine est sa forme plasmatique chez l’humain

(Lucock, 2000) et chez la vache (données non publiées). Les folates plasmatiques peuvent être

liés à des protéines de faible affinité, principalement l’albumine, ou à une protéine à affinité

élevée, la Folate Binding Protein pouvant être liée à la membrane cytoplasmique de différents

tissus ou soluble dans différents fluides (plasma, lait) (Henderson, 1990). Selon une étude récente

chez l’homme (Lin et al., 2004), bien que le rôle des folates dans le processus d’hématopoïèse est

non négligeable car les folates érythrocytaires constituent la principale forme de stockage de cette

vitamine, seulement 0,25% des folates plasmatiques sont destinés à la moelle osseuse alors que

98,5% sont captés par les viscères. Les folates sont alors amenés au foie, puis redistribués aux

tissus périphériques sous la forme de 5-MTHF monoglutamates ou encore recyclés en suivant le

cycle entérohépatique (Steinberg, 1984).

II-5.1.3.3 Transport et distribution tissulaire (Figure 15) :

Les folates sont transportés à travers les membranes cellulaires sous leur forme

monoglutamates. Plusieurs systèmes sont impliqués; parmi les mieux caractérisés, il y a le

transporteur des folates réduits (RFC, Reduced Folate Carrier) qui assure un transport facilité et

bidirectionnel des folates et les récepteurs des folates qui permettent l’entrée des folates dans la

cellule par endocytose (Matherly et Goldman, 2003). Les folates se retrouvent majoritairement

dans le foie et les globules rouges sous leurs formes polyglutamates, synthétisées à partir des

formes monoglutamates grâce à la folylpolyglutamate synthétase (Lucock, 2000; Smulders and

Stehouwer, 2005), et c’est sous cette forme qu’ils sont actifs comme coenzymes. La régulation

métabolique des folates dépend de deux processus physiologiques importants : la capacité de

captation du tissu et la rétention des folates tissulaires (Steinberg, 1984). La capacité de captation

des tissus varie en fonction de la présence des récepteurs des folates et de RFC membranaires

alors que la rétention des folates par les tissus est contrôlée par la « polyglutamylation » des

46

folates. L’ajout de résidus glutamate permet à la cellule de retenir les folates en limitant leur

sortie (Shane et Stokstad, 1985).

II-5.1.3.4 Excrétion :

Le fait que seulement 1 à 2% des folates alimentaires soient excrétés sous forme intacte

dans les urines suggère que la majorité des folates sont catabolisés avant leur excrétion urinaire.

La première étape de ce catabolisme est le clivage de la liaison du carbone 9 et de l’azote 10 des

folates polyglutamates intracellulaires, conduisant à la production de ptéridines et de para-

aminobenzoylpolyglutamates (pABGn). Ces derniers sont ensuite hydrolysés en monoglutamate

(pABG) puis N-acétylés en acétamidobenzoylglutamate (apABG) au niveau hépatique avant leur

élimination (Caudill et al., 1998). Chez la femme, le catabolisme des folates est connu pour être

augmenté pendant la grossesse. Selon les travaux de Higgins et al. (2000), l’apABG augmente de

70% durant le premier trimestre de la grossesse.

L’excrétion biliaire de folates est très importante mais la plupart de ces folates seront

réabsorbés au niveau de l’intestin grêle (cycle entérohépatique), une faible proportion seulement

se retrouve dans les fèces (McDowell, 2000).

II-5.1.4 Métabolisme cellulaire

Au niveau cellulaire, les folates sont localisés dans le cytosol et la mitochondrie, et les

formes présentes dans chacun des deux compartiments sont différentes (Lucock, 2000). Par

exemple, dans le cytoplasme des cellules du foie de rat, 45% des folates réduits sont sous forme

de méthyle-THF, 30% sous forme de formyle-THF et 25% sous forme non-substituée. Le

métabolisme mitochondrial des unités monocarbonées fournit des groupements monocarbonés au

métabolisme cytoplasmique, notamment par l’intermédiaire du formate (Appling, 1991).

47

Figure 15 : Absorption, métabolisme, stockage et excrétion des folates (FBP, Folate Binding Protein ; MBBI, Membrane de la Bordure en Brosse Intestinale ; MG, MonoGlutamate ; PG, PolyGlutamate ; FPGS, FolylPolyGlutamate Synthétase ; γ-GH, γ-Glutamyl Hydrolase ; GCPIV, Glutamate CarboxyPeptidase IV ; AF, Acide Folique ; DHF, DiHydroFolate ; THF, TétraHydroFolate ; 5-CH3-THF, 5-méthyl-THF ; pABG, p-AminoBenzoylGlutamate ; RFC, Reduced Folate Carrier ; FR, Folate Recepteur).

FR RFC

Reins

pABG

Urine

48

Dans la cellule, les folates sont des cofacteurs importants de plusieurs voies métaboliques

(Bässler, 1997). Le 5-MTHF, absorbé par la cellule, étant un pauvre substrat pour la

folylpolyglutamate synthétase, il sera préalablement déméthylé par la méthionine synthase (MS)

qui est une enzyme dépendante de la vitamine B12 (Smulders and Stehouwer, 2005). L’ajout des

résidus glutamate, en plus d’augmenter la rétention des folates dans la cellule (Lucock,

2000), améliore l’affinité des folates pour les différentes enzymes (Bässler, 1997).

Le THF, produit par la MS ou issu de la réduction de l’acide folique en dihydrofolate

(DHF) puis THF sous l’action de la dihydrofolate réductase, agit comme transporteur d’unités

monocarbonées pour de multiples réactions (synthèse des bases purine et pyrimidine, régénération

de la méthionine, catabolisme d'acides aminés) (Bässler, 1997). La source principale de

groupements carbonés est la sérine qui réagit avec le THF pour former le 5,10-méthylène-THF et

de la glycine grâce à la sérine hydroxyméthyltransférase (SHMT), enzyme dépendante de la

vitamine B6. La glycine, via le « glycine cleavage system », ainsi que le catabolisme de la choline

et l’histidine, par la voie de la forminoglutamate, fournissent des sources alternatives d’unités à

un carbone (Lucock, 2000).

Le 5,10-méthylène-THF va ensuite pouvoir être métabolisé selon trois voies métaboliques

différentes (Shane et Stokstad, 1985; Smulders and Stehouwer, 2005; Figure 16) :

- La première voie implique la thymidylate synthase qui catalyse la formation du

déoxythymidylate (dTMP) à partir de la déoxyuridylate (dUMP). Cette réaction, en plus de

synthétiser des bases pyrimidines, produit également du DHF, lequel devra être réduit par la

dihydrofolate réductase en THF pour être de nouveau métaboliquement actif (Lucock, 2000).

- La deuxième voie métabolique permet la formation du 10-formyl-THF suite à deux

réactions réversibles : la 5,10-méthylène déshydrogénase et la 5,10-méthényl cyclohydrolase. Le

10-formyl-THF peut aussi être synthétisé à partir du THF et de l’acide formique par la 10-formyl-

THF synthétase. La glycinamide ribonucléotide (GAR) et l’aminoimidazole-4-carboxamide

ribonucléotide (AICAR) vont recevoir une unité carbonée du 10-formyl-THF leur permettant de

développer l’anneau purine (Lucock, 2000).

- La troisième voie consiste à fournir les groupements méthyles nécessaires à la

reméthylation de l’homocystéine, par le biais de la MS-vitamine B12 dépendante, qui conduit à la

synthèse de méthionine et aboutit à la formation de S-adénosylméthionine (SAM), le principal

49

agent méthylant impliqué dans plus d’une centaine de réactions de transméthylation (développée

dans le chapitre II-5.3.4). Dans ce cas, la 5,10-méthylène-THF est réduite en 5-MTHF par une

flavoprotéine, la 5,10-méthylène-THF réductase (MTHFR) (Green et al., 1988). Le donneur

d’électron impliqué dans cette réaction est le Flavine Adénine Dinucléotide Réduit (FADH2), un

coenzyme issu de la vitamine B2 (riboflavine). Cette réaction est irréversible en condition

physiologique.

Le métabolisme des groupements méthyles et des autres unités monocarbonées est

hautement régulé (Shane et Stokstad, 1985; Bailey et Gregory, 1999). Le transfert de carbones de

la sérine vers le THF par la SHMT est inhibé par 5-MTHF et le 5-formyl-THF. Un autre

mécanisme de régulation résulte de l’inhibition de la MTHFR par la SAM, ce qui empêche la

production de 5-MTHF. Ainsi, lorsque la concentration intracellulaire en groupements méthyles

devient importante, comme c’est le cas lors d’un apport élevé en méthionine ou en choline, la

SAM exerce un rétrocontrôle négatif sur la MTHFR, ce qui aboutit à une diminution de l’apport

de nouveaux groupements méthyles via 5-MTHF (Bailey et Gregory, 1999; Smulders and

Stehouwer, 2005).

Il ne faut pas non plus oublier qu’une carence sévère en folates peut conduire à un type

spécifique d’anémie chez l’homme, l’anémie mégaloblastique. Cette situation apparaît à cause

d’une altération de la division cellulaire qui est en relation avec le rôle joué par les folates dans

la synthèse des acides nucléiques (Bailey et Gregory, 1999; Lucock, 2000). De même, de par ses

fonctions dans les voies métaboliques, il n’est pas étonnant de constater l’importance des folates

dans les phénomènes de conception, gestation et croissance (Piedrahita et al., 1999; Burgoon et

al., 2002).

Vu l’implication des folates dans la synthèse des acides nucléiques et indirectement (par

l’intermédiaire de la SAM) dans la méthylation de l’ADN, ce composé pourrait jouer un rôle

crucial dans le maintien de la stabilité et la structure de l’ADN ainsi qu’au niveau de la régulation

transcriptionnelle (Kim, 1999; Choi et Mason, 2000; Duthie et al., 2002; Bollheimer et al., 2005).

50

Figure 16 : Métabolisme des unités monocarbonées dépendant de l’acide folique. AICAR, aminoimidazole-4-carboxamide ribonucléotide ; DHFn, dihydrofolate ; HCOOH, acide formique ; FPG, folypolyglutamate synthétase ; FTS, 10-Formyl-THF Synthétase ; GAR, glycinamide ribonucléotide ; GCS, glycine cleavage system ; Glun, glutamate ; HCY, homocystéine ; MET, méthionine ; MS, méthionine synthase ; MTD, 5,10-méthylène-THF déshydrogénase ; MTCH, 5,10-méthényl-THF cyclohydrolase ; MTHFR, 5,10-méthylène-tétrahydrofolate réductase ; SAM, S-adénosylméthionine ; SHMT, sérine hydroxyméthyltransférase ; THFn, tétrahydrofolate (Adapté de Lucock, 2000).

En effet, une carence en folates diminue la formation de dTMP. Le niveau bas de dTMP

va nuire à la synthèse et à la réparation de l’ADN tandis que l’accumulation de dUMP va

conduire à l’incorporation anormale d’uracile dans l’ADN. Ce phénomène est mutagénique

puisque l’uracile peut s’apparier avec la guanine et générer une mutation ponctuelle (Li et al.,

2003). Mais l’incorporation d’uracile dans l’ADN peut aussi conduire à une instabilité génétique

par un autre mécanisme. Plusieurs enzymes (endonucléases et glycosylases) sont capables

d’exciser l’uracile anormalement incorporée en créant ainsi des cassures simples brins. Ces

cassures, si la carence en folates est durable et si deux uraciles sur des brins opposés sont

FTS HCOO

5-MTHF

5-méthyl-THF THF

5,10-méthylène-THF

THFn Sérine

Glycine

HCY MET

Glun

10-formyl-THF

THFn

GAR AICAR

PurinesPurines

DHFn

Déoxyuridylate

Déoxythymidylate

MTHFR, B2

GCS

Dihydrofolate réductase

Thymidylate synthase

MS, B12

FPG

SHMT, B6

MTD

MTCH

5,10-méthényl-THF THF

SAM

51

excisées, peuvent conduire à l’apparition de cassures double brins, puis à des dommages

chromosomiques contribuant à la carcinogenèse (Li et al., 2003). Par ailleurs, en diminuant la

production de dTMP, la carence en folates altère le pool intracellulaire des

désoxyribonucléotides, et par conséquent, la réparation de l’ADN.

De plus, la SAM est capable de méthyler les cytosines des séquences palindromiques

CpG de l’ADN, en particulier au niveau des promoteurs des gènes. Or la méthylation de l’ADN

est un déterminant épigénétique important dans la transcription des gènes, dans le maintien de

l’intégrité et de la stabilité de l’ADN, dans les modifications de la chromatine et dans l’apparition

de mutations (Jones et Baylin, 2002). Une carence en 5-MTHF peut donc conduire à une

hypométhylation de l’ADN qui est associée à une augmentation de l’expression des gènes

(Duthie et al., 2002).

II-5.2 Vitamine B12

II-5.2.1 Structure et définition

La vitamine B12 ou cobalamine a été la dernière vitamine à être découverte en 1948 car

elle ne se trouve pas dans les végétaux mais est uniquement synthétisée par les microorganismes.

La cobalamine est une macromolécule composée d'un noyau tétrapyrrolique qui renferme en son

centre un atome de cobalt auquel sont reliés différents groupements permettant de répertorier

quatre formes actives de vitamine B12: cyanocobalamine, hydroxocobalamine (formes

oxydées et stables), méthylcobalamine et adénosylcobalamine (deux coenzymes réduits

présents chez les mammifères) (Le Grusse et Watier, 1993; Figure 17).

52

Figure 17 : Structure chimique de la vitamine B12.

Cette structure comprend également un nucléotide : le 5,6-diméthylbenzimidazole dont le

groupe imidazole est relié au cobalt et le phosphate a l’un des noyaux pyrrols (McDowell, 2000).

Ce nucléotide peut être remplacé par du benzimidazole ou de l’imidazole et alors former des

analogues de la vitamine B12 qui conservent donc une structure similaire tout en étant dépourvus

d’activité vitaminique. Parmi eux, on peut nommer la cobinamide méthyl phosphate qui agirait

comme inhibiteur compétitif en bloquant le système de transport des formes actives de la

vitamine B12 (Ishida et al., 1994). Il se pourrait aussi que certains de ces analogues soient formés

lors d’une étape intermédiaire de la biosynthèse de la vitamine B12 et soient alors des formes

inachevées de la vitamine (McDowell, 2000).

II-5.2.2 Données nutritionnelles : sources alimentaires, besoins, carences

Plusieurs espèces bactériennes présentes dans le tractus digestif et le rumen sont capables

de synthétiser la vitamine B12. Une telle synthèse a une importance considérable pour les

animaux coprophages et les ruminants qui, si l’apport en cobalt est adéquat (0,1 à 0,2 mg/kg pour

ces derniers), sont totalement indépendants des sources externes de vitamine B12 contrairement à

l’homme. Les aliments d’origine animale sont une bonne source de vitamine B12 notamment le

foie et le lait (542 et 54 µg/kg respectivement chez la vache laitière) (McDowell, 2000). Girard et

R = CN ; cyanocobalamine R= OH ; hydroxycobalamine R = CH3 ; méthylcobalamine R = 5-désoxyadénosyl ; adénosylcobalamine

53

Matte (2005b) ont montré qu’un apport de 10 mg de vitamine B12, par injection intramusculaire, à

des vaches Holstein en lactation permet d’améliorer significativement les quantités retrouvées

dans le lait.

Chez les ruminants, seul un apport insuffisant en cobalt, pourrait faire apparaître des

signes de carence. Par contre, Sutton et Elliot (1972) soulignent également que le type de régime

alimentaire pourrait influencer la synthèse et l’utilisation de cette vitamine, notamment en

augmentant la production d’analogues de la vitamine B12 avec une alimentation riche en

concentrés. D’après le NRC (2001), les besoins en vitamine B12 pour les bovins laitiers devraient

se situer entre 0,34 et 0,68 µg/kg de poids corporel. Chez l’homme, l’absence ou une diminution

de synthèse du facteur intrinsèque (protéine intervenant lors de l’absorption intestinale de la

vitamine B12) peut entraîner une carence suite à une malabsorption de la vitamine. Le résultat

d’une carence en vitamine B12 chez l’homme est une anémie pernicieuse accompagnée d’autres

signes cliniques aussi observés chez l’animal : lésions neurologiques, perte d’appétit et de

croissance, faiblesse musculaire pour les principaux (McDowell, 2000).

II-5.2.3 Métabolisme : absorption intestinale, distribution, transport,

stockage et excrétion

II-5.2.3.1 Absorption intestinale

Dans les aliments, la vitamine B12 reste attachée sur les protéines alimentaires. Le

processus d'absorption de cette vitamine est complexe car il va nécessiter l’intervention de

plusieurs composés capable de lier la vitamine.

Tout d'abord les sécrétions acides de l'estomac libèrent la cobalamine des protéines

alimentaires. Dans le milieu acide qu’est l’estomac, cette dernière va alors préférentiellement se lier

à une protéine anciennement appelée « protéine R », l’haptocorrine, d'origine salivaire et

gastrique, jusqu'à ce que les enzymes pancréatiques la détruisent (Russell-Jones et Alpers, 1999).

De nouveau libre dans un environnement plus alcalin, la vitamine B12 va pouvoir se complexer au

facteur intrinsèque (Nicolas et Guéant, 1994). Le facteur intrinsèque est une glycoprotéine

(mucoprotéine) sécrétée par les cellules pariétales de l'estomac, qui va permettre à la cobalamine

de franchir la barrière intestinale au niveau iléal (Ganesan et al., 2002). Il est sécrété en grande

quantité par rapport aux besoins de liaison avec la vitamine B12; seulement 1% du facteur

54

intrinsèque total est utilisé. En se liant à la vitamine B12, le facteur intrinsèque se dimérise ce qui

lui confère une meilleure résistance à la protéolyse et en même temps protège la vitamine B12 du

catabolisme par les bactéries intestinales (Combs, 1998). Le complexe facteur

intrinsèque/vitamine B12 va se fixer sur un récepteur spécifique de la bordure en brosse des

cellules épithéliales de l’iléon : la cubiline. Ce récepteur possède deux sites de liaison : l’un est

spécifique à la partie protéique du facteur intrinsèque et l’autre spécifique à la cobalamine

(Nicolas et Guéant, 1994). Une fois fixée au récepteur, le complexe va traverser la paroi du tube

digestif par endocytose et le facteur intrinsèque est dégradé dans l’entérocyte libérant ainsi la

vitamine B12 dans le sang sous une forme liée à une protéine : la transcobalamine II (Seetharam

et al., 1999; Seetharam et Li, 2000; Figures 18 et 19).

Figure 18 : Mécanismes d’absorption de la vitamine B12 (Tiré de Le Grusse et Watier, 1993).

Donc les patients ayant une diminution de sécrétion d’acide gastrique, un

dysfonctionnement du pancréas ou une atrophie du fundus, où est produit le facteur intrinsèque,

vont absorber faiblement la vitamine B12 (Allen et al., 1978; Behrns et al., 1994; Cohen et al.,

ESTOMAC

PANCREAS

ILEON

SANG

Vitamine B12

Protéine Alimentaire (cobalophiline)

Protéine R (Haptocorrine)

Facteur Intrinsèque

Cubiline

55

2000). Vu la complexité des mécanismes d’absorption, l’absorption de la vitamine B12 est lente

(pic de concentration sanguine entre 6 et 8 heures après ingestion) et limitée (l’absorption est

saturée au-delà de 0,7 à 1,1 nmol) (Combs, 1998).

A des plus fortes concentrations, il existe aussi un mécanisme d’absorption passive

indépendant du facteur intrinsèque mais dont l’efficacité est faible (1% de la dose ingérée) (Le

Grusse et Watier, 1993). Chez les ruminants, 3% du cobalt ingéré va être converti en vitamine B12

dans le rumen et seulement 1 à 3% de cette vitamine produite va être absorbée (McDowell, 2000).

II-5.2.3.2 Transport sanguin

Dans le sang, la vitamine B12 est toujours liée à des protéines de transport spécifiques, les

transcobalamines ou l’haptocorrine sérique, qui assurent l’internalisation dans les cellules grâce à

un phénomène d’endocytose qui s’opère au niveau des récepteurs membranaires (Seetharam et

al., 1999; Figure 19).

Il existe trois types de transcobalamines : la transcobalamine I est impliquée dans le

stockage de la cobalamine, la transcobalamine II a un rôle dans le transport intracellulaire de la

vitamine B12 et enfin la transcobalamine III, dont les fonctions encore inconnues, semblerait

participer à la captation de la vitamine B12 par les hépatocytes (McDowell, 2000). La

transcobalamine de type II est la plus étudiée car elle facilite le transfert dans le sang portal de la

vitamine B12 (Quadros et al., 1999) et que le dosage de cette protéine plasmatique saturée en

cobalamine (holo-transcobalamine) serait un marqueur sensible d’une carence en cette vitamine

(Herrmann et Geisel, 2002; Nexo et al., 2000).

II-5.2.3.3 Entrée et distribution tissulaire

Le complexe vitamine B12-transcobalamine II, présent dans le sang portal, se combine

aux récepteurs spécifiques présents dans les membranes cellulaires de nombreux tissus (Figure

19). Ce récepteur existe sous deux configurations : monomérique, forme minoritaire et inactive,

ou dimérique qui prédomine et permettrait d’assurer sa fonction d’importation de la vitamine B12

dans la cellule (Bose et Seetharam, 1997). Cette dimérisation du récepteur nécessite la présence

de cholestérol présent dans la bicouche lipidique constituant la membrane cellulaire, sinon il

56

reste sous forme de monomère (Bose et al., 1996). L’entrée dans la cellule de la vitamine B12 se

fait par endocytose et dans le cytoplasme, les vésicules d’endocytose fusionnent avec des

lysosomes. Après la dégradation lysosomale de la protéine de transport, la cobalamine libre est

essentielle soit pour sa rétention intracellulaire ou son utilisation en tant que coenzyme

(Seetharam et al., 1999; Figure 19).

Figure 19 : Implication des protéines de transport de la vitamine B12 dans les mécanismes d’absorption intestinale (figure de gauche) et d’entrée de la vitamine dans les cellules (figure de droite). Les flèches en pointillés représentent les voies encore inconnues. (Cbl, Cobalamine ; MeCbl, méthylcobalamine ; AdoCbl, Adénosylcobalamine ; IF, facteur intrinsèque ; Me-MalonylCoA mutase, méthylmalonylCoA mutase ; TCII, transcobalamine II) (Adapté de Seetharam et al., 1999).

La vitamine B12 est stockée en quantité significative dans les différents organes dont

approximativement 60% dans le foie humain (Le Grusse et Watier, 1993). Des travaux chez la

vache laitière suggèrent que le foie apparaît aussi comme un organe central dans le stockage et le

métabolisme de la vitamine B12. Après l’ingestion de 500 mg de cyanocobalamine, Girard et al.

(2001) ont montré que 27% de la cyanocobalamine est retrouvée dans le sang portal et 46% de la

vitamine libérée dans le sang portal serait extraite par le foie.

IF-Cbl

TCII-Cbl

IF-Cbl

TCII

IF-Cbl

IF-Cbl

TCII

TCII-Cbl

Synthèse endogène

TCII

Dégradation IF dans lysosomes

IF-R/Cubiline

Lumière intestinale

TCII-Cbl

TCII-R Cholestérol

TCII-Cbl

TCII-Cbl

Lysosomes

Dégradation TCII

Cbl MeCbl

AdoCbl

Méthionine synthase

Me-MalonylCoA mutase

Circulation sanguine

57

II-5.2.3.4 Excrétion

Au total, l’élimination quotidienne de la vitamine B12 est de 2 à 5 µg chez l’homme

(McDowell, 2000). La cobalamine, non utilisée par l’organisme, est éliminée dans la bile, par

voie fécale ou dans les urines mais cette dernière voie est minimale (< 0,25 µg/jour) (Le Grusse

et Watier, 1993).

La majorité de la vitamine B12 excrétée par la bile dans l’intestin est réabsorbée au niveau

iléal (environ 65 à 75%) selon le mécanisme d’absorption actif impliquant le facteur intrinsèque

(McDowell, 2000). Ce cycle entérohépatique constitue un moyen très efficace de conservation

de la vitamine B12.

II-5.2.4 Métabolisme cellulaire

Dans les tissus périphériques, les formes actives de la vitamine B12 sont

l'adénosylcobalamine, au niveau mitochondrial, qui sert de coenzyme à la méthylmalonyl-CoA

mutase et la leucine-2,3-aminomutase (première étape dans la dégradation de cet acide aminé)

et la méthylcobalamine, dans le cytoplasme, qui est indispensable au bon fonctionnement de la

MS (McDowell, 2000; Figure 20). Chez l’homme, la méthylcobalamine constitue 60 à 80% de la

cobalamine plasmatique, pendant que l’adénosylcobalamine est majoritaire dans toutes les

cellules des différents tissus (60 à 70% dans le foie) (McDowell, 2000).

Au niveau cytoplasmique, la réaction de transméthylation dépendante de la

méthylcobalamine explique pourquoi cette vitamine joue un rôle fondamental (Krautler, 2005)

dans les tissus à renouvellement rapide (THF est impliqué dans la synthèse de l’ADN, voir

chapitre II-5.1.4) ou ayant un métabolisme protéique intense (régénération de la méthionine)

(McDowell, 2000). En effet, les relations étroites entre la vitamine B12 et le métabolisme des

folates sont mises en évidence avec l’hypothèse du « methyl trap ». La MS, avec son coenzyme,

enlève le groupe méthyle du 5-MTHF et permet la régénération de la méthionine à partir

d’homocystéine et du THF, accepteur de groupements monocarbonés et impliqué entre autre dans

la synthèse des acides nucléiques. Mais avec une carence en vitamine B12, la MS ne déméthyle

pas efficacement le 5-MTHF qui va alors s’accumuler dans le plasma (augmentation de 50 à

100% chez le mouton) car il n’est pas bien retenu par les tissus (Smith et Osborne-White, 1973).

De telles conditions entraînent alors une carence fonctionnelle en folates qui empêche la synthèse

58

d’ADN et la régénération de la méthionine, ce qui peut entraver le cycle des méthylations (Shane

et Stokstad, 1985).

Figure 20 : Métabolisme cellulaire de la vitamine B12. AdCbl, adénosylcobalamine ; Cbl, cobalamine ; CoA, coenzyme A ; MeCbl, méthylcobalamine ; TCII, transcobalamine II ; 5-mTHF, 5-méthyltétrahydrofolate, THF ; tétrahydrofolate (Adapté de Le Grusse et Watier, 1993).

L’adénosylcobalamine intervient dans une réaction d’isomérisation qui permet la

conversion du méthylmalonyl-CoA en succinyl-CoA (Krautler, 2005) qui pourra entrer dans le

cycle de Krebs et participer à la néoglucogenèse. Le méthylmalonyl-CoA peut être issu du

propionate (d’origine métabolique ou alimentaire), d’acides gras à nombre impair de carbones ou

encore du catabolisme de 4 acides aminés (isoleucine, valine, thréonine et méthionine). Le blocage

de la méthylmalonyl-CoA mutase, consécutif à un déficit en cobalamine, se traduit par une

accumulation d’acide méthylmalonique qui sera éliminé par voie urinaire (Combs, 1998).

II-5.3 Méthionine

II-5.3.1 Structure et définition

La méthionine est un acide aminé essentiel, dont les apports sont souvent limitants pour

la productivité des vaches laitières (Schwab et al., 1992 ; Rulquin et al., 1993). La présence d’un

Méthylmalonyl-CoA Succinyl-CoA

TCII-Cbl Cbl

TCII

Cbl

AdCbl

MeCbl Homocystéine Méthionine

MITOCHONDRIE CYTOPLASME

5-mTHF THF

Méthylmalonyl-CoA mutase

Méthionine synthase

59

atome de soufre dans la molécule de méthionine la rend très hydrophobe, conférant ainsi des

propriétés particulières aux protéines qui la contient (Figure 21 A). En plus de son rôle comme

acide aminé constitutif des protéines corporelles, la méthionine joue également un rôle clé dans

les voies de transméthylation et transsulfuration (Finkelstein et Martin, 1986 ; Brosnan et

Brosnan, 2006 ; Brosnan et al. 2007).

A) B)

Figure 21 : Structures chimiques A) de la méthionine B) et de son dérivé : la S-

Adénosylméthionine.

II-5.3.2 Méthionine dans la synthèse protéique

Alors que certains acides aminés sont uniquement impliqués dans la fonctionnalité des

protéines en maintenant une structure spatiale adéquate, la méthionine intervient aussi dans

l’initiation de la traduction. En effet, c’est l’acide aminé initiateur de la synthèse de toutes les

protéines eucaryotes. Lors de ce phénomène, l’ARNt spécifique de la méthionine (portant

l’anticodon : CAU), accompagné de plusieurs facteurs de traduction (notamment eIF-2 et de

GTP), de la sous-unité 40S du ribosome et d’ARNm, va pouvoir fixer la méthionine sur le codon

initiateur : AUG pour initier la synthèse protéique. Drabkin et RajBhandary (1998) suggèrent que

c’est la nature hydrophobe de la méthionine qui favorise la liaison entre l’ARNt et eIF-2. Avec

une double mutation dans le codon et l’anticodon, ils ont été capable de montrer que la valine,

acide aminé hydrophobe, pourrait initier la traduction dans les cellules des mammifères de

manière plus efficace que la glutamine de nature polaire.

L’hydrophobicité de la méthionine place l’acide aminé dans le cœur hydrophobe défini

par la structure tertiaire de la protéine mais elle pourrait aussi se trouver à la surface des protéines

C H CH2 CH2 S

NH2

COOH

CH3

S

60

(Levine et al., 1996). Brosnan et Brosnan (2006) précisent également que c’est un acide aminé

souvent retrouvé dans la bicouche lipidique des membranes. Tous les acides aminés sont victimes

des attaques de divers agents oxydants mais les plus sensibles à l’oxydation sont les acides

aminés aromatiques et soufrés (Stadtman, 1993). Et ainsi exposée, la méthionine peut donc être

oxydée en méthionine sulfoxide par diverses espèces oxygénées réactives. Néanmoins, ces

modifications oxidatives peuvent être réparées grâce à la présence de méthionine sulfoxide

réductase. De récentes études suggèrent que la méthionine dans les protéines pourrait constituer

un système endogène de défense antioxydant grâce à son cycle d’oxydation et de réduction

(Levine et al., 1996; Moskovitz, 2005). Les fonctions des protéines peuvent être affectées par

l’oxydation de certains de leur résidu méthionine, créant des changements de conformation dans

les protéines du fait du remplacement de résidus hydrophobes (méthionine) par d’autres plus

hydrophiles (méthionine sulfoxide) (Moskovitz, 2005). Donc il apparaît que plusieurs protéines

pourraient être régulées selon le statut de leurs résidus méthionine (oxydé ou réduit).

II-5.3.3 S-adénosylméthionine et les réactions de méthylation

Le métabolite actif de la méthionine est la S-adénosylméthionine (SAM) qui est un

composé biologique important (Brosnan et al., 2007; Figure 21 B) car c’est le second substrat

enzymatique après l’ATP (Fontecave et al., 2004). La SAM est synthétisée lors d’une

réaction entre la méthionine et l’ATP catalysée par une méthionine adénosyltransférase

(Finkelstein, 1990).

L’utilité primordiale de la SAM est de donner son groupement méthyle à une grande

variété d’accepteurs (acide aminés, lipides, protéines, ADN, ARN,…). Ces réactions sont

catalysées par des méthyltransférases dont la propriété commune est d’être inhibées par

leur produit, la S-adénosylhomocystéine (SAH) (Brosnan et al. 2007; Williams et

Schalinske, 2007). Chez l’homme, il a été estimé que la guanidinoacétate N-

méthyltransférase (GAMT, responsable de la synthèse de créatine) et la

phosphatidyléthanolamine N-méthyltransférase (PEMT, synthèse de phosphatidylcholine)

sont les réactions de méthylation majeures utilisant la SAM (Stead et al., 2006).

Récemment, Mudd et al. (2007) soulignent également l’importance de la glycine N-

61

méthyltransférase (GNMT, synthèse de sarcosine) pour éliminer les excès de groupements

méthyles.

Selon Stead et al. (2006), la PEMT serait la méthyltransférase qui consomme la

majorité des groupes méthyles fournit par la SAM; cette réaction a un impact important sur

le métabolisme des lipides hépatiques. Cette enzyme catalyse une série de réactions par

lesquelles trois groupements méthyles sont donnés par la SAM pour transformer la

phosphatidyléthanolamine (PE) en phosphatidylcholine (PC) contribuant ainsi à former

trois molécules d’homocystéine (Ridgway et Vance, 1988). Chez l’homme, cette voie

métabolique serait responsable d’un tiers de la production de PC, le reste serait synthétisé à

partir de la choline par la voie CDP-choline (Williams et Schalinske, 2007). Ces deux voies

produisent différents types de PC: à partir de la choline, les principales espèces formées

contiennent des acides gras saturés à chaine moyenne alors que la PEMT forme de la PC

avec des acides gras polyinsaturés à longues chaines (DeLong et al., 1999). En utilisant des

souris « knockout » pour le gène PEMT, Noga et al. (2002) ont montré que la PC formée

par cette voie est préférenciellement utilisée pour la synthèse des VLDL où il représente le

lipide majoritaire. En effet, les souris PEMT -/- de cette étude voient leur production de PC

diminuer ainsi que la sécrétion des VLDL, menant à une accumulation de lipides dans le

foie et à une stéatose. De plus, il est intéresant de noter qu’une inhibition de la PEMT va

modifier les compositions en acides gras du plasma et des membranes. Or le ratio PC/PE

est un marqueur de la fluidité membranaire et par conséquent, la méthylation de ces

phospholipides va jouer un rôle important dans la transduction des signaux à travers des

récepteurs membranaires (Sugden, 2006).

II-5.3.4 Le métabolisme de la méthionine

II-5.3.4.1 Les voies métaboliques

Le métabolisme de cet acide aminé est subdivisé en transméthylation, reméthylation et

transsulfuration (Scott, 1999; Selhub, 1999; Mason, 2003; Brosnan et Brosnan, 2006; Brosnan et

al., 2007; Figure 22). La transméthylation implique l’activation de la méthionine en SAM par une

méthionine adénosyltranférase, suivie par un transfert du groupement méthyle de SAM par une

62

méthyltransférase. La transméthylation est complétée par une hydrolyse réversible de SAH en

homocystéine et adénosyle.

L'homocystéine se retrouve à l'intersection de deux voies métaboliques : la reméthylation

et la transsulfuration. La MS reméthyle l’homocystéine en méthionine en conservant ainsi le

squelette carboné de cet acide aminé. La MS utilise le 5-MTHF, produit par la MTHFR, comme

donneur de groupements méthyle. La MTHFR, en générant ainsi de nouveaux groupements

méthyles à partir du pool d’unités monocarbonés (méthylnéogénèse), joue un rôle métabolique

primordial car elle protège l’organisme des situations où les apports alimentaires en

groupements méthyles (méthionine, bétaine ou choline) seraient limitants. Les tissus hépatiques

et rénaux ont une alternative pour la reméthylation de l’homocystéine via la bétaine

homocystéine méthyltransférase (BHMT) dépendante du zinc (Melse-Boonstra et al., 2005).

Elle emploie la bétaine comme donneur de groupements méthyles.

Le catabolisme de la méthionine se fait par la voie de transsulfuration, une séquence de

réactions irréversibles catalysées par deux enzymes et qui aboutit à la production de cystéine à

partir de l'homocystéine. La condensation de la sérine avec l’homocystéine produit la

cystathionine grâce à la cystathionine bêta-synthase. La cystathionine est ensuite hydrolysée en

cystéine, alpha-kétobutyrate et ammoniac et cette réaction est catalysée par la cystathionine

gamma-lyase. Ainsi, la méthionine permet la synthèse de cystéine, un acide aminé non essentiel,

nécessaire non seulement à la synthèse protéique mais aussi pour la synthèse de glutathion. Par

ailleurs, après le passage par de nombreux intermédiaires, l’alpha-kétobutyrate peut permettre la

formation de succinyl-CoA, substrat du cycle de Krebs, pouvant, par la suite, mener à une

production de glucose via la néoglucogenèse. Cette voie dépend de la vitamine B12 au niveau de

la méthylmalonyl CoA mutase (MUT). Il est aussi important de souligner que cette même voie,

impliquant la MUT, est essentielle pour le métabolisme du propionate, des acides gras à nombre

impair de carbones et certains acide aminés : l’isoleucine, la valine, la thréonine et, comme décrit

ci-haut, la méthionine.

II-5.3.4.2 Les régulations

Vu l'importance de ces voies métaboliques, il n'est pas étonnant que de nombreux

chercheurs se soient intéressés à leur régulation (Selhub, 1999; Lucock, 2000; Rowling et al.,

63

2002; Brosnan et Brosnan, 2006). Le contrôle du métabolisme de la méthionine est complexe.

L’équilibre de l’homocystéine entre reméthylation et transsulfuration serait déterminé par la

disponibilité en groupements méthyles (Mudd et Poole, 1975). Chez l’homme, quand les

apports en groupements méthyles sont importants, le besoin de reméthylation est plus faible

donc l’homocystéine est majoritairement catabolisée. Dans le foie, il apparaît que cet équilibre

est régulé par les niveaux cellulaires en SAM par des mécanismes allostériques. La méthionine

adénosyltransférase est activée par son produit et, ainsi, les concentrations hépatiques de SAM

seraient élevées lors d’apports importants en méthionine. La SAM agit comme activateur de la

cystathionine bêta-synthase, stimulant ainsi la transsulfuration mais aussi comme inhibiteur de

la MTHFR, réduisant simultanément, la disponibilité des groupements méthyles pour la

reméthylation.

En plus, la GNMT, enzyme qui utilise la SAM pour méthyler la glycine et produire de la

sarcosine, est moins sensible à l’inhibition par la SAH qu’à l’inhibition allostérique du 5-MTHF

(Wagner et al., 1985; Luka et al., 2007). Ce système de régulation permet d’une part, aux

groupements méthyles d’être conservés pour des réactions de méthylation d’importance

biologique et, d’autre part, la formation de la sarcosine, un composé non toxique, qui n’a pas

d’utilité biologique connue hormis qu’elle peut être oxydée dans la mitochondrie pour générer

de la glycine, et donc permettre, si besoin est, le réapprovisionnement du pool des unités

monocarbonées. Cette réaction s’avère importante pour l’organisme car elle permet de réguler le

ratio SAM/SAH, considéré comme un indicateur de la capacité de méthylation dans la cellule

(Williams et Schalinske, 2007).

En résumé, quand l’apport en méthionine est suffisant, la SAM est produite en grande

quantité. Une fois les besoins majeurs de méthylation comblés, l’accumulation de la SAM va alors

inhiber la MTHFR, la synthèse de 5-MTHF ne s’avérant plus nécessaire et activer la dégradation de

l’homocystéine. Au contraire, avec un apport limité en méthionine, il y a moins de SAM formée

d’où une moindre inhibition de la MTHFR. Le 5-MTHF synthétisé est alors disponible pour la

formation de méthionine via la reméthylation de l’homocystéine et contribue à inhiber la GNMT,

dirigeant l’utilisation de la méthionine disponible vers les réactions essentielles de méthylation.

L’importante caractéristique du métabolisme de la méthionine est sa dépendance vis-à-

vis du statut en 4 vitamines B. L’acide folique, en tant que 5-MTHF, est accepteur et donneur

64

de groupements méthyles pour la MS. Le 5-MTHF est produit par la MTHFR qui contient du

FAD, un dérivé de la riboflavine (vitamine B2). L’activité de la MS dépend aussi de la vitamine

B12 qui agit comme coenzyme. Enfin le pyridoxal phosphate (vitamine B6) est le coenzyme pour la

cystathionine bêta-synthase et la cystathionine gamma-lyase. Par conséquent, puisque ces

vitamines sont impliquées dans les voies de reméthylation et transsulfuration, il n’est pas

surprenant que des carences en ces vitamines induisent des changements dans les niveaux

d’homocystéine (Strain et al., 2004).

II-6 CAS PARTICULIER DE LA VACHE LAITIERE

II-6.1 Caractéristiques du cycle des méthylations

Chez les animaux monogastriques, les principales sources alimentaires de

groupements méthyles sont la méthionine, la choline et la créatine. Par contre chez les

ruminants, l'alimentation est pauvre en créatine et méthionine, tandis que la choline est

détruite par la microflore ruminale (Dawson et al., 1981; Baldi et Pinotti, 2006) d'où la nécessité

pour ces animaux de développer des mécanismes adaptés. Le métabolisme des groupements

méthyles est généralement conservateur avec un taux relativement faible de catabolisme des

unités à un carbone (notamment de la choline) et un taux élevé de synthèse de novo des

groupements via la voie du THF (Snoswell et Xue, 1987; Pinotti et al., 2002). Les

précurseurs néoglucogéniques, principalement la sérine et la glycine, sont les principales

sources de ces nouveaux groupements méthyles. Par contre, dépendant de l’équilibre

énergétique et du stade physiologique, ces précurseurs peuvent être insuffisants chez le

ruminant. En effet, l’étude du métabolisme des groupes méthyles chez des brebis a mis en

évidence une augmentation de l’activité de la phospholipide méthyltransférase (PEMT) et

de la MS de 33 et 34% respectivement (Xue et Snoswell, 1985). Ainsi, en début de lactation

chez la vache laitière, la demande en groupements méthyles est élevée alors que la pression

pour la synthèse de glucose est augmentée pour supporter la production laitière et les

besoins énergétiques croissants créant une compétition entre néoglucogenèse et

méthylnéogenèse pour les mêmes précurseurs (Armentano, 1994 ; Girard et Matte, 2005a).

65

Figure 22 : Le métabolisme de la méthionine. CBS, Cystathionine β-synthase; CGL, Cystathionine γ-lyase; BHMT, Bétaine méthyltransférase; DMG, Diméthylglycine; GNMT, Glycine N-méthyltransférase; MAT, Méthionine adénosyltransférase; MS, Méthionine synthase; MT, Méthyltransférase; MTHFR, Méthylènetétrahydrofolate réductase; Pi, phosphate; SAH, S-adénosylhomocystéine; SAHH, S-adénosylhomocystéine hydrolase; SAM, S-adénosylméthionine; SHMT, Sérine hydroxyméthyltransférase; THF, Tétrahydrofolate; 5-MTHF, 5-méthylTHF; 5,10-CH2THF, 5,10-méthylèneTHF (d’après Brosnan et al., 2007).

II-6.2 Effet d’apports en acide folique et vitamine B12

Le métabolisme des groupements monocarbonés est un réseau de réactions biochimiques

interreliées qui aboutit non seulement à la production de groupements méthyles mais aussi de

cystéine et dont les éléments clés sont l'acide folique, la vitamine B12 et la méthionine (Le Grusse

et Watier, 1993; Figure 23). De plus la vitamine B12 est étroitement liée au métabolisme de

Protéines alimentaires

Protéines corporelles

Méthionine SAM

SAH Homocystéine

Cystathionine

Cystéine

ATP

Glycine

ADP+Pi

Sarcosine

MAT

GNMT X-CH3

XMT

Bétaine

DMG

BHMT

THF

5-MTHF

5,10-CH2THF

SHMT

MTHFR

MS

H2O Adenosine H2O

Sérine CBS

H2O

NH4+ + alpha-ketobutyrate

CGL

Glutathion Oxydation

Méthionine SAM

SAH

MS

CBS

SAHH

Choline

66

l’énergie et de la néoglucogenèse. En début de lactation, les besoins en groupements méthyles

ainsi qu'en glucose de la vache laitière sont très importants. Une compétition entre ces deux

métabolismes va rendre déterminants les apports en acide folique et vitamine B12 pour la

vache laitière afin d'optimiser ces voies métaboliques.

Sous certaines conditions, les apports en acide folique peuvent être limitants pour la vache

laitière (Girard et al., 1995; Girard et Matte, 1998).

Dans une première expérience, ces auteurs rapportent que des injections intramusculaires

de 160 mg d'acide folique par semaine à des vaches laitières, ont permis d'augmenter la

production laitière, le transfert des folates dans le lait et enfin la teneur en protéines du lait

pendant la dernière moitié de la lactation. Après le vêlage, les suppléments d'acide folique ont

augmenté les concentrations des protéines du lait de 32,3 à 35,1 g/kg pour les vaches

multipares mais n’ont eu aucun effet chez les vaches primipares (Girard et al., 1995).

Des résultats similaires ont été mis en évidence dans une deuxième expérience (Girard et Matte,

1998) où les auteurs ont donné des suppléments alimentaires de 0, 2 ou 4 mg d'acide folique par

kilogramme de poids corporel à des vaches laitières pendant 4 semaines avant le vêlage et jusqu'à

305 jours de lactation. Ces supplémentations augmentent les folates dans le sérum et dans le lait.

Là encore, seule la production laitière des vaches multipares a augmenté linéairement avec les

quantités d'acide folique ingérées pendant les 305 jours de lactation. L’intensité de cette

réponse variait selon le stade de lactation: une augmentation de 6% de lait pour les vaches

multipares recevant 4 mg d'acide folique pendant les 100 premiers jours, de 10% entre 100 et

200 jours de lactation, et aucun effet pendant les 100 derniers jours. De plus une diminution de

l'azote non-protéique dans le lait, mise en évidence chez les vaches multipares nourries avec un

supplément en acide folique, indique que l'azote serait utilisé plus efficacement (Girard et Matte,

1998).

67

Figure 23 : Voies métaboliques impliquant l’acide folique et la vitamine B12 et leurs régulations (BHMT, Bétaine Homocystéine MéthylTransférase; CBS, Cystathionine β Synthase; DMG, DiMéthylGlycine; GC, γ Cystathioninase; GCL, Glutamate Cystéine Ligase; GNMT, Glycine N-MéthylTransférase; GSH, Glutathion réduit; GSS, GSH Syntéthase; MAT, Méthionine AdénosylTransférase; MMCM, MéthylMalonyl-CoA Mutase; MS, Méthionine Synthase; MTHFR, 5,10-CH2-THF Réductase; SAH, S-AdénosylHomocystéine; SAM, S-AdénosylMéthionine; SHMT, Sérine HydroxyMéthylTransférase; THF, Tétrahydrofolate).

Dans ces deux expériences, les vaches ont reçu un régime alimentaire dont les apports

calculés en méthionine étaient inférieurs aux recommandations du NRC (2001). Donc les effets

obtenus pourraient avoir été en partie médiés par une amélioration de la capacité de

régénération de la méthionine et une amélioration du cycle des méthylations. De plus, malgré un

apport adéquat en cobalt, les teneurs plasmatiques en vitamine B12 étaient basses en début de

lactation mais remontaient à partir de 8 à 12 semaines de lactation. Ceci pourrait venir d'une prise

alimentaire qui, en début de lactation, n'est pas à son maximum ce qui en plus pourrait favoriser

SubstratCH3-substrat

SAH SAM

Méthionine Méthionine

synthase SAM

SAM

5-MéthylTHF THF

5,10-MéthylèneTHF

10-formylTHF

5-MTHFR

B12

B12

Cystathionine

Cystéine

Αlpha-ketobutyrate

Propionyl-coA

D-méthylmalonylCoA

L-méthylmalonylCoA

Cycle de Krebs

Méthyl malonylCoA mutase

Glucose succinylCoA

Cystathionine synthase

Synthèse ADN

Sérine

Sérine Glycine

Formate

Propionate

Homocystéine

Cycle de l’acide folique

Cycle de reméthylation

Cycle de transsulfuration

Activation

Inhibition

5-MTHF

68

la synthèse, par les microorganismes du rumen, d'analogues de la vitamine B12 au détriment

des formes biologiquement actives (Girard et Matte, 1999).

Ces mêmes auteurs ont donc entrepris une troisième étude afin d’éclaircir les interactions

entre des suppléments alimentaires d’acide folique et de méthionine protégée de la dégradation

ruminale sur les performances de lactation et le métabolisme des folates chez des vaches laitières

multipares durant 305 jours de lactation. Toutes les vaches ont reçu une alimentation de base

couvrant 70% des besoins en méthionine mais pour la moitié d’entre elles, de la méthionine

protégée de la dégradation ruminale a été ajoutée à la ration de base. A l’intérieur de chaque niveau

de méthionine, 0, 3 ou 6 mg d’acide folique par kg de poids corporel ont été distribués. La

production laitière et le rendement en composantes du lait n’ont pas été affectés par les

suppléments mais seules les vaches, recevant les apports supplémentaires en méthionine, ont eu

une augmentation des concentrations en protéines du lait. Néanmoins les concentrations de

vitamine B12 plasmatiques sont restées faibles pendant toute la lactation même si ces

concentrations ont évolué au cours de la lactation de façon similaire à celles décrites

antérieurement. Il est donc possible que, malgré un apport adéquat en cobalt, le faible statut en

vitamine B12 surtout en début de lactation ait interféré avec le métabolisme des folates lors de cette

expérience (Girard et al., 2005).

C’est pourquoi leurs travaux se sont orientés vers une nouvelle étude dans laquelle les

vaches laitières primipares, recevant la même ration de base que l’expérience précédente (Girard

et al., 2005), additionnée de méthionine protégée de la dégradation ruminale et de suppléments

alimentaires journaliers d'acide folique (4 mg / kg de poids corporel), ont reçu ou non des

injections intramusculaires hebdomadaires de vitamine B12 de la 4e à la 18e semaine de lactation.

Ces injections ont eu tendance à augmenter la production laitière et ont augmenté le rendement

de ses composantes: solides totaux, gras, lactose et vitamine B12 (Girard et Matte, 2005b). En

plus, l’augmentation de l’hémoglobine sanguine observée avec les suppléments d’acide folique et

de vitamine B12 se reflète par une amélioration de la synthèse d’ADN. Un tel résultat, combiné à

la diminution des concentrations plasmatiques en acide méthylmalonique chez les vaches

injectées avec la vitamine B12 supportent l’hypothèse, qu’en début de lactation, la vitamine B12

n’était pas optimale et limitait les performances des vaches laitières.

69

Graulet et al. (2007) ont étudié les effets de suppléments alimentaires d’acide folique (0

ou 2.6 g/jour) seuls ou en combinaison avec de la vitamine B12 (0 ou 0.5 g/jour) donnés de 3

semaines pré-vêlage jusqu’à 8 semaines post-vêlage sur les performances de lactation et le

métabolisme de vaches Holstein multipares. La production laitière et le rendement en protéines du

lait pendant les 8 premières semaines de lactation ont été augmentés chez les vaches recevant les

suppléments d’acide folique, seuls ou combinés aux suppléments de vitamine B12 sans toutefois

que la prise alimentaire ait été modifiée. Les suppléments de vitamine B12 n’ont eu aucun effet.

Par contre, chez les vaches ne recevant que le supplément d’acide folique seul, il y a eu une

augmentation des concentrations de lipides hépatiques (totaux, triglycérides, cholestérol) et une

diminution des concentrations plasmatiques de glucose par rapport aux vaches recevant le

supplément combiné d’acide folique et vitamine B12. Il semblerait donc que le supplément

combiné de ces deux vitamines améliore l’efficacité métabolique des vaches laitières.

II-7 HYPOTHÈSES DE TRAVAIL ET OBJECTIFS

En début de lactation, l’augmentation importante des besoins en nutriments impose aux

vaches laitières une réorganisation de leur métabolisme afin de s’adapter et fournir l’énergie, le

glucose et les acides aminés nécessaires pour répondre aux besoins de la glande mammaire. Les

travaux antérieurs ont démontré que l'apport en acide folique et vitamine B12 n'est pas toujours

suffisant pour maximiser la santé et la productivité des vaches laitières.

Considérant les rôles connus de l’acide folique, les effets rapportés suite à une

augmentation des apports en cette vitamine sur les performances de lactation pourraient être liée

à une action sur la synthèse de l’ADN et/ou le cycle des méthylations. Or l’élément clé du cycle

des méthylations est la SAM. Ces concentrations cellulaires dépendent de la disponibilité en

groupements méthyles qui peuvent être fournis pré-formés par la méthionine, la bétaïne et la

choline ou synthétisés de novo via le métabolisme des folates. Ainsi, si les effets de la

supplémentation en acide folique sur la productivité des vaches laitières sont médiés par une

amélioration du cycle des méthylations, des suppléments en méthionine devrait réduire les

besoins en acide folique et vitamine B12.

De plus, l’acide folique et la vitamine B12 agissent comme coenzymes dans plusieurs

réactions des grandes voies métaboliques de l’énergie et des protéines. Ces deux vitamines

70

pourraient aussi jouer un rôle important dans la régulation de ces voies métaboliques. Ainsi, les

suppléments en acide folique et vitamine B12 amélioreraient les performances de lactation des

vaches laitières en augmentant l’efficacité métabolique des métabolismes du glucose et des

protéines.

Les objectifs de cette thèse sont donc :

1. Déterminer les effets d’une augmentation des apports en acide folique et vitamine B12

pendant la période critique entourant le vêlage et le premier tiers de la lactation sur la

production et la composition du lait en fonction des apports en méthionine.

2. Préciser l’effet et le mode d’action de ces vitamines B sur les voies des métabolismes

énergétique et protéique.

Pour répondre à ces objectifs, la consommation, la production laitière et un certain nombre

de paramètres plasmatiques ont été suivis sur 60 vaches Holstein de 3 semaines pré-vêlage à 16

semaines de lactation. Pour comprendre les effets de l’acide folique, de la vitamine B12 et de la

méthionine, rapportés dans le chapitre III, sur les variables de production, les métabolismes du

glucose et de la méthionine ont été étudiés plus spécifiquement à l’aide d’infusions continues

avec des isotopes stables. Les résultats, présentés dans le chapitre IV, ont été renforcés par une

analyse en RT-PCR de l’expression de gènes impliqués dans ces voies métaboliques (chapitre V).

Cette étude constitue un pas supplémentaire vers l’évaluation des besoins en vitamines du

complexe B des vaches hautes productrices en début de lactation et vers des

recommandations précises pour leur inclusion dans les rations pour vaches laitières, si besoin est.

71

II-8 RÉFÉRENCES BIBLIOGRAPHIQUES

Allen, R. H., B. Seetharam, N. C. Allen, E. R. Podell, and D. H. Alpers. 1978. Correction of cobalamin malabsorption in pancreatic insufficiency with a cobalamin analogue that binds with high affinity to R protein but not to intrinsic factor. In vivo evidence that a failure to partially degrade R protein is responsible for cobalamin malabsorption in pancreatic insufficiency. J. Clin. Invest. 61:1628-1634.

Appling, D. R. 1991. Compartmentation of folate-mediated one-carbon metabolism in eukaryotes. FASEB J. 5:2645-2651.

Armentano, L. E. 1994. Impact of metabolism by extragastrointestinal tissues on secretory rate of milk proteins. J. Dairy Sci. 77:2809-2820.

Auboiron, S., D. Durand, J. C. Robert, M. J. Chapman, and D. Bauchart. 1995. Effects of dietary fat and L-methionine on the hepatic metabolism of very low density lipoproteins in the preruminant calf. Reprod. Nutr. Dev. 35:167-178.

Bailey, L. B. 1990. Folate status assessment. J. Nutr. 120 Suppl. 11:1508-1511.

Bailey, L. B. and J. F. Gregory 3rd. 1999. Folate metabolism and requirements. J. Nutr. 129:779-782.

Baird, G. D., J. G. van der Walt, and E. N. Bergman. 1983. Whole-body metabolism of glucose and lactate in productive sheep and cows. Br. J. Nutr. 50:249-265.

Baldi, A. and L. Pinotti. 2006. Choline metabolism in high-producing dairy cows: metabolic and nutritional basis. Can. J. Anim. Sci. 86: 207-212.

Balmain, J. H., S. J. Folley, and R. F. Glascock. 1954. Relative utilization of glucose and acetate carbon for lipogenesis by mammary gland slices, studies with tritium, 13C and 14C. Biochem. J. 56:234-239.

Barry, J. M., W. Bartley, J. L. Linzell, and D. S. Robinson. 1963. The uptake from the blood of triglyceride fatty acids of chilomicra and low-density lipoprteins by the mammary gland of the goat . Biochem. J. 89:6-11.

Bassett, J. M. 1978. Endocrine factors in the control of nutrient utilization: ruminants. Proc. Nutr. Soc. 37:273-280.

Bässler, K. H. 1997. Enzymatic effects of folic acid and vitamin B12. Int. J. Vitam. Nutr. Res. 67:385-388.

Bauchart, D. 1993. Lipid absorption and transport in ruminants. J. Dairy Sci. 76:3864-3881.

Bauchart, D., D. Gruffat, and D. Durand. 1996. Lipid absorption and hepatic metabolism in ruminants. Proc. Nutr. Soc. 55:39-47.

Bauman, D. E. and W. B. Currie. 1980. Partitioning of nutrients during pregnancy and lactation: a review of mechanisms involving homeostasis and homeorhesis. J. Dairy Sci. 63:1514-1529.

Bauman, D. E. and J. M. Griinari. 2003. Nutritional regulation of milk fat synthesis. Annu. Rev. Nutr. 23:203-227.

Bechdel, S. I. 1928. Synthesis of vitamin B in the rumen of the cow. J. Biol. Chem. 80:231-238.

Behrns, K. E., C. D. Smith, and M. G. Sarr. 1994. Prospective evaluation of gastric acid secretion and cobalamin absorption following gastric bypass for clinically severe obesity. Dig. Dis. Sci. 39:315-320.

Bell, A. W. 1995. Regulation of organic nutrient metabolism during transition from late pregnancy to early lactation.

72

J. Anim. Sci. 73:2804-2819.

Bell, A. W. and D. E. Bauman. 1997. Adaptations of glucose metabolism during pregnancy and lactation. J. Mammary Gland Biol. Neoplasia. 2:265-278.

Bell, A. W., W. S. Burhans, and T. R. Overton. 2000. Protein nutrition in late pregnancy, maternal protein reserves and lactation performance in dairy cows. Proc. Nutr. Soc. 59:119-126.

Bennink, M. R., R. W. Mellenberger, R. A. Frobish and D. E. Bauman. 1972. Glucose oxidation and entry rate as affected by the initiation of lactation. J.Dairy Sci. 55 :712 (Abstract).

Bergen, W. G., J. R. Busboom, and R. A. Merkel. 1988. Leucine degradation in sheep. Br. J. Nutr. 59:323-333.

Bergman, E. N. 1990. Energy contributions of volatile fatty acids from the gastrointestinal tract in various species. Physiol. Rev. 70:567-590.

Berthiaume, R., P. Dubreuil, M. Stevenson, B. W. McBride, and H. Lapierre. 2001. Intestinal disappearance and mesenteric and portal appearance of amino acids in dairy cows fed ruminally protected methionine. J. Dairy Sci. 84:194-203.

Blair, J. A., I. T. Johnson, and A. J. Matty. 1974. Absorption of folic acid by everted segments of rat jejunum. J. Physiol. 236:653-661.

Bobe, G., J. W. Young, and D. C. Beitz. 2004. Invited review: pathology, etiology, prevention, and treatment of fatty liver in dairy cows. J. Dairy Sci. 87:3105-3124.

Bollheimer, L. C., R. Buettner, A. Kullmann, and F. Kullmann. 2005. Folate and its preventive potential in colorectal carcinogenesis. How strong is the biological and epidemiological evidence? Crit. Rev. Oncol. Hematol. 55:13-36.

Bose, S, J. Feix, S. Seetharam and B. Seetharam. 1996. Dimerization of transcobalamin II receptor - requirement of a structurally ordered lipid bilayer. J. Biol. Chem. 271:11718-11725.

Bose, S. and B. Seetharam. 1997. Purification, membrane expression, and interactions of transcobalamin II receptor. Methods Enzymol. 281:281-289.

Botts, R. L., R. W. Hemken, and L. S. Bull. 1979. Protein reserves in the lactating dairy cow. J. Dairy Sci. 62:433-440.

Brady, P. S., R. R. Ramsay, and L. J. Brady. 1993. Regulation of the long-chain carnitine acyltransferases. FASEB J. 7:1039-1044.

Brindle, N. P., V. A. Zammit, and C. I. Pogson. 1985. Regulation of carnitine palmitoyltransferase activity by malonyl-CoA in mitochondria from sheep liver, a tissue with a low capacity for fatty acid synthesis. Biochem. J. 232:177-182.

Britton, R. and C. Krehbiel. 1993. Nutrient metabolism by gut tissues. J. Dairy Sci. 76:2125-2131.

Brosnan, J. T. and M. E. Brosnan. 2006. The sulfur-containing amino acids: an overview. J. Nutr. 136:1636S-1640S

Brosnan, J. T., M. E. Brosnan, R. F. P. Bertolo and J. A. Brunton. 2007. Methionine: a metabolically unique amino acid. Livest. Sci. 112:2-7.

Burgoon, J. M., J. Selhub, M. Nadeau, and T. W. Sadler. 2002. Investigation of the effects of folate deficiency on embryonic development through the establishment of a folate deficient mouse model. Teratology. 65:219-

73

227.

Butler, W. R. and R. D. Smith. 1989. Interrelationships between energy balance and postpartum reproductive function in dairy cattle. J. Dairy Sci. 72:767-783.

Caudill, M. A., J. F. Gregory, A. D. Hutson, and L. B. Bailey. 1998. Folate catabolism in pregnant and nonpregnant women with controlled folate intakes. J. Nutr. 128:204-208.

Chaiyabutr, N., A. Faulkner, and M. Peaker. 1980. The utilization of glucose for the synthesis of milk components in the fed and starved lactating goat in vivo. Biochem. J. 186:301-308.

Chalupa, W. 1984. Discussion of protein symposium. J. Dairy Sci. 67:1134-1146.

Choi, S. W. and J. B. Mason. 2000. Folate and carcinogenesis: an integrated scheme. J. Nutr. 130:129-132.

Chouinard, Y. Nutrition et physiologie des ruminants. Université Laval, QC, Canada (notes de cours).

Coggan, A. R. 1999. Use of stable isotope to study carbohydrate and fat metabolism at the whole-body level. Proc. Nutr. Soc. 58: 953-961.

Cohen, H., W. M. Weinstein, and R. Carmel. 2000. Heterogeneity of gastric histology and function in food cobalamin malabsorption: absence of atrophic gastritis and achlorhydria in some patients with severe malabsorption. Gut. 47:638-645.

Collard, B. L., P. J. Boettcher, J. C. Dekkers, D. Petitclerc, and L. R. Schaeffer. 2000. Relationships between energy balance and health traits of dairy cattle in early lactation. J. Dairy Sci. 83:2683-2690.

Combs, G. F. Jr. 1998. The vitamins. Fondamental aspects in nutrition and health. 2nd Edition San Diego CA, USA : academic press.

Coppock, C. E., C. H. Noller, and S. A. Wolfe. 1974. Effect of forage-concentrate ratio in complete feeds fed ad libitum on energy intake in relation to requirements by dairy cows. J. Dairy Sci. 57:1371-1380.

Cossins, E. A. 2000. The fascinating world of folate and one-carbon metabolism. Can. J. Bot. 78:691-708.

Danfaer, A., V. Tetens and N. Agergaard. 1995. Review and an experimental study on the physiological and quantitative aspects of gluconeogenesis in lactating ruminants. Comp. Biochem. Physiol. B. Biochem. Mol. Biol. 111(2):201-210.

Dawson, R. M., D. W. Grime, and D. B. Lindsay. 1981. On the insensitivity of sheep to the almost complete microbial destruction of dietary choline before alimentary-tract absorption. Biochem. J. 196:499-504.

DeLong, C. J., Y. J. Shen, M. J. Thomas, and Z. Cui. 1999. Molecular distinction of phosphatidylcholine synthesis between the CDP-choline pathway and phosphatidylethanolamine methylation pathway. J. Biol. Chem. 274:29683-29688.

Dils, R. R. 1986. Comparative aspects of milk fat synthesis. J. Dairy Sci. 69:904-910.

Donkin, S. S. and L. E. Armentano. 1993. Preparation of extended in vitro cultures of bovine hepatocytes that are hormonally responsive. J. Anim. Sci. 71:2218-2227.

Drabkin, H. J. and U. L. RajBhandary. 1998. Initiation of protein synthesis in mammalian cells with codons other than AUG and amino acids other than methionine. Mol. Cell. Biol. 18:5140-5147.

Drackley, J. K, T. R. Overton and G. N. Douglas. 2001. Adaptations of glucose and long-chain fatty acid metabolism

74

in liver of dairy cows during the periparturient period. J. Dairy Sci. 84 (E. Suppl.):E100-E112.

Duthie, S. J., S. Narayanan, G. M. Brand, L. Pirie, and G. Grant. 2002. Impact of folate deficiency on DNA stability. J. Nutr. 132:2444S-2449S.

Eastridge, M. L. 2006. Major advances in applied dairy cattle nutrition. J. Dairy Sci. 89:1311-1323.

Eisemann, J. H., D. R. Catherman, and G. B. Huntington. 1994. Comparison of insulin infusion sites on metabolite net flux and insulin kinetics in growing euglycemic beef steers. J. Anim. Sci. 72:990-997.

Filsell, O. H., I. G. Jarrett, P. H. Taylor, and D. B. Keech. 1969. Effects of fasting, diabetes and glucocorticoids on gluconeogenic enzymes in the sheep. Biochim. Biophys. Acta. 184:54-63.

Finkelstein, J. D. and J. J. Martin. 1986. Methionine metabolism in mammals. Adaptation to methionine excess. J. Biol. Chem. 261:1582-1587.

Finkelstein, J. D. 1990. Methionine metabolism in mammals. J. Nutr. Biochem. 1:228-237.

Fontecave, M., M. Atta, and E. Mulliez. 2004. S-adenosylmethionine: nothing goes to waste. Trends. Biochem. Sci. 29:243-249.

Freetly, H. C. and J. Klindt. 1996. Changes in gut and liver glucose, lactate, insulin, and oxygen flux in mature ewes during mesenteric or abdominal vena cava glucose infusion. J. Nutr. 126:924-932.

Ganesan, T., M. H. Khadra, J. Wallis, and D. E. Neal. 2002. Vitamin B12 malabsorption following bladder reconstruction or diversion with bowel segments. ANZ J. Surg. 72:479-482.

Girard, C. L. and J. J. Matte. 1989. Serum folates in gestating and lactating dairy cows. J. Dairy Sci. 72:3240-3246.

Girard, C. L., J.J. Matte, and G.F. Tremblay. 1995. Gestation and lactation of dairy cows: a role for folic acid? J. Dairy Sci. 78:404-411.

Girard, C. L. and J. J. Matte. 1998. Dietary supplements of folic acid during lactation: effects on the performance of dairy cows. J. Dairy Sci. 81:1412-1419.

Girard, C. L. and J. J. Matte. 1999. Changes in serum concentrations of folates, pyridoxal, pyridoxal-5-phosphate and vitamin B12 during lactation of dairy cows fed dietary supplements of folic acid. Can. J. Anim. Sci. 79:107-113.

Girard, C. L., H. Lapierre, A. Desrochers, C. Benchaar, J. J. Matte, and D. Remond. 2001. Net flux of folates and vitamin B12 through the gastrointestinal tract and the liver of lactating dairy cows. Br. J. Nutr. 86:707-715.

Girard, C. L. and D. Remond. 2003. Net flux of folates and vitamin B12 through the gastrointestinal tract of sheep. Can. J. Anim. Sci. 83:273-278.

Girard, C. L., H. Lapierre, J. J. Matte, and G. E. Lobley. 2005. Effects of dietary supplements of folic acid and rumen-protected methionine on lactational performance and folate metabolism of dairy cows. J. Dairy Sci. 88:660-670.

Girard, C. L., and J. J. Matte. 2005a. Folic acid and vitamin B12 requirements of dairy cows: a concept to be revised. Livest. Prod. Sci. 98:123-133.

Girard, C. L. and J. J. Matte. 2005b. Effects of intramuscular injections of vitamin B12 on lactation performance of dairy cows fed dietary supplements of folic acid and rumen-protected methionine. J. Dairy Sci. 88:671-676.

75

Graulet, B., D. Gruffat, D. Durand, and D. Bauchart. 1998. Fatty acid metabolism and very low density lipoprotein secretion in liver slices from rats and preruminant calves. J. Biochem. (Tokyo) 124:1212-1219.

Graulet, B., D. Gruffat, D. Durand, and D. Bauchart. 2004. Small intestine and liver microsomal triacylglycerol transfer protein in the bovine and rat: effects of dietary coconut oil. J. Dairy Sci. 87:3858-3868.

Graulet, B, J. J. Matte, A. Desrochers, L. Doepel, M. F. Palin, and C. L. Girard. 2007. Effects of dietary supplements of folic acid and vitamin B12 on metabolism of dairy cows in early lactation. J. Dairy Sci. 90:3442-3455.

Green, J. M., D. P. Ballou, and R. G. Matthews. 1988. Examination of the role of methylenetetrahydrofolate reductase in incorporation of methyltetrahydrofolate into cellular metabolism. FASEB J. 2:42-47.

Greenfield, R. B., M. J. Cecava, and S. S. Donkin. 2000. Changes in mRNA expression for gluconeogenic enzymes in liver of dairy cattle during the transition to lactation. J. Dairy Sci. 83:1228-1236.

Gregory, J. F. 3rd. 2001. Case study: folate bioavailability. J. Nutr. 131:1376S-1382S.

Gruffat, D., D. Durand, B. Graulet, and D. Bauchart. 1996. Regulation of VLDL synthesis and secretion in the liver. Reprod. Nutr. Dev. 36:375-389.

Grummer, R. R. 1993. Etiology of lipid-related metabolic disorders in periparturient dairy cows. J. Dairy Sci. 76:3882-3896.

Haymond, M. W. and A. L. Sunehag. 2000. The reciprocal pool model for the measurement of gluconeogenesis by use of [U-13C]glucose. Am. J. Physiol. Endocrinol. Metab. 278:E140-E145.

Heitmann, R. N., D. J. Dawes, and S. C. Sensenig. 1987. Hepatic ketogenesis and peripheral ketone body utilization in the ruminant. J. Nutr. 117:1174-1180.

Henderson, G. B. 1990. Folate-binding proteins. Annu. Rev. Nutr. 10:319-335.

Herdt, T. H. and R. S. Emery. 1992. Therapy of diseases of ruminant intermediary metabolism. Vet. Clin. North Am. Food Anim. Pract. 8:91-106.

Herrmann, W. and J. Geisel. 2002. Vegetarian lifestyle and monitoring of vitamin B-12 status. Clin. Chim. Acta. 326:47-59.

Higgins, J. R., E. P. Quinlivan, J. McPartlin, J. M. Scott, D. G. Weir, and M. R. Darling. 2000. The relationship between increased folate catabolism and the increased requirement for folate in pregnancy. BJOG 107:1149-1154.

Hocquette, J. F. and D. Bauchart. 1999. Intestinal absorption, blood transport and hepatic and muscle metabolism of fatty acids in preruminant and ruminant animals. Reprod. Nutr. Dev. 39:27-48.

Ishida, A., H. Kanefusa, H. Fujita and T. Toraya. 1994. Microbiological activities of nucleotide loop-modified analogues of vitamin B12. Arch. Microbiol. 161:293-299.

Janovick Guretzky, N. A., D. B. Carlson, J. E. Garrett and J. K. Drackley. 2006. Lipid metabolite profiles and milk production for Holstein and Jersey cows fed rumen-protected choline during the peri-parturient period. J. Dairy Sci. 89: 188-200.

Jennes, R. 1985. Biochemical and nutritional aspects of milk and colostrum in lactation. P. 164. B.L. Larson ed., Iowa State Press, Ames IA.

Jones, P. A. and S. B. Baylin. 2002. The fundamental role of epigenetic events in cancer. Nat. Rev. Genet. 3:415-

76

428.

Judson, G. J., E. Anderson, J. R. Luick, and R. A. Leng. 1968. The contribution of propionate to glucose synthesis in sheep given diets of different grain content. Br. J. Nutr. 22:69-75.

Kim, K. H. 1997. Regulation of mammalian acetyl-coenzyme A carboxylase. Annu. Rev. Nutr. 17:77-99.

Kim, Y. I. 1999. Folate and carcinogenesis: evidence, mechanisms, and implications. J. Nutr. Biochem. 10: 66-88.

Kleppe, B. B., R. J. Aiello, R. R. Grummer, and L. E. Armentano. 1988. Triglyceride accumulation and very low density lipoprotein secretion by rat and goat hepatocytes in vitro. J. Dairy Sci. 71:1813-1822.

Krautler, B. 2005. Vitamin B12: chemistry and biochemistry. Biochem. Soc. Trans. 33:806-810.

Kreikemeier, K. K., D. L. Harmon, R. T. Brandt Jr, T. B. Avery, and D. E. Johnson. 1991. Small intestinal starch digestion in steers: effect of various levels of abomasal glucose, corn starch and corn dextrin infusion on small intestinal disappearance and net glucose absorption. J. Anim. Sci. 69:328-338.

Kumar, S., S. Lakshmanan, and J. C. Shaw. 1959. beta-Hydroxybutyrate and acetate metabolism of the perfused bovine udder. J. Biol. Chem. 234:754-757.

Kumar, S., V. N. Singh, and R. Keren-paz. 1965. Biosynthesis of short-chain fatty acids in lactating mammary supernatant . Biochim. Biophys. Acta. 98:221-229.

Lapierre, H., J. P. Blouin, J. F. Bernier, C. K. Reynolds, P. Dubreuil, and G. E. Lobley. 2002. Effect of supply of metabolizable protein on whole body and splanchnic leucine metabolism in lactating dairy cows. J. Dairy Sci. 85:2631-2641.

Lapierre, H., R. Berthiaume, G. Raggio, M. C. Thivierge, L. Doepel, D. Pacheco, P. Dubreuil and G. E. Lobley. 2005. The route of absorbed nitrogen into milk protein. Animal Science 80:11-22.

Le Grusse, J. and B. Watier. 1993. Les vitamines. Données biochimiques, nutritionelles et cliniques. Centre d'étude et d'information sur les vitamines, Produits Roche. Neuilly-sur-Seine, France.

Lemaigre, F. P. and G. G. Rousseau. 1994. Transcriptional control of genes that regulate glycolysis and gluconeogenesis in adult liver. Biochem. J. 303 ( Pt 1):1-14.

Levine, R. L., L. Mosoni, B. S. Berlett, and E. R. Stadtman. 1996. Methionine residues as endogenous antioxidants in proteins. Proc. Natl. Acad. Sci. U S A 93:15036-15040.

Li, G. M., S. R. Presnell, and L. Gu. 2003. Folate deficiency, mismatch repair-dependent apoptosis, and human disease. J. Nutr. Biochem. 14:568-575.

Lin, Y., S. T. Dueker, J. R. Follett, J. G. Fadel, A. Arjomand, P. D. Schneider, J. W. Miller, R. Green, B. A. Buchholz, J. S. Vogel, R. D. Phair and A. J. Clifford. 2004. Quantification of in vivo human folate metabolism. Am. J. Clin. Nutr. 80: 680-691.

Lindsay, D. B. 1971. Changes in the pattern of glucose metabolism in growth, pregnancy and lactation in ruminants. Proc. Nutr. Soc. 30:272-277.

Lindsay, D. B. 1979. Metabolism in the whole animal. Proc. Nutr. Soc. 38:295-301.

Linzell, J. L., E. F. Annison, S. Fazaberley and R. A. Leng. 1967. The incorporation of acetate, stearate and D(-)-beta-hydroxybutyrate into milk fat by the isolated perfused mammary gland of the goat. Biochem. J. 104:134.

77

Linzell, J. L. 1972. Mechanism of secretion of the aqueous phase of milk. J. Dairy Sci. 55:1316-1322.

Lobley, G. E., A. Connell, D. K. Revell, B. J. Bequette, D. S. Brown, and A. G. Calder. 1996. Splanchnic-bed transfers of amino acids in sheep blood and plasma, as monitored through use of a multiple U-13C-labelled amino acid mixture. Br. J. Nutr. 75:217-235.

Lobley, G. E., D. M. Bremner, and D. S. Brown. 2001. Response in hepatic removal of amino acids by the sheep to short-term infusions of varied amounts of an amino acid mixture into the mesenteric vein. Br. J. Nutr. 85:689-698.

Lobley, G. E. 2003. Protein turnover - What does it means for animal production ? Can. J. Anim. Sci. 83:327-340.

Lobley, G. E. and H. Lapierre. 2003. Post-absortive metabolism of amino acids. Progress in research on energy and protein metabolism. Ed. W.B. Souffrant and C.C. Metges. European Association for Animal Production. 109:737-756.

Lomax, M. A. and G. D. Baird. 1983. Blood flow and nutrient exchange across the liver and gut of the dairy cow. Effects of lactation and fasting. Br. J. Nutr. 49:481-496.

Lozano, O., C. B. Theurer, A. Alio, J. T. Huber, A. Delgado-Elorduy, P. Cuneo, D. DeYoung, M. Sadik and R. S. Swingle. 2000. Net absorption and hepatic metabolism of glucose, L-lactate, and volatile fatty acids by steers fed diets containing sorghum grain processed as dry-rolled or steam-flaked at different densities. J. Anim. Sci. 78: 1364-1371.

Lucock, M. 2000. Folic acid: nutritional biochemistry, molecular biology, and role in disease processes. Mol. Genet. Metab. 71:121-138.

Luka, Z., S. Pakhomova, L. V. Loukachevitch, M. Egli, M. E. Newcomer, and C. Wagner. 2007. 5-methyltetrahydrofolate is bound in intersubunit areas of rat liver folate-binding protein glycine N-methyltransferase. J. Biol. Chem. 282:4069-4075.

Majee, D. N., E. C. Schwab, S. J. Bertics, W. M. Seymour and R. D. Shaver. 2003. Lactation performance by dairy cows fed supplemental biotin and a B-vitamin blend. J. Dairy Sci. 86: 2106-2112.

Marcos, E., A. Mazur, P. Cardot, and Y. Rayssiguier. 1990. Serum apolipoproteins B and A-I and naturally occurring fatty liver in dairy cows. Lipids 25:575-577.

Mason, J. B. 2003. Biomarkers of nutrient exposure and status in one-carbon (methyl) metabolism. J. Nutr. 133 Suppl. 3:941S-947S.

Matherly, L. H. and D. I. Goldman. 2003. Membrane transport of folates. Vitam. Horm. 66:403-456.

McDowell, G. H. 1983. Hormonal control of glucose homeostasis in ruminants. Proc. Nutr. Soc. 42:149-167.

McDowell, L. R. 2000. Vitamins in animal and human nutrition. 2nd edition, Iowa State University Press, Ames, IA.

McGarry, J. D. and D. W. Foster. 1980. Regulation of hepatic fatty acid oxidation and ketone body production. Annu. Rev. Biochem. 49:395-420.

McNeill, D. M., R. Slepetis, R. A. Ehrhardt, D. M. Smith, and A. W. Bell. 1997. Protein requirements of sheep in late pregnancy: partitioning of nitrogen between gravid uterus and maternal tissues. J. Anim. Sci. 75:809-816.

Mellenberger, R. W., D. E. Bauman, and D. R. Nelson. 1973. Metabolic adaptations during lactogenesis. Fatty acid and lactose synthesis in cow mammary tissue. Biochem. J. 136:741-748.

78

Melse-Boonstra, A., P. I. Holm, P. M. Ueland, M. Olthof, R. Clarke, and P. Verhoef. 2005. Betaïne concentration as a determinant of fasting total homocysteine concentrations and the effect of folic acid supplementation on betaïne concentrations. Am. J. Clin. Nutr. 81:1378-1382.

Miller, B. L., J. C. Meiske and R. D. Goodrich. 1986. Effects of grain and concentrate level on B-vitamin production and absorption in steers. J. Anim. Sci. 62:473-483.

Mills, S. E., D. C. Beitz, and J. W. Young. 1986. Evidence for impaired metabolism in liver during induced lactation ketosis of dairy cows. J. Dairy Sci. 69:362-370.

Moe, P. W., H. F. Tyrrell, and W. P. Flatt. 1971. Energetics of body tissue mobilization. J. Dairy Sci. 54:548-553.

Moskovitz, J. 2005. Roles of methionine suldfoxide reductases in antioxidant defense, protein regulation and survival. Curr. Pharm. Des. 11:1451-1457.

Mudd, S. H. and J. R. Poole. 1975. Labile methyl balances for normal humans on various dietary regimens. Metabolism. 24:721-735.

Mudd, S. H., J. T. Brosnan, M. E. Brosnan, R. L. Jacobs, S. P. Stabler, R. H. Allen, D. E. Vance, and C. Wagner. 2007. Methyl balance and transmethylation fluxes in humans. Am. J. Clin. Nutr. 85:19-25.

Neville, M. C. and M. F. Picciano. 1997. Regulation of milk lipid secretion and composition. Annu. Rev. Nutr. 17:159-183.

Nexo, E., A. L. Christensen, T. E. Petersen, and S. N. Fedosov. 2000. Measurement of transcobalamin by ELISA. Clin. Chem. 46:1643-1649.

Nicolas, J. P. and J. L. Gueant. 1994. Absorption, distribution and excretion of vitamin B12. Ann. Gastroenterol. Hepatol. (Paris) 30:270-276, 281; discussion 281-282.

Nocek, J. E. and S. Tamminga. 1991. Site of digestion of starch in the gastrointestinal tract of dairy cows and its effect on milk yield and composition. J. Dairy Sci. 74:3598-3629.

Noga, A. A., Y. Zhao, and D. E. Vance. 2002. An unexpected requirement for phosphatidylethanolamine N-methyltransferase in the secretion of very low density lipoproteins. J. Biol. Chem. 277:42358-42365.

National research council. 2001. Nutrient Requirements of Dairy Cattle. 7th rev. ed. Natl. Acad. Sci., Washington, DC.

Ohgi, T., S. Kamimura, Y. Minezaki, and M. Takahashi. 2005. Relationship between fat accumulation in the liver and energy intake, milk fat yield and blood metabolites in dairy cows. Anim. Sci. 76:549-557.

Overton, T. R., J. K. Drackley, C. J. Ottemann-Abbamonte, A. D. Beaulieu, and J. H. Clark. 1998. Metabolic adaptation to experimentally increased glucose demand in ruminants. J. Anim. Sci. 76:2938-2946.

Overton, T. R., J. K. Drackley, C. J. Ottemann-Abbamonte, A. D. Beaulieu, L. S. Emmert, and J. H. Clark. 1999. Substrate utilization for hepatic gluconeogenesis is altered by increased glucose demand in ruminants. J. Anim. Sci. 77:1940-1951.

Palmquist, D. L., C. L. Davis, R. E. Brown and D. S. Sachan. 1969. Availability and metabolism of various substrates in ruminants. V. Entry rate into the body and incorporation into milk fat of D-beta-hydroxybutyrate. J. Dairy Sci. 52:633-638.

Pethick, D. W. and D. B. Lindsay. 1982. Metabolism of ketone bodies in pregnant sheep. Br. J. Nutr. 48:549-563.

79

Piedrahita, J. A., B. Oetama, G. D. Bennett, J. van Waes, B. A. Kamen, J. Richardson, S. W. Lacey, R.G. Anderson, and R. H. Finnell. 1999. Mice lacking the folic acid-binding protein Folbp1 are defective in early embryonic development. Nat. Genet. 23:228-232.

Piepenbrink, M. S. and T. R. Overton. 2003. Liver metabolism and production of cows fed increasing amounts of rumen-protected choline during the periparturient period. J. Dairy Sci. 86:1722-1733.

Pilkis, S. J. and T. H. Claus. 1991. Hepatic gluconeogenesis/glycolysis: regulation and structure/function relationships of substrate cycle enzymes. Annu. Rev. Nutr. 11:465-515.

Pinotti, L., A. Baldi and V. Dell’Orto. 2002. Comparative mammalian choline metabolism with emphasis on the high-yielding dairy cows. Nutrition Research Reviews 15:315-331.

Pisulewski, P. M., H. Rulquin, J. L. Peyraud, and R. Verite. 1996. Lactational and systemic responses of dairy cows to postruminal infusions of increasing amounts of methionine. J. Dairy Sci. 79:1781-1791.

Popjak, G., T. H. French, G. D. Hunter, and A. J. Martin. 1951. Mode of formation of milk fatty acids from acetate in the goat. Biochem. J. 48:612-618.

Pullen, D. L., J. S. Liesman, and R. S. Emery. 1990. A species comparison of liver slice synthesis and secretion of triacylglycerol from nonesterified fatty acids in media. J. Anim. Sci. 68:1395-1399.

Quadros, E. V., A. L. Regec, K. M. Khan, E. Quadros, and S. P. Rothenberg. 1999. Transcobalamin II synthesized in the intestinal villi facilitates transfer of cobalamin to the portal blood. Am. J. Physiol. 277:G161-G166.

Reilly, P. E. and E. J. Ford. 1971. The effects of different dietary contents of protein on amino acid and glucose production and on the contribution of amino acids to gluconeogensis in sheep. Br J. Nutr 26:249-263.

Ridgway, N. D. and D. E. Vance. 1988. Specificity of rat hepatic phosphatidylethanolamine N-methyltransferase for molecular species of diacyl phosphatidylethanolamine. J. Biol. Chem. 263 (15): 16856-16863.

Robinson, J. J. 1986. Changes in body composition during pregnancy and lactation. Proc. Nutr. Soc. 45:71-80.

Rowling, M. J., M. H. McMullen, D. C. Chipman and K. L. Schalinske. 2002. Hepatic glycine N-methyltransferase is up-regulated by excess dietary methionine in rats. J. Nutr. 132:2545-2550.

Rulquin, H. 1992. Intérêts et limites d'un apport de méthionine et de lysine dans l'alimentation des vaches laitières. INRA Prod. Anim. 5:29-36.

Rulquin, H., P. M. Pisulewski, R. Vérité and J. Guinard. 1993. Milk production and composition as a function of postruminal lysine and methionine supply: a nutrient-response approach. Livest. Prod. Sci. 37:69-90.

Russell-Jones G. J. and D. H. Alpers. 1999. Vitamin B12 transporters. Pharm. Biotechnol. 12:493-520.

Santschi, D. E., R. Berthiaume, J. J. Matte, A. F. Mustafa and C. L. Girard. 2005a. Fate of supplementary B-vitamins in the gastrointestinal tract of dairy cows. J. Dairy Sci. 88:2043-2054.

Santschi, D. E., J. Chiquette, R. Berthiaume, R. Martineau, J. J. Matte, A. F. Mustafa, and C. L. Girard. 2005b. Effects of the forage to concentrate ratio on B-vitamin concentrations in different ruminal fractions of dairy cows. Can. J. Anim. Sci. 85:389-399.

Schwab, C. G., C. K. Bozak N. L. Whitehouse and M. M. Meshab. 1992. Amino acid limitation and flow to duodenum at four stages of lactation. 1. Sequence of lysine and methionine limitation. J. Dairy Sci. 75:2486-2502.

80

Schwab, E. C., C. G. Schwab, R. D. Shaver, C. L Girard, D. E. Putnam and N. L.Whitehouse. 2006. Dietary forage and nonfiber carbohydrate contents influence B-vitamins intake, duodenal flow, and apparent ruminal synthesis in lactating dairy cows. J. Dairy Sci. 89:174-187.

Scott, J. M. 1999. Folate and vitamin B12. Proc. Nutr. Soc. 58:441-448.

Seetharam, B., S. Bose, and N. Li. 1999. Cellular import of cobalamin (Vitamin B-12). J. Nutr. 129:1761-1764.

Seetharam, B. and N. Li. 2000. Transcobalamin II and its cell surface receptor. Vitam. Horm. 59:337-366.

Selhub, J. 1999. Homocysteine metabolism. Annu. Rev. Nutr. 19:217-246.

Shane, B. and E. L. Stokstad. 1985. Vitamin B12-folate interrelationships. Annu. Rev. Nutr. 5:115-141.

Shaw, J. C. and C. B. Knodt. 1941. The utilization of β-hydroxybutyric acid by the lactating mammary gland. J. Biol. Chem. 138: 287-292.

She, P., G. L. Lindberg, A. R. Hippen, D. C. Beitz, and J. W. Young. 1999. Regulation of messenger ribonucleic acid expression for gluconeogenic enzymes during glucagon infusions into lactating cows. J. Dairy Sci. 82:1153-1163.

Shibano, K. and S. Kawamura. 2006. Serum free amino acid concentration in hepatic lipidosis of dairy cows in the periparturient period. J. Vet. Med. Sci. 68:393-396.

Smith, G. H. 1971. Glucose metabolism in the ruminant. Proc. Nutr. Soc. 30:265-272.

Smith, R. M. and W. S. Osborne-White. 1973. Folic acid metabolism in vitamin B12-deficient sheep. Depletion of liver folates. Biochem. J. 136:279-293.

Smulders, Y. M. and C. D. A. Stehouwer. 2005. Folate metabolism and cardiovascular disease. Semin. Vasc. Med. 5(2): 87-97.

Snoswell, A. M. and G. P. Xue. 1987. Methyl group metabolism in sheep. Comp. Biochem. Physiol. B 88:383-394.

Socha, M. T., D. E. Putnam, B. D. Garthwaite, N. L. Whitehouse, N. A. Kierstead, C. G. Schwab, G. A. Ducharme and J. C. Robert. 2005. Improving intestinal amino acid supply of pre-and postpartum dairy cows rumen-protected methionine and lysine. J. Dairy Sci. 88:1113-1128.

Stadtman, E. R. 1993. Oxidation of free amino acids and amino acid residues in proteins by radiolysis and by metal-catalyzed reactions. Annu Rev Biochem 62:797-821.

Stead, L. M., J. T. Brosnan, M. E. Brosnan, D. E. Vance, and R. L. Jacobs. 2006. Is it time to reevaluate methyl balance in humans? Am. J. Clin. Nutr. 83:5-10.

Steinberg, S. E. 1984. Mechanisms of folate homeostasis. Am. J. Physiol. 246:G319-G324.

Strain, J. J., L. Dowey, M. Ward, K. Pentieva, and H. McNulty. 2004. B-vitamins, homocysteine metabolism and CVD. Proc. Nutr. Soc. 63:597-603.

Sugden, C. 2006. One-carbon metabolism in psychiatric illness. Nutr. Res. Rev. 19:117-136.

Sutton, A. L. and J. M. Elliot. 1972. Effect of ratio of roughage to concentrate and level of feed intake on ovine ruminal vitamin B12 production. J. Nutr. 102:1341-1346.

Swick, R. W. and N. J. Benevenga. 1977. Labile protein reserves and protein turnover. J. Dairy Sci. 60:505-515.

81

Taylor, P. H., J. C. Wallace, and D. B. Keech. 1971. Gluconeogenic enzymes in sheep liver. Intracellular localization of pyruvate carboxylase and phosphoenolpyruvate carboxykinase in normal, fasted and diabetic sheep. Biochim. Biophys. Acta. 237:179-191.

Thivierge, M. C., D. Petitclerc, J. F. Bernier, Y. Couture and H. Lapierre. 2002. Variations in mammary protein metabolism during the natural filling of the udder with milk over a 12-h period between two milkings: leucine kinetics. J. Dairy Sci. 85:2974-2985.

Thompson, J. R., G. Weiser, K. Seto, and A. L. Black. 1975. Effect of glucose load on synthesis of plasma glucose in lactating cows. J. Dairy Sci. 58:362-370.

Tong, L. 2005. Acetyl-coenzyme A carboxylase: crucial metabolic enzyme and attractive target for drug discovery. Cell. Mol. Life Sci. 62:1784-1803.

Trenkle, A. 1981. Endocrine regulation of energy metabolism in ruminants. Fed Proc 40:2536-2541.

Van Knelgsel, A. T. M., H. Van den Brand, J. Dijkstra, S. Tamminga and B. Kemp. 2005. Effect of dietary energy source on energy balance, production, metabolic disorders and reproduction in lactating dairy cattle. Reprod. Nutr. Dev. 45:665-688.

Veerkamp, R. F. 1998. Selection for economic efficiency of dairy cattle using information on live weight and feed intake: a review. J. Dairy Sci. 81:1109-1119.

Veerkamp, R. F., J. K. Oldenbroek, H. J. Van der Gaast and J. H. Van der Werf. 2000. Genetic correlation between days until start of luteal activity and milk yield, energy balance, and live weights. J. Dairy Sci. 83:577-583.

Vernon, R. G. 2005. Lipid metabolism during lactation: a review of adipose tissue-liver interactions and the development of fatty liver. J. Dairy Res. 72:460-469.

Voet, D. and J. G.Voet. 1998. Biochimie. DeBoeck Universite, 2e edition.

Wagner, C., W. T. Briggs and R. J. Cook. 1985. Inhibition of glycine N-methyltransferase activity by folate derivatives: implications for regulation of methyl group metabolism. Biochem. Biophys. Res. Commun. 127:746-752.

Waterlow, J. C., P. J. Garlick and D. J. Millward. 1978. Protein turnover in mammalian tissues and in the whole body. North-Holland Publishing Company, New-York, USA.

Weigand, E., J. W. Young, and A. D. McGilliard. 1975. Volatile fatty acid metabolism by rumen mucosa from cattle fed hay or grain. J. Dairy Sci. 58:1294-1300.

White, R. G., J. W. Steel, R. A. Leng, and J. R. Luick. 1969. Evaluation of three isotope-dilution techniques for studying the kinetics of glucose metabolism in sheep. Biochem. J. 114:203-214.

Williams, E. L., S. M. Rodriguez, D. C. Beitz, and S. S. Donkin. 2006. Effects of short-term glucagon administration on gluconeogenic enzymes in the liver of midlactation dairy cows. J. Dairy Sci. 89:693-703.

Williams, K. T. and K. L. Schalinske. 2007. New insights into the regulation of methyl group and homocysteine metabolism. J. Nutr. 137:311-314.

Wilson, S., J. C. MacRae and P. J. Buttery. 1983. Glucose production and utilization in non-pregnant, pregnant and lactating ewes. Br. J. Nutr. 50:303-316.

Wiltrout, D. W. and L. D. Satter. 1972. Contribution of propionate to glucose synthesis in the lactating and nonlactating cow. J. Dairy Sci. 55:307-317.

82

Wolfe, R. R. 1992. Radioactive and stable isotope tracers in biomedicine : Principles and practices of kinetic analysis. Wiley-Liss, Inc., New-York, USA.

Wolff, J. E. and E. N. Bergman. 1972. Gluconeogenesis from plasma amino acids in fed sheep. Am. J. Physiol. 223:455-460.

Xue, G. P. and A. M. Snoswell. 1985. Regulation of methyl group metabolism in lactating ewes. Biochem. Int. 11:381-385.

Young, J. W., S. L. Thorp, and H. Z. De Lumen. 1969. Activity of selected gluconeogenic and lipogenic enzymes in bovine rumen mucosa, liver and adipose tissue. Biochem. J. 114:83-88.

Young, J. W. 1977. Gluconeogenesis in cattle: significance and methodology. J. Dairy Sci. 60:1-15.

Young, R. V. and J. S. Margini. 1990. Mechanisms and nutritional significance of metabolic responses to altered intakes of protein and amino acids, with reference to nutritional adaptation in humans. Am. J. Clin. Nutr. 51:270-289.

Zammit, V. A. 1990. Ketogenesis in the liver of ruminants - adaptations to a challenge. Journal of agricultural Science, Cambridge 115:155-162.

Zinn, R. A., F. N. Owen, R. I. Stuart, J. R. Dunbar and B. B. Norman. 1987. B-vitamin supplementation of diet for feedlot cattle. J. Anim. Sci. 65: 267-277.

83

CHAPITRE III

LACTATIONAL PERFORMANCE OF DAIRY COWS

ACCORDING TO FOLIC ACID AND VITAMIN B12 SUPPLY

AND METHIONINE PROVISION

Ce chapitre a été accepté avec corrections mineures pour publication dans la revue “Journal of

Dairy Science” le 14 août 2008 sous la référence de A. Preynat, H. Lapierre, M.C. Thivierge,

M.F. Palin, J.J. Matte, A. Desrochers and C. L. Girard. 2009. Lactational Performance of Dairy

Cows According to Folic Acid and Vitamin B12 Supply and Methionine Provision,. J. Dairy Sci.

xx : xx-xx et une version révisée sera publiée sous le titre “Influence of Methionine Supply on the

Response of Lactational Performance of Dairy Cows to Supplementary Folic Acid and Vitamin

B12 “.

84

III-1 RÉSUMÉ

Durant les 16 premières semaines de lactation, les injections intramusculaires d'acide

folique et vitamine B12 tendaient à augmenter la production laitière de 1,4 kg/jour aussi bien que

les rendements en lactose, protéines brutes et solides totaux, en début de lactation. La

supplémentation en méthionine protégée de la dégradation ruminale augmentait la concentration

des protéines du lait. Les vitamines B tendaient à diminuer les concentrations plasmatiques

d’homocystéine de 5,51 avec aucun supplément vitaminique à 4,54 et 4,77 ± 0,37 µM pour

l’acide folique seul ou combiné avec la vitamine B12, respectivement. Les résultats de la présente

étude suggèrent que les effets des suppléments combinés d’acide folique et de vitamine B12 sur

les performances de lactation des vaches laitières n’étaient pas dus à une augmentation de

l’apport en groupements méthyles puisque les suppléments de méthionine, une source de

groupements méthyles préformés, n’ont pas altéré la réponse des vaches aux suppléments

vitaminiques.

Mots-clés : vache laitière, acide folique, vitamine B12, méthionine protégée de la dégradation

ruminale

85

III-2 ABSTRACT

The present experiment was undertaken to determine if the effects of supplementary folic

acid on lactational performance were due to an improved methylneogenesis and if the supply in

vitamin B12 could affect with this metabolic pathway. In this eventuality, supplementary Met, a

major source of preformed methyl groups, should reduce the requirements for these vitamins.

Sixty multiparous Holstein cows were assigned to 10 blocks of 6 cows each according to their

previous milk production. Within each block, 3 cows were fed a diet estimated to supply Met as

1.83% metabolizable protein whereas the 3 other cows were fed the same diet supplemented with

18 g of rumen-protected methionine (RPM), to supply Met as 2.23% metabolizable protein.

Within each level of Met, cows received either no vitamin supplement, weekly intramuscular

injections of 160 mg of folic acid alone or combined with 10 mg of vitamin B12, from 3 wk

before to 16 wk after calving. There was no treatment effect on DMI during pre- and post-calving

periods, 13.4 ± 0.4 and 21.8 ± 0.4 kg/d, respectively. Milk production was not affected by RPM.

Folic acid and vitamin B12 given together tended to increase milk production during the 16 wk of

lactation. This effect was more pronounced during the first 4 wk of lactation, 37.5, 37.7 and 40.3

± 0.9 kg/d for cows receiving no vitamin supplement, folic acid alone or combined with vitamin

B12, respectively. Milk fat yield was not affected by treatments. Lactose, crude protein and total

solid yields were greater, in early lactation, in cows injected with folic acid and vitamin B12

together but this effect faded out as lactation progressed. Intramuscular injections of folic acid

alone or combined with vitamin B12 tended to decrease plasma concentrations of homocysteine

from 5.51 with no vitamin supplement to 4.54 and 4.77 ± 0.37 µM, respectively. Results of the

present experiment suggest that the effects of the combined supplement of folic acid and vitamin

B12 on lactational performance of dairy cows were not due to an improvement in methyl groups

supply as RPM supplement, a source of preformed methyl groups, did not alter the cow

responsiveness to vitamin supplements.

Key words: dairy cow, folic acid, vitamin B12, rumen-protected methionine

86

III-3 INTRODUCTION

Previous experiments (see review, Girard and Matte, 2005a), showed that supplementary

folic acid could increase milk and milk protein yields in dairy cows but responses to the vitamin

supplement were variable. The unique role of folic acid is the transfer of one-carbon units and it

is essential to two metabolic pathways: DNA synthesis and the methylation cycle.

Tetrahydrofolate (THF) accepts one-carbon units from donors such as Ser, Gly, His or formate

and transfers them for purine and pyrimidine synthesis for DNA synthesis. Reactions in this

pathway are reversible. Tetrahydrofolate, after being reversibly converted to 5,10-methylene-

THF could also become involved in the methylation cycle after its irreversible conversion to 5-

methyl-THF. The major function of the methylation cycle is to provide S-adenosylmethionine

(SAM), which is the major donor of methyl groups in mammals. After having given its methyl

group, SAM becomes S-adenosylhomocysteine and then, homocysteine (Hcy). Hcy, a non-

structural AA, could be catabolized through the transsulfuration pathway or remethylated to Met.

Remethylation of Hcy uses 5-methyl-THF as a source of de novo methyl groups. This reaction is

mediated by an enzyme, methionine synthase for which vitamin B12 is a coenzyme (Lucock,

2000). As the production of 5-methyl-THF is irreversible and as this form of folates can not be

retained in the cells, a deficiency of vitamin B12 can trap folic acid under its methylated form, 5-

methyl-THF, and reduces its cellular utilization (Scott and Weir, 1981; Bässler, 1997).

A parenteral supplement of vitamin B12, given to cows fed a basal diet supplemented with

folic acid and Met, increased milk component yields as compared to cows only supplemented

with Met and folic acid (Girard and Matte, 2005b). However, in cows fed a diet providing a low

Met supply, dietary supplements of folic acid, given alone or in combination with vitamin B12,

increased milk and milk protein yields (Graulet et al., 2007). It is noteworthy that, in this last

study, the two vitamins given together seem to improve metabolic efficiency by increasing

plasma glucose and decreasing accumulation of hepatic lipids as compared to folic acid alone

(Graulet et al, 2007). However, the mode of action of supplementary folic acid is fully not

elucidated.

Given the metabolic roles of folic acid, the effects of supplementary folic acid on

lactational performance could be related to its action on DNA synthesis and/or the methylation

cycle. Cellular concentration of SAM is function of the availability of methyl groups which are

87

provided as preformed labile methyl groups by Met, betaine and choline or from de novo

synthesis from folate metabolism as described above. If the effects of supplementary folic acid on

lactational performance of dairy cows are mediated through the methylation cycle, then

supplementary Met, a major source of preformed methyl groups for SAM synthesis, should

reduce the requirements for folic acid and vitamin B12. Therefore, given the importance of

vitamin B12 to prevent functional deficiency of folates and the role of Met, as a source of methyl

groups, the present experiment was undertaken to elucidate the metabolic pathways explaining

the effects of supplementary folic acid on lactational performance described previously.

III-4 MATERIALS AND METHODS

III-4.1 Cows and treatments

Sixty Holstein multiparous cows from the herd at the Agriculture and Agri-Food Canada

Research Centre (Sherbrooke, QC, Canada) were kept in a tie-stall barn under 16 h of light per

day (0630 to 2230 h) and were milked twice daily at 12 h intervals. Care of cows followed the

recommended code of practice of Agriculture Canada (1990) and the guidelines of the Canadian

Council of Animal Care (1993). The experimental period began 3 wk before the expected time of

calving and lasted until 16 wk after calving. Cows were fed a close-up diet for 3 wk before the

expected time of calving until calving and then a basal lactation diet (Tableau 3). Cows had free

access to water and were fed ad libitum allowing 10% of refusals. The TMR was served once

daily before calving, at 0800 h and twice daily after calving, at 0800 h and 1600 h. Long hay was

given at 0730 h during all the experimental period. The amount of feed served was recorded

every day whereas refusals were weighed daily at 0700 h, 5 d per wk. DMI was calculated per

week for each cow as follows: average amount of feed served per day (7 d/wk) minus average

amount of orts per day (5 d/wk).

Cows were assigned to 10 blocks of 6 cows each according to their average milk

production in the previous lactation (27.8 ± 0.5 kg/d). Treatments were tested according to a 2 ×

3 factorial arrangement. Within each block, 3 cows were fed the basal diet estimated (NRC,

2001) to supply Met as 1.83% of metabolizable protein (MP) supply (M-) whereas the three

other cows were fed the same diet supplemented daily with rumen-protected Met (RPM; M+: 9

88

and 18 g Mepron-85/d, Degussa AG, Hanau, Germany, pre and post-calving respectively). With a

net Met concentration of 85%, 73% of rumen by-pass protection and 82% of intestinal

digestibility (Berthiaume et al., 2001), the product used in the present experiment was estimated

to provide 9.2 g/d of Met after calving and to increase the estimated Met supply to 2.23% of MP

(NRC, 2001). Within each level of Met (M+ or M-), cows received either no vitamin supplement

(B9-B12-), weekly intramuscular injections of 160 mg of folic acid alone (pteroylmonoglutamic

acid, ICN Biochemicals inc., Cleveland, Ohio, USA; B9+B12-) or in combination with 10 mg of

vitamin B12 (cyanocobalamin, 5 000 µg/mL, Vetoquinol, Lavaltrie, Québec, Canada; B9+B12+).

The amounts of vitamin supplemented were selected according to previous experiments (Girard

et al., 1995; Girard and Matte, 2005b). The parenteral route was chosen, instead of dietary

supplementation, in order to isolate the effects of vitamins on cow metabolism and to rule out any

possible effect on ruminal microflora.

III-4.2 Sampling procedures

III-4.2.1 Feed

Forage samples were collected twice a week. A subsample was immediately analysed by

near infrared reflectance spectrometry, to adjust, when necessary, the amounts of energy and

protein supplements to maintain similar concentrations of energy and degradable and

undegradable proteins throughout the experimental period. Another subsample was frozen at -

20°C for further analyses: DM, CP, ash, ether extract (AOAC, 1990), ADF, NDF, and acid-

detergent lignin (Ankom200 fiber analyzer, Ankom Technology Corp., Fairport, NY) and

minerals by inductively coupled plasma emission spectrometry (Agri-Food Laboratories, Guelph,

ON, Canada).

III-4.2.2 Body weight

Body weight was recorded at 1300 h at 22 ± 4.6 d pre-calving and 14 ± 1.7, 28 ± 1.7, 56 ±

1.7, 84 ± 1.7, and 112 ± 1.9 d after calving.

.

89

III-4.2.3 Milk

Milk production was recorded at each milking. Milk samples were collected during 4

consecutive milkings at 13 ± 2, 27 ± 2, 55 ± 2, 83 ± 2 and 111 ± 2 d of lactation. Milk

composition (fat, protein, lactose and urea) was determined with near infrared reflectance

spectroscopy method (Valacta, Sainte-Anne-de-Bellevue, QC, Canada).

III-4.2.4 Blood

After the distribution of the morning meal, blood samples were collected at 24 ± 5 d pre-

calving and 14 ± 2, 28 ± 2, 56 ± 2, 84 ± 2 and 112 ± 2 d after calving by caudal venipuncture,

using a Vacutainer® system (Becton, Dickinson and Co., Franklin Lakes, NJ). Tubes containing

EDTA were used for analyses of folates, vitamin B12, vitamin B6, biotin, BHBA and NEFA,

whereas tubes with heparin were used for AA, glucose and urea determinations. Blood was

centrifuged 20 min within one hour after sampling at 1,854 × g at 4oC. For amino acid analysis,

400 µL of plasma were mixed with 400 µL of Met sulfone (0.4 mM, internal standard, Sigma,

Oakville, ON, Canada). Plasma was kept frozen at -20oC until assayed.

III-4.3 Laboratory analyses

III-4.3.1 Folates and vitamin B12

Folates and vitamin B12 were determined in duplicate by radioassay using a commercial

kit designed for human plasma (Quantaphase folates II/vitamin B12, Bio-Rad Laboratories

Canada Ltd, Mississauga, ON, Canada) as described for plasma folates and vitamin B12 by Girard

and Matte (1988), milk folates by Girard and Matte (1998) and milk vitamin B12 by Preynat et al.

(2009, Chapitre IV). The interassay coefficients of variation were 4.2 and 4.8% for folates and

4.1 and 6.3% for vitamin B12 in plasma and milk, respectively.

90

III-4.3.2 Plasma biotin and vitamin B6

Biotin was determined using an ELISA test developed and validated for bovine plasma

(Santschi et al., 2005).

Plasma vitamin B6 was determined by a fluorimetric method adapted from Srivastava and

Beutler (1973) and Petidier et al. (1986). Five hundred microliters of plasma were diluted with

175 µL ultrapure water and vortexed. Seventy five microliters of 0.7 M Na2HPO4 and 125 µL of

0.2 M semicarbazide-HCl were added to tubes, vortexed and covered with aluminium foil. The

tubes were placed in boiling water for 5 min, rapidly cooled on ice, and 500 µL 12 % HClO4

were added. The tubes were centrifuged at 2,306 x g for 20 min at 4°C. A volume of 500 µL of

supernatant was taken and mixed with 2.5 mL of 0.1 M Na3PO4 just before measuring the

fluorescence (lambda excitation and emission were 360 and 460 nm, respectively). The inter-

assay coefficient of variation was 1.2%.

III-4.3.3 Plasma urea, NEFA, glucose and BHB

Plasma urea, NEFA, glucose and BHBA were determined using commercial kits:

Diagnostic Chemicals Limited UREA ASSAY, BioPacific Diagnostic Inc., Charlottetown, PE,

Canada; NEFA-C from Wako Chemicals GmbH, Neuss, Germany; Roche Diagnostics Glucose

GmbH, Mannheim, Germany and Pointe Scientific Inc., β-hydroxybutyrate Reagent Set, Canton,

MI, respectively.

III-4.3.4 Total homocysteine, total cysteine and methionine in plasma

Total Hcy, total Cys and Met concentrations were determined in plasma by a modification

of the HPLC methods of Malinow et al. (1989) described in Girard et al. (2005). Further changes

are reported in Preynat et al. (2009, Chapitre IV).

91

III-4.3.5 Amino acids in plasma

Plasma concentrations of the other AA were determined by HPLC as described by

Preynat et al. (2009, Chapitre IV).

III-4.4 Statistical analyses

Two levels of Met supplementation (0 or 18 g of RPM) and 3 supplements of B-vitamins

(none, folic acid alone or both folic acid and vitamin B12) were used in a 2 × 3 factorial

arrangement in a 10 randomized complete block design. All variables were analyzed using the

MIXED procedure of SAS (2004) according to a complete block design with treatments as main

effects, repeated measures in time and block as random effect. As the time intervals were

different, the six following covariance structures were compared: SP(POW), SP(GAU),

SP(EXP), SP(LIN), SP(LINL) and SP(SPH). For each variable, the statistical analysis retained

was the one with the smallest fit statistic values. Results are reported as least square means and

standard errors of the means. Means were assumed to be different at P ≤ 0.05 and tended to differ

at 0.05 < P ≤ 0.10. When the vitamin effect reached a level of significance of 90%, differences

between means were compared using an adjusted Tukey test. When the Met × vitamin interaction

reached a level of significant of 90%, the SLICE option in the LSMEANS statement was used to

help interpretation (SAS Institute, 2004).

III-5 RESULTS

III-4.5.1 Lactational performance

At the beginning of the experiment, 3 wk before the expected time of calving, BW

was similar among treatments (702 ± 7; P ≥ 0.7; Tableau 4). However, during lactation, BW of

M+ cows decreased slightly more from 2 to 4 wk of lactation than for M- cows with 623, 609,

609, 623 and 620 ± 9 kg vs 626, 620, 620, 624 and 626 ± 9 kg, respectively at 2, 4, 8, 12 and 16

wk of lactation (Met × time interaction, P = 0.05).

92

There was no treatment effect on DMI during the pre- and post-calving periods,

averaging 13.4 ± 0.4 and 21.8 ± 0.4 kg/d, respectively (P ≥ 0.13; Tableau 4).

Milk production was not affected by RPM (P = 0.8; Tableau 4). Folic acid and vitamin

B12, supplied both together, tended to increase milk production (vitamin, P = 0.08, Tableau 4 and

vitamin × time interaction, P = 0.10, Figure 24). On average, during the 16 wk of lactation, milk

production of B9+B12+ cows was 1.4 and 2 kg/d higher than for B9-B12- (P = 0.12) and B9+B12-

(P = 0.03) cows, respectively. Average milk productions of B9-B12- and B9+B12- cows were not

different (P = 0.5). The response in milk production for B9+B12+ cows was more marked during

the first 4 wk of lactation when milk production averaged 37.5, 37.7 and 40.3 ± 0.9 kg/d for B9-

B12-, B9+B12- and B9+B12+ respectively (P = 0.04). Gross efficiency (milk yield/DMI) is affected

differently by vitamin supplements according to Met supply (Met × vitamin interaction, P = 0.01;

Tableau 4). Globally, in M- cows, although gross efficiency of B9+B12- cows was numerically

lower, there was no statistically significant effect of vitamin supplementation (P = 0.73).

However, in M+ cows, gross efficiency was higher for B9+B12+ than for B9-B12- (P = 0.01) and

B9+B12- (P = 0.0001); moreover, it was lower (P = 0.03) for B9+B12- than B9-B12-.

Milk fat and total solids concentrations did not differ among treatments (P ≥ 0.2; Tableau

4). RPM increased milk crude protein concentrations from 29.4 to 30.5 ± 0.3 g/kg for M- and

M+, respectively (P = 0.001; Tableau 4). Response of lactose concentrations to vitamin

supplements differed according to Met supply (Met × vitamin interaction, P = 0.01; Tableau 4);

there was no effect of B-vitamin supply in M- cows (P = 0.66) but it changed milk concentrations

of lactose in M+ cows (P = 0.0001). In M+ cows, milk lactose concentrations were similar (P =

0.86) for B9-B12- and B9+B12- cows but lower for B9+B12+ (P = 0.001).

Milk fat yield was not affected by treatments (P ≥ 0.2; Tableau 4). Milk yields of lactose,

crude proteins and total solids were greater in early lactation in cows injected with folic acid and

vitamin B12 together but this effect faded out as lactation progressed (vitamin × time interaction,

P ≤ 0.05; Figure 25).

Milk concentrations of urea tended to be altered by vitamin supplements (P = 0.10;

Tableau 4), being higher for B9+B12+ cows than for cows receiving no vitamin supplement (P =

0.04) or folic acid alone (P = 0.002); 12.3, 12.1 and 12.9 ± 0.3 mg/dL for B9-B12-, B9+B12- and

B9+B12+ respectively. Milk urea also tended to change during the first 16 wk of lactation

according to Met supplementation (Met × time interaction, P = 0.06). At 2, 4, 8, 12 and 16 wk of

93

lactation, milk urea concentrations averaged 11.9, 12.3, 12.8, 13.3 and 12.8 for M- and 12.4,

12.0, 11.3, 12.8 and 12.7 ± 0.4 mg/dL for M+ cows, respectively.

There was no effect of vitamin supplements on average milk concentrations of folates

during the first 16 wk of lactation (P > 0.2; Tableau 4). However, the amount of folates secreted

in milk daily increased with the combined supplements of folic acid and vitamin B12 compared to

the other treatments (P ≤ 0.05), averaging 2.38, 2.36 and 2.67 ± 0.11 mg/d for B9-B12-, B9+B12-

and B9+B12+, respectively. Concentrations and amounts of vitamin B12 secreted in milk were

increased by intramuscular injections of vitamin B12 (P = 0.001; Tableau 4).

III-4.5.2 Plasma variables

III-4.5.2.1 B-vitamins

At the beginning of the experiment, 3 wk before the expected time of calving, plasma

folates (7.4 ± 0.6 ng/mL) and vitamin B12 (231 ± 10 pg/mL) were similar among treatments (P ≥

0.3). On average, after calving, cows fed RPM tended to have lower plasma concentrations of

folates than M- cows (P = 0.09; Tableau 5) with, 15.2 vs 16.6 ± 0.7 ng/mL for M+ and M-,

respectively. The effect of vitamin supplementation on plasma folates changed during lactation

(vitamin × time interaction, P = 0.03; Figure 26). Plasma concentrations of folates in B9-B12- and

B9+B12+ cows increased to reach a plateau at 4 wk of lactation whereas in B9+B12- cows, plasma

folates increased until 8 wk after calving and decreased thereafter to reach a plateau at 12 wk of

lactation.

Plasma concentrations of vitamin B12 were increased by vitamin B12 supplements (P =

0.001; Tableau 5); 189, 187 and 365 ± 15 pg/mL for B9-B12-, B9+B12- and B9+B12+, respectively.

Nevertheless, Met supply tended to modify the response to vitamin supplementation (Met ×

vitamin interaction, P = 0.1). In cows injected with folic acid and vitamin B12 together, plasma

concentrations of vitamin B12 were higher (P = 0.04) in M+ than M- cows whereas there was no

such effect in B9-B12- (P = 0.5) and B9+B12- (P = 0.3). Overall, the lowest plasma

concentrations of vitamin B12 were observed 4 and 8 wk after calving but increased thereafter

(time, P = 0.06) with ; 259, 219, 218, 262 and 278 ± 18 pg/mL at 2, 4, 8, 12 and 16 wk of

lactation, respectively.

94

Plasma concentrations of biotin and vitamin B6 were not affected by treatments (P ≥ 0.3;

Tableau 5) but, for the two vitamins, the lowest concentration was observed 2 wk after calving

(time, P ≤ 0.001). At 2, 4, 8, 12 and 16 wk of lactation, plasma concentrations of vitamin B6 and

biotin were 177, 186, 184, 188 and 181 ± 5 ng/mL and 911, 978.9, 979, 1054 and 1052 ± 17.7

pg/mL, respectively.

III-4.5.2.2 Glucose, NEFA, BHBA and Urea

Dietary supplements of RPM decreased plasma concentrations of glucose from 3.63 to

3.55 ± 0.03 μM (P = 0.05; Tableau 5). The lowest concentration was observed 2 wk after calving

with, 3.45, 3.55, 3.71, 3.63 and 3.61 ± 0.04 μM at 2, 4, 8, 12 and 16 wk of lactation, respectively

(time, P = 0.001).

Plasma concentrations of NEFA decreased during the experimental period (time, P =

0.001) with, 757, 549, 326, 192 and 159 ± 30 μM at 2, 4, 8, 12 and 16 wk of lactation but did not

differ among treatments (P ≥ 0.2).

The response of plasma concentrations of BHBA to vitamin supplements tended to differ

according to Met supply (Met × vitamin interaction, P = 0.06; Tableau 5); cows fed RPM had

higher (P = 0.02) BHBA concentrations than M- cows when not supplemented with vitamins

whereas there was no effect (P ≥ 0.3) of Met supply on plasma BHBA in B9+B12- and B9+B12+

cows. Plasma concentrations of BHBA decreased as lactation progressed (time, P = 0.02) from

0.70, 0.70, 0.61, 0.57 and 0.52 ± 0.04 mM at 2, 4, 8, 12 and 16 wk of lactation, respectively.

Plasma concentrations of urea were not different among treatments (P ≥ 0.2; Tableau 5)

but increased throughout the experimental period (time, P = 0.001), 3.8, 4.6, 5.0, 5.7 and 5.8 ±

0.1 mM, at 2, 4, 8, 12 and 16 wk of lactation, respectively.

III-4.5.2.3 Amino acids

Dietary supplements of RPM increased plasma concentrations of Met from 21 to 24 ± 1

μM (P = 0.01) but decreased plasma concentrations of Tyr (P = 0.05; Tableau 5) and Ser (P =

0.10; Tableau 5).

95

Plasma concentrations of Ser (P = 0.04), Asp (P = 0.03) and Hcy (P = 0.08) changed

according to vitamin supplementation (Tableau 5). Folic acid and vitamin B12 given together

tended to increase plasma concentrations of Ser as compared to the two other treatments (P ≤

0.07), 111, 114 and 120 ± 3 μM for B9-B12-, B9+B12- and B9+B12+, respectively. Plasma Asp was

higher (P = 0.02) in B9+B12- (7.4 ± 0.5 μM) than in B9-B12- (5.5 ± 0.5 μM) but did not differ (P =

0.6) from B9+B12+ cows (6.6 ± 0.5 μM). Intramuscular injections of folic acid alone (P = 0.03) or

combined with vitamin B12 (P = 0.09) tended to decrease plasma concentrations of Hcy, from

5.51 to 4.54 and 4.77 ± 0.37 μM in B9-B12-, B9+B12- and B9+B12+ cows, respectively (P = 0.08;

Tableau 5).

The responses of plasma concentrations of Ala, Arg, His, Ile, Leu, Lys, Pro, Val,

branched-chain AA, essential AA and total AA to vitamin injections differed according to the

level of Met supplementation (Met × vitamin interaction, P ≤ 0.07; Tableau 5). In M- cows,

plasma concentrations of these AA were higher (P ≤ 0.04) in B9+B12+ cows as compared to the

others treatments while the vitamin supplements had no such effect in M+ cows (P ≥ 0.05). An

opposite trend was observed for plasma Thr (Met × vitamin interaction, P ≤ 0.01).

Globally, plasma concentrations of Ala, Arg, Cys, His, Hcy, Leu, Lys, Phe, Pro, Ser, Val,

branched-chain AA and essential AA increased throughout the experimental period toward a

plateau at the end of the experimental period (time, P ≤ 0.002, data not shown). Plasma

concentrations of Asp, Thr and Tyr increased from 2 to 8 wk of lactation but decreased thereafter

(time, P ≤ 0.01). Plasma Gly, Glu and non-essential AA decreased as the lactation progressed

(time, P ≤ 0.001) whereas there was no effect of time (P ≥ 0.12) on plasma Ile, Met and total AA.

III-6 DISCUSSION

Based on changes in milk and plasma concentrations of vitamin B12, intramuscular

injections of vitamin B12 increased the supply of this vitamin to dairy cows as observed by Girard

and Matte (2005b). However, the increase in plasma vitamin B12 was smaller in M- cows than

M+ cows, suggesting a difference in tissue utilization of the vitamin according to Met supply.

Milk concentrations of folates were not affected by folic acid injections although the

amount of folates secreted in milk daily were higher in B9+B12+ cows. The absence of response

96

of plasma concentrations of folates, determined 7 d after the weekly intramuscular injections of

folic acid, could be due to the rapid plasma clearance of folic acid after intramuscular injections

of this vitamin (Girard et al., 1989). Similarly, regardless of parity, a single intramuscular

injection of folic acid failed to increase plasma and milk concentrations of folates in early

lactation (Girard et al., 1989). However, weekly intramuscular injections of 160 mg of folic acid

given for at least 30 wk before calving increased plasma folates from 14 to 17 ng/mL during the

first 6 wk of lactation but had no effect on milk concentrations of folates (Girard et al., 1995).

Nevertheless, independent of vitamin supply, plasma folates decreased when Met supply

increased as also reported in rat (Gawthorne and Stokstad, 1971; Thenen and Stokstad, 1973) and

human (Connor et al., 1978). This is probably due to S-adenosylmethionine (SAM) intracellular

concentrations rising in parallel to Met supply and acting as an allosteric inhibitor of

methylenetetrahydrofolate reductase (MTHFR)(Lucock, 2000). The latter is the enzyme

promoting the conversion of 5,10-methylene-THF to 5-methyl-THF, the major form of folates in

human (Selhub, 1999) and cow (unpublished) plasma.

In the present experiment, supplementary folic acid alone had no effect on milk

production or milk component yields of multiparous cows but in M+ cows, it decreased gross

efficiency, calculated as milk yield/DMI. Supplementation of folic acid plus vitamin B12 tended

to increase milk production and milk component yields (crude protein, lactose and total solids),

the effect being greater during the first 4 wk of lactation. Indeed, the effects of supplementary

folic acid on lactational performance of dairy cows reported in the literature are variable. In early

lactation, milk production was either unchanged or depressed following folic acid

supplementation in primiparous cows, whereas in cows at their second or more lactation, milk

production was increased (Girard et al., 1995, Girard and Matte, 1998). However, Girard et al.

(2005) observed no effect of folic acid supplements on milk and milk component yields in

multiparous cows, fed a basal diet, supplemented or not with Met. Nevertheless, intramuscular

injections of vitamin B12 improved milk and milk component yields of primiparous cows fed the

same basal diet than in the study of Girard et al. (2005) supplemented with RPM and folic acid

(Girard and Matte, 2005b). Graulet et al. (2007) observed that dietary supplements of folic acid,

given alone or combined with vitamin B12, increased milk and milk protein yields to the same

extent whereas feeding the two vitamins together increased metabolic efficiency. However, in

that study, supplementary vitamin B12 alone had no effect on lactational performance.

97

Even if milk component yields tended to be increased by the combined supplement of

folic acid and vitamin B12 without increasing DMI, especially in early lactation, there was no

increment in plasma concentrations of NEFA and BHBA, indicating a possible improvement in

metabolic efficiency when folic acid and vitamin B12 were given together. These observations are

supported by the results from a study conducted on a sub-group of cows from the present

experiment where whole-body glucose and Met fluxes were measured at 12 wk of lactation

(Preynat et al., 2009, chapitre IV). In this study, supplementary folic acid and vitamin B12 given

together increased glucose whole body flux, probably due to an increase in gluconeogenesis. In

the same line, Graulet et al. (2007) observed that, even if milk production was similar for cows

fed supplementary folic acid, alone or combined with vitamin B12, plasma concentration of

glucose was higher in cows fed the two vitamins together. Vitamin B12 is a coenzyme for

methylmalonylCoA mutase, a mitochondrial enzyme essential to the entry of propionate in the

Krebs cycle, propionate being the major glucose precursor in ruminants (Kennedy et al., 1990;

Taoka et al., 1994). However, even if folates are not known to participate in the

methylmalonylCoA pathway, Graulet et al. (2007) reported that the affinity of the enzyme for

vitamin B12 was increased in liver of cows fed folic acid and vitamin B12 together as compared to

no vitamin supplements or the two vitamins given separately. Similarly, Selhub et al. (2007)

observed that both metabolic pathways involving vitamin B12-dependent enzymes, methionine

synthase and methylmalonylCoA mutase, are affected by folic acid supply. According to these

authors, when vitamin B12 supply is adequate, increasing folate status improves the efficiency of

the two vitamin B12-dependent enzymes whereas when vitamin B12 status is low, increasing

folate supply worsens the two enzymatic functions. Such effect needs to be further investigated.

Biotin, another B vitamin, is a coenzyme for the enzyme propionyl-CoA carboxylase, a

reaction preceding the action of methylmalonyl-CoA mutase in the metabolic pathway for the

entry of propionate in the Krebs cycle (Combs, 1998). Plasma concentrations of biotin were not

affected by treatments giving an indication that, even if efficiency of this metabolic pathway was

improved by vitamin supplements, biotin supply did not seem to be limiting.

Plasma concentrations of Hcy were decreased by injections of folic acid, alone or

combined with vitamin B12, independently of Met supply. Within cells, especially hepatic cells,

the metabolic fates of Hcy are catabolism through the transsulfuration pathway or remethylation.

In the latter pathway, Hcy accepts a methyl group from 5-methyl-THF to form Met via a vitamin

98

B12 dependent-enzyme, methionine synthase (Selhub, 1999). Excess of Hcy is exported out of the

cells to maintain low intracellular concentrations of this cytotoxic AA (Selhub, 1999), explaining

the small concentrations of Hcy normally present in plasma. As observed in humans (Mangum et

al., 1969; Stam et al., 2005), supplements of folic acid, with or without vitamin B12, probably

reduced plasma concentrations of Hcy through an enhancement of methionine synthase activity.

The impact of treatments on the transsulfuration pathway was limited as they had no effect on

plasma concentrations of Cys or vitamin B6, a coenzyme for two enzymes of this pathway.

The supplement of RPM, used in the present experiment, increased plasma concentrations

of Met as previously reported (Overton et al., 1996; Overton et al. 1998). It also increased crude

protein concentrations in milk which is the effect the most frequently reported in the literature

(NRC, 2001; Leonardi et al., 2003; Socha et al., 2005) but had no effect on milk crude protein

yield. Although in the current experiment, feeding RPM slightly decreased glucose

concentrations by 2% and tended to increase plasma concentrations of BHBA by 30% in cows

fed no vitamin supplement, glucose concentrations were within normal physiological range (Ohgi

et al., 2005) and BHBA concentrations were below the limit for ketosis (1 mM; Gröhn et al.,

1983). These observations are consistent with a slight increase in body reserve mobilization in

cows fed RPM based on an average lost of 14 kg BW between the 2nd and 4th wk of lactation.

The effects of vitamin supplements on milk component yields did not differ according to

Met supply. However, intramuscular injections of the two vitamins together increased plasma

concentrations of Ala, Arg, His, Ile, Leu, Lys, Val, branched-chain AA, total AA and essential

AA in M- cows whereas there was no such effect in M+ cows. This observation suggests a

change in whole body protein metabolism with folic acid and vitamin B12 injections when Met

supply was low. In a sub-group of cows from the present experiment, it was observed that the

combined supplement of folic acid and vitamin B12 increased protein synthesis through possibly

increased protein turnover when Met supply was low and through decreased Met oxidation when

RPM was fed (Preynat et al., 2009, chapitre IV).

III-7 CONCLUSION

In the present experiment, in spite of the observation that plasma Hcy was decreased by

supplementary folic acid, alone or combined with vitamin B12, folic acid supplements alone had

99

no positive effect on milk and milk component yields. Moreover as supplying preformed labile

methyl groups as RPM had no effect either on milk and milk component yields, it is unlikely that

the effect of the combined supplement of vitamins on lactational performance during the first

weeks of lactation, when plasma concentrations of vitamin B12 were the lowest, were due to an

improvement in methyl group supply through methylneogenesis. The effects of RPM on plasma

folates as well as differences in response to RPM of plasma concentrations of vitamin B12 and

several AA according to vitamin supplements suggest that Met supply affected tissue utilization

of these vitamins and whole body protein metabolism. Folic acid and vitamin B12 given together

increased milk and milk component yields during the first weeks of lactation without effect on

DMI or plasma NEFA. Given the experimental design used, it is not possible to conclude if these

effects were due to the combination of the two vitamins or to vitamin B12 itself.

III-8 ACKNOWLEDGMENTS

The authors are grateful to Guylaine Fortin, Michel Poitras and Jean Vallières for animal

care, to Chrystiane Plante, Véronique Roy, Linda Marier and Micheline Gingras for technical

assistance and Steve Méthot for statistical advices. Thanks are also extended to the financial

support of the Action Concertée Fonds NOVALAIT inc.– FQRNT - MAPAQ – Agriculture et

Agroalimentaire Canada.

100

Tableau 3. Ingredients and nutrient composition of the diets fed to dairy cows

Close-up diet Lactation diet

Ingredients, %

Grass hay 33.01 8.22

Legume-grass silage3 11.0 23.4

Corn silage4 14.5 23.1

Cracked corn 16.9 28.5

Soybean meal 49% 9.6

Beet pulp 13.3

Micronized soybean 3.9 2.0

Distiller's grain (wheat) 1.3 0.7

Distiller's grain (corn) 2.2 1.1

Canola meal 1.3 0.7

Mineral and vitamin premix 1.65 1.86

Calcium carbonate 1.0 0.8

Nutrient composition

CP, % 12.8 17.3

RDP, %7 7.9 10.6

RUP, %7 4.9 6.7

ADF, % 26.5 19.2

NDF, % 45.2 30.4

NEl, Mcal/kg DM8 1.55 1.58

MP, g/day8 1,055 2,341

Methionine, % MP8 1.85 1.83

Lysine, % MP8 6.18 6.3

K, % 1.27 1.55

Ca, % 0.69 0.87

P, % 0.52 0.44

Mg, % 0.39 0.29

S, % 0.25 0.26

101

Cl, % 0.43 0.34 1 7.8 ± 1.1% CP, 0.8 ± 0.1% soluble protein, 34.2 ± 5.8% ADF, 58.9 ± 7.0% NDF, 5.6 ± 0.6% lignin, (n =

3). 210.9 ± 1.7% CP, 2.4 ± 0.1% soluble protein, 31.9 ± 1.8% ADF, 55.1 ± 4.2% NDF, 4.4 ± 0.5% lignin (n =

5). 316.8 ± 2.3% CP, 8.0 ± 1.2% soluble protein, 32.8 ± 4.1% ADF, 42.3 ± 5.9% NDF, 7.5 ± 2.5% lignin (n =

11). 47.6 ± 0.4% CP, 3.5 ± 0.6% soluble protein, 21.3 ± 1.5% ADF, 37.0 ± 1.9% NDF, 2.1 ± 0.3% lignin (n =

10). 5Contains per kg, 30 g Ca, 120 g P, 120 g Mg, 69 g Na, 106 g Cl, 15 g K, 20 g S, 4,343 mg Fe, 6,566 mg

Mn, 6,465 mg Zn, 1,616 mg Cu, 202 mg I, 121 mg Co, 40 mg Se (25% organic selenium), 732,323 IU vitamin A, 247,475 IU vitamin D and 7,576 IU vitamin E.

6Contains per kg, 95 g Ca, 55 g P, 55 g Mg, 130 g Na, 150 g Cl, 14 g K, 21 g S, 2,745 mg Fe, 2,065 mg Mn, 3,000 mg Zn, 495 mg Cu, 69 mg I, 33 mg Co, 20 mg Se (25% organic selenium), 501,859 IU vitamin A, 65,000 IU vitamin D and 2,600 IU vitamin E.

7Calculated according to National Research Council model (2001). 8Calculated according to National Research Council (2001) from average DMI of control cows (M-B9-B12-

) during the close-up (12.6 kg/d) and lactation (21.8 kg/d) periods.

102

Tableau 4. Effects of dietary supplements of rumen-protected Met (M) and intramuscular injections of folic acid (B9) and vitamin B12 (B12) given to dairy cows from 3 wk before calving to 16 wk of lactation on dry matter intake, milk production and composition

Treatments1 P values

M+ M-

B9-B12- B9+B12- B9+B12+ B9-B12- B9+B12- B9+B12+ SEM2 met vit met*vit

n 10 10 10 10 10 10

BW, kg

3 wk before calving 703 693 704 716 705 694 17 0.71 0.76 0.74

post-calving3 616 617 618 624 622 624 15 0.61 0.99 0.99

DMI, kg/d

pre-calving4 13.7 13.4 13.4 12.6 13.3 13.8 0.4 0.31 0.50 0.13

post-calving4 21.4 22.3 21.1 21.8 21.7 22.5 0.6 0.36 0.75 0.19

Milk production, kg/d 5 37.3 36.9 38.8 37.7 36.8 38.9 1.1 0.83 0.08 0.97 Milk yield/DMI4 1.76 1.70 1.81 1.76 1.72 1.75 0.04 0.26 0.004 0.01 Milk composition

Fat, g/kg4 37.3 37.1 37.1 36.9 36.3 35.7 0.9 0.23 0.72 0.80

Crude protein, g/kg4 30.8 30.4 30.1 29.5 29.5 29.1 0.3 0.001 0.15 0.78

Lactose, g/kg4 46.5 46.3 45.1 46.6 46.5 46.3 0.3 0.001 0.001 0.01

Total solids, g/kg4, 7 114.5 113.6 112.3 113.1 112.4 111.1 1.3 0.19 0.23 0.99

Urea, mg/dL3 12.2 12.0 12.5 12.4 12.2 13.2 0.4 0.20 0.10 0.81

Folates, ng/mL4 65.4 61.6 69.7 62.7 66.8 68.5 3.8 0.87 0.23 0.46

Vitamin B12, pg/mL4 4800 4996 7359 4781 4976 6816 270 0.33 0.001 0.48 Milk yields

103

Fat, kg/d4 1.38 1.37 1.44 1.38 1.33 1.38 0.04 0.32 0.23 0.71

Crude protein, kg/d5 1.14 1.12 1.17 1.11 1.08 1.13 0.03 0.16 0.29 0.99

Lactose, kg/d5 1.73 1.70 1.75 1.76 1.71 1.80 0.05 0.35 0.23 0.87

Total solids, kg/d5, 7 4.26 4.19 4.35 4.25 4.13 4.32 0.11 0.65 0.16 0.96

Folates, mg/d6 2.41 2.26 2.67 2.36 2.45 2.65 0.14 0.75 0.05 0.61 Vitamin B12, μg/d 175 179 282 178 182 262 9 0.47 0.001 0.32

1M-: basal diet –; M+: basal diet + rumen-protected Met; B9-B12-: no vitamin supplement; B9+B12-: 160 mg folic acid/wk; B9+B12+: 160 mg folic acid/wk + 10 mg cyanocobalamin/wk. 2SEM = standard error of the mean. 3Met × time, P ≤ 0.06. 4Time effect, P = 0.0001. 5Vitamin × time, P ≤ 0.10. 6Met × vitamin × time, P = 0.08. 7Total solids = fat + proteins + lactose.

104

Tableau 5. Effects of dietary supplements of rumen-protected Met (M) and intramuscular injections of folic acid (B9) and vitamin B12 (B12) given to dairy cows from 3 wk before calving to 16 wk of lactation on plasma concentrations of some B-vitamins, glucose, urea, NEFA, BHBA and AA

Treatments1 P values

M+ M-

B9-B12- B9+B12- B9+B12+ B9-B12- B9+B12- B9+B12+ SEM2 met vit met*vit

n 10 10 10 10 10 10

Vitamins

Folates, ng/mL3 14.5 15.0 16.1 15.9 16.5 17.4 1.1 0.09 0.32 0.99

Vitamin B12, pg/mL4 198 174 394 181 200 337 20 0.31 0.001 0.10

Vitamin B6, ng/mL4 183 181 179 183 185 188 7 0.30 0.99 0.77

Biotin, pg/mL4 1006 985 1000 998 1001 981 23 0.83 0.85 0.70

Glucose, μM4 3.55 3.57 3.54 3.66 3.63 3.6 0.05 0.05 0.77 0.82

NEFA, μM4 450 370 391 401 367 401 35 0.58 0.19 0.61

BHBA, mM4 0.74 0.58 0.62 0.57 0.51 0.70 0.05 0.21 0.04 0.06

Urea, mM4 4.87 4.69 5.03 4.95 5.04 5.07 0.16 0.18 0.43 0.47

AA, μM

Ala4 293.4 286.4 277.4 274.2 279.3 304.9 11.1 0.96 0.68 0.07

Arg4 80.8 82.2 81.0 77.7 84.8 91.6 3.0 0.11 0.03 0.03

Asp4 5.1 7.6 6.9 5.9 7.3 6.2 0.7 0.89 0.03 0.53

Cys4 108.5 108.5 105.5 105.1 108.3 111.0 4.4 0.83 0.90 0.49

105

Glu4 62.8 60.4 58.3 58.1 57.7 57.6 2.3 0.11 0.47 0.62

Gly4 437.7 388.6 424.7 402.8 398.1 405.9 18.2 0.31 0.27 0.45

His4 46.5 43.0 42.2 43.6 48.8 54.4 2.8 0.02 0.45 0.02

Hcy4 5.96 4.46 4.71 5.06 4.61 4.83 0.48 0.56 0.08 0.41

Ile 140.5 137.2 135.5 135.1 133.1 156.6 5.6 0.25 0.18 0.01 Leu4 218.9 212.1 198.5 216.9 208.5 244.1 9.1 0.07 0.44 0.01

Lys4 90.6 88.3 82.8 90.3 84.9 103.7 3.3 0.03 0.12 0.0003

Met 23.7 23.5 23.3 21.3 20.7 21.8 1.2 0.01 0.90 0.84

Phe4 53.4 53.2 50.4 55.5 51.6 56.8 2.4 0.19 0.62 0.18

Pro4 124.4 134.6 117.6 126.3 127.4 142.3 5.5 0.08 0.42 0.002

Ser4 108.9 109.1 120.2 113.9 118.4 119.7 3.6 0.1 0.04 0.36

Thr4 149.8 152.2 132.9 150.7 142.3 157.1 5.7 0.27 0.64 0.01

Tyr4 71.9 83.1 78.3 81.7 81.0 85.6 3.3 0.05 0.14 0.11

Val4 326.5 325.0 300.0 320.9 331.5 369.3 11.4 0.01 0.62 0.002

BCAA4, 5 682 674 631 673 673 762 25 0.04 0.58 0.004

TAA6 2229 2184 2120 2172 2177 2369 53 0.12 0.40 0.003 EAA4, 7 1023 1010 937 1013 1001 1135 30 0.01 0.56 0.0002

NEAA4, 8 1185 1152 1163 1141 1154 1213 31 0.92 0.45 0.26 1M-: basal diet –; M+: basal diet + rumen-protected Met; B9-B12-: no vitamin supplement; B9+B12-: 160 mg folic acid/wk; B9+B12+: 160 mg folic acid/wk + 10 mg cyanocobalamin/wk. 2SEM = standard error of the mean. 3Vitamin × time, P < 0.09. 4Time effect, P < 0.01. 5BCAA, branched-chain amino acids = Ile + Leu + Val. 6TAA, total amino acids. 7EAA, essentials amino acids = His + Ile + Leu + Met + Lys + Phe + Thr + Val. 8NEAA, non essentials amino acids = Ala + Arg + Asp + Cys + Glu + Gly + Pro + Ser + Tyr.

Figure 24. Effects of intramuscular injections of folic acid (B9) and vitamin B12 (B12) given to dairy cows from 3 wk before calving to 16 wk of lactation on milk production. B9-B12- (_ _ ▲_ _) = no vitamin supplement; B9+B12- (□) = 160 mg of folic acid/wk; B9+B12+ (■) = 160 mg of folic acid/wk + 10 mg of vitamin B12/wk (SEM = 1.0; vitamin × time interaction, P = 0.10)

30

32

34

36

38

40

42

44

0 2 4 6 8 10 12 14 16 18

Time after calving (wk)

Milk

yie

ld

(kg

/d)

Figure 25. Effects of intramuscular injections of folic acid (B9) and vitamin B12 (B12) given to dairy cows from 3 wk before calving to 16 wk of lactation on milk protein yields. B9-B12- (

_ _ ▲_ _) = no vitamin supplement; B9+B12- (□) = 160 mg of folic acid/wk; B9+B12+ (■) = 160 mg of folic acid/wk + 10 mg of vitamin B12/wk (SEM = 33.1; vitamin × time interaction, P = 0.04)

900

950

1000

1050

1100

1150

1200

1250

1300

0 2 4 6 8 10 12 14 16 18

Time after calving (wk)

Milk

pro

tein

yie

ld (

g/d)

Figure 26. Effects of intramuscular injections of folic acid (B9) and vitamin B12 (B12) given to dairy cows from 3 wk before calving to 16 wk of lactation on plasma concentrations of folates. B9-B12- (

_ _ ▲_ _) = no vitamin supplement; B9+B12- (□) = 160 mg of folic acid/wk; B9+B12+ (■) = 160 mg of folic acid/wk + 10 mg of vitamin B12/wk (SEM = 1.0; vitamin × time interaction, P = 0.03)

12

13

14

15

16

17

18

19

0 2 4 6 8 10 12 14 16 18

Time after calving (wk)

Pla

sma

fola

tes

(ng/

mL)

III-9 REFERENCES

Agriculture Canada. 1990. Recommended Code of Practice for Care and Handling of Dairy Cattle. Publ. No. 1853/E. Agric. Can., Ottawa, Ontario.

Association of Official Analytical Chemists. 1990. Official Methods of Analysis. 15th ed. AOAC,

Arlington, VA.

Bässler, K. H. 1997. Enzymatic effects of folic acid and vitamin B12. Internat. J. Vitam. Nutr. Res. 67: 385-388.

Berthiaume, R., P. Dubreuil, M. Stevenson, B. W. McBride, and H. Lapierre. 2001. Intestinal disappearance and mesenteric and portal appearance of amino acids in dairy cows fed ruminally protected methionine. J. Dairy Sci. 84:194-203.

Canadian Council on Animal Care. 1993. Guide to the Care and Use of Experimental Animals. 2nd ed. Vol. 1. E.D. Rolfert, B.M. Cross, and A.A. McWilliam, ed. Can. Counc. Anim. Care. Ottawa, Ontario.

Connor, H., D. J. Newton, F. E. Preston, and H. F. Woods. 1978. Oral methionine loading as a cause of acute serum folate deficiency: its relevance to parenteral nutrition. Postgraduate Med. 54: 318-320.

Gawthorne, J. M., and E. L. R. Stokstad. 1971. The effect of vitamin B12 and methionine on folic acid uptake by rat liver. Proc. Soc. Exp. Biol. Med. 136:42-46.

Girard, C. L., and J. J. Matte. 1988. Blood serum concentrations of folates and vitamin B12 during growth period of white veal calves. Can. J. Anim. Sci. 68:455-60.

Girard, C. L., J. J. Matte, and G. F. Tremblay. 1989. Serum folates in gestating and lactating dairy cows. J. Dairy Sci. 72:3240-3246.

Girard, C. L., J. J. Matte, and G. F. Tremblay. 1995. Gestation and lactation of dairy cows: a role for folic acid ? J. Dairy Sci. 78:404-11.

Girard, C. L., and J. J. Matte. 1998. Dietary supplements of folic acid during lactation: effects on the performance of dairy cows. J. Dairy Sci. 81:1412-1419.

Girard, C. L., H. Lapierre, J. J. Matte, and G. E. Lobley. 2005. Effects of dietary supplements of folic acid and rumen-protected methionine on lactational performance and folate metabolism of dairy cows. J. Dairy Sci. 88:660-70.

Girard, C. L., and J. J. Matte. 2005a. Folic acid and vitamin B12 requirements of dairy cows: a concept to be revised. Livest. Prod. Sci. 98:123-133.

Girard, C. L., and J. J. Matte. 2005b. Effects of intramuscular injections of vitamin B12 on lactation performance of dairy cows fed dietary supplements of folic acid and rumen-protected methionine. J. Dairy Sci 88:671-6.

Graulet, B., J. J. Matte, A. Desrochers, L. Doepel, M. F. Palin, and C. L. Girard. 2007. Effects of dietary supplements of folic acid and vitamin B12 on metabolism of dairy cows in early lactation. J. Dairy Sci. 90:3442-3455.

Gröhn, Y., L. A. Lindberg, M. L. Bruss, and T. B. Farver. 1983. Fatty infiltration of liver in spontaneously ketotic dairy cows. J. Dairy Sci. 66:2320-2328.

Kennedy, D. G., A. Cannavan, A. Molloy, F. O’Harte, S. M. Taylor, S. Kennedy, and W. J. Blanchflower. 1990. MethylmalonylCoA mutase (EC 5.4.99.2) and methionine synthetase (EC 2.1.1.13) in the tissues of cobalt-vitamin B12 deficient sheep. Br. J. Nutr. 64: 721-732.

Leonardi, C., M. Stevenson, and L. E. Armentano. 2003. Effect of two levels of crude protein and methionine supplementation on performance of dairy cows. 2003. J. Dairy Sci. 86:4033-42.

Lucock, M. 2000. Folic acid: nutritional biochemistry, molecular biology, and role in disease processes. Mol. Genet. Metab. 71:121-38.

Malinow, M. R., S. S. Kang, L. M. Taylor, P. W. K. Wong, B. Coull, T. Inahara, D. Mukerjee, G. Sexton, and B. Upson. 1989. Prevalence of hyperhomocyst(e)inemia in patients with peripheral arterial occlusive disease. Circulation. 79:1180-88.

Mangum, J. H., Murray B. K., and North J. A. 1969. Vitamin B12 dependent methionine biosynthesis in cultured mammalian cells. Biochemistry. 8:3496-9.

National Research Council. 2001. Nutrient Requirements of Dairy Cattle. 7th rev. ed. Natl. Acad. Sci., Washington, DC.

Ohgi, T., S. Kamimura, Y. Minezaki, and M. Takahashi. 2005. Relationship between fat accumulation in the liver and energy intake, milk fat yield and blood metabolites in dairy cows. Anim. Sci. 76:549-557.

Overton, T. R., D. W. LaCount, T. M. Cicela, and J. H. Clark. 1996. Evaluation of a ruminally protected methionine products for lactating dairy cows. J. Dairy Sci. 79:631-38.

Overton, T. R., L. S. Emmert, and J. H. Clark. 1998. Effects of source of carbohydrate and protein and rumen-protected methionine on performance of cows. J. Dairy Sci. 81:221-28.

Petidier, A., S. Rubio, A. Gomez-Hens, and M. Valcarcel. 1986. Simultaneous and direct determination of pyridoxal, pyridoxal-5’-phosphate, pyridoxic acid in serum by derivative synchronous fluorescence spectroscopy. Anal. Biochem. 157:212-20.

Preynat, A., H. Lapierre, C. M. Thivierge, M. F. Palin, J. J. Matte, A. Desrochers, and C. L. Girard. 2009 (Chapitre IV). Effects of supplements of folic acid, vitamin B12 and rumen-protected methionine on whole body metabolism of methionine and glucose in lactating dairy cows. J. Dairy Sci.92:677-689.

Santschi, D. E., J. Chiquette, R. Berthiaume, R. Martineau, J. J. Matte, A. F. Mustafa, and C. L. Girard. 2005. Effects of the forage to concentrate ratio on B-vitamin concentrations in different ruminal fractions of dairy cows. Can. J. Anim. Sci. 85:389-399.

SAS Institute. 2004. SAS/STAT User’s Guide: Volumes 1-7. SAS Inst. Inc., Cary, NC.

Scott, J. M., and D. G. Weir. 1981. The methyl trap. A physiological response in man to prevent methyl group deficiency in kwashiorkor (methionine deficiency) and an explanation for folic-acid induced exacerbation of subacute combined degeneration in pernicious anaemia. Lancet. 2:337-340.

Selhub, J. 1999. Homocysteine metabolism. Annu. Rev. Nutr. 19:217-246.

Selhub, J., M. S. Morris, and P. F. Jacques. 2007. In vitamin B12 deficiency, higher serum folate is associated with increased total homocysteine and methylmalonic acid concentrations. Proc. Natl. Acad. Sci. USA. 104: 19995-20000.

Socha, M. T., D. E. Putnam, B. D. Garthwaite, N. L. Whitehouse, N. A. Kierstead, C. G. Schwab, G. A. Ducharme, and J. C. Robert. 2005. J. Dairy Sci. 88:1113-28.

Srivastava, S. K., and E. Beutler. 1973. A new fluorimetric method for the determination of pyridoxal 5’-phosphate. Biochim. Biophys. Acta. 304:765-73.

Stam, F., Y. M. Smulders, C. Guldener, C. Jakoks, C. D. A., Stehouwer, and K. Meer. 2005. Folic acid treatment increases homocysteine remethylation and methionine transmethylation in healthy

subjects. Clin. Sci. 108:449-456.

Taoka, S., R. Padmakumar, M. Lai, H. Liu, and R. Banerjee. 1994. Inhibition of the human methylmalonyl-CoA mutase by various Co-A esters. J. Biol. Chem. 269:31630-31634.

Thenen, S.W., and E. L. R. Stokstad. 1973. Effect of methionine on specific folate coenzyme pools in vitamin B12 deficiency and supplemented rats. J. Nutr. 103: 353-370.

CHAPITRE IV

EFFECTS OF SUPPLEMENTS OF FOLIC ACID,

VITAMIN B12 AND RUMEN-PROTECTED

METHIONINE ON WHOLE BODY METABOLISM

OF METHIONINE AND GLUCOSE IN LACTATING

DAIRY COWS

Ce chapitre a été soumis pour publication dans la revue “Journal of Dairy Science ”

sous la référence de A. Preynat, H. Lapierre, M.C. Thivierge, M.F. Palin, J.J. Matte, A.

Desrochers and C. L. Girard. 2009. Effects of Supplements of Folic Acid, Vitamin B12

and Rumen-Protected Methionine on Whole Body Metabolism of Methionine and

Glucose in Lactating Dairy Cows. J. Dairy Sci. 92 : 677-689.

IV-1 RÉSUMÉ

À 12 semaines de lactation, des cinétiques de glucose et de méthionine ont été

mesurées en infusant du D-[U13-C]glucose et de la L-[1-13C, 2H3] méthionine. Le

supplément de vitamines augmentait les concentrations d’acide folique et de vitamine

B12 dans le lait et le plasma, la production laitière de 34,7 à 38,9 ± 1,0 kg/jour ainsi que

les rendements en lactose, protéines et solides totaux du lait. Les flux corporels de

glucose tendaient à augmenter avec la supplémentation vitaminique d’une amplitude

quantitativement similaire à l’augmentation du rendement en lactose. Le supplément de

vitamines augmentait l'utilisation de la méthionine pour la synthèse protéique via un

accroissement du turnover protéique lorsque l'apport en méthionine était faible et via

une diminution de l’oxydation de la méthionine lorsque un supplément de méthionine

était apporté. Donc, ces vitamines B agiraient sur les performances de lactation en

améliorant l’efficacité des métabolismes du glucose et de la méthionine.

Mots-clés : vache laitière, méthionine protégée de la dégradation ruminale, vitamines B,

cinétiques du glucose et de la méthionine

IV-2 ABSTRACT

The present experiment was undertaken to determine the effects of dietary

supplements of rumen-protected methionine and intramuscular injections of folic acid

and vitamin B12, given 3 wk before to 16 wk after calving, on glucose and methionine

metabolism of lactating dairy cows. Twenty-four multiparous Holstein cows were

assigned to 6 blocks of 4 cows each according to their previous milk production. Within

each block, 2 cows were fed a diet estimated to supply methionine as 1.83%

metabolizable protein, equivalent to 76% of methionine requirement, whereas the 2

other cows were fed the same diet supplemented daily with 18 g of rumen-protected

methionine. Within each diet, the cows were administrated either no vitamin

supplement or weekly intramuscular injections of 160 mg of folic acid plus 10 mg of

vitamin B12. To investigate metabolic changes at 12 wk of lactation, glucose and

methionine kinetics were measured by isotope dilution using infusions of D[U-13C]glucose, [13C]NaHCO3 and L[1-13C,2H3]methionine. Milk and plasma

concentrations of folic acid and vitamin B12 increased with vitamin injections.

Supplementary B-vitamins increased milk production from 34.7 to 38.9 ± 1.0 kg/d as

well as milk lactose, protein and total solid yields. Whole body glucose flux tended to

increase with the vitamin supplementation with a similar quantitative magnitude as the

milk lactose yield increment. Vitamin supplementation increased Met utilization for

protein synthesis through possibly increased protein turnover when methionine was

deficient and through decreased methionine oxidation when rumen-protected

methionine was fed. Vitamin supplementation decreased plasma concentrations of

homocysteine independently of rumen-protected methionine feeding, although no effect

of vitamin was measured on methionine remethylation, but this could be due to the

limitation of the technique used. Therefore, the effects of these B-vitamins on

lactational performance were not mainly explained by Met economy due to a more

efficient methylneogenesis but rather by an improvement in efficiency of glucose and

Met metabolism.

Key words: dairy cow, folic acid, vitamin B12, methionine and glucose kinetics

IV-3 INTRODUCTION

In the latest NRC edition (2001), recommendations were made for two AA, Lys

and Met, based on works of Rulquin et al. (1993) and Schwab (1996), according to

which, under intensive dairy systems, these AA may be limiting in certain diets. Under

such circumstances, increasing Met supply through feeding rumen-protected Met

(RPM) has the potential to augment milk protein and fat concentrations and yields in

high-producing dairy cows, probably through increased protein synthesis (NRC, 2001).

Met is not only an AA involved in the structure per se of proteins but it also plays a

unique role as the initiating AA for the synthesis of proteins (Brosnan et al., 2007). In

addition to these roles in protein synthesis, Met, as a source of preformed labile methyl

groups, is a key player in transmethylation reactions and lactation has been

demonstrated to increase the demand for methylated compounds (Xue and Snoswell,

1985). The NRC (2001) requirement for Met was based on the relationship between

Met supply and milk protein yield, but very little information is available on Met

requirements for methyl group transfer in high-yielding cows.

Methyl group transfer occurs through the activation of Met in S-

adenosylmethionine (SAM), which is the most important methyl group donor to a wide

range of acceptors (Finkelstein, 1990). After the transfer of its methyl group, SAM

becomes S-adenosylhomocysteine (SAH), which is hydrolyzed to homocysteine (Hcy)

and adenosine. The former can be remethylated into Met by the vitamin B12-dependent

enzyme, methionine synthase which mediates the transfer of the methyl group from 5-

methyltetrahydrofolate, a folate co-factor (Bässler, 1997). Therefore, both folic acid and

vitamin B12 are essential for remethylation of Hcy to Met. A major function of this

cycle is to ensure that the cells always have an adequate supply of SAM, even when

intake of preformed labile methyl groups such as Met, betaine or choline is low. Hcy

can also be catabolized via the transulfuration pathway (cystathionine synthase) which

leads to Cys synthesis (Finkelstein, 1990).

Vitamin B12 also relates to energy metabolism as a coenzyme for the

methylmalonyl-CoA mutase, an enzyme crucial to propionate entry into the Krebs cycle

and subsequent gluconeogenesis (McDowell, 2000). During lactation in dairy cattle,

large amounts of glucose are required for lactose synthesis and as an energy source. As

very limited amounts of glucose are absorbed from intestinal digestion of starch, the

dairy cow relies heavily on gluconeogenesis for glucose supply (Reynolds, 2006). In

high-yielding dairy cows, propionate is the major glucose precursor, followed by

glycerol, lactate and AA, such as Ala, Glu, Gly or Ser (Danfaer et al., 1995).

Milk secretion requires important supplies of both glucose and AA. Given the

roles of folic acid and vitamin B12 in protein and energy metabolism, these two B-

vitamins should play an important role in the regulation of these metabolic pathways in

lactating dairy cows. In addition, due to their direct link with the regeneration of Met

from Hcy, their metabolic effect and subsequent response on animal performance might

depend on Met supply. Thus, it was hypothesized that supplements of folic acid plus

vitamin B12 would affect lactational performance 1) through the methylation cycle and

would that be the case, this effect would be more important when Met supply is limited

and 2) by improving gluconeogenesis due to the role of vitamin B12 in this metabolic

pathway. The present study was therefore undertaken to determine the effects of RPM

and folic acid plus vitamin B12 supplementation and their potential interaction on whole

body kinetics of Met and glucose in lactating dairy cows at 12 wk of lactation.

IV-4 MATERIALS AND METHODS

IV-4.1 Cows and Treatments

For the purpose of the current study, twenty-four multiparous lactating Holstein

cows from the herd at the Agriculture and Agri-Food Canada Research Centre

(Sherbrooke, QC, Canada) were selected from a larger study. The cows were kept in a

tie-stall barn under 16 h light cycle per d (0630 to 2230 h) and were milked twice daily

at 12 h intervals. Care of cows followed the recommended Code of Practice of

Agriculture Canada (1990) and the guidelines of the Canadian Council on Animal Care

(1993). The experimental period began 3 wk before calving and lasted until 16 wk after

calving. All cows were fed a close-up diet for 3 wk before the expected date of calving

until calving and then a basal lactation diet (Tableau 6). For the larger study, cows had

free access to water and were fed ad libitum allowing 10% of refusals. They were fed

once daily before calving and twice daily during lactation. Long grass hay was given at

0730 h and the mixed ration was served at 0800 and 1300 h.

Cows were assigned to 6 blocks of 4 cows each according to milk production of

their previous lactation. Within each block, 2 cows were fed the basal diet calculated

(NRC, 2001) to provide Met at 1.83% of metabolizable protein (MP) supply (M-),

equivalent to 76% of the Met requirement (NRC, 2001) whereas the other 2 cows were

fed the same diet supplemented daily with RPM (M+: 9 and 18 g Mepron-85/d,

Degussa AG, Hanau, Germany; pre and post-calving, respectively). With a net Met

content of 85%, 73% of rumen by-pass protection and 82% of intestinal digestibility

(Berthiaume et al. 2001), the product used in the present experiment was estimated to

provide 9.2 g/d of Met after calving and increased the estimated Met supply to 2.23% of

MP, equivalent to 93% of the Met requirement (NRC, 2001). Within each level of Met

supplementation (M+ or M-), the cows received either no vitamin supplement (B9-B12-)

or weekly intramuscular injections of vitamins (B9+B12+): 160 mg of folic acid

(pteroylmonoglutamic acid, ICN Biochemicals inc., Cleveland, Ohio) plus 10 mg of

vitamin B12 (cyanocobalamin, 5 000 µg/mL, Vetoquinol, Lavaltrie, QC, Canada). These

levels of supplementation were chosen according to previous experiments (Girard et al.,

1995; Girard and Matte, 2005). The parenteral route was chosen, instead of dietary

supplementation, to rule out any possible effects of vitamins on ruminal microflora.

The larger study was conducted up to 16 wk of lactation, but the measurements

currently reported were conducted during the 12th wk of lactation. This stage of

lactation was selected based on previous results obtained in dairy cows supplemented

with folic acid alone (Girard and Matte, 1998). Measurements of whole body

irreversible loss rate (ILR) of Met and glucose were conducted during steady state

achieved through 2 h feeding in 12 equal meals per d using automated feeders (Ankom,

Fairport, NY); the latter started 3 d before the onset of tracer infusions. Rumen-

protected Met was also given with the meals in 12 equal servings of 1.5 g. Long hay

was given once a d (0730 h). During the 2 h feeding period, cows were fed 95% of ad

libitum DMI measured during the 2 previous wk to avoid refusals.

IV-4.2 Forage and milk analyses

Forage samples were analyzed for DM, CP, ash, ether extract (AOAC, 2000),

ADF, NDF, and acid-detergent lignin (Ankom200 fiber analyzer, Ankom technology

corp., Fairport, NY), minerals by inductively coupled plasma emission spectrometry

(AOAC, 2000) (Agri-Food Laboratories, Guelph, On, Canada).

Milk production was recorded at each milking. Milk samples were collected at 4

consecutive milkings at 82.7 ± 1.9 d of lactation. Milk composition (fat, protein, lactose

and urea) was determined by near infrared reflectance spectroscopy method (Valacta,

Sainte-Anne-de-Bellevue, QC, Canada).

Vitamins in milk: Milk folates were determined by radioassay (interassay CV = 4.8%) with a commercial

kit designed for human plasma (Quantaphase Folates II, Bio-Rad Laboratories (Canada)

Ltd, Mississauga, ON, Canada) after preparation as described by Girard and Matte

(1998).

Samples for determination of vitamin B12 in milk were prepared as follows: 10

mL of milk, 2 mL of 0.2 N HCl and 100 µL of 1.0 mM NaCN were placed in a 50 mL

tube (Sarstedt inc, Newton, NC), corked and vortexed. The tubes were placed in boiling

water for 15 min, rapidly cooled on ice and transferred in 15-mL polycarbonate tubes

for centrifugation at 51,520 x g for 20 min at 4°C. The supernatants were filtered

(Whatman filter 42, 9 mm of diameter, Fisher Scientific, Ottawa, ON, Canada) in

weighed tubes of 50 mL, weighed again and the amount of supernatant was obtained by

difference. The pH was adjusted to 6.5 with 3.3 N NaOH. The tubes were then filled to

20 mL with distilled water, vortexed and stored at -20°C or used immediately. Vitamin

B12 was determined in duplicate for each hydrolysis using a radioassay (Quantaphase

B12, Bio-Rad Laboratories (Canada) Ltd, Mississauga, ON, Canada). The interassay CV

was 6.3% and recovery of a known amount of cyanocobalamin was 103.0%.

IV-4.3 Blood sampling procedure

At 83.9 ± 1.7 d after calving, after distribution of the morning meal, blood

samples were collected by venipuncture of the caudal vein, using a Vacutainer® system

(Becton, Dickinson and Co., Franklin Lakes, NJ) using tubes with EDTA for folates,

vitamin B12, BHBA and NEFA analyses. Tubes with heparin were used for AA, glucose

and urea determinations. Immediately after collection, the tubes were placed on ice and

within 1 h after sampling, blood was centrifuged 20 min at 1,854 x g at 4°C. For AA

analysis, 400 µL of plasma was mixed with 400 µL of Met sulfone (0.4 mM, internal

standard, Sigma-Aldrich, Oakville, ON, Canada). Plasma was frozen at -20oC until

assays.

IV-4.4 Blood plasma analyses

IV-4.4.1 Folates and vitamin B12

Folates and vitamin B12 in plasma were determined in duplicate using a

radioassay (Quantaphase Folate II and Quantaphase B12, Bio-Rad Laboratories (Canada)

Ltd) as described by Girard and Matte (1988). Interassay CV were 4.2 and 4.1% for

folates and vitamin B12, respectively.

IV-4.4.2 Urea, NEFA, Glucose and BHBA

Plasma urea, NEFA, glucose and BHBA were determined using commercial kits

(Diagnostic Chemicals Limited UREA ASSAY, BioPacific Diagnostic Inc.,

Charlottetown, PE, Canada; NEFA-C, Wako Chemicals GmbH, Neuss, Germany;

Roche Diagnostics Glucose GmbH, Mannheim, Germany and Pointe Scientific Inc., β-

hydroxybutyrate Reagent Set, Canton, MI, respectively).

IV-4.4.3 Amino acids

Total Hcy and total Cys concentrations were determined in plasma by a

modification of the HPLC method of Malinow et al. (1989) described in Girard et al.

(2005). Two further changes were made: the mobile phase was a mixture of 50 mM

sodium phosphate monobasic, 1.0 mM 1-octanesulfonic acid (Sigma Ultra) and 2%

acetonitrile and the solvent was pumped through the analytic column (4.6 × 150 MCM)

at 2 mL/min. Met concentration was measured by isotope dilution using gas

chromatography-mass spectrometry (GC-MS; Hewlett Packard, Model CG6890-

MS5973, Agilent Technologies, Willmington, DE) as previously described (Calder et

al., 1999).

Plasma concentrations of other AA were determined by HPLC with precolumn

derivatization according to the Pico-Tag procedure (Waters, Mississauga, ON, Canada)

and using a method adapted from White et al. (1986). Processed plasma, with Met

sulfone added as an internal standard, was filtered through a 10,000 molecular weight

filter and centrifuged for 30 min at 31,000 x g at 4°C. A Pico-Tag column was used for

separation of physiological AA (3.9 × 300 mm) maintained at 46ºC in a column heater.

The mobile phase consisted of 2 eluents labeled A (0.07 M sodium acetate trihydrate

buffer containing 350 µL of 10 mg/mL ethylenediamine tetraacetic, adjusted to pH 6.45

with glacial acetic acid, filtered on 0.45 µm nylon membrane filters and mixed with

25.65 mL acetonitrile) and B (methanol, water and acetonitrile; 15:40:45, v/v) used

according to a gradient elution program (Tableau 7). AA standards 18 H (Pierce,

Rockford, IL) were dissolved in water using serial dilutions: 160, 240, 320 and 400 μM

and injected at the beginning of each week.

IV-4.5 Kinetic measurements

IV-4.5.1 Infusion and blood sampling

The tracer infusions began on average on 87 ± 7 d of lactation. The day before

the beginning of the infusion period, two catheters were inserted into two jugular veins,

one to perform infusions and the other to collect blood. Tracers were dissolved in sterile

saline and were administrated as follows: L-[1-13C,2H3]Met (13C, 99% and methyl-2H3,

98%, Cambridge Isotope Laboratories, Andover, MA) on d 1, [13C]sodium bicarbonate

(Cambridge Isotope Laboratories) on d 2 and D[U13-C]glucose (13C6, 99%, Cambridge

Isotope Laboratories) on d 3. On each of these days, 4 blood samples were collected

before onset of the infusion to determine the natural abundance of the infused

metabolite and of CO2. All daily infusions started with a priming dose of either 0.96, 2.5

or 3.3 mmol followed by a 4h constant infusion performed at the rate of 0.96, 1.8 or 5.5

mmol/h for Met, bicarbonate and glucose, respectively.

Starting 2 h after the initiation of the infusion, 5 jugular blood samples were

taken every 30 min into heparinized syringes. On each sampling day, immediately after

collection, three 1.5-mL portions were placed into evacuated Vacutainer® tubes

(Becton, Dickison and Co.) containing 1 mL of frozen lactic acid and reacted

immediately for measurement of CO2 enrichment on the same d. On d 1 and 3, the

remaining blood (10 mL) was distributed into heparinized Vacutainer® tubes, kept on

ice and centrifuged within 30 min after sampling at 1,854 x g for 15 min at 4°C. Plasma

samples were stored at -20ºC until measurement of isotopic enrichment (IE) of Met (d

1) and glucose (d 3).

IV-4.5.2 Isotopic enrichment analyses

The CO2 released from reaction of whole blood with lactic acid was analyzed for

[13C] IE for m/z ions 44, 45 and 46 on a triple collector isotopic ratio mass spectrometer

(Sira 12, VG Masslab, Manchester, UK).

For Met IE, after deproteinisation of 1 mL of plasma with 250 µL of 38 %

sulfosalicylic acid, samples were vortexed and centrifuged at 18,516 x g for 10 min at

4°C. Supernatants were transferred on a poly-prep chromatography column containing 1

cm of AG 50W-X8 100-200 mesh hydrogen form resin (BIO-RAD Laboratories,

Hercules, CA). The resin was rinsed twice with 2 mL of ultrapure water, then Met was

extracted with 2 mL of 2 N NH4OH and, rinsed with 1 mL of ultrapure water and

collected into 7-mL glass tubes covered with paraffin and placed at -80ºC. Once frozen,

the samples were freeze-dried overnight. The samples were then dissolved with 250 µL

of ultra-pure water, transferred into reacti-vials and dried at 90ºC under nitrogen

atmosphere. Following cooling, the samples were derivatized with 50 µL of MTBSTFA

(N-(Tert-Butyldimethylsilyl)-N-methyltrifluoroacetamide, Sigma-Aldrich):MF (N,N-

Dimethylformamide, Sigma-Aldrich) (1:1) at 120ºC for 30 min.

The IE of plasma Met was determined by GC-MS (Agilent Technologies). The

chromatography was performed at a helium flow rate of 0.8 mL/min using a 30-metre

column (HP–5MS 19091S-433, Agilent technologies) with a 0.25 µm thickness and

0.25 mm in diameter. One microlitre of each sample was injected according to the split

injection system (7673, Agilent technologies) set as follows: injector temperature of

280°C and pressure of 10.89 psi. The initial oven temperature was held at 170°C for 5

min, then raised to the final temperature of 300°C at 15°C/min and held at 300°C for 8

min. The mass spectrometry was operated in electrical impact mode under vacuum at a

source temperature of 250°C. Infusion of L[1-13C,2H3]Met was associated with two

plasma species of labelled Met: the original molecule and L[1-13C]Met, formed from

remethylation of [1-13C]Hcy obtained after transmethylation of L[1-13C,2H3]Met. The

abundance of specific ions was determined by selected ion monitoring at the following

m/z ions: 292:295 for [1-13C,2H3]Met (m+4; this fragment did not include the labelled

C) and 320:321 for [1-13C]Met (m+1). A stock solution of Met, containing both 1.08616

µmol of L[1-13C,2H3]methionine (Cambridge Isotope Laboratories) and 31 µmol of

unlabelled Met was prepared in ultrapure water. The theorical IE of the solution was

3.35 atom percent excess (ape). A constant volume of this L[1-13C,2H3]methionine

solution was added to graded concentration of unlabelled Met to generate a standard

curve (62, 46.5, 31, 24.8, 15.5 and 9.3 µM). The graded IE of the curve was 2.53, 2.35,

2.23, 2.14, 2.12 and 2.08 ape. The standard curve was plotted with area under the curve

of Met (m/z 292) against the ratio of observed ape (m/z 295) on theorical ape (ape =

3.35). This curve was used to correct the measured IE of L[1-13C,2H3]methionine

according to the concentration of the sample.

Glucose IE was analyzed by GC-MS (Agilent Technologies) using the

pentaacetate derivative (Haymond and Sunehag, 2000). Fifty microlitres of plasma were

put into 1.5-mL microcentrifuge tubes along with 200 µL of cold acetone (Fisher

Scientific). The samples were vortexed and refrigerated for 10 min prior to

centrifugation at 3 000 x g for 10 min at 4°C. Supernatant was decanted into 2-mL sub-

sample vials and evaporated thoroughly under nitrogen. Dried samples were dissolved

with 50 µL of 98% acetic anhydride: 99.8% pyridine (2:1) (Sigma-Aldrich Chemical

Co.) and, after sealing vials very tightly with Teflon caps, vortexed. Samples were

derivatized overnight at room temperature. Infusates were analyzed using a similar

procedure, but using 100 µL of the mixture 2:1 of acetic anhydride (98%): pyridine

(99.8%). After overnight derivatization, samples were dried under nitrogen and

reconstituted in 300 µL of ethyl acetate (Sigma-Aldrich Chemical Co.), which can also

be used to dilute samples if needed. Samples were analyzed by GC-MS with a HP1701

column (30 m x 0.25 mm ID, 0.25 µm phase thickness) in split-less mode of injection

(HP GC:6890-MS:5973; Agilent Technologies Canada inc., QC, Canada). Gas

chromatography conditions were as follows: 70°C for 1 min and then ramp at 30°C/min

to 280°C for 5 min. Injector and detector were set to at 250 and 280°C respectively with

6 psi of helium pressure. The gas chromatograph was coupled to a quadrupole mass

spectrometer with mass selective detector operating in the positive chemical ionisation

mode. Isotopic enrichments were measured by monitoring ions at m/z 331, 332, 333,

334 and 337 to quantify the IE of m+1, m+2, m+3 and m+6 of glucose isotopomers,

respectively; isotopic enrichments on m+4 and m+5 isotopomers were undetectable.

IV-4.5.3 Calculations

The IE of the Met, glucose and CO2 are expressed as mole percent excess (mpe)

and were calculated as follows, correcting for background abundance:

IE = (Ri – Ro) / ((1 + (Ri – Ro)) × 100

where Ri and Ro corresponded to the ratio of peak area of m + n / m + 0 of the enriched

(Ri) and background (Ro) samples. Whole body Met, glucose and CO2 ILR (mmol/h)

were calculated as follows:

ILR = INF / IE

where INF was the rate of infusion of labelled Met, glucose or bicarbonate infusion and

IE, the IE of plasma Met, glucose or blood CO2. The infusion rate was not removed

from the ILR because, in further calculations, we could not assume that the dose of

labelled Met infused was completely oxidized. Therefore, to have a better appraisal of

the oxidation relative to whole body ILR, the rate of infusion was not removed from

either term.

Met kinetics were calculated according to the model described in Figure 27.

Whole body Met-methyl flux rate (ILR M), calculated with the IE of (m+4)Met,

estimated the loss rate of Met as soon as the methyl group was transferred to SAM,

producing a labelled [1-13C]Hcy. Remethylation of this labelled Hcy generated [1-13C]Met, considering null the probability of incorporation of a labelled methyl group to

a labelled Hcy. The estimation of whole body Met-carboxyl flux rate (ILR C), using the

sum of IE of m+4 and m+1, yielded the ILR of Met excluding remethylation. The

difference between ILR-M and ILR-C represents a minimal estimate of remethylation

because if a (m+1)Met re-entered the transmethylation-remethylation cycle, the Met

molecule was not further altered and therefore, this fraction was not accounted for in the

calculation. The whole body fractional rate of oxidation (FO, %) of Met was calculated

using the following equation:

FO = [(IECO2-Met × ILR-CO2-bic) / INF] x 100

where IECO2-Met was the IE of CO2 measured during the infusion of the labelled Met,

ILR-CO2-bic represented CO2 production estimated during the bicarbonate infusion and

INF was the rate of infusion of labelled Met. Whole-body Met oxidation (Ox, mmol/h)

was then calculated as follows:

Ox = FO × ILR

= [(IECO2 × ILR-CO2-bic) / INF] × (INF / IEm+4)

= (IECO2 × ILR-CO2-bic) / IEm+4

Met used for whole body protein synthesis was calculated as the difference between

whole body ILR-C and Met oxidation. Transmethylation was the sum of remethylation

and Met oxidation (Figure 27).

Uniformly labelled glucose was infused in this study to assess the feasibility of

measuring gluconeogenesis using mass isotopomer distribution analysis (m+1, m+2,

m+3 and m+6). However, the IE of glucose species m+1, m+2 and m+3 were below

detection specification of the GC-MS for more than half of the cows. Therefore, only

whole body glucose ILR is reported using m+6 isotopomer. The FO of glucose was

calculated similarly to Met FO with the exception that the infusion rate was multiplied

by 6 to account for the 6 labelled carbons per molecule of glucose.

IV-4.6 Statistical analyses

Supplementations of Met (0 or 18 g of RPM) and B-vitamins (0 or both folic

acid and vitamin B12) were tested as the main factors in a 2 × 2 factorial arrangement

with 6 randomized complete blocks. Milk production and composition as well as DMI

were averaged for the whole 12th wk. All variables were analyzed using the MIXED

procedure of SAS (2004) with supplementations of Met and vitamins as the main

factors. Orthogonal contrasts were used to determine the effect of Met and vitamin

supplementations and their interaction. Results were reported as least square means with

standard errors. The significance level was defined at P ≤ 0.05 and trends toward

significance were considered at 0.05 < P ≤ 0.15. The SLICE option was used to

compare vitamin effect within each level of Met supplementation when the Met by

vitamin interaction reached a P value < 0.15.

IV-5 RESULTS

IV-5.1 Production data

Body weight and DMI averaged 624 ± 17 kg and 23 ± 1 kg/d, respectively and

did not differ between treatments (P > 0.55, Tableau 8).

Milk production, however, increased (P = 0.01) by approximately 12% with the

administration of folic acid plus vitamin B12, from 34.8 ± 1.0 to 38.9 ± 1.0 kg/d. Milk

concentrations of total solids, fat and lactose did not differ among treatments (P > 0.29)

whereas milk crude protein concentrations tended to increase by 1.3 g/kg in M+ cows

(P = 0.14, Tableau 8). Milk yields of protein, lactose and total solids increased (P <

0.05) with vitamin supplements and averaged 1.03 ± 0.03 vs 1.11 ± 0.03 kg/d, 1.62 ±

0.05 vs 1.79 ± 0.05 kg/d and 3.85 ± 0.11 vs 4.22 ± 0.11 kg/d for B9-B12- vs B9+B12+,

respectively (Tableau 8). Milk fat yield only tended to increase (P = 0.09) with vitamin

supplements, 1.20 ± 0.05 vs 1.31 ± 0.05 kg/d for B9-B12- vs B9+B12+, respectively.

Increased vitamin supply tended to be associated with an increase in milk urea

concentrations (P = 0.08, 124.8 ± 6.5 vs 137.3 ± 6.6 g/kg for B9-B12- vs B9+B12+

respectively, Tableau 8). Milk concentrations of vitamin B12 were higher in cows

injected with B vitamins (P = 0.02) whereas concentrations of folates were not affected

(P > 0.25, Tableau 8). Nevertheless, supplementary folic acid plus vitamin B12

increased the amounts of these vitamins secreted daily in milk: 173.2 ± 20.9 vs 266.6 ±

21.7 µg/d for vitamin B12 (P = 0.002; Tableau 8) and 2.59 ± 0.37 vs 3.27 ± 0.38 mg/d

for folates (P = 0.07; Tableau 8) for B9-B12- vs B9+B12+, respectively.

IV-5.2 Plasma variables

Plasma concentration of vitamin B12 increased by 72% with vitamin injections

(236.7 ± 32.0 vs 407.0 ± 35.1 for B9-B12- vs B9+B12+, P = 0.002; Tableau 9) but this

increase tended to be greater in cows fed no RPM supplement (Met × vitamin

interaction, P = 0.13). Plasma concentrations of folates also tended to vary according to

vitamin and Met supplementation (Met × vitamin interaction, P = 0.10; Tableau 9);

indeed, B-vitamin injections increased plasma concentrations of folates in cows fed

RPM (P = 0.02) whereas no difference was observed in M- cows (P = 0.99).

The response of plasma concentrations of urea to vitamin injections tended to

differ within each level of Met supplementation (Met × vitamin interaction, P = 0.07,

Tableau 9). Injections of folic acid plus vitamin B12 had no effect in cows fed

supplementary Met (P = 0.90) but increased plasma urea in M- cows (P = 0.01). Plasma

concentrations of glucose, BHBA and NEFA did not vary among treatments (P > 0.34;

Tableau 9).

Cows injected with folic acid plus vitamin B12 supplements had lower (P = 0.03)

Hcy concentrations than the control cows, 6.50 ± 0.64 vs 4.88 ± 0.69 µM but higher (P

= 0.04) plasma concentrations of Arg, 92.9 ± 4.8 vs 105.0 ± 5.0 µM, for B9-B12- vs

B9+B12+, respectively (Tableau 9).

Dietary supplement of RPM decreased plasma concentrations of Ile, from 159.4

± 9.1 to 137.6 ± 8.8 µM (P = 0.07), Leu, from 253.6 ± 16.1 to 208.3 ± 15.5 µM (P =

0.03), Val, from 373.2 ± 17.3 to 314.9 ± 17.3 µM (P = 0.02) and consequently,

branched-chain amino acids (BCAA), from 786.1 ± 41.7 to 660.7 ± 40.3 µM (P = 0.03).

RPM also decreased plasma Tyr, from 87.9 ± 4.8 to 76.2 ± 4.6 µM (P = 0.10) and EAA

(P = 0.03) from 1202 ± 55 to 1041 ± 53 µM, for M- and M+ cows, respectively

(Tableau 9).

Folic acid plus vitamin B12 administration increased plasma concentrations of

Lys and Met in cows fed no supplementary Met (P < 0.05), whereas they had no effect

(P ≥ 0.77) when the cows received RPM (Met × vitamin interaction, P = 0.06 and 0.10

for Lys and Met, respectively, Tableau 9). In M+ cows, plasma concentrations of Cys

decreased with B-vitamin supply (P = 0.01) whereas in M- cows, vitamins had no effect

on Cys concentrations (P = 0.47; Met × vitamin interaction, P = 0.02, Figure 28). A

similar trend was observed for plasma Phe (Met × vitamin interaction, P = 0.09,

Tableau 9) notwithstanding that plasma Phe was higher for M- than M+ cows, 68.6 ±

5.0 to 54.7 ± 4.9 µM, respectively (P = 0.01). The response of Gly and Ser to vitamin

injections tended to differ within each level of Met supplementation (Met × vitamin

interaction, P = 0.06, Tableau 9); injections of folic acid plus vitamin B12 had no effect

in cows not supplemented with Met (P ≥ 0.24) but they tended to increase

concentrations of these two AA in cows fed RPM (P = 0.07). Plasma concentrations of

Ala, Asp, Glu, His, Pro, Thr, total NEAA and TAA were not affected by treatments (P ≥

0.19).

IV-5.3 Whole body kinetics

Glucose ILR tended to increase with administration of folic acid plus vitamin

B12 (802 ± 16 vs 838 ± 17 mmol/h for B9-B12- vs B9+B12+ respectively; P = 0.11,

Tableau 10). On average, 23% of glucose ILR was oxidized whereas 50% was used for

lactose milk production but these variables were not affected by treatments (P > 0.49,

Tableau 10).

Results on whole body Met kinetics are reported in Tableau 11. Dietary

supplements of Met increased ILR-M from 20.0 ± 0.9 to 24.5 ± 0.9 mmol/h (P = 0.003).

The Met-carboxyl flux (ILR-C) rate was also higher (P = 0.003) in M+ than M- cows,

averaging 17.9 ± 0.7 vs 21.4 ± 0.7 mmol/h for M- vs M+, respectively. The effects of

vitamin supplements on the ILR-M and ILR-C, however tended to differ according to

the level of dietary Met (Met × vitamin interaction, P = 0.11 and 0.09, respectively).

Supplementary folic acid plus vitamin B12 increased the ILR-M and ILR-C by

approximately 20% in M- cows (P = 0.07 and 0.04 for ILR-M and ILR-C) but had no

effect on M+ cows (P > 0.69).

Folic acid plus vitamin B12 supplements decreased Met entry in the

transmethylation pathway (TM, Figure 27) in cows fed RPM (P = 0.002), whereas it

had no effect (P = 0.45) when the cows did not receive Met supplementation (Met ×

vitamin interaction, P = 0.01, Tableau 11). The entry of Met into the transmethylation

pathway relative to ILR-M followed the same pattern except that the interaction was

only a tendency (P = 0.10). A similar tendency was observed for Met oxidation (Met ×

vitamin interaction, P = 0.06, Figure 28), whereas fractional oxidation of Met did not

reach significance (P > 0.16).

The rate of Met going to Hcy and remethylated (RM, Figure 27) was higher in

M+ cows (P = 0.04), but the ratio of remethylation on ILR-M was not affected by

treatments (P > 0.20), averaging 12% of ILR-M. Met used for protein synthesis

increased from 14.5 ± 0.8 to 17.9 ± 0.8 mmol/h with RPM supplements (P = 0.01) and

tended to increase (P = 0.06), from 15.1 ± 0.86 to 17.3 ± 0.8 mmol/h with vitamin

supplements.

IV-6 DISCUSSION

In the present experiment, intramuscular injections of folic acid plus vitamin B12

successfully increased vitamin supply to dairy cows. Indeed, as previously observed

with intramuscular injections (Girard et al., 1995; Girard and Matte, 2005),

supplementary vitamin B12, and to a lesser extent, folic acid increased secretion of

folates and vitamin B12 in milk and their plasma concentrations.

The increase in milk production and milk component yields following

administration of a combined supplement of folic acid and vitamin B12 observed in the

present experiment is in agreement with observations from previous experiments.

Intramuscular injections of vitamin B12, given to cows fed a basal diet supplemented

with folic acid and Met, increased milk component yields as compared to cows only

supplemented with Met and folic acid (Girard and Matte, 2005). Graulet et al. (2007)

also observed that in cows fed a diet providing a low Met supply, dietary supplements

of folic acid, given alone or in combination with vitamin B12, increased milk and milk

protein yields as compared to unsupplemented cows and in addition, the two vitamins

given together increased plasma glucose and decreased accumulation of hepatic lipids

as compared to folic acid alone.

IV-6.1 Glucose kinetics

In the current study, whole body glucose ILR was higher than previously

reported in dairy cows infused uniformly labelled glucose (Clark et al., 1977; Hammon

et al., 2008) but DMI and milk production of cows in these previous studies were lower

than in the current experiment. Nevertheless, the ratio of milk lactose to whole body

glucose ILR averaged 51% in the current study, as reported for this stage of lactation

(Clark et al., 1977; Bruckental et al., 1980; Rigout et al., 2002). Glucose oxidation was

not altered by the treatments and averaged 23% of ILR, a value higher than previously

reported in dairy cows (17%, Bauman et al., 1988; 14%, Hammon et al., 2008). The

oxidation rate, measured through the recovery of glucose carbons in CO2, is a minimum

estimate as it only accounted for the carbons of uniformly labelled glucose that were

recovered in CO2, omitting other carbons of glucose that were incorporated into

intermediate products.

Administration of folic acid plus vitamin B12 increased glucose ILR by 160 g/d

compared with control cows and was associated with a similar increment in milk lactose

secretion. Glucose is the primary precursor for mammary lactose synthesis. Therefore,

the amount of glucose available may have an impact on milk production because lactose

is the major osmoregulator for mammary uptake of water (Linzell, 1972) and a close

relationship between whole body glucose flux and milk volume has been proposed

(Danfaer et al., 1995). The increased milk production of 4 kg/d observed with the folic

acid plus vitamin B12 supplements may reflect an increase of the quantity of glucose

available. However, it has been recently reported that the increment in whole body ILR

of glucose induced by infusions of either glucose, a mixture of 5 gluconeogenic NEAA

in the duodenum or propionate in the rumen of mid-lactation dairy cows was not

paralleled by changes in lactose yields (Lemosquet et al., 2005). Therefore, glucose ILR

might be important but not the sole driver of milk and lactose yields.

Whole body glucose ILR, as the rate of appearance, represents the sum of

glucose available from portal absorption, glycogenolysis and gluconeogenesis. In the

current study, it is unlikely that the portal absorption of glucose or glucose precursors

differed between treatments because DMI of the same basal diet was similar between

treatments. Glucose turnover from the glycogen pool could not be evaluated with this

model, but there is no data available from the literature indicating that supplementary

folic acid or vitamin B12 would modify glycogen kinetics. Therefore, it is likely that the

increase in whole body ILR of glucose observed in cows supplemented with folic acid

plus vitamin B12 was due to enhanced gluconeogenesis. In fed ruminants, 50-60% of

gluconeogenesis is provided by propionate (Danfaer et al., 1995). Propionate,

originating from rumen fermentation of carbohydrates, provides propionyl-CoA which

is carboxylated to methylmalonyl-CoA by propionyl-CoA carboxylase, a biotin-

dependent enzyme. This pathway can also include catabolism of some AA (Ile, Val,

Thr, Met). Methylmalonyl-CoA is then isomerized in succinyl-CoA in a reaction

including the vitamin B12-dependent enzyme, methylmalonyl-CoA mutase (Le Grusse

and Watier, 1993). Succinyl-CoA finally enters into the Krebs cycle where it can be

used for gluconeogenesis. Bergman (1990) emphasizes that the methylmalonyl-CoA

mutase step becomes limiting when vitamin B12 supply is low. Graulet et al. (2007)

observed a decrease of the Km for adenosylcobalamin of methylmalonyl-CoA mutase in

liver of cows supplemented with folic acid plus vitamin B12, indicating an increased

affinity of this enzyme for its coenzyme, thus improving the efficiency of this metabolic

pathway. In addition, the cows in the present study were selected from a larger study for

which gene expression of methylmalonyl-CoA mutase in liver increased by 15% when

the cows were injected with folic acid plus vitamin B12 as compared with control cows

(Preynat et al., Chapitre V). Therefore, supplementary folic acid plus vitamin B12 may

improve the efficiency of utilization of glucose precursors for gluconeogenesis, thus

allowing positive effects of these B-vitamins on glucose availability and subsequently

milk yield.

The increased milk protein yield in cows injected with folic acid plus vitamin

B12, also reported by Graulet et al. (2007), could result from the improvement of

glucose supply observed with the vitamin treatment discussed above. Such hypothesis is

in agreement with previous studies which showed that an increased supply of energy

increases the amounts of proteins secreted in milk (Rulquin and Delaby, 1997; Rulquin

et al., 2004; Raggio et al., 2006). The enhanced availability of specific energy sources

could explain the milk protein increase by a sparing effect on gluconeogenic AA, the

spared AA being available at mammary level for the synthesis of milk protein. This

effect may also be due to an increase of mammary blood flow favouring AA uptake as

already seen with postruminally glucose infusion (Rulquin et al., 2004).

IV-6.2 Methionine kinetics

Whole body Met fluxes in M-B9-B12- cows are in the range of those previously

reported in human; around 30 and 25 µmol.kg-1.h-1 for ILR-M and ILR-C, respectively

(Storch et al., 1990; Mercier et al., 2006) and similar to those observed in sheep fed a

diet in which Met was calculated to be the first limiting AA (Lobley et al, 1996). The

major outlets for Met are its incorporation into newly synthesized proteins and

formation of SAM, through the transmethylation pathway. These outlets are in

equilibrium with Met entry rate, the sum of Met absorbed, Met arising from protein

degradation and Met coming from Hcy methylation. Storch et al. (1988) measured the

Met kinetics with [methyl-2H3] and [1-13C]Met in humans. They pointed out that,

whatever the supply in dietary Met (deficiency or not), the major part of Met (77%) was

used for protein synthesis whereas a smaller proportion (23%) entered in the

transmethylation pathway. This partition was also observed in the current study with, on

average, 73% of ILR-M directed towards protein synthesis of which approximately 53%

were secreted in milk protein.

As previously observed in humans fed a diet supplemented with Met and Cys

(Storch et al., 1990; Fukagawa et al., 1998; DiBuono et al., 2003), both ILR-M and

ILR-C also increased with Met supplementation in dairy cows, with a concomitant

increment in whole body protein synthesis. However, Met supplementation only tended

to increase milk protein concentration (+ 0.13 g/100g). As there was no effect of

supplementary Met on milk protein yield and assuming no effect of Met on N retention,

it is likely that a general stimulation of protein turnover occurred with RPM.

In M- cows, intramuscular injections of folic acid plus vitamin B12 increased

ILR-M and ILR-C by approximately 20% whereas oxidation of Met tended to decrease

with vitamin supplementation in M+ cows. Altogether, this resulted in increased

utilization of Met for protein synthesis with vitamin supplementation, independent of

the level of Met supply. It still remains unclear, however, if the positive effect of

vitamin supplementation on protein synthesis observed in this study was related to an

effect on protein synthesis itself, or was a consequence of the positive effect of the

vitamin supplements on glucose availability, but is certainly linked with the increased

milk protein yield induced by vitamin supplementation.

In M- cows, intramuscular injections of vitamins increased plasma

concentrations of Met, Lys and BCAA. Coupled with the observation that vitamin

supplementation increased Met ILR in M- cows, this suggested that vitamin

supplementation in M- cows increased protein turnover, which might increase

circulating concentrations of AA not extracted by the liver as Lys and the BCAA

(Lapierre et al., 2005). On the other hand, Graulet et al. (2007) also observed that

supplements of folic acid, alone or combined with vitamin B12, tended to increase

plasma concentrations of Met. In this last experiment also, milk protein yield was

increased by these vitamin supplements.

In the transmethylation pathway, Met is transformed in SAM, the major donor

of methyl group, which after giving its methyl group, will form SAH and finally,

provide the carbon skeleton of Hcy. Hcy could be either remethylated in Met, using

folates (5-methyl-tetrahydrofolate) as one-carbon unit donor and vitamin B12 as

coenzyme for the enzyme, methionine synthase or, alternatively catabolized through the

transsulfuration pathway. In this last pathway, Hcy undergoes a condensation reaction

with serine via cystathionine synthase to form cystathionine, the direct precursor of Cys

(Selhub, 1999). Cys sulfur is derived from Met whereas the carbon and nitrogen are

derived from Ser.

According to the metabolic pathways described above, weekly intramuscular

injections of both folic acid plus vitamin B12 decreased by 33% the plasma

concentrations of Hcy. These results are in agreement with previous observations in

cows (Girard et al., 2005) and growing-finishing pigs (Giguère et al., 2008) reporting a

decrease in plasma concentrations of Hcy with a dietary supplement of folic acid,

irrespective of the level of Met added to the diet. These observations would suggest

increased remethylation of Hcy with vitamin supplementation. In humans, Met

regeneration through Hcy remethylation is decreased by folate deficiency (Cuskelly et

al., 2001), whereas a supplement of folic acid given to healthy adults improved by 59%

the remethylation and reduced plasma Hcy by 18% (Stam et al., 2005). In farm animals,

the fate of Hcy between transsulfuration or remethylation has been studied only by

Lobley et al. (1996) who observed that, in sheep, the provision of the major methylated

products (creatine and choline) reduced the need for remethylation. In humans,

remethylation is primarily regulated by the need for methyl groups (Brosnan et al.,

2007; Mudd et al., 2007). Methyl groups are provided directly by dietary Met, choline

or betaine or from methylneogenesis through the folate pathway (Stead et al., 2006).

Therefore, in humans, when the intake of preformed labile methyl groups, as Met,

decreases, methylneogenesis prevails. Surprisingly, in the present experiment,

calculated value of RM increased with the intake of Met (M+). In humans, Mudd and

Poole (1975) demonstrated that even with diets providing an adequate supply of Met,

the homocysteinyl moiety cycled more than once between Met and Hcy, the number of

cycles increasing when the intake of methyl groups decreased. Recycling of Hcy also

increased in liver of rats when Met supply decreased (Eloranta et al., 1990). Moreover,

these authors observed that the capacity of the skeletal muscle for Met catabolism,

through the transsulfuration pathway, is limited and, consequently, there is a continuous

flow of Met from extrahepatic tissues to liver (Eloranta et al., 1990). Within the limit of

the methods used, calculated RM values are likely to represent only the flux of

remethylated Hcy released in the plasma pool and cannot detect if the same molecule

has made more than one cycle. If the number of cycles of the homocysteinyl moiety was

higher within hepatic cells of cows fed no supplementary RPM or fed supplementary

folic acid plus vitamin B12, then the limitation of the method used would not allow for

detection of these differences.

Met molecules that enter the transmethylation pathway, transformed into Hcy

and not remethylated to Met, are going through the transulfuration pathway and

oxidation. In the present experiment, supplementation with vitamins of M+ cows

decreased Met oxidation, with simultaneous increment in plasma concentrations of Ser

and decrease of plasma concentrations of Cys, all suggesting a real decreased oxidation

under this treatment. No explanation can actually be offered to explain this unexpected

interaction, the decrease of Met oxidation with vitamin supplementation only with RPM

feeding.

IV-7 CONCLUSION

In the current study, folic acid plus vitamin B12 supplementation increased both

milk lactose and protein yields. These increases were related to the positive effect of

vitamins on glucose ILR and Met ILR, the later being mostly due to an increase of Met

directed towards protein synthesis. Milk protein yield was not modified by

supplementary Met, despite an increment in Met ILR and the use of Met for protein

synthesis, suggesting that Met increased protein turnover. In conclusion, the effects of

the supplements of folic acid and vitamin B12 on lactational performance were not

mainly explained by Met economy through a more efficient methylneogenesis as

hypothesized but rather to an improvement in the efficiency of glucose and Met

metabolism.

IV-8 ACKNOWLEDGMENTS

The authors are grateful to dairy barn staff for animal care, to Chrystiane Plante,

Mario Leonard, Jocelyne and Micheline Gingras for technical assistance, and Steve

Methot for statistical advices. Thanks are also extended to the financial support of the

Action Concertée NOVALAIT– FQRNT - MAPAQ – Agriculture and Agri-Food

Canada.

Tableau 6. Ingredients and nutrient composition of the diets fed to dairy cows

Close-up cows Lactation cows

Ingredients, %

Long grass hay 33.01 8.22

Legume-grass silage3 11.0 23.4

Corn silage4 14.5 23.1

Cracked corn 16.9 28.5

Soybean meal 49% 9.6

Beet pulp 13.3

Micronized soybean 3.9 2.0

Distiller's grain (wheat) 1.3 0.7

Distiller's grain (corn) 2.2 1.1

Canola meal 1.3 0.7

Mineral and vitamin premix 1.65 1.86

Calcium carbonate 1.0 0.8

Nutrient composition

CP, % 12.8 17.3

RDP, %7 7.9 10.6

RUP, %7 4.9 6.7

ADF, % 26.5 19.2

NDF, % 45.2 30.4

NEl, Mcal/kg DM8 1.55 1.58

MP, g/d8 1,055 2,341

Methionine, % MP8 1.85 1.83

Lysine, % MP8 6.18 6.3

K, % 1.27 1.55

Ca, % 0.69 0.87

P, % 0.52 0.44

Mg, % 0.39 0.29

S, % 0.25 0.26

Cl, %) 0.43 0.34 1 7.8 ± 1.1 % CP, 0.8 ± 0.1 % soluble proteins, 34.2 ± 5.8 % ADF, 58.9 ± 7.0 % NDF, 5.6 ± 0.6

% lignin, (n = 3).

210.9 ± 1.7 % CP, 2.4 ± 0.1 % soluble proteins, 31.9 ± 1.8 % ADF, 55.1 ± 4.2 % NDF, 4.4 ± 0.5 % lignin (n = 5).

316.8 ± 2.3 % CP, 8.0 ± 1.2 % soluble proteins, 32.8 ± 4.1 % ADF, 42.3 ± 5.9 % NDF, 7.5 ± 2.5 % lignin (n = 11).

47.6 ± 0.4 % CP, 3.5 ± 0.6 % soluble proteins, 21.3 ± 1.5 % ADF, 37.0 ± 1.9 % NDF, 2.1 ± 0.3 % lignin (n = 10).

5Contains per kg, 30 g Ca, 120 g P, 120 g Mg, 69 g Na, 106 g Cl, 15 g K, 20 g S, 4,343 mg Fe, 6,566 mg Mn, 6,465 mg Zn, 1,616 mg Cu, 202 mg I, 121 mg Co, 40 mg Se (25 % organic selenium), 732,323 IU vitamin A, 247,475 IU vitamin D and 7,576 IU vitamin E.

6Contains per kg, 95 g Ca, 55 g P, 55 g Mg, 130 g Na, 150 g Cl, 14 g K, 21 g S, 2,745 mg Fe, 2,065 mg Mn, 3,000 mg Zn, 495 mg Cu, 69 mg I, 33 mg Co, 20 mg Se (25 % organic selenium), 501,859 IU vitamin A, 65,000 IU vitamin D and 2,600 IU vitamin E.

7Calculated according to National Research Council model (2001). 8Calculated according to National Research Council (2001) from average DMI of control cows

(M-B9-B12-) during the close-up (12.6 kg/d) and lactation (21.8 kg/d) periods.

Tableau 7. Binary gradient mobile phase composition used to analyze plasma AA by HPLC

Percent eluent, % Time,

min A1 B2 Curve

Flow-rate, mL/min

0 100

14 97 3 11 1

25 94 6 8 1

30 91 9 5 1

55 72 28 5 1

65 60 40 6 1

70 0 100 6 1

75 0 100 1 1

76 100 0 1 1 1 Eluent A, 0.07 M sodium acetate trihydrate buffer containing 350 µL of 10 mg/mL ethylenediamine tetraacetic, ajusted at pH 6.45 with glacial acetic acid, filtered on 0.45 µm nylon membrane filters and mixed with 25.65 mL acetonitrile. 2 Eluent B, methanol, water and acetonitrile (15:40:45, v/v).

137

Tableau 8. Effects of dietary supplements of rumen-protected methionine (M) and intramuscular injections of folic acid (B9) and vitamin B12 (B12) given to dairy cows on production variables at 12 wk of lactation

Treatments1 P values M+ M-

B9-B12- (n = 6)

B9+B12+ (n = 6)

B9-B12- (n = 6)

B9+B12+ (n = 5)

met vit met*vit

Body weight, kg 613 ± 17 644 ± 17 619 ± 17 619 ± 19 0.55 0.47 0.36

DMI, kg/d 23.7 ± 1.0 23.1 ± 1.0 23.0 ± 1.0 23.5 ± 1.1 0.86 0.98 0.56

Milk production, kg/d 34.1 ± 1.4 39.2 ± 1.4 35.4 ± 1.4 38.6 ± 1.5 0.82 0.01 0.52

Fat, g/kg 34.5 ± 1.5 34.3 ± 1.5 34.5 ± 1.5 33.3 ± 1.6 0.71 0.62 0.71

Protein, g/kg 30.0 ± 0.8 29.4 ± 0.8 29.0 ± 0.8 27.9 ± 0.9 0.14 0.31 0.74

Lactose, g/kg 46.7 ± 0.7 45.7 ± 0.7 46.8 ± 0.7 46.2 ± 0.8 0.69 0.29 0.77

Urea, g/kg 123.5 ± 7.9 130.7 ± 7.9 126.1 ± 7.9 144.0 ± 8.5 0,25 0,08 0,43

Total solids, g/kg 111.2 ± 2.2 109.4 ± 2.2 110.3 ± 2.2 107.4 ± 2.4 0.53 0.32 0.81

Folates, ng/mL 81.4 ± 10.5 81.4 ± 10.5 69.1 ± 10.5 85.9 ± 11.1 0.59 0.25 0.25

Vitamin B12, pg/mL 5422 ± 758 6600 ± 758 4666 ± 758 7287 ± 828 0.96 0.02 0.34

Fat, kg/d 1.18 ± 0.06 1.34 ± 0.06 1.22 ± 0.06 1.27 ± 0.07 0.81 0.09 0.35

Protein, kg/d 1.02 ± 0.04 1.15 ± 0.04 1.03 ± 0.04 1.07 ± 0.05 0.40 0.05 0.32

Lactose, kg/d 1.59 ± 0.07 1.79 ± 0.07 1.65 ± 0.07 1.78 ± 0.08 0.70 0.04 0.66

Total solids, kg/d 3.79 ± 0.15 4.29 ± 0.15 3.90 ± 0.15 4.14 ± 0.17 0.90 0.03 0.41

Folates, mg/d 2.78 ± 0.44 3.20 ± 0.44 2.40 ± 0.44 3.35 ± 0.47 0.74 0.07 0.45

Vitamin B12, µg/d 182.1 ± 26.7 256.7 ± 26.7 164.3 ± 26.7 276.5 ± 29.0 0.97 0.002 0.45

1M- and M+: basal diet – or + rumen-protected Met; B9-B12-: no vitamin supplement; B9+B12+: 160 mg folic acid/wk + 10 mg cyanocobalamin/wk.

138

Tableau 9. Effects of dietary supplements of rumen-protected Met (M) and intramuscular injections of folic acid (B9) and vitamin B12 (B12) given to dairy cows on plasma variables at 12 wk of lactation

Treatments1 P values M+ M- B9-B12-

(n=6) B9+B12+

(n=6) B9-B12-

(n=6) B9+B12+

(n=5) met vit met*vit

Folates, ng/mL 12.4 ± 1.5 17.8 ± 1.5 16.9 ± 1.5 16.8 ± 1.6 0.25 0.10 0.10 Vitamin B12, pg/mL 269.6 ± 44.2 364.8 ± 44.2 203.8 ± 44.2 443.8 ± 48.4 0.88 0.002 0.13 Glucose, µM 3.57 ± 0.12 3.54 ± 0.12 3.62 ± 0.12 3.47 ± 1.07 0.94 0.45 0.61 Urea, mM 5.93 ± 0.39 5.99 ± 0.39 5.64 ± 0.39 7.01 ± 0.43 0.29 0.06 0.07 BHBA, mM 0.68 ± 0.11 0.65 ± 0.11 0.56 ± 0.11 0.71 ± 0.12 0.79 0.55 0.39 NEFA, µM 171.7 ± 55.0 200.4 ± 55.0 160.3 ± 55.0 242.2 ± 60.2 0.79 0.34 0.64 Amino acids, µM Ala 297 ± 24 313 ± 24 291 ± 24 291 ± 25 0.44 0.68 0.65 Arg 93.8 ± 6.0 100.3 ± 6.0 92.0 ± 6.0 109.7 ± 6.5 0.47 0.04 0.30 Asp 4.88 ± 1.25 6.55 ± 1.25 5.46 ± 1.3 6.24 ± 1.37 0.92 0.36 0.73 Cys 119.9 ± 5.0 101.5 ± 5.4 109.5 ± 5.0 114.2 ± 5.4 0.80 0.15 0.02 Glu 53.4 ± 4.1 52.9 ± 4.1 54.8 ± 4.1 48.3 ± 4.5 0.71 0.40 0.48 Gly 314.3 ± 32.9 377.3 ± 32.9 340.8 ± 32.9 293.1 ± 35.4 0.29 0.78 0.06 His 54.5 ± 6.5 52.7 ± 6.5 59.4 ± 6.5 63.2 ± 7.1 0.19 0.87 0.62 Hcy 7.12 ± 0.78 5.08 ± 0.84 5.87 ± 0.78 4.68 ± 0.84 0.23 0.03 0.53 Ile 139.0 ± 11.5 136.1 ± 11.5 147.9 ± 11.5 170.9 ± 12.6 0.07 0.36 0.28 Leu 215.1 ± 20.4 201.5 ± 20.4 233.2 ± 20.4 274.1 ± 22.3 0.03 0.50 0.18 Lys 99.7 ± 7.8 97.8 ± 7.8 98.8 ± 7.8 126.7 ± 8.4 0.07 0.09 0.06 Met 25.1 ± 1.5 24.5 ± 1.5 20.5 ± 1.5 25.3 ± 1.7 0.24 0.21 0.10 Phe 59.9 ± 5.7 49.5 ± 5.7 65.9 ± 5.7 71.4 ± 6.1 0.01 0.58 0.09 Pro 127.9 ± 13.4 133.8 ± 13.4 138.8 ± 13.4 153.7 ± 14.6 0.24 0.43 0.72 Ser 99.5 ± 6.1 116.9 ± 6.1 114.5 ± 6.1 106.4 ± 6.7 0.73 0.47 0.06 Thr 147.6 ± 11.8 151.1 ± 11.8 149.4 ± 11.8 152.2 ± 13.0 0.90 0.80 0.97 Tyr 74.4 ± 6.5 78.0 ± 6.5 84.7 ± 6.5 91.2 ± 7.1 0.10 0.46 0.83

139

Val 328.0 ± 22.7 301.9 ± 22.7 351.3 ± 22.7 395.2 ± 24.8 0.02 0.70 0.14 BCAA2 682.1 ± 53.7 639.2 ± 53.7 732.3 ± 53.7 839.9 ± 58.7 0.03 0.55 0.17 EAA3 1069 ± 69 1013 ± 70 1126 ± 69 1278 ± 70 0.03 0.48 0.13 NEAA4 1185 ± 65 1277 ± 70 1232 ± 65 1214 ± 70 0.87 0.49 0.30 TAA5 2254 ± 122 2300 ± 132 2358 ± 122 2493 ± 132 0.19 0.42 0.68

1M- and M+: basal diet – or + rumen-protected Met; B9-B12-: no vitamin supplement; B9+B12+: 160 mg folic acid/wk + 10 mg cyanocobalamin/wk. 2 BCAA, branched-chain amino acids = Ile + Leu + Val 3 EAA, essential amino acids = His + Ile + Leu + Val + Lys + Phe + Thr + Met 4 NEAA, non-essential amino acids = Ala + Arg + Asp + Glu + Gly + Pro + Ser + Tyr + cys 5 TAA, total amino acids

140

Tableau 10. Effects of dietary supplements of rumen-protected Met (M) and intramuscular injections of folic acid (B9) and vitamin B12 (B12) given to dairy cows on whole body glucose kinetics at 12 wk of lactation

Treatments1 P values M+ M- met vit met*vit B9-B12-

(n=6) B9+B12+

(n=6) B9-B12- (n=6)

B9+B12+ (n=5)

Glucose kinetics (mmol/h) ILR 817 ± 22 843 ± 22 787 ± 22 833 ± 24 0.36 0.11 0.63 Ox2 190 ± 19 182 ± 19 183 ± 19 197 ± 20 0.81 0.81 0.49 FO (%)3 23.2 ± 2.0 21.5 ± 2.0 23.1 ± 2.0 23.3 ± 2.1 0.55 0.63 0.54 Milk lactose / glucose ILR4 0.47 ± 0.02 0.52 ± 0.02 0.51 ± 0.02 0.52 ± 0.02 0.38 0.22 0.48

1M- and M+: basal diet – or + rumen-protected Met; B9-B12-: no vitamin supplement; B9+B12+: 160 mg folic acid/wk + 10 mg cyanocobalamin/wk. 2 Ox = oxidation = FO * ILR glucose 3 FO = fractional oxidation 4 Milk lactose-/glucose ILR = [(ILR glucose – Ox glucose) / 2] / ILR glucose

141

Tableau 11. Effects of dietary supplements of rumen-protected Met (M) and intramuscular injections of folic acid (B9) and vitamin B12 (B12) given to dairy cows on whole body Met kinetics at 12 wk of lactation

Treatments1 P values M+ M- B9-B12-

(n=6) B9+B12+

(n=6) B9-B12-

(n=6) B9+B12+

(n=5) met vit met*vit

Met kinetics (mmol/h) ILR-M2 24.8 ± 1.2 24.1 ± 1.2 18.3 ± 1.2 21.8 ± 1.3 0.003 0.27 0.11 ILR-C3 21.6 ± 1.0 21.3 ± 1.0 16.2 ± 1.0 19.5 ± 1.1 0.003 0.15 0.09 RM4 3.2 ± 0.4 2.8 ± 0.4 2.0 ± 0.4 2.3 ± 0.4 0.04 0.84 0.42 Ox5 4.5 ± 0.6 2.6 ± 0.6 3.1 ± 0.6 3.6 ± 0.6 0.74 0.22 0.06 FO (%)6 18.6 ± 2.5 11.1 ± 2.5 16.7 ± 2.5 16.5 ± 2.7 0.50 0.16 0.18 TM7 7.7 ± 0.6 5.4 ± 0.6 5.2 ± 0.6 5.7 ± 0.6 0.02 0.06 0.01 PS8 17.1 ± 1.1 18.7 ± 1.1 13.1 ± 1.1 15.9 ± 1.1 0.01 0.06 0.59 Ox / ILR-M 0.19 ± 0.03 0.11 ± 0.03 0.17 ± 0.03 0.17 ± 0.03 0.50 0.16 0.18 RM / ILR-M 0.13 ± 0.01 0.12 ± 0.01 0.11 ± 0.01 0.10 ± 0.01 0.21 0.52 0.81 Ox / TM 0.58 ± 0.06 0.48 ± 0.06 0.61 ± 0.06 0.63 ± 0.07 0.20 0.24 0.23 RM / TM 0.42 ± 0.06 0.56 ± 0.06 0.41 ± 0.06 0.39 ± 0.07 0.20 0.34 0.23 TM / ILR-M 0.31 ± 0.02 0.23 ± 0.02 0.28 ± 0.02 0.27 ± 0.02 0.98 0.05 0.10 1M- and M+: basal diet – or + rumen-protected Met; B9-B12-: no vitamin supplement; B9+B12+: 160 mg folic acid/wk + 10 mg cyanocobalamin/wk. One cow in M+B9+B12+ group has been removed for Ox, FO, transmethylation and protein synthesis calculation. 2 ILR-M = Met-methyl flux; irreversible loss rate of 3D3 labelled Met, and it corresponds to the sum of protein synthesis, oxidation and remethylation. 3 ILR-C = Met -carboxyl flux; irreversible loss rate of 13C labelled Met and it corresponds to the sum of protein synthesis and oxidation. 4 RM = remethylation cycle = ILR-M – ILR-C 5 Ox = oxidation = FO × ILR-M 6 FO = fractional oxidation 7 TM = transmethylation = RM + Ox 8 PS = protein synthesis = ILR-M – RM – Ox = ILR-C – Ox

142

Figure 27. A schematic pathway of L-[1-13C,2H3]methionine with its components: transmethylation (TM), remethylation (RM) and transsulfuration (TS); CH3-THF, methyl-tetrahydrofolate, THF, tetrahydrofolate. If methionine is labelled on the methyl group and the carboxyl group, the methyl label will be lost during TM while homocysteine RM will produce methionine labelled only on the carboxyl group. The carboxyl label will be lost during TS, which correspond to methionine oxidation, and will appear in CO2 (adapted from Mercier et al., 2006)

Protein synthesis

Methionine

C H3 – S – (CH2)2 – CH C OOH

NH2

Homocysteine

HS – (CH2)2 – CHC OOH

NH2

C H3

THF

CH3-THF

Vitamin B12 RM TM

Cysteine

HS – CH2 – CHCOOH

NH2

TS C O2

143

Figure 28. Effects of dietary supplements of rumen-protected methionine (M) and intramuscular injections of folic acid (B9) and vitamin B12 (B12) given to dairy cows from 3 wk before calving to 12 wk of lactation on A) plasma concentration of cysteine (methionine x vitamins; P = 0.02) and B) methionine oxidation (methionine x vitamins; P = 0.06) on wk 12 of lactation

A)

100

105

110

115

120

125

130

M+B9-B12- M+B9+B12+ M-B9-B12- M-B9+B12+

Pla

sma

co

nce

ntr

atio

ns

of c

yste

ine

, uM

B)

2

2,5

3

3,5

4

4,5

5

5,5

M+B9-B12- M+B9+B12+ M-B9-B12- M-B9+B12+

Met

hion

ine

oxid

atio

n, m

mol

/h

144

IV-9 REFERENCES

Agriculture Canada. 1990. Recommended Code of Practice for Care and Handling of Dairy Cattle. Publ. No. 1853/E. Agric. Can., Ottawa, Ontario.

Association of Official Analytical Chemists. 2000. Official Methods of Analysis. 17th ed. AOAC, Arlington, VA. Bässler, K. H. 1997. Enzymatic effects of folic acid and vitamin B12. Internat. J. Vitam. Nutr. Res. 67:385-388. Bauman, D. E., C. J. Peel, W. D. Steinhour, P. J. Reynolds, H. F. Tyrrell, A. C. G. Brown, and G. L. Haaland. 1988.

Effect of bovine somatotropin on metabolism of lactating dairy cows: influence on rates of irreversible loss and oxidation of glucose and nonesterified fatty acid. J. Nutr. 118:1031-1040.

Bergman, E. N. 1990. Energy contributions of volatile fatty acids from the gastrointestinal tract in various species.

Physiol. Rev. 70:567-590. Berthiaume, R., P. Dubreuil, M. Stevenson, B. W. McBride, and H. Lapierre. 2001. Intestinal disappearance and

mesenteric and portal appearance of amino acids in dairy cows fed ruminally protected methionine. J. Dairy Sci. 84:194-203.

Brosnan, J. T., M. E. Brosnan, R. F. P. Bertolo, and J. A. Brunton. 2007. Methionine: a metabolically unique amino

acid. Livest. Sci. 112:2-7. Bruckental, I., J. D. Oldham, and J. D. Sutton 1980. Glucose and urea kinetics in cows in early lactation. Br. J. Nutr.

44:33-45. Calder, A. G., K. E. Garden, S. E. Anderson, and G. E. Lobley. 1999. Quantification of blood and plasma amino

acids using isotope dilution electron impact gas chromatography/mass spectrometry with U-13C amino acids as internal standards. Rapid Commun. .Mass Spectrom. 13:2080-2083.

Canadian Council on Animal Care. 1993. Guide to the Care and Use of Experimental Animals. 2nd ed. Vol. 1. E. D.

Rolfert, B. M. Cross, and A. A. McWilliam, ed. Can. Counc. Anim. Care. Ottawa, ON, Canada. Clark, J. H., H. R. Spires, R. G. Derrig, and M. R. Benning 1977. Milk production, nitrogen utilization and glucose

synthesis in lactating cows infused postruminally with sodium caseinate and glucose. J. Nutr. 107:631-644. Cuskelly, G. J., P. W. Stacpoole, J. Williamson, T. G. Baumgartner, and J. F. Gregory III. 2001. Deficiencies of

folate and vitamin B6 exert distinct effects on homocysteine, serine, and methionine kinetics. Am. J. Physiol. Endocrinol. Metab. 281:E1182-E1190.

Danfaer, A., V. Tetens, and N. Agergaard. 1995. Review and an experimental study on the physiological and

quantitative aspects of gluconeogenesis in lactating ruminants. Comp. Biochem. Physiol. B. Biochem. Mol. Biol. 111:201-210.

DiBuono, M., L. J. Wykes, D. E. C. Cole, R. O. Ball, and P. B. Pencharz. 2003. Regulation of sulphur amino acid

metabolism in men in response to changes in sulphur amino acid intakes. J. Nutr. 133:733-739. Eloranta, T. O., V. Martikainen, and T. K. Smith. 1990. Adaptation of adenosylmethionine metabolism and

methionine recycling to variations in dietary methionine in the rat. Proc. Soc. Exp. Biol. Med. 194:364-371. Finkelstein, J. D. 1990. Methionine metabolism in mammals. J. Nutr. Biochem. 1:228-37. Fukagawa, N. K., Y. M. Yu, and V. R. Young. 1998. Methionine and cysteine kinetics at differents intakes of

methionine and cystine in elderly men and women. Am. J. Clin. Nutr. 38:380-388.

145

Giguère, A., C. L. Girard, and J. J. Matte. 2008. Methionine, folic acid and vitamin B12 in growing-finishing pigs:

Impact on growth performance and meat quality. Archiv. Anim. Nutr. 62:193-206. Girard, C. L., and J. J. Matte. 1988. Blood serum concentrations of folates and vitamin B12 during growth period of

white veal calves. Can. J. Anim. Sci. 68:455-460. Girard, C. L., J. J. Matte, and G. F. Tremblay. 1995. Gestation and lactation of dairy cows: a role for folic acid? J.

Dairy Sci. 78:404-411. Girard, C. L., and J. J. Matte. 1998. Dietary supplements of folic acid during lactation: effects on the performance of

dairy cows. J. Dairy Sci. 81:1412-1419. Girard, C. L., H. Lapierre, J. J. Matte, and G. E. Lobley. 2005. Effects of dietary supplements of folic acid and

rumen-protected methionine on lactational performance and folate metabolism of dairy cows. J. Dairy Sci. 88:660-670.

Girard, C. L., and J. J. Matte. 2005. Effects of intramuscular injections of vitamin B12 on lactation performance of

dairy cows fed dietary supplements of folic acid and rumen-protected methionine. J. Dairy Sci. 88:671-676. Graulet, B., J. J. Matte, A. Desrochers, L. Doepel, M. F. Palin, and C. L. Girard. 2007. Effects of dietary supplements

of folic acid and vitamin B12 on metabolism of dairy cows in early lactation. J. Dairy Sci. 90:3442-3455. Hammon, H. M., C. C. Metges, P. Junghans, F. Becker, O. Bellmann, F. Schneider, G. Nürnberg, P. Dubreuil, and H.

Lapierre. 2008. Metabolic changes and net portal flux in dairy cows fed a ration containing rumen-protected fat as compared to a control diet. J. Dairy Sci. 91:208-217.

Haymond, M. W., and A. L. Sunehag. 2000. The reciprocal pool model for the measurement of gluconeogenesis by

use of [U-13C]glucose. Am. J. Physiol. Endocrinol. Metab. 278:E140-E145. Le Grusse, J., and B. Watier. 1993. Les vitamines. Données biochimiques, nutritionnelles et cliniques. Centre

d’étude et d’information sur les vitamines, Produits Roche. Neuilly-sur-Seine, France. Lapierre, H., R. Berthiaume, G. Raggio, M. C. Thivierge, L. Doepel, D. Pacheco, P. Dubreuil, and G. E. Lobley.

2005. The route of absorbed nitrogen into milk protein. Anim. Sci. 80:11-22. Lemosquet, S., E. Delamaire, J. Guinard-Flament, and H. Lapierre. 2005. Glucose rate of appearance (Ra) responses

to isoenergetic infusions of glucose (GLC), propionic acid (C3) and non essential amino acids (NEAA) in dairy cows. J. Anim. Sci. 83 / J. Dairy Sci. 88 (Suppl. 1): 182. (Abstr.).

Linzell, J.L. 1972. Mechanism of secretion of the aqueous phase of milk. J. Dairy Sci. 55:1316-1322. Lobley, G. E., A. Connell, and D. Revell. 1996. The importance of transmethylation reactions to methionine

metabolism in sheep: effects of supplementation of creatine and choline. Br. J. Nutr. 75:47-56. Malinow, M. R., S. S. Kang, L. M. Taylor, P. W. K. Wong, B. Coull, T. Inahara, D. Mukerjee, G. Sexton, and B.

Upson. 1989. Prevalence of hyperhomocyst(e)inemia in patients with peripheral arterial occlusive disease. Circulation. 79:1180-1188.

McDowell, L. R. 2000. Vitamins in animal and human nutrition. 2nd ed., Iowa State, University Press, Ames, IA. Mercier, S., D. Breuille, C. Buffiere, J. Gimonet, I. Papet, P. Patuteau-Mirand, and C. Obled. 2006. Methionine

kinetics are altered in the elderly both in the basal state and after vaccination. Amer. J. Clin. Nutr. 83:291-298.

Mudd, S. H., and J. R. Poole. 1975. Labile methyl balances for normal humans on various dietary regimens.

146

Metabolism. 24:721-735. Mudd, S. H., J. T.Brosnan, M. E. Brosnan, R. L. Jacobs, S. P. Stabler, R. H. Allen, D. E. Vance, and C. Wagner.

2007. Methyl balance and transmethylation fluxes in humans. Amer. J. Nutr. 85:19-25. National Research Council. 2001. Nutrient Requirements of Dairy Cattle. 7th rev. ed. Natl. Acad. Sci., Washington,

DC. Raggio, G., G. E. Lobley, S. Lemosquet, H. Rulquin, and H. Lapierre. 2006. Effect of casein and propionate supply

on whole body protein metabolism in lactating dairy cows. Can. J. Anim. Sci. 86:81-89. Reynolds, C. K. 2006. Production and metabolic effects of site of starch digestion in dairy cattle. Anim. Feed Sci.

Tech. 130:78-94. Rigout, S., S. Lemosquet, J. E. Van Eys, J. W. Blum, and H. Rulquin. 2002. Duodenal glucose increases glucose

fluxes and lactose synthesis in grass silage-fed dairy cows. J. Dairy Sci. 85:595-606. Rulquin, H., P. M. Pisulewski, R. Vérité, and J. Guinard. 1993. Milk production and composition as a function of

postruminal lysine and methionine supply: a nutrient-response approach. Livest. Prod. Sci. 37:69-90. Rulquin, H., and L. Delaby. 1997. Effects of energy balance of dairy cows on lactational responses to rumen-

protected methionine. J. Dairy Sci. 80:2513-2522. Rulquin, H., S. Rigout, S. Lemosquet, and A. Bach. 2004. Infusion of glucose directs circulating amino acids to the

mammary gland in well-fed dairy cows. J. Dairy Sci. 87:340-349. SAS Institute. 2004. SAS/STAT User’s Guide: Volume 1-7. SAS Inst. Inc., Cary, NC. Schwab, C. G. 1996. Rumen-protected amino acids for dairy cattle: Progress towards determining lysine and

methionine requirements. Anim. Feed Sci. Technol. 59:87-101. Selhub, J. 1999. Homocysteine metabolism. Annu. Rev. Nutr. 19:217-246. Stam, F., Y. M. Smulders, C. Guldener, C. Jakobs, C. D. A. Stehouwer, and K. Meer. 2005. Folic acid treatment

increases homocysteine remethylation and methionine transmethylation in healthy subjects. Clin. Sci. 108:449-456.

Stead, L. M., J. T. Brosnan, M. E. Brosnan, D. E. Vance, and R. L. Jacobs. 2006. Is it time to reevaluate methyl

balance in humans ? Amer. J. Clin. Nutr. 83:5-10. Storch, K. J., D. A. Wagner, J. F. Burke, and V. R. Young. 1988. Quantitative study in vivo of methionine cycle in

humans using [methyl-2H3] and [1-13C]methionine. Amer. J. Physiol. 255:E322-E331. Storch, K. J., D. A. Wagner, J. F. Burke, and V. R. Young. 1990. [1-13C; methyl2H3]methionine kinetics in humans:

methionine conservation and cystine spare. Amer. J. Physiol. 258:E790-E798. White, J. A., R. J. Hart, and J. C. Fry. 1986. An evaluation of the Waters Pico-Tag system for amino-acid analysis of

food materials. J. Aut. Chem. 8:170-177. Xue, G. P., and A. M. Snoswell. 1985. Regulation of methyl group metabolism in lactating ewes. Biochem Int.

11:381-385.

147

148

CHAPITRE V

HEPATIC METABOLISM OF DAIRY COWS ACCORDING

TO FOLIC ACID AND VITAMIN B12 SUPPLY AND

METHIONINE PROVISION.

Ce chapitre sera soumis pour publication dans la revue “Journal of Dairy Science ” sous la

référence de A. Preynat, H. Lapierre, M.C. Thivierge, M.F. Palin, J.J. Matte, A. Desrochers and

C. L. Girard. 2009. Hepatic Metabolism of Dairy Cows According to Folic Acid and Vitamin B12

Supply and Methionine Provision. J. Dairy Sci. xx : xx-xx.

149

V-1 RÉSUMÉ

De -3 à +16 semaines de lactation, les suppléments de méthionine protégée de la

dégradation ruminale affectent l’efficacité du cycle des méthylations. Les concentrations

hépatiques de folates et de vitamine B12 étaient augmentées en réponse à leur supplément

respectif mais cette réponse variait en fonction des apports de méthionine. Les expressions

géniques de la 5, 10-méthylène-tétrahydrofolate réductase et de la méthylmalonylCoA mutase

étaient augmentées par les injections combinées d’acide folique et de vitamine B12. La

méthylmalonylCoA mutase, une enzyme dépendante de la vitamine B12, est essentielle pour

l’utilisation du propionate pour la néoglucogenèse. Ces résultats suggèrent qu'une augmentation

des apports de groupements méthyles, préformés ou via la méthylnéogenèse, affectait

l'expression de plusieurs gènes liés au cycle des méthylations mais n'avait qu'un effet limité sur

les performances zootechniques. Cependant, les effets des suppléments vitaminiques sur les

performances de lactation des vaches laitières résultaient probablement d'une amélioration du

métabolisme du glucose en début de lactation.

Mots-clés : vache laitière, acide folique, vitamine B12, méthionine protégée de la dégradation

ruminale

150

V-2 ABSTRACT

The present experiment was undertaken to study the interactions between dietary

supplements of rumen-protected methionine (RPM) and intramuscular injections of folic acid and

vitamin B12, given from 3 wk before calving to 16 wk of lactation, on hepatic metabolism of

lactating dairy cows. Sixty multiparous Holstein cows were assigned to 10 blocks of 6 cows each

according to their previous milk production. Within each block, 3 cows were fed a diet calculated

to supply Met as 1.83% metabolizable protein, equivalent to 76% of Met requirement, whereas

the 3 other cows were fed the same diet supplemented with 18 g of RPM. Within each level of

Met, the cows received either no vitamin supplement, weekly intramuscular injections of 160 mg

of folic acid alone or combined with 10 mg of vitamin B12. Liver biopsies were taken at 2, 4, 8

and 16 wk of lactation. Liver concentrations of folates and vitamin B12 were increased by their

respective supplements but this response to vitamin supplements was altered by methionine

supply. Concentrations of triglycerides increased in liver of cows fed RPM whereas

concentrations of cholesterol ester, cholesterol, diglycerides and phosphatidylcholine were not

affected. Folic acid and vitamin B12 given together increased hepatic concentrations of

phosphatidylethanolamine only in cows fed RPM. Gene expressions of 5,10-methylene-

tetrahydrofolate reductase, microsomal transfer protein and phosphatidylethanolamine

methyltransferase were higher in liver of cows fed RPM supplements. The relative mRNA

abundance of 5,10-methylene-tetrahydrofolate reductase and methylmalonylCoA mutase were

increased by the combined injections of folic acid and vitamin B12, whereas those of methionine

synthase and methionine synthase reductase were not affected by treatments. These data suggest

that increasing supply of methyl groups, as preformed labile methyl groups or through

methylneogenesis, affected the expression of several genes linked to the methylation cycle but

had a limited impact on dairy cow performance. However, the observed effects of the combined

supplement of folic acid and vitamin B12 on lactational performance of dairy cows probably

result from an improvement of glucose metabolism during early lactation.

Key words: dairy cow, folic acid, vitamin B12, rumen-protected methionine

151

V-3 INTRODUCTION

Folic acid, vitamin B12 and Met roles are closely interrelated in the methylation cycle

(Figure 29). Folic acid deficiency reduces the activity of the methylation cycle by decreasing

methylneogenesis. Vitamin B12 is the coenzyme of methionine synthase, the enzyme essential for

the transfer of a methyl group from 5-methyl-tetrahydrofolate to homocysteine (Hcy) for

regeneration of Met, the precursor of S-adenosylmethionine (SAM), a major donor of methyl

groups. A vitamin B12 deficiency blocks the transfer of a methyl group from 5-methyl-

tetrahydrofolate leading to a secondary folate deficiency by interfering with folate utilization in

cells (Scott, 1999). Met supply, due to its role as donor of preformed labile methyl groups, affects

the needs for methylneogenesis (Bailey and Gregory, 1999) and consequently, for these two

vitamins.

Besides their roles in the methylation cycle, folic acid is involved in purine and

pyrimidine synthesis, and consequently, DNA synthesis and cell division; vitamin B12 plays a

major role for the entry of propionate in the Krebs cycle and gluconeogenesis, through the

vitamin B12-dependent enzyme, methylmalonyl-CoA mutase (MUT) (McDowell, 2000) and Met

has an important role in protein synthesis (Brosnan et al., 2007).

Recent studies demonstrated that, under some circumstances, supplementary folic acid

and vitamin B12 improved lactational performance of dairy cows without altering DMI (Girard

and Matte, 2005; Graulet et al., 2007). However, given the intricate metabolic pathways

dependent of these two vitamins, it is not clear if these effects were mediated through changes in

DNA synthesis, methylneogenesis or gluconeogenesis. Girard and Matte (2005) observed that

administration of vitamin B12 to dairy cows fed a diet supplemented with rumen-protected Met

(RPM) and folic acid increased lactational performance and blood hemoglobin concentrations

but decreased plasma concentrations of methylmalonic acid. The results suggest that low vitamin

B12 supply interfered with the vitamin B12-dependent enzyme, MUT as well as with folate

metabolism because folic acid deficiency, through its role in DNA synthesis, affects

hematopoiesis (Bills et al., 1992). However, Graulet et al. (2007) reported that supplementary

folic acid, given alone or in combination with vitamin B12, increased milk and milk protein yields

without affecting DMI suggesting that these responses were not dependent of vitamin B12 supply.

However, in this last study, when vitamin B12 was given with folic acid, changes in

152

concentrations of plasma glucose and hepatic lipids suggested an improvement in metabolic

efficiency. These effects were probably related to improved gluconeogenesis efficiency due to an

increased affinity of MUT for its cofactor, vitamin B12, in hepatocytes of cows fed

simultaneously folic acid and vitamin B12 supplements.

Given the close interaction of folic acid and vitamin B12 in methylation cycle and glucose

metabolism, these two vitamins should play an important role in the regulation of these metabolic

pathways in lactating dairy cows. In addition, as the liver plays a key role in the coordination of

nutrient fluxes to support lactation, it was hypothesized that supplements of these two vitamins

would improve metabolic efficiency at the hepatic level. In an attempt to further delineate the

modes of action of folic acid and vitamin B12 on hepatic metabolism, different metabolites and

expression of genes closely related to the roles described above of these three nutrients have been

studied. In addition, in vitro capacity of gluconeogenesis and protein synthesis was measured on

liver tissues obtained by biopsy from the cows used in Preynat et al. (2009a, Chapitre III).

V-4 MATERIALS AND METHODS

V-4.1 Animals, diets and experimental design

Sixty multiparous Holstein cows from the herd at the Agriculture and Agri-Food Canada

Research Centre (Sherbrooke, PQ, Canada) were assigned to 10 blocks of 6 cows each according

to their previous milk production; treatments were tested according to a 2 x 3 factorial

arrangement. Within each block, 3 cows were fed the basal diet calculated to supply Met as

1.83% of metabolisable protein (MP), equivalent to 76% of the Met requirement (NRC, 2001)

(M-). The three other cows were fed the same diet supplemented daily with RPM (M+: 9 and 18

g Mepron-85/d, Degussa AG, Hanau, Germany, pre and post-calving) to bring the estimated Met

supply to 2.23% of MP in the lactation diet, equivalent to 93% of the Met requirement (NRC,

2001). Within each level of Met (M+ or M-), the cows received either no vitamin supplement

(B9-B12-), weekly intramuscular injections of 160 mg of folic acid alone (B9+B12-;

pteroylmonoglutamic acid, ICN Biochemicals inc., Cleveland, Ohio, USA) or in combination

with 10 mg of vitamin B12 (B9+B12+; cyanocobalamin, 5 000 µg/mL, Vetoquinol, Lavaltrie,

Québec, Canada).

153

The experimental period began 3 wk before the expected date of calving and lasted until

16 wk after calving. Cow management and diet composition are described in Preynat et al.

(2009a, Chapitre III).

V-4.2 Sampling procedure

Liver biopsies were performed at 13.9 ± 1.3, 27.8 ± 1.4, 55.8 ± 1.4 and 112.1 ± 1.8 d after

calving under local anaesthesia and ultrasound guidance to minimize the hemorrhagic risks as

described by Graulet et al. (2007). The procedure was approved by the Institutional Committee

on Animal Care of the Sherbrooke Research Centre in accordance with the guidelines of the

Canadian Council of Animal Care (1993). Liver tissue was immediately blotted to remove blood

and an average of 0.610 ± 0.017 g of fresh tissue was transported to the laboratory in ice-cold

transport media (RPMI 1640 media without phenol red; pH 7.2, filtered to 0.22 µm and kept

under sterile conditions) and used immediately to determine hepatic capacity for protein synthesis

and gluconeogenesis using an in vitro metabolic system. The remaining tissue (approximately 2.4

± 0.5 g) was immediately frozen into liquid nitrogen and stored at -80°C until used.

V-4.3 Laboratory analyses

V-4.3.1 Folates and vitamin B12

Concentrations of folates and vitamin B12 in liver were determined in duplicate by

radioassay using a commercial kit designed for human plasma (Quantaphase FolatesII/vitamin

B12, Bio-Rad Laboratories (Canada) Ltd, Mississauga, ON, Canada) as described by Graulet et al.

(2007). The interassay coefficients of variation were 4.4 and 2.0% for folates and vitamin B12,

respectively.

V-4.3.2 Biotin

Concentration of biotin in liver was determined using a method described by Santschi and

Girard (2007) for analysis in digesta. Approximately 50 mg of liver tissue were homogenized in a

glass grinder tube with 10 mL of ultrapure water for 1 min. Homogenates were transferred to 50

154

mL tubes. Glass tubes and grinders were rinsed with 10 mL ultrapure water to recover the total

amount of homogenates. One gram of dried pancreas (pancreas acetone powder, bovine; Sigma,

Oakville, ON, Canada) was added and the volume was completed to 30 mL with ultrapure water.

The tubes were mixed carefully, incubated in an ultra-sound bath for 15 min and then, in a water

bath at 37°C for 18 h. Following incubation, the samples were autoclaved for 10 min at 121°C to

stop all enzymatic activity. After cooling, the volume was completed at 50 mL with ultrapure

water and the tubes were centrifuged for 12 min at 1,538 x g and 4°C. Samples were then diluted

1:70 in PBS to achieve a final dilution of 1:3,500. This preparation was used in the ELISA assay

as described by Santschi and Girard (2007).

V-4.3.3 Lipid fractions (cholesterol ester, triglycerides, diglycerides,

cholesterol, phosphatidylethanolamine and phosphatidylcholine) in liver

Lipids in hepatic tissue were extracted according to the method described by Folch et al.

(1957) and quantified using a HPLC method adapted from Homan and Anderson (1998). The dry

lipid extracts were dissolved in 5 mL of isooctan/tetrahydrofuran (9/1) (Sigma) and stored at -

20ºC until HPLC analysis. The HPLC system components were from Kontron Instruments

(Zürich, Switzerland) and consisted of a P325 pump, a 360 autosampler and vacuum degasser

200 (PerkinElmer, Courtaboeuf, France). All components were controlled by the Kromasystem

2000 software. A 150 x 4.6 mm column containing silica 5 μm (Sunfire Silica 5 μm, Waters,

Guyancourt, France) and equipped with a 0.2 μm column prefilter (Waters) was heated to 40ºC in

a column thermostat 482 (Kontron Instruments). Lipids were detected with a SEDEX 85

evaporative light scattering detector (Sedere S.A., Alfortville, France), equipped with nitrogen

generator (Parker Balston® N2-04, Parker Hannifin, La Chaussee Saint Victor, France), set to

50% of maximum gain, a drift tube temperature of 45ºC and a nitrogen pressure of 3.5 bar.

V-4.3.4 RNA extraction and cDNA synthesis

Total RNA was extracted from liver biopsies using TRIzol reagent (Gibco BRL,

Burlington, ON, Canada) according to the manufacturer’s instructions. Total RNA was dissolved

in water and quantified spectrophotometrically at 260 nm and an aliquot was run on 1% agarose

155

gel to verify its integrity. Total RNA was reverse transcripted to cDNA in a PTC-200 Peltier

Programmable Thermal Cycler (MJ Research, Foster City, CA). Five µg of total RNA were

treated with three units of DNase I (amplification grade; Gibco BRL) to remove contaminating

genomic DNA. First-strand cDNA was synthesized using a superscript II preamplification system

(Gibco BRL) and 500 ng of oligo(dT)12-18 as primer (Amersham Pharmacia Biotech, Baie d’Urfé,

QC, Canada) in 50 μL of total reaction volume.

.

V-4.3.5 Cloning and Sequencing of 5,10-Methylene-tetrahydrofolate

Reductase, Betaïne Homocysteine Methyltransferase and Methionine

Synthase Reductase Bovine Genes

To determine the bovine specific sequence of 5,10-methylene-tetrahydrofolate reductase

(MTHFR), betaine homocysteine methyltransferase (BHMT) and methionine synthase reductase

(MTRR), degenerate primers (Tableau 6) were designed based on homology between human

(Genbank accession no. NM_005957, BC012616 and AF025794, respectively) and mouse

(Genbank accession no. NM_010840, AF033381 and BC025942, respectively) sequences.

PCR amplifications were performed under the following conditions: the 50-μL PCR

reaction contained 200 μM dNTPs, 300 nM of each primer, 1.5 mM MgCL2, 1 unit of Taq

polymerase (Clontech a Takara Company, Mountain View, CA) in 1 x Taq polymerase buffer.

The PCR profile consisted of an initial denaturation step at 94ºC for 1 min followed by 35 cycles

of 94ºC for 30 sec, 50ºC for 30 sec, 68ºC for 1 min, and a final extension at 68ºC for 5 min. This

amplification generated one fragment of 612, 489 and 516 bp for MTHFR, BHMT and MTRR,

respectively (Tableau 6). The nucleotide sequence of the amplified fragment was determined by

cycle sequencing in both directions a total of three independent amplifications. Sequence

determination was performed using the Big Dye Terminator Cycle Sequencing Ready Reactions

(PE Applied Biosystems, Foster City, CA, USA) according to manufacturer’s instructions and

run on an ABI 377 DNA sequencer (PE Applied Biosystems).

156

V-4.3.6 5’- and 3’- RACE of MTHFR, BHMT, MTRR and Methionine

Synthase Bovine Genes.

To obtain the complete coding sequence of bovine MTHFR, BHMT, MTRR and

methionine synthase (MS), 5’ and 3’ rapid amplification of the cDNA ends (RACE) was

performed using the MarathonTM cDNA amplification kit (Clontech). Poly A+ RNA was isolated

using the Nucleotrap mRNA purification kit (Clontech). One µg of poly A+ RNA from bovine

liver tissue was reverse-transcribed using the Marathon cDNA synthesis primer. Second strand of

cDNA was synthesized and a Marathon cDNA adaptor (Clontech) was then ligated to it. The 3’

and 5’ end amplification of bovine selected genes was performed using gene-specific primers,

defined in Tableau 6. Both 5’ and 3’ end fragments were sequenced as described above and were

assembled using the AutoAssembler 2.0 software (PE Applied Biosystems) to determine the

complete bovine specific MTHFR, BHMT, MTRR and MS coding sequences.

V-4.3.7 Selected bovine genes mRNA levels

The cDNA of cells obtained by liver biopsy was analyzed for actin-beta (ACTB), BHMT,

cyclophiline (CYCLO), glyceraldehyde-3-phosphate dehydrogenase (GAPDH), glucuronidase-

beta (GUSB), glycine N-methyltransferase (GNMT), MS, MTHFR, microsomal transfer protein

(MTP), MTRR, MUT and phosphatidylethanolamine methyltransferase (PEMT) mRNA levels

using real-time PCR amplification. Gene-specific primers (Tableau 6) were designed and selected

using the Primer Express Software (PE Applied Biosystem). Real-time PCR amplifications were

performed in 25-μL reaction volume consisting of 300 nM forward and reverse primers, 1 μL of

cDNA, 0.25 AmpErase (PE Applied Biosystem) and 1 x SYBRGreen Master Mix (PE Applied

Biosystem). Cycling conditions were 2 min at 50ºC, followed by 10 min at 95ºC, then 40 cycles

of 15 sec at 95ºC and 1 min at annealing temperature (Tableau 6). Amplification, detection, and

analysis were performed with an ABI Prism 7700 Sequence Detector (PE Applied Biosystem). A

correction for each plate was realized by dividing the threshold cycle value of samples by the

smallest threshold cycle value of the plate. Then samples were normalized using a housekeeping

gene. The expression of an “ideal” housekeeping gene should not vary with treatments or

physiological state in the studied tissue (Bustin, 2000, 2002). However, Rhoads et al. (2003) and

Janovick-Guretzky et al. (2007) observed that, during the peripartum period in dairy cows,

157

expression of many genes frequently used as housekeeping genes varied. In order to circumvent

this problem, an alternative methodology had been tested, using the best combination of 3

housekeeping genes (ACTB, CYCLO and GUSB), chosen according to Vandesompele et al.

(2002) to form the “bestkeeper” gene. However, as the bestkeeper gene was significantly affected

by the studied treatments (Met × vitamins interaction, P < 0.0001), the samples were normalized

using gene expression of GAPDH which did not significantly (P ≥ 0.08) differed among

treatments.

All real-time PCR reactions were performed in triplicate and standard curves were

established in duplicate for each gene. A pool of cDNA obtained from different liver biopsies

was used to create a standard curve for quantification of the transcripts using the relative standard

curve method as described by Applied Biosystem (User Bulletin #2, 1997). Standard curve

arbitrary units were made using 2 µL, 1.5 µL, 1 µL and then serial dilutions corresponding to

0.75, 0.50, 0.25, 0.10, 0.05, 0.025 and 0.005 µL of cDNA. For each sample, the amount of each

target gene mRNA relative to endogenous GAPDH was determined from their respective

standard curves. Relative quantity ratios were obtained by dividing the relative quantity unit of

each target gene by the one of GAPDH. The specificity of the amplified fragments was verified

on a 3.5% agarose gel and with melting curve analysis using the Dissociation Curves v1.0

software (PE Applied Biosystem).

V-4.3.8 Liver incubations

Less than 1 h after the biopsy, liver tissue was sliced in section of 1 mm thickness (20

mg). An average amount of 101.4 ± 2.6 mg of fresh tissue was placed on sterile stainless steel

grids above the central well of BD FalconTM cell culture dishes (B.D. Labware, Franklin Lakes)

and covered with 0.9 mL of incubation medium. The incubation medium used to evaluate

gluconeogenesis had the same composition than the transport medium plus 0.3 mM of Hcy

(Sigma), 63.8 mg/L of Cys (Sigma), 10 mL/L of an the antibiotic-antimycotic mixture (10,000

U/mL of penicillin (Sigma), 10 mg/mL of sulphate streptomycin (Sigma), 25 µg/mL of

amphotericin (Sigma)) and 2.5 mM of [2-14C]-propionate (MP Biomedicals, Inc., Irvine, CA).

The incubation procedures to measure protein synthesis were similar to those described above for

gluconeogenesis except that the 63.8 mg/mL of Cys were replaced by 31.9 mg/L of cold Cys

158

(Sigma) and 31.9 mg/L of [35S]-cysteine (Amersham Biosciences Corp., Baie d’Urfé, QC,

Canada). For each biopsy, liver tissue was divided between two BD FalconTM cell culture dishes

for each set of experimental condition. Water was added in the peripheral well to maintain

humidity during incubation and BD FalconTM cell culture dishes were capped and gassed for 3-4

min with 95% O2:5% CO2 and placed in incubator (Scientific Products Ultra-Tech NJ 701T, Cie

Baxter, Asheville, NC) at 37°C for 2 h. At the end of the incubation period, the labelled medium

was removed and the slices of liver were homogenized with a dounce homogenizer in 1 mL of

the following solution: Tris 25 mM (Sigma), NaCl 50 mM (Fisher, Ottawa, ON, Canada; pH 8.0)

and proteases inhibitors (5 mg/mL of leupeptin (Sigma), 1 mM of benzamidin (Sigma), 100

µg/µL of phenylMethylSulfonyl Fluorid (Sigma) and 1 mg/mL of pepstatin A (Sigma)).

For determination of the capacity of the liver tissue for gluconeogenesis, 600 µL of cold

0.4 M HClO4 (Fisher) were mixed to 600 µL of incubation medium or cell homogenate,

incubated for 20 min on ice and centrifuged at 3,000 × g for 20 min at 4°C. One millilitre of

supernatant was removed and deproteinized after incubation on ice for 20 min with 135 µL of

15% KOH. Tubes were centrifuged at 3,000 × g for 20 min at 4°C and again 1 mL of supernatant

was removed and the pH was adjusted between 7.0 to 7.4 with 6.0 N HCl (Fisher). The

radiolabelled glucose, synthesized from [2-14C]-propionate, was separated by placing a volume of

300 µL of supernatant on an anion exchange resin (AG 1-X8 100-200 mesh acetate form; Bio-

Rad, Hercules, CA). The resin was rinsed with 500 µL of ultrapure water and the eluate was

collected in a scintillation vial. This operation was repeated 7 times. Each vial was then filled

with 4 mL of scintillation cocktail (Ready Solv HP Beckman Coulter inc., Fullerton, CA), capped

and vortexed. Radioactivity was measured by liquid scintillation counting (Packard tri-carb 2900

TR, Packard Instrument Cie, Meriden, CT). The rate of gluconeogenesis, expressed as nmol of

precursor converted to glucose per gram of fresh liver per hour, was calculated as explained by

Williams et al. (2006).

Protein synthesis was measured as previously described by Gruffat-Mouty et al. (1999).

The rate of protein synthesis was calculated from the specific radioactivity of the precursor,

corrected according the time, and nmol of product formed per hour per g of fresh liver.

159

V-4.4 Statistical analyses

Two levels of Met (0 or 18 g of RPM) and 3 levels of B-vitamin (none, folic acid alone or

in combination with vitamin B12) supplements were used in a 2 x 3 factorial arrangement in a 10

randomized complete blocks design. All variables were analyzed using the MIXED procedure of

SAS (2004) according to a complete block design with treatments as main effects, repeated

measures in time and block as random effect. As the time intervals were different, the six

following covariance structures were compared: SP(POW), SP(GAU), SP(EXP), SP(LIN),

SP(LINL) and SP(SPH). For each variable, the statistical analysis retained was the one with the

smallest fit statistic values. Results are reported as least square means and standard errors of the

means. Means were assumed to be different at P ≤ 0.05 and tended to differ at 0.05 < P ≤ 0.10.

When the vitamin effect reached a level of significance of 90%, differences between means were

compared using an adjusted Tukey test. When the Met × vitamin interaction or a treatment × time

interaction reached a level of significant of 90%, the SLICE option in the LSMEANS statement

was used to help interpretation (SAS Institute, 2004).

V-5 RESULTS

V-5.1 B-vitamins

Hepatic concentrations of folates were increased (P = 0.001) by intramuscular injections

of folic acid alone or combined with vitamin B12; 6.7, 10.3 and 10.4 ± 0.28 μg/g of fresh tissue

for B9-B12-, B9+B12- and B9+B12+ cows, respectively (Tableau 7). RPM decreased folates

concentrations from 9.4 to 8.9 ± 0.25 µg/g of fresh tissue (P = 0.03; Tableau 7). The effect of B-

vitamins and Met supplementation on liver folates also changed during lactation (Met × vitamin

× time interaction, P = 0.002; Figure 30). Hepatic concentrations of folates generally increased

from 2 wk after calving to reach a plateau at 8 wk of lactation, except for M-B9+B12+ cows, for

which a plateau was reached earlier, at 4 wk of lactation.

Hepatic concentrations of vitamin B12 were increased by vitamin B12 supplements; 0.94,

0.90 and 1.10 ± 0.02 μg/g of fresh tissue for B9-B12-, B9+B12- and B9+B12+ cows, respectively (P

= 0.001; Tableau 7). Nevertheless, Met supply modified the response to vitamin supplementation

(Met × vitamin interaction, P = 0.03; Tableau 7). For control cows (P = 0.02) and cows injected

160

with folic acid and vitamin B12 together (P = 0.002), liver concentrations of vitamin B12 were

higher in M- than M+ cows whereas there was no such effect in cows treated with B9+B12- (P =

0.63).

Biotin concentrations in liver tended to change according to vitamin supplementation (P =

0.07; Tableau 7). Hepatic concentrations of biotin tended to be higher (P = 0.08) for B9+B12-

(16.2 ± 0.15 µg/g fresh tissue) than for B9+B12+ (15.8 ± 0.15 µg/g fresh tissue) but did not differ

(P = 0.19) from B9-B12- (15.9 ± 0.15 µg/g fresh tissue).

V-5.2 Lipids

Hepatic concentrations of total lipids decreased as lactation progressed (time, P < 0.0001),

from 7.52, 5.76, 3.78 to 3.23 ± 0.31 g/100 g of fresh tissue at 2, 4, 8 and 16 wk of lactation,

respectively. Hepatic concentrations of CE, TG, DG, Ch and PE followed a similar pattern (time,

P < 0.0002), only PC concentrations in liver tended to increase during the experimental period

(time, P = 0.07, data not shown).

Dietary supplements of RPM increased liver concentrations of TG from 1.81 to 2.63 ±

0.32 g/100 g of fresh tissue (P = 0.02, Tableau 7). The response in liver concentrations of PE to

vitamin injections differed according to the level of Met supplementation (Met × vitamin, P =

0.009; Tableau 7). Indeed, B-vitamin injections, as folic acid alone or with vitamin B12, increased

(P = 0.007) concentrations of PE in liver of cows fed RPM but had no effect (P = 0.6) in M-

cows. Liver concentrations of CE, DG (fractions 1 and 2), Ch, PC and total lipids were not

affected by treatments (P > 0.2; Tableau 7).

V-5.3 Gene expression of BHMT, GNMT, MS, MTHFR, MTP, MTRR, MMCoA

and PEMT

Vitamin supplements affected gene expressions of MTHFR (0.84, 0.92 and 1.03 ± 0.07, P

= 0.02) and MUT (1.02, 1.12 and 1.17 ± 0.08, P = 0.01; Tableau 7) for B9-B12-, B9+B12- and

B9+B12+ cows, respectively. The relative mRNA abundance of MTHFR gene was higher for

B9+B12+ than for B9-B12- (P = 0.006) and B9+B12- cows (P = 0.1) but the last two treatments

were not different (P = 0.3). Compared to control cows, supplementary folic acid combined with

161

vitamin B12 increased (P = 0.004) MUT relative mRNA abundance whereas supplementary folic

acid given alone only tended to increase it (P = 0.06).

In M- cows, expressions of MTHFR, MTP and PEMT transcripts were lower by 13 (P =

0.02), 8 (P = 0.05) and 6 (P = 0.10) % compared with cows fed the basal diet supplemented with

RPM (Tableau 7). The relative mRNA abundance of MS and MTRR genes was not affected by

treatments (P > 0.2; Tableau 7).

Ingestion of RPM modified the relative mRNA abundance of MTP, MTHFR and BHMT

genes according to the stage of lactation (Met × time interaction, P < 0.10 for MTP and MTHFR

and P = 0.03 for BHMT). Overall, the transcript abundance of these genes decreased throughout

the experimental period but was lower at 2 and 16 wk of lactation for M- cows. GNMT mRNA

levels tended to change with time according to vitamin supply (vitamin × time interaction, P =

0.06; Figure 31). There was no effect (P ≥ 0.5) of vitamin supplementation on the GNMT relative

mRNA abundance in liver at 2, 4 and 8 wk of lactation but it increased (P = 0.002) at 16 wk of

lactation in cows injected with vitamins, especially in B9+B12+ cows.

The relative mRNA abundance of PEMT gene decreased throughout the experimental

period (time, P < 0.0001), whereas MS gene transcripts increased moderately from 2 to 8 wk of

lactation but decreased thereafter (time, P = 0.0003). There was no variation of MTRR and MUT

transcript abundance throughout the experimental period (P > 0.11).

V-5.4 Gluconeogenesis and protein synthesis

The capacity of liver slices to convert [2-14C]-propionate in glucose was not modified by

treatments (P > 0.5; Tableau 8) but it decreased throughout the studied period (P = 0.03); 1,003.6

± 26.4, 947.4 ± 25.0, 925.7 ± 25.3 and 902.4 ± 25.5 nmol/(g wet weight × h) at 2, 4, 8 and 16 wk

of lactation, respectively.

The incorporation of [35S]-cysteine into total precipitate cellular and medium proteins

tended to be altered by vitamin supplementation differently according to time after calving

(vitamin × time interaction, P = 0.07; Tableau 8). Two wk after calving, protein synthesis was

higher in cows injected with folic acid and vitamin B12 (P = 0.05) but this difference disappeared

later in lactation (P ≥ 0.18). The rate of protein synthesis, in nmol/(g fresh tissue × h), was 51.6,

58.7, 51.7 and 66.5 ± 4.3 for B9-B12-, 55.1, 48.6, 44.5 and 57.4 ± 4.3 for B9+B12- and 65.7, 50.0,

48.5 and 59.8 ± 4.4 for B9+B12+, at 2, 4, 8 and 16 wk of lactation, respectively.

162

V-6 DISCUSSION

V-6.1 B-vitamin status

In the present experiment, as previously observed by Graulet et al. (2007), folic acid and

vitamin B12 supplements increased concentrations of these vitamins in liver of dairy cows.

Nevertheless, independent of vitamin supply and as previously observed in steers (Lambert et al.,

2002), hepatic concentrations of folates decreased with Met supplementation. Similarly, while

studying the effect of vitamin B12 severe deficiency in sheep, Smith et al. (1974) observed that in

pair-fed sheep not deficient in vitamin B12, supplementary Met decreased hepatic concentrations

of folates, especially the 5-methyl-tetrahydrofolate.

In the present experiment, in cows injected with folic acid and vitamin B12 together,

hepatic concentrations of vitamin B12 tended to be higher in M- than M+ cows whereas plasma

vitamin B12 followed the opposite pattern (Preynat et al., 2009a, Chapitre III). In cells, vitamin

B12 is bound to proteins, the two vitamin B12-dependent enzymes, MS and MUT (Combs, 1998).

These observations indicate an increased cellular retention of vitamin B12 in the liver when the

supply in preformed labile methyl groups was limited possibly linked to an increased need for

Hcy remethylation as MS activity is regulated by vitamin B12 (Oltean and Banerjee, 2003 and

2004).

Another B-vitamin, biotin, also acts as a coenzyme for two gluconeogenic enzymes:

pyruvate carboxylase and propionylCoA carboxylase (Combs, 1998). Greenfield et al. (2000)

observed that the activity of the pyruvate carboxylase enzyme increased in the liver of dairy cows

in early lactation. One can suspect that such change should increase the cow requirement for

biotin. However, if this is the case, it was not reflected in the current experiment, neither for

plasma (Preynat et al., 2009a, Chapitre III) nor hepatic concentrations of biotin, which did not

change from 2 to 16 wk of lactation. The injections of folic acid alone tended to increase liver

concentrations of biotin by 2% but the physiological significance of such change is not clear.

V-6.2 The methylation cycle

The role of the methylation cycle is to ensure a constant supply in SAM which is a methyl

donor in numerous metabolic reactions, such as formation of PC, creatine and DNA methylation

163

(Scott, 1999). In this cycle, the role of folate coenzymes is to provide one-carbon units for de

novo formation of methyl groups. Consequently, tetrahydrofolate (THF) can accept one-carbon

units and form 5,10-methylene-THF which, under the action of MTHFR, will be irreversibly

converted into 5-methyl-THF (Bailey and Gregory, 1999). MTHFR is allosterically inhibited by

the product of the methylation cycle, SAM (Jencks and Matthews, 1987; Yamada et al., 2005).

Consequently, conditions increasing methyl group supply should inhibit the enzyme activity.

However, in the current experiment, increasing the supply of preformed labile methyl groups,

such as Met, or folic acid and vitamin B12 supply, essential for methylneogenesis, increased the

mRNA abundance of MTHFR. There are few studies on nutritional factors affecting mRNA

levels of MTHFR. Only the study from Tchantchou et al. (2006) reported that both mRNA

concentration and enzymatic activity of MTHFR in brain cells were increased in response to

folate deprivation in mice. Accordingly, the current observations suggest the following

hypotheses that either gene expression and activity of this enzyme are negatively correlated in

cows or that, under our experimental conditions, intracellular concentrations of SAM were not

sufficient to inhibit MTHFR gene expression and, possibly activity, even in animals

supplemented with Met and/or vitamins.

The second reaction related to the methylation cycle involves the enzyme, MS. In this

reaction, the 5-methyl-THF resulting from the MTHFR reaction transfers its methyl group to

vitamin B12 coenzyme which acts as an intermediary transporter to transfer this group to Hcy,

thus forming Met. In the present experiment, neither vitamin supplements nor RPM affected gene

expression of MS. In dairy cows, Graulet et al. (2007) also did not observe changes in mRNA

abundance and activity of MS in response to dietary supplements of folic and vitamin B12, given

alone or in combination. This is in agreement with observations from Gulati et al. (1999) who

demonstrated that regulation of MS activity is not a function of changes in mRNA abundance or

conversion of the apoenzyme into holoenzyme. The regulation of MS rather occurs through an

improved translational efficiency modulated by vitamin B12 as also recently reported by Oltean

and Banerjee (2003 and 2004).

A functional deficiency in MS can also occur. Indeed, as described previously, MS

catalyzes the transfer of the methyl group from 5-methyl-THF to the vitamin B12 cofactor and

then, to Hcy for regeneration of Met and THF. The vitamin B12 cofactor is under the form of

cob(I)alamin but, after successive cyclings, it may be oxidized in cob(II)alamin causing the

164

inactivation of MS. Regeneration of the enzyme activity requires a reductive methylation which

is catalyzed by MTRR and is using SAM as a methyl group donor (Olteanu and Banerjee, 2001).

In the present study, the observed stable expression of MTRR possibly indicates that oxidation of

cob(I)alamin did not differ among treatments and time after calving and suggests that availability

of this enzyme was not limiting the functionality of MS during the experimental period.

Remethylation of Hcy can also occur through BHMT, a methyltransferase which

catalyzes the transfer of a methyl group from betaine, a product of choline oxidation, to Hcy for

Met regeneration. An in vitro study suggests that, in rat liver, MS and BHMT contributed equally

to the remethylation of Hcy (Finkelstein and Martin, 1984). In rat liver, the response of BHMT

activity to Met restriction and dietary supply of other methyl donors is due to changes in gene

expression of the enzyme (Park and Garrow, 1999). Nevertheless, in ruminants, regulation of

BHMT activity differs markedly from non-ruminants. In dairy ruminants, availability of choline

from dietary supply is low due to its extensive degradation in rumen (Sharma et Erdman, 1989)

while the output of methylated compounds to milk is particularly high. Xue and Snoswell (1986)

demonstrated that the activity of BHMT is more than 5 times lower in liver of sheep than rats.

Moreover, the activity of this enzyme is not increased during lactation in ewes in spite of the

increased demand for methyl groups (Xue and Snoswell, 1985). Similarly, there was no recovery

of labelled-choline in the Met pool in lactating goats, indicating that in ruminants, the role of

BHMT would be negligible for Hcy remethylation (Emmanuel and Kennelly, 1984). In growing

steers, BHMT activity changed quadratically with an increased Met supply, the higher activity

being observed with the lowest and the highest Met supply (Lambert et al., 2002). In the present

experiment, gene expression of BHMT was not influenced markedly by treatments although it

was higher in cows fed RPM, at 2 and 16 wk after calving. Even assuming that changes in gene

expression of the enzyme is directly related to its activity in cows, given that plasma

concentrations of Hcy were not affected by RPM (Preynat et al., 2009a, Chapitre III) and the

limited role of BHMT in the transmethylation pathway in ruminants, the physiological

significance of these changes is difficult to estimate.

In non-ruminants, the major reactions of methylations are synthesis of PC through PEMT,

creatine through guanidinoacetate N-methyltransferase and sarcosine through GNMT (Mudd et

al., 2007). Utilization of methyl groups by the former two methyltransferases is limited by the

physiological need for their product but it is not the case for GNMT which acts as a “safety

165

valve” to avoid methyl group excess (Luka et al. 2007). In the present experiment, in order to

study the impact of increasing provision of preformed labile methyl groups or promoting

methylneogenesis by folic acid and vitamin B12 supply, gene expression of PEMT and GNMT

were studied.

Through 3 successive methylations, PEMT allows PE to form PC (Vance et al., 2007). PC

is essential for the structural integrity of cell membranes, is secreted into bile and is a constituent

of plasma lipoproteins (Jacobs et al., 2005), this last function being important in lactating

ruminants, due to the increased demand for milk fat synthesis (Emmanuel and Kennelly, 1984).

In the present study, the level of PEMT mRNA tended to increase with Met supplements. Jacobs

et al. (2005) reported that Met supply affects PEMT gene expression and activity. In addition, it

appears that an increased gene expression of PEMT is associated with an increase in protein

abundance and enzyme activity (Resseguie et al., 2007). However, in the current study, even if

the trends of RPM to increase gene expression of PEMT could have been associated with changes

in the enzyme activity, hepatic concentrations of PC were not affected by supplementary Met.

Nevertheless, we cannot rule out that this lack of effect was due to an increased exportation of PC

from the liver. B-vitamin supplements had no effect on gene expression of PEMT or hepatic

concentrations of PC. However, vitamin supplements increased hepatic concentrations of PE in

cows fed RPM while they had no effect in M- cows. It could then be hypothesized that the

increased concentrations of PE in liver of M+ cows injected with folic acid, with or without

vitamin B12, were due to an increased rate of formation of PE rather than a decrease in

methylation of PC. In rats, choline deficiency delayed PE synthesis (Lyman et al., 1973). Such

result could be explained by the fact that PE in cells can be formed from phosphatidylserine

which is synthesized by base-exchange reaction from either PC or PE. The enzyme using PC as

substrate is more widely expressed in murine tissues than the one using PE (Vance and Vance,

2004). In ruminants, the turnover rate of the choline moiety of PC is generally low as an

adaptation mechanism to poor methyl supply (Snoswell and Xue, 1987). However, it can be

hypothesized that, under conditions increasing methyl group supply, such as Met, folic acid and

vitamin B12 supplementations, the increase in PE concentrations could be due to an increased

turnover rate of PC, which promotes formation of phosphatidylserine and then, of PE.

The role of GNMT is to maintain a constant SAM:S-adenosylhomocysteine (SAH) ratio.

When methyl group supply is low, GNMT is inhibited to conserve methyl groups for

166

metabolically important methylation reactions (Finkelstein, 1990). Sarcosine has no known

metabolic function but it can be rapidly metabolized to provide an one-carbon unit to form 5,10-

methylene-THF (Brosnan and Brosnan, 2006). Indeed, in liver, Met availability, both from the

diet and the folate dependent one-carbon pool, modulates GNMT activity directly via SAM

(Rowling et al., 2002) and indirectly, through 5-methyl-THF (Balaghi et al., 1993; Luka et al.,

2007). In ewes, lactation increases PEMT activity while decreasing GNMT activity (Xue and

Snoswell, 1985) although the later probably has less physiological importance in ruminants due

to the low dietary supply in methyl groups. Indeed, GNMT activity in sheep liver is less than

0.5% of its activity in rat liver (Xue and Snoswell, 1986). Nieman et al. (2006) showed that

mRNA and protein abundance of GNMT were related with its enzymatic activity. Therefore, the

increase of GNMT mRNA abundance observed in cows receiving folic acid with or without

vitamin B12 at the end of the studied period could be due to an increased SAM:SAH ratio.

Nevertheless, in the present experiment, in spite of some effects of RPM supplements on

gene expression of enzymes involved in the methylation cycle, such as MTHFR, BHMT and

PEMT, increasing Met supply had no effect on plasma concentrations of Hcy or lactational

performance as reported by Preynat et al. (2009a, Chapitre III). However, the decrease in plasma

concentrations of Hcy induced by injections of folic acid alone or combined with vitamin B12,

irrespective of the level of Met added to the diet (Preynat et al., 2009a, Chapitre III) indicated

that folic acid supply altered the efficiency of the methylation cycle. As supplementary vitamin

B12 had no additional effect on plasma Hcy, supply of this vitamin in the current study was likely

sufficient not to negatively interfere with this metabolic pathway. Nevertheless, in cows used in

the present experiment, RPM and folic acid supplements alone had no effect on milk and milk

component yields (Preynat et al., 2009a, Chapitre III). Consequently, it seems that the effects of

Met supply and supplementary folic acid on the methylation cycle did not have a significant

effect on lactational performance of dairy cows.

V-6.3 Gluconeogenesis, energy and protein metabolism

A previous study showed that in early lactation, supplementary folic acid, given alone or

in combination with vitamin B12, increased milk and milk protein yields without any effect on

DMI (Graulet et al., 2007). However, surprisingly, cows fed supplementary folic acid alone had

higher hepatic concentrations of lipids than those fed folic acid and vitamin B12 together. The

167

authors hypothesized that this effect could be related to the other vitamin B12-dependent enzyme,

MUT. This enzyme isomerizes methylmalonyl-CoA (MMCoA) in succinyl-CoA and is essential

for the entry of propionate in the Krebs cycle and its utilization for gluconeogenesis (Le Grusse

and Watier, 1993). Moreover, MMCoA acts as an interface in the regulation of gluconeogenesis

and β-oxidation (Zammit, 1990). However, when vitamin B12 supply is not sufficient,

isomerisation of MMCoA is reduced leading to its accumulation and inhibition of β-oxidation of

fatty acids, even if gluconeogenesis is reduced. Indeed, in early lactation, the increased energy

requirements for maintenance and lactation, simultaneously to underfeeding, contribute to an

intensive body fat mobilization, which increased hepatic concentrations of total lipids and TG

(Bobe et al., 2004). In contrast to Graulet et al. (2007), in the present experiment, supplementary

folic acid had no effect on hepatic concentrations of TG or total lipids as well as no effect on milk

and milk component yields (Preynat et al., 2009a, Chapitre III).

Another contributing factor to the accumulation of TG in dairy cow liver is the slow rate

of TG export as very low density lipoprotein (VLDL). The limited VLDL secretion by bovine

liver could be due to a limiting step in VLDL assembly (Graulet et al., 1998) or, as hypothesized

by Bauchart (1993), by a lack of availability of VLDL constituents. Met could be a limiting

nutrient for hepatic metabolism of fatty acids during the periparturient period as a limiting AA for

apolipoprotein synthesis or as a methyl donor for PC synthesis, an essential component of VLDL

particles (Grummer, 1993; Noga et al., 2002; Shibano and Kawamura, 2005). As stated by

Bernabucci et al. (2004), synthesis of VLDL requires TG, PL, Ch, CE, apolipoprotein (B100, C

and E) and an enzyme, MTP which plays a fundamental role in coordinating the assembly of

VLDL. Although, in the present experiment, supplementary Met increased gene expression of

MTP and hepatic TG, these changes should be interpreted with caution because in periparturient

cows developing fatty liver, the increase of MTP mRNA was not correlated with liver TG,

plasma NEFA or VLDL particles and MTP protein and activity (Bremmer et al., 2000;

Bernabucci et al., 2004).

In the present study, supplementary Met also increased hepatic concentrations of TG.

However, the extent of this increase was somewhat limited as hepatic concentrations of 6.2 and

3.8 g of TG per 100 g of fresh tissue were measured in M+ cows, at 2 and 4 wk of lactation

respectively, which correspond to a mild fatty liver (Bobe et al., 2004). Moreover, from 8 wk

after calving, liver TG concentrations decreased below 1 g of TG per 100 g of fresh tissue, (0.6

168

and 0.3 g of TG per 100 g of fresh tissue at 8 and 16 wk of lactation, respectively in cows fed

RPM), considered the limit for normal liver (Bobe et al., 2004). The slightly higher accumulation

of fatty acids in liver of M+ cows is in accordance with a small loss of BW in early lactation and

the decrease in plasma glucose (Preynat et al., 2009a, Chapitre III).

The in vitro capacity of liver tissue for conversion of [2-14C]-propionate to glucose was

greater, 2 wk after calving and was not affected by Met supply. Therefore, it seems that the level

of TG infiltration in liver observed in early lactation in cows fed RPM and in spite of effects on

plasma glucose (Preynat et al., 2009a, Chapitre III), was not sufficient to impair significantly

gluconeogenic capacity of hepatic cells as previously reported (Cadorniga-Valino et al., 1997;

Piepenbrink et al., 2004).

In the present experiment, gene expression of MUT was increased by B-vitamin

supplements as compared to unsupplemented cows and this increase was greater in cows injected

with the two vitamins together although no effect of vitamin injections on in vitro capacity of

liver tissue for gluconeogenesis was detected. However, at 12 wk of lactation, whole body flux of

glucose tended to be higher in cows injected with folic acid and vitamin B12 together as compared

to the control cows, this increase being of a similar quantitative magnitude as the observed

increment in milk lactose yield (Preynat et al., 2009b, Chapitre IV). Although folic acid is not

known to participate in the MUT pathway, Graulet et al. (2007) observed no effect of

supplementary folic acid and/or vitamin B12 on gene expression of MUT or its activity but the

requirement of the enzyme for the cofactor, vitamin B12, decreased in cow liver when the two

vitamins were given together, improving the efficiency of this metabolic reaction. Selhub et al.

(2007) also observed in humans that when the supply in vitamin B12 is considered adequate,

plasma concentrations of methylmalonic acid are inversely proportional to folate supply. In cell

culture, inactivation of MS reduces MUT holoactivity by decreasing cellular concentrations of

adenosylcobalamin, the vitamin B12 cofactor for MUT (Riedel et al., 1999). These observations

indicate that the effect of folic acid supply on MUT was possibly linked to a coordination of the

distribution of cobalamin cofactor between cytosol (MS) and mitochondria (MUT). Although in

the present experiment, the effects of vitamin B12 given alone were not studied, the observed

effects of supplementary folic acid and vitamin B12 given together on mRNA abundance of MUT

as well as on whole body flux of glucose at 12 wk of lactation (Preynat et al., 2009b, Chapitre

169

IV) indicate that administration of the two vitamins together could improve gluconeogenesis

efficiency.

In vitro protein synthesis was higher in liver tissue of cows injected with the two vitamins

together at 2 wk of lactation although this effect was not apparent later in lactation. This is in

agreement with observations from Preynat et al. (2009a, Chapitre III) who reported an increased

milk protein yield with the combined injections of the two vitamins, especially during the first

wks following calving.

V-7 CONCLUSION

In the current study, gene expressions of hepatic enzymes closely involved in the

methylation cycle were modified by Met supply. Cellular utilization of folates and vitamin B12 in

liver was also modified when the supply in labile preformed methyl groups was limited.

Simultaneous administration of folic acid and vitamin B12 also affect MUT, a gene linked to

gluconeogenesis.

On the cows studied in the present experiment, Preynat et al. (2009a, Chapitre III)

observed that the cellular effects of supplementary folic acid translated by a decrease in plasma

concentrations of Hcy although there was no effect of RPM or folic acid, when given alone on

lactational performance. These observations combined with those of the present experiment

indicate that an increase in methyl group supply, preformed or from methylneogenesis, affect the

efficiency of the methylation cycle but had by themselves a limited impact on milk component

yields. Therefore, the increased milk production and milk component yields reported in cows

supplemented with folic acid and vitamin B12 together (Preynat et al., 2009a, Chapitre III) seem

to be rather related to the effect of the vitamins on the increased gene expression of MUT. This

observation is further supported by the increased whole body fluxes of glucose observed in cows

supplemented with folic acid and vitamin B12 together as compared to unsupplemented cows

(Preynat et al., 2009b, Chapitre IV). Therefore, it seems that the effects of the combined

supplement of vitamins on lactational performance were due to an improved efficiency of glucose

metabolism rather than an effect on methylneogenesis.

170

V-8 ACKNOWLEDGMENTS

The authors thank Dominique Bauchart (Institut National de la Recherche Agronomique,

Theix, France) who welcomed A. Preynat in his laboratory and provided expertise for hepatic

lipid analysis. We are also grateful to Eric Martineau, DMV, who performed liver biopsies;

Guylaine Fortin, Michel Poitras and Jean Vallières for animal care, Chrystiane Plante, Véronique

Roy, Linda Marier and Danielle Beaudry for technical assistance, and to Steve Méthot for

statistical advices. Thanks are also extended to the financial support of the Action Concertée

Fonds NOVALAIT inc.– FQRNT - MAPAQ – Agriculture et Agroalimentaire Canada.

171

Tableau 12. Primer sequences and optimal conditions for PCR of bovine selected genes

Primer Primer sequences (5'-3' )3 Primer GenBank Length Annealing name 1 position (nt) accession no. (bp) T (ºC)

Cloning2 BHMT-F CAGTTCGYCAGCTTCATCGRGAG 218-240 AY854632 489 50 BHMT-R GGCAGTTCACRCCRAYRATGGAKG 706-683 MTHFR-F TGGARACCATCCTGCAYATGA 553-573 AY854631 612 50 MTHFR-R CGCGGTTGAGGGTRTAGAAG 1164-1145 MTRR-F GTKCCAATTTCAAARGCMRTT 831-851 DQ084520 516 50 MTRR-R TTTAGGAAGRTGYTCSAGCAG 1346-1326 Race BHMT-5' ATGCTTTCAAGGCTTCAACTGCC 583-561 AY854632 583 BHMT-3' CATGCAGACCTTCACCTTCTATG 264-286 1602 MS-5' TTCCTGTCTGGAGAGAGATGTCC 433-411 DQ084519 433 MS-3' CGGCACAAGCTGAGTGAAGAAGA 148-170 nt 3685 MTHFR-5' TTGCGGATGGCAGCATCATTGT 1075-1054 AY854631 1075 MTHFR-3' CTGGAGGTGCCACAGCAGATCA 1008-1029 1593 MTRR-5' CTGCTGCACAGCTCCTGCAGCC 1225-1204 DQ084520 1225 MTRR-3' GTGACGATTAAGGCAGACACGAG 1032-1054 1121 Real-Time PCR2 ACTB-F GCGTGGCTACAGCTTCACC 624-642 AY141970 54 60 ACTB-R TTGATGTCACGGACGATTTC 677-658 BHMT-F TGTCAAGAAGGGCATCCTAGAAC 78-100 AY854632 70 58 BHMT-R AAAGACAAACCCTCCGTCTCC 147-127 CYCLO-F GAGCACTGGAGAGAAAGGATTTG 124-146 AF228021 71 60 CYCLO-R GGCACATAAATCCCGGAATTATT 194-172 GAPDH-F TGACCCCTTCATTGACCTTCA 66-86 BTU85042 66 60 GAPDH-R AACTTGCCGTGGGTGGAAT 131-113 GNMT-F GTGACAAGATGCTGAAGTATGCTCTC 263-288 XM_618409 71 59 GNMT-R CCACTTGTCAAAGGCAGGGT 333-314 GUSB-F ATCGGCAGCGCCCACTACT 414-432 NM_001083436 65 60 GUSB-R CCCTCGTGCTCTAACACATGGAC 478-456 MUT-F CGAATTGCCAGGAACACACA 1392-1411 NM_173939 70 59 MUT-R CCCAAGGATCAGCCACTTTG 1461-1442 MS-F CAAATCCATAAGGAGTACCTCCTAGC 259-284 DQ084519 76 59 MS-R GGGCAATAGAAGTGCTGCTGA 334-313 MTHFR-F CATCATCACCCAGCTATTCTTTGA 860-883 AY854631 76 59 MTHFR-R GGTAATGCCTATCTCGGAGCAA 935-914 MTP-F GGTCCGTCAAGTTCTGAAGGAA 1757-1778 BRTMTP1 69 59 MTP-R GAGGAGGACCCACTCTTGGAG 1825-1805 MTRR-F TCTTCTGATAGAGTTGGACATCTCGA 884-909 DQ084520 80 59 MTRR-R TGTTGGGACAGATCACGTTGA 963-943 PEMT-F GCTGTCCTTGCCATTGTCTTC 513-533 NM_182989 69 58 PEMT-R TCGGGTCTTGTGTTCCCATC 581-562

1 ACTB, actin beta; BHMT, betaine homocysteine methyltransferase; CYCLO, cyclophiline; GAPDH, glyceraldehyde-3-phosphate deshydrogenase; GNMT, glycine N-methyltransferase; GUSB, beta-glucuronidase; MUT, methylmalonyl-CoA mutase; MS, methionine synthase; MTHFR, 5,10-methylene-tetrahydrofolate reductase; MTP, microsomal transfer protein; MTRR, methionine synthase reductase and PEMT, phosphatidylethanolamine methyltransferase

172

2 F = forward primer; R = reverse primer 3 Degerated primers where M= A or C, R= A or G, Y= C or T, K= T or G, S= C or G

173

Tableau 13. Effects of dietary supplements of rumen-protected methionine (M) and intramuscular injections of folic acid (B9) and vitamin B12 (B12) given to dairy cows from 3 wk before calving to 16 wk of lactation on liver concentrations of B vitamins, lipid fractions and relative mRNA abundance of selected genes

Treatments1 P values

M+ M-

B9-B12- B9+B12- B9+B12+ B9-B12- B9+B12- B9+B12+ SEM2 met vit met*vit

n 10 10 10 10 10 10 Vitamins, μg/g fresh tissue

Folates3 6.4 10.2 10.0 7.0 10.5 10.8 0.4 0.03 0.001 0.63

Vitamin B12 0.91 0.91 1.05 0.98 0.89 1.15 0.03 0.004 0.001 0.03

Biotin 15.8 16.1 16.0 15.9 16.4 15.5 0.21 0.99 0.07 0.27

Lipids, g/100 g fresh tissue4

CE5 0.112 0.113 0.125 0.111 0.096 0.112 0.012 0.21 0.27 0.61

TG5 3.08 1.96 2.86 1.53 1.88 2.02 0.49 0.02 0.46 0.24

DG15 0.080 0.077 0.090 0.080 0.073 0.090 0.010 0.86 0.18 0.95

DG25 0.481 0.434 0.480 0.470 0.467 0.477 0.028 0.77 0.51 0.68

Ch5 0.179 0.190 0.194 0.192 0.173 0.181 0.009 0.42 0.79 0.11

PE5 0.518 0.578 0.620 0.526 0.517 0.487 0.0261 0.001 0.33 0.009

PC5 1.88 1.79 1.76 1.80 1.83 1.75 0.08 0.83 0.61 0.74

Total lipids5 5.34 4.86 4.64 5.22 4.36 6.02 0.52 0.54 0.29 0.16

Relative mRNA abundance6

BHMT7 0.98 0.97 1.07 0.86 0.97 0.94 0.09 0.17 0.52 0.61

GNMT8 0.48 0.75 0.73 0.55 0.70 0.70 0.15 0.99 0.19 0.87

MS5 0.84 0.89 0.96 0.81 0.92 0.78 0.07 0.26 0.45 0.23

174

MTHFR7 0.95 0.96 1.08 0.73 0.88 0.98 0.08 0.02 0.02 0.47

MTP7 1.2 1.16 1.24 1.03 1.16 1.12 0.11 0.05 0.60 0.35 MTRR 0.96 1.02 1.03 0.9 0.94 0.98 0.10 0.19 0.44 0.98 MUT 1.1 1.12 1.16 0.93 1.12 1.18 0.09 0.20 0.01 0.16

PEMT5 1.15 1.19 1.17 1.05 1.14 1.12 0.07 0.10 0.48 0.83

1M-: basal diet; M+: basal diet with rumen-protected Met; B9-B12-: no vitamin supplement; B9+B12-: 160 mg folic acid/wk; B9+B12+: 160 mg mg folic acid/wk + 10 mg cyanocobalamin/wk. 2SEM = standard error of the mean. 3Methionine x vitamin x time, P = 0.002. 4CE: cholesterol ester, TG: triglycerides, DG: diglycerides, fractions 1 and 2, Ch: cholesterol, PE: phosphatidylethanolamine, PC: phosphatidylcholine. 5Time effect (2, 4, 8 and 16 wk of lactation), P ≤ 0.07. 6Relative mRNA abundance of selected genes normalized with GAPDH (glyceraldehyde-3-phosphate deshydrogenase) as housekeeping gene. BHMT, betaïne homocysteine methyltransferase; GNMT, glycine N-methyltransferase; MUT, methylmalonyl-CoA mutase; MS, methionine synthase; MTHFR, 5,10-methylene-tetrahydrofolate reductase; MTP, microsomal transfer protein; MTRR, methionine synthase reductase and PEMT, phosphatidylethanolamine methyltransferase. 7Methionine x time, P ≤ 0.10. 8Vitamin x time, P ≤ 0.06.

175

Tableau 14. In vitro estimation of the capacity of cow liver for gluconeogenesis by the conversion of [2-14C]-propionate to glucose and protein synthesis by incorporation of [35S]-cysteine according to Met (M), folic acid (B9) and vitamin B12 (B12) supplements given from 3 wk before calving to 16 wk of lactation

Treatments1 P values

M+ M-

B9-B12- B9+B12- B9+B12+ B9-B12- B9+B12- B9+B12+ met vit met×vit

n 10 10 10 9 9 10 Gluconeogenesis2, nmol/(g wet weight × h)

946.7 938.4 933.2 916.2 991.8 942.3 0.71 0.59 0.49

± 34.5 ± 33.9 ± 35.4 ± 36.1 ± 35.8 ± 34.9 Protein synthesis3, nmol/(g wet weight × h)

58.0 53.9 54.1 56.2 48.9 57.9 0.71 0.17 0.38

± 3.4 ± 3.4 ± 3.4 ± 3.5 ± 3.5 ± 3.4

1M-: basal diet; M+: basal diet with rumen-protected Met; B9-B12-: no vitamin supplement; B9+B12-: 160 mg folic acid/wk; B9+B12+: 160 mg folic acid/wk + 10 mg cyanocobalamin/wk. 2Time effect (2, 4, 8 and 16 wk of lactation), P = 0.03. 3Vitamin x time, P = 0.07.

176

Figure 29. Folate and vitamin B12-dependent pathways and methylation cycle.

Ket enzymes : 1- Methionine adenosyltransferase 2- Phosphatidylcholine methyltransferase 3- Glycine N-methyltransferase 4- S-Adenosylhomocysteine hydrolase 5- Methionine synthase 6- Methionine synthase reductase 7- 5,10-methylenetetrahydrofolate reductase 8- Betaïne methyltransferase 9- Cystathionine beta-synthase 10- Cystathionine beta-lyase 11- Methylmalonyl-CoA mutase

177

MS-B12(III)-CH3

MS-B12(I)

méthionine

homocystééine

5,10-CH2THF

THF

5-MTHF

MS-B12(II)

bétaïne

Diméthyl-l i

Sarcosine

Sérine

PS

PE

SAM

SAH

PC

Sarcosine

Glycine

Cystathionine

Cystéine

α-ketobutyrate Propionyl-CoA

Méthylmalonyl-CoA

Succinyl-CoA Cycle de Krebs

Choline

CDP-choline

PC

DAG

CTP

1

protéines ATP

2

3

4

5

7

5

6

9

10 11

8

178

Figure 30. Effects of dietary supplements of rumen-protected methionine (M) and intramuscular injections of folic acid (B9) and vitamin B12 (B12) given to dairy cows from 3 wk before calving to 16 wk of lactation on liver concentrations of folates. The solid lines represent cows fed 18 g of RPM (M+) and the dotted lines represent cows without Met supplements (M-). B9-B12- (▲) = no vitamin supplement; B9+B12- (●) = 160 mg of folic acid/wk; B9+B12+ (□) = 160 mg of folic acid/wk + 10 mg of vitamin B12/wk (SE = 0.55; Met × vitamin × time, P = 0.002)

5

6

7

8

9

10

11

12

13

0 2 4 6 8 10 12 14 16 18

Time after calving (wk)

Liv

er f

olat

es (

µg/

g fr

esh

tissu

e)

179

Figure 31. Effects of dietary supplements of rumen-protected methionine (M) and intramuscular injections of folic acid (B9) and vitamin B12 (B12) given to dairy cows from 3 wk before calving to 16 wk of lactation on GNMT relative mRNA abundance. Gene expression ratio normalized with GAPDH. B9-B12- (▲) = no vitamin supplement; B9+B12- (●) = 160 mg of folic acid/wk; B9+B12+ (□) = 160 mg of folic acid/wk + 10 mg of vitamin B12/wk (SEM = 0.14; vitamin × time, P = 0.06)

0

0,2

0,4

0,6

0,8

1

1,2

1,4

0 2 4 6 8 10 12 14 16 18

Time after calving (wk)

GN

MT

rel

ativ

e m

RN

A a

bund

ance

180

V-9 REFERENCES

Bailey, L. B., and J. F. Gregory. 1999. Folate metabolism and requirements. J. Nutr. 129:779-782.

Balaghi, M., D. W. Horne, and C. Wagner. 1993. Hepatic one-carbon metabolism in early folate deficiency in rats. Biochem. J. 291:145-149.

Bauchart, D. 1993. Lipid absorption and transport in ruminants. J. Dairy Sci. 76:3864-3881.

Bernabucci, U., B. Ronchi, L. Basirico, D. Pirazzi, F. Rueca, N. Lacetera, and A. Nardone. 2004. Abundance of mRNA of apolipoprotein B100, apolipoprotein E and microsomal triglyceride transfer protein in liver from periparturient dairy cows. J. Dairy Sci. 87:2881-2888.

Bills, N. D., M. J. Koury, A. J. Clifford and E. N. Dessypris. 1992. Ineffective hematopoiesis in folate-deficient mice. Blood. 79:2273-2280.

Bobe, G., J. W. Young, and D. C. Beitz. 2004. Invited review: pathology, etiology, prevention, and treatment of fatty liver in dairy cows. J. Dairy Sci. 87:3105-3124.

Bremmer, D. R., S. J. Bertics, S. A. Besong, and R. R. Grummer. 2000. Changes in hepatic microsomal triglyceride transfer protein and triglyceride in periparturient dairy cattle. J. Dairy Sci. 83:2252-2260.

Brosnan, J. T., and M. E. Brosnan. 2006. The sulphur-containing amino acids: an overview. J. Nutr. 136:1636S-1640S.

Brosnan, J. T., M. E. Brosnan, R. F. P. Bertolo and J. A. Brunton. 2007. Methionine: a metabolically unique amino acid. Livest. Sci. 112:2-7.

Bustin, S. A. 2000. Absolute quantification of mRNA using real-time reverse transcription polymerase chain reaction assays. J. Mol. Endocrinol. 25:169-193.

Bustin, S. A. 2002. Quantification of mRNA using real-time reverse transcription PCR (RT-PCR): trends and problems. J. Mol. Endocrinol. 29:23-39.

Cadorniga-Valino, C., R. R. Grummer, L. E. Armentano, S. S. Donkin, and S. J. Bertics. 1997. Effects of fatty acids and hormones on fatty acid metabolism and gluconeogenesis in bovine hepatocytes. J. Dairy Sci. 80:646-656.

Canadian Council on Animal Care. 1993. Guide to the Care and Use of Experimental Animals. 2nd ed. Vol. 1. E.D. Rolfert, B.M. Cross, and A.A. McWilliam, ed. Can. Counc. Anim. Care. Ottawa, Ontario.

Combs, G. F. Jr. 1998. The vitamins. Fondamental aspects in nutrition and health. 2nd edition. San Diego. CA, USA. Academic Press.

Emmanuel, B., and J. J. Kennelly. 1984. Kinetics of methionine and choline and their incorporation into plasma lipids and milk components in lactating goats. J. Dairy Sci. 67:1912-1918.

Finkelstein, J. D. and J. J. Martin. 1984. Methionine metabolism in mammals. Distribution of homocysteine between competing pathways. J. Biol. Chem. 259:9508-9513.

Finkelstein, J. D. 1990. Methionine metabolism in mammals. J. Nutr. Biochem. 1:228-37.

Folch, J., M. Lees, and G. H. Sloane Stanley. 1957. A simple method for the isolation and purification of total lipids from animal tissues. J. Biol. Chem. 226:497-509.

Girard, C. L., and J. J. Matte. 2005. Effects of intramuscular injections of vitamin B12 on lactation performance of dairy cows fed dietary supplements of folic acid and rumen-protected methionine. J. Dairy Sci. 88:671-676.

181

Graulet, B., D. Gruffat, D. Durand, and D. Bauchart. 1998. Fatty acid metabolism and very low density lipoprotein secretion in liver slices from rats and preruminant calves. J. Biochem. 124:1212-1219.

Graulet, B., J. J. Matte, A. Desrochers, L. Doepel, M. F. Palin, and C. L. Girard. 2007. Effects of dietary supplements of folic acid and vitamin B12 on metabolism of dairy cows in early lactation. J. Dairy Sci. 90:3442-3455.

Greenfield, R. B., M. J. Cecava, and S. S Donkin. 2000. Changes in mRNA expression for gluconeogenic enzymes in liver of dairy cattle during the transition to lactation. J. Dairy Sci. 83:1228-1236.

Gruffat-Mouty, D., B. Graulet, D. Durand, M. E. Samson-Bouma, and D. Bauchart. 1999. Apolipoprotein B production and very low density lipoprotein secretion by calf liver slices. J. Biochem. 126: 188-193.

Grummer, R. R. 1993. Etiology of lipid-related metabolic disorders in periparturient dairy cows. J. Dairy Sci. 76:3882-3896.

Gulati, S., L. C. Brody, and R. Banerjee. 1999. Posttranscriptional regulation of mammalian methionine synthase by B12. Biochem. Biophys. Res. Commun. 259:436-442.

Homan, R., and M. K. Anderson. 1998. Rapid separation and quantification of combined neutral and polar lipid classes by high-performance liquid chromatography and evaporative light-scattering mass detection. J. Chromatogr. B. 708:21-26.

Jacobs, R. L., L. M. Stead, C. Devlin, I. Tabas, M. E. Brosnan, J. T. Brosnan, and D. E. Vance. 2005. Physiological regulation of phospholipids methylation alters plasma homocysteine in mice. J. Biol. Chem. 280:28299-28305.

Janovick-Guretzky, N. A., H. M. Dann, D. B. Carlson, M. R. Murphy, J. J. Loor, and J. K. Drackley. 2007. Housekeeping gene expression in bovine liver is affected by physiological state, feed intake, and dietary treatment. J. Dairy Sci. 90:2246-2252.

Jencks, D. A., and R. G. Matthews. 1987. Allosteric inhibition of methyltetrahydrofolate reductase by adenosylmethionine. Effects of adenosylmethionine and NADPH on the equilibrium between active and inactive forms of the enzyme and on the kinetics of approach to equilibrium. J. Biol. Chem. 252:2485-2493.

Lambert, B. D., E. C. Titgemeyer, G. L. Stokka, B. M. DeBey, and C. A. Löest. 2002. Methionine supply to growing steers affects hepatic activities of methionine synthase and betaïne-homocysteine methyltransferase, but not cystathionine synthase. J. Nutr. 132:2004-2009.

Le Grusse, J., and B. Watier. 1993. Les vitamines. Données biochimiques, nutritionnelles et cliniques. Centre d’étude et d’information sur les vitamines, Produits Roche. Neuilly-sur-Seine, France.

Luka, Z., S. Pakhomova, L. V. Loukachevitch, M. Egli, M. E. Newcomer, and C. Wagner. 2007. 5-methyltetrahydrofolate is bound in intersubunit areas of rat liver folate-binding protein glycine N-methyltransferase. J. Biol. Chem. 282:4069-4075.

Lyman, R. L., G. Sheehan, and J. Tinoco. 1973. Phosphatidylethanolamine metabolism in rats fed a low methionine, choline-deficient diet. Lipids. 8:71-79.

McDowell, L. R. 2000. Vitamins in animal and human nutrition. 2nd ed. University Press, Ames, IA, Iowa State.

Mudd, S. H., J. T. Brosnan, M. E. Brosnan, R. L. Jacobs, S. P. Stabler, R. H. Allen, D. E. Vance, and C. Wagner. 2007. Methyl balance and transmethylation fluxes in humans. Amer. J. Nutr. 85:19-25.

Noga, A. A., Y. Zhao, and D. E. Vance. 2002. An unexpected requirement for phosphatidylethanolamine N-methyltransferase in the secretion of very low density lipoproteins. J. Biol. Chem. 277:42358-42365.

National Research Council. 2001. Nutrient Requirements of Dairy Cattle. 7th rev. ed. Natl. Acad. Sci., Washington, DC.

182

Nieman, K. M., C. S. Hartz, S. S. Szegedi, T. A. Garrow, J. D. Sparks, and K. L. Schalinske. 2006. Folate status modulates the induction of hepatic glycine N-methyltransferase and homocysteine metabolism in diabetic rats. Amer. J. Physiol. Endocrinol. Metab. 291:E1235-E1242.

Oltean, S., and R. Banerjee. 2003. Nutritional modulation of gene expression and homocysteine utilization by vitamin B12. J. Biol. Chem. 278:20778-20784.

Oltean, S., and R. Banerjee. 2004. A B12-responsive internal ribosome entry site (IRES) element in human methionine synthase. J. Biol. Chem. 280:32662-32668.

Olteanu, H., and R. Banerjee. 2001. Human methionine synthase reductase, a soluble P-450 reductase-like dual flavoprotein, is sufficient for NADPH-dependent methionine synthase activation. J. Biol. Chem. 276:35558-35563.

Park, E. I., and T. A. Garrow. 1999. Interaction between dietary methionine and methyl donor intake on rat liver betaïne-homocysteine methyltransferase gene expression and organization of the human gene. J. Biol. Chem. 274:7816-7824.

Piepenbrink, M. S., A. L. Marr, M. R. Waldron, W. R. Butler, T. R. Overton, M. Vazquez-Anon, and M. D. Holt. 2004. Feeding 2-hydroxy-4-(methylthio)-butanoic acid to periparturient dairy cows improves milk production but not hepatic metabolism. J. Dairy Sci. 87:1071-1084.

Preynat, A., H. Lapierre, M. C. Thivierge; M. F. Palin, J. J. Matte, A. Desrochers, and C. L. Girard. 2009a (Chapitre III). Lactational performance of dairy cows according to folic acid and vitamin B12 supply and methionine provision. J. Dairy Sci. (Accepted).

Preynat, A., H. Lapierre, M. C. Thivierge, M. F. Palin, J. J. Matte, A. Desrochers, and C. L. Girard. 2009b (Chapitre IV). Effects of supplements of folic acid, vitamin B12 and rumen-protected methionine on whole body metabolism of methionine and glucose in lactating dairy cows. J. Dairy Sci. 92:677-689.

Resseguie, M., J. Song, M. D. Niculescu, K. A. DaCosta, T. A. Randall, and S. H. Zeisel. 2007. Phosphatidylethanolamine N-methyltransferase (PEMT) gene expression is induced by estrogen in human and mouse primary hepatocytes. FASEB J. 21:2622-2632.

Rhoads, R. P., C. McManaman, K. L. Ingvartsen, and Y. R. Boisclair. 2003. The housekeeping genes GAPDH and cyclophilin are regulated by metabolic state in the liver of dairy cows. J. Dairy Sci. 86:3423-3429.

Riedel, B., T. Fiskerstrand, H. Refsum, and P. M. Ueland. 1999. Co-ordinate variations in methylmalonyl-CoA mutase, and the cobalamin cofactors in human glioma cells during nitrous oxide exposure and the subsequent recovery phase. Biochem. J. 341:133-138.

Rowling, M. J., M. H. McMullen, D. C. Chipman, and K. L. Schalinske. 2002. Hepatic glycine N-methyltransferase is up-regulated by excess dietary methionine in rats. J. Nutr. 132:2545-2550.

SAS Institute. 2004. SAS/STAT User’s Guide: Volumes 1-7. SAS Inst. Inc., Cary, NC.

Santschi, D. E., and C. L. Girard. 2007. Calculations of apparent ruminal synthesis and intestinal absorption of biotin in dairy cows as influenced by the extraction method. Arch. Anim. Nutr. 61:157-167.

Scott, J. M. 1999. Folate and vitamin B12. Proc. Nutr. Soc. 58:441-448.

Selhub, J., M. S. Morris, and P. F. Jacques. 2007. In vitamin B12 deficiency, higher serum folate is associated with increased total homocysteine and methylmalonic acid concentrations. Proc. Natl. Acad. Sci. USA. 104:19995-20000.

Sharma, B. K., and R. A. Erdman. 1989. In vitro degradation of choline from selected feedstuffs and choline supplements. J. Dairy Sci. 72:2772-2776.

Shibano, K. I., and S. Kawamura. 2005. Serum free amino acid concentration in hepatic lipidosis of dairy cows in the periparturient period. J. Vet. Med. Sci. 68:393-396.

183

Smith, R. M., W. S. Osborne-White, and J. M. Gawthorne. 1974. Folic acid metabolism in vitamin B12-deficicent sheep. Effects of injected methionine on liver constituents associated with folate metabolism. Biochem. J. 142:105-117.

Snoswell, A. M., and G. P. Xue. 1987. Methyl group metabolism in sheep. Comp. Biochem, Physiol. 88B:383-394.

Tchantchou, F., M. Graves, and T. B. Shea. 2006. Expression and activity of methionine cycle genes are altered following folate and vitamin E deficiency under oxidative challenge: modulation by apolipoprotein E-deficiency. Nutr. Neurosci. 9:17-24.

User bulletin #2, 1997: ABI PRISM 7700 Sequence Detection System, p 36. Foster City, CA, USA: Applied Biosystems.

Vance, J. E and D. E. Vance. 2004. Phospholipid biosynthesis in mammalian cells. Biochem. Cell Biol. 82: 113-128.

Vance, D. E., Z. Li, and R. L. Jacobs. 2007. Hepatic phosphatidylethanolamine N-methyltransferase unexpected roles in animal biochemistry and physiology. J. Biol. Chem. 282:33237-33241.

Vandesompele, J., K. De Preter, F. Pattyn, B. Poppe, N. Van Roy, A. De Paepe, and F. Speleman. 2002. Accurate normalization of real-time quantitative RT6PCR data by geometric averaging of multiple internal control genes. Genome Biol. 3:1-12.

Williams, E. L., S. M. Rodriguez, D. C. Beitz and S. S. Donkin. 2006. Effects of short-term glucagon administration on gluconeogenic enzymes in the liver of midlactation dairy cows. J. Dairy Sci. 89:693-703.

Xue, G. P., and A. M. Snoswell. 1985. Regulation of methyl group metabolism in lactating ewes. Biochem. Internat. 11:381-385.

Xue, G. P., and A. M. Snoswell. 1986. Developmental changes in the activities of enzymes related to methyl group metabolism in sheep tissues. Comp. Biochem. Physiol. 83B:115-120.

Yamada, K., J. R. Strahler, P. C. Andrews, and R. G. Mattews. 2005. Regulation of human methylenetetrahydrofolate reductase by phosphorylation. Proc. Natl. Acad. Sci. USA. 102:10454-10459.

Zammit, V. A. 1990. Ketogenesis in the liver of ruminants – adaptations to a challenge. J. Agric. Sci. (Camb.). 155:155-162.

184

CHAPITRE VI

DISCUSSION ET CONCLUSION GÉNÉRALE

185

VI-1 DISCUSSION

L’objectif de ce travail était de déterminer si les effets d’une supplémentation en

acide folique sur les performances pendant la période critique entourant le vêlage et le

premier tiers de la lactation étaient dus à une amélioration de la méthylnéogénèse et si

l’apport en vitamine B12 pourrait affecter cette voie métabolique. Dans cette éventualité, la

supplémentation en méthionine, une importante source de groupements méthyles préformés,

devrait réduire les besoins en ces vitamines.

Cette étude a montré que, parallèlement à une amélioration des statuts en folates et

vitamine B12 dans le lait, le plasma et le foie, la supplémentation conjointe en ces vitamines B

augmentait la production laitière et ceci de façon plus marquée pendant les 4 semaines

suivant le vêlage. Cette amélioration des performances de lactation pourrait résulter soit d’un

apport en groupements méthyles plus important car ces groupements sont souvent limitants

chez la vache laitière (Girard et Matte, 2005) soit d’une amélioration de l’efficacité des voies

métaboliques de l’énergie et de la protéine, comme proposé par Graulet et al. (2007).

Les concentrations d’homocystéine plasmatique diminuaient en réponse aux

injections d’acide folique seules ou combinées avec la vitamine B12. Il est probable que cette

diminution résulterait d’une amélioration de l’activité de la méthionine synthase, comme

observé chez l’homme (Mangum et al., 1969 ; Stam et al., 2005). Malheureusement, seule

l’expression génique de la méthionine synthase a été mesurée dans ce travail et les niveaux

d’ARNm de cette enzyme n’ont pas été affectés par nos traitements. En parallèle,

l’estimation de l’importance de cette voie de reméthylation, grâce à l’infusion de la

méthionine doublement marquée, reste imprécise du fait des limites imposées par notre

méthode. Toutefois, il est important de noter que le statut en vitamine B12 semble suffisant

pour ne pas interférer négativement dans cette voie métabolique car aucun effet additionnel

de cette vitamine sur l’homocystéine plasmatique n’a été observé. Le catabolisme de

l’homocystéine à travers la voie de transsulfuration pourrait aussi expliquer la réduction des

concentrations de cet acide aminé dans le plasma. Par contre, à 12 semaines de lactation, nos

résultats ont montré que cette voie était diminuée chez les vaches recevant les suppléments

combinés de méthionine, d’acide folique et de vitamine B12. Même si des effets des

suppléments de méthionine ont été rapportés sur les taux d’ARNm de plusieurs enzymes du

cycle de méthylation (MTHFR, BHMT et PEMT), l’ajout de méthionine protégée de la

dégradation ruminale à la ration n’a eu aucun effet sur les concentrations plasmatiques en

homocystéine ou sur les performances de lactation. De la même façon, les apports en acide

186

folique seul n’ont eu aucun effet sur les rendements en lait et ses composantes. Ces

observations indiqueraient que les effets d’un apport en groupements méthyles, préformés ou

provenant de la méthylnéogénèse, sur le cycle de méthylation aurait un impact limité sur le

rendement en lait et ses composantes. Il est donc peu probable que les effets positifs d’une

supplémentation en acide folique et vitamine B12 sur les performances de lactation des

vaches laitières aient été causés par une augmentation de l’apport en groupements méthyles

via la méthylnéogénèse. Des études complémentaires à ce travail consisteraient à mesurer

l’activité et les niveaux en ARNm et protéine des enzymes clés du cycle de méthylation.

L’augmentation des pertes irréversibles de glucose, observée chez les vaches recevant

les injections d’acide folique et de vitamine B12 ensemble, était d’une amplitude

quantitativement similaire à celle du rendement en lactose dans le lait. Le volume de lait

sécrété et les flux corporels de glucose étant généralement considérés comme étroitement liés

(Danfaer et al., 1995), ces observations suggèrent fortement que la production laitière,

augmentée par les suppléments combinés d’acide folique et de vitamine B12, sans effets sur la

prise alimentaire ou les concentrations plasmatiques des acides gras libres et du β-

hydroxybutyrate, reflète une efficacité accrue du métabolisme du glucose. En effet, il est

possible que la production de glucose ait été augmentée grâce à une meilleure utilisation des

précurseurs néoglucogéniques à travers la voie de la méthylmalonylCoA mutase. Cette

hypothèse est supportée par l’augmentation de l’expression du gène de la méthylmalonylCoA

mutase en réponse aux suppléments combinés en acide folique et vitamine B12. Cette enzyme

est une étape limitante dans l’entrée du propionate dans le cycle de Krebs et son utilisation

pour la néoglucogenèse car elle est dépendante de son coenzyme, la vitamine B12 (Bergman,

1990). L’étude des flux corporels de méthionine montrent que le supplément combiné

d’acide folique et de vitamine B12 améliorerait l’utilisation de la méthionine pour la synthèse

protéique soit en augmentant le turnover protéique chez les vaches ne recevant pas de

suppléments alimentaires en méthionine, soit en diminuant l’oxydation de la méthionine chez

les vaches nourries avec le régime supplémenté en méthionine.

Au vu de ces résultats, l’effet d’un apport combiné en acide folique et en vitamine B12

sur les performances de lactation de vaches laitières hautes productrices résulterait plutôt

d’une amélioration de l’efficacité du métabolisme du glucose suite à une augmentation de

leur capacité de néoglucogenèse plutôt qu’un effet sur la méthylnéogénèse. Des études

futures viseraient à préciser la nature de ces mécanismes et de leur régulation.

187

VI-2 CONCLUSION GÉNÉRALE

Les résultats obtenus ont permis de montrer que :

- les apports en acide folique et vitamine B12 seraient insuffisants chez la vache laitière

haute productrice en début de lactation car une supplémentation en ces deux

vitamines améliore non seulement les performances de lactation mais aussi leurs

statuts et l’efficacité des voies métabolismes du glucose et de la méthionine.

- L'expression de plusieurs gènes liés au cycle des méthylations serait affecté par les

apports en groupements méthyles, préformés (méthionine) ou provenant de la

méthylnéogénèse (acide folique).

- L’acide folique et la vitamine B12 agiraient conjointement sur les métabolismes du

glucose et des protéines par une amélioration de l’efficacité de la voie de la

méthylmalonylCoA mutase et une redirection préférentielle de la méthionine vers la

synthèse protéique, respectivement.

- L’augmentation de la production laitière et des rendements des composantes du lait,

rapportée chez les vaches recevant les injections intramusculaires d’acide folique et

de vitamine B12, serait probablement reliée aux effets de ces vitamines sur le

métabolisme du glucose plutôt qu’aux effets sur la méthylnéogénèse.

VI-3 RÉFÉRENCES BIBLIOGRAPHIQUES

Bergman, E. N. 1990. Energy contributions of volatile fatty acids from the gastrointestinal tract in various species. Physiol. Rev. 70:567-590.

Danfaer, A., V. Tetens and N. Agergaard. 1995. Review and an experimental study on the physiological and quantitative aspects of gluconeogenesis in lactating ruminants. Comp. Biochem. Physiol. B. Biochem. Mol. Biol. 111(2):201-210.

Girard, C. L. and JJ. Matte. 2005b. Effects of intramuscular injections of vitamin B12 on lactation performance of dairy cows fed dietary supplements of folic acid and rumen-protected methionine. J. Dairy Sci. 88:671-676.

Graulet, B, JJ. Matte, A. Desrochers, L. Doepel, M. F. Palin, and C. L. Girard. 2007. Effects of dietary supplements of folic acid and vitamin B12 on metabolism of dairy cows in early lactation. J. Dairy Sci. 90:3442-3455

Mangum, J. H., Murray B. K., and North J. A. 1969. Vitamin B12 dependent methionine biosynthesis in cultured

mammalian cells. Biochemistry. 8:3496-9.

Stam, F., Y. M. Smulders, C. Guldener, C. Jakobs, C. D. A. Stehouwer, and K. Meer. 2005. Folic acid treatment increases homocysteine remethylation and methionine transmethylation in healthy subjects. Clin. Sci. 108:449-456.