Thèse en cotutelle - univ-oran1.dz · Célia SARAND, Vivien MABILAT, Cathérine LOY, Muriel BLIN,...

1

Thèse en cotutelle

En vue de l’obtention du diplôme de DOCTORAT, en biologie

Spécialité : Science de la santé et du développement

Pathologie vasculaire et nutrition

Présentée par

Tawfik ADDI

Intitulé :

Rôle de la voie AhR dans la régulation de l’expression des

gènes ; Identification des partenaires moléculaires répondant à l'Activation d'Aryl

hydrocarbon Receptor par les toxines urémiques

Soutenue le 10/04/2019

Devant le jury :

Président : Mr Habib Hammou Professeur, Université Oran 1

Examinateur : Mme Khedidja Mekki Professeur, Université Oran 1

Examinateur : Mr Christophe Soulage Maitre de Conférence-Professeur

Associé, Université de Lyon 1

Examinateur : Mr Christophe Dubois Professeur, Aix-Marseille Université

Directeur de thèse : Mr Omar Kheroua Professeur, Université Oran 1

Co-directeur de thèse : Mr Stéphane Burtey Professeur, Aix-Marseille Université

Membre invité : Mme Hafida Merzouk Professeur, Université de Tlemcen

Aix-Marseille Université Faculté de Pharmacie de Marseille

Ecole Doctorale Sciences de la Vie et de la Santé

Université Oran 1 Faculté des Sciences de la Nature et de la vie

Ecole doctorale sciences de la santé et du développement

2

Je dédie cette thèse chaleureusement à ma famille

À mes parents ;

Ma mère mon père « les anges gardiens de leurs fils, qui nous ont tout

donné pour réussir, sans jamais mesurer leurs efforts »

Tout au long de ma vie, vous m’avez encouragé à persévérer dans mes études.

Ainsi, cet accomplissement est le fruit de votre soutien. Merci pour votre

bienveillance en espérant vous avoir rendu fier de moi.

Que Dieu vous garde Inchallah.

À mes frères et belles-sœurs ; Karim, Mohammed Y, Sofiane, Mounir (mon

jumeau), Fouad (le Mazouzi) et Fatima, Khadidja et Imene.

Je vous remercie pour votre confiance inébranlable, et soutien que vous m’avez

apporté durant la réalisation de cette thèse.

Je vous souhaite une pleine réussite dans la vie.

À mes nièces et neveux ;

Abdellah M, Wassim M, Abderrahmane F, Ibrahim A, Dayena, sa sœur

jumelle Malek (qui est au paradis) et Mohammed R.

Mes chères nièces et neveux ; il faut déjà apprendre à lire pour comprendre ses

mots, mais voilà j’espère qu’ont grandissant vous aurez l’occasion de lire cette

thèse, et de comprendre comment vous avez aidé votre tonton à réaliser ce

travail. C’est simple, dans les moments où la lumière dans le tunnel paraissait

de plus en plus loin, ou quand toutes les portes semblaient fermées ; votre rire,

joie, et surtout l’insouciance et l’innocence à la vie me permettaient de me

relaxer, et de voir les choses avec recule, ce qui est la clé pour surmonter toutes

les difficultés et avancer ; comme le dit l’expression « lorsque nous sommes trop

proches de l’arbre, il est impossible de voir la forêt ». Que Dieu vous garde en

bonne santé, je vous souhaite tout le bonheur de cette vie.

Dédicace

3

Remerciements

Remerciements

Cette thèse en Cotutelle a été réalisé entre Aix-Marseille Université, Centre de Recherche en Cardio-

Vasculaire et Nutrition (C2VN) l’Université Oran 1, Laboratoire de Physiologie de la Nutrition et de

la Sécurité Alimentaire (LPNSA)

Je remercie vivement ;

Le Professeur Françoise DIGNAT-GEORGE de m’avoir permis de travailler au sein du

laboratoire UMR_S 1076 (C2VN actuel), et de m’avoir fait intégrer la meilleure équipe de recherche

qu’on puisse espérer ; l’Équipe «Urémie» qui m’a accueilli à bras ouverts depuis mon master 2.

Le Professeur Marie-Christine ALESSI, dans la continuité d’accueil au sein du C2VN.

J’adresse mes intenses remerciements à mon directeur de thèse d’Aix-Marseille Université, le

Professeur Stéphane BURTEY. Merci pour le soutien indéfectible que vous m’avez apporté. Merci de

m’avoir conseillé, orienté, et accueilli cordialement dans l’équipe «Urémie». Cette équipe qui a

toujours cru en moi, qui m’a formé et fait adorer la recherche, et que je considère comme ma famille

scientifique.

Je tiens également à adresser mes sincères remerciements à mon directeur de thèse de

l’Université d’Oran, LPNSA, le Professeur Omar KHEROUA, de m’avoir constamment appuyé et

encouragé durant cette thèse. Aussi, pour m’avoir donné l’opportunité de voir grand, en ayant initié

le Master international.

Mes vifs remerciements vont également aux membres du jury pour avoir accepté la lecture et

l’évaluation de cette thèse, et pour l’intérêt qu’ils ont porté à ce travail.

Je remercie vivement le professeur Habib HAMMOU, responsable du Master international, pour

son appui fondamental depuis le Master, dans l’initiation de la cotutelle et durant l’organisation de la

soutenance.

Je remercie également les enseignants de l’université Oran 1, LPNSA, pour leurs soutiens,

particulièrement : le Pr Djamel SAIDI, le Pr Hanane KADDOURI et le Pr Ahmed BOUALGA.

Le Master international qui reste un élément déclencheur de cette concrétisation ; mis en place en

collaboration conjointe avec le professeur Omar KHEROUA, le professeur Christophe DUBOIS, le

professeur Jean-Louis MÈGE, à qui j’exprime également mes profonds remerciements.

Je remercie pareillement le Docteur Kamel El Eddine El MECHERFI d’avoir été à mes côtés, et de

m’avoir apporté ses conseils durant le début de cette thèse.

Un remerciement particulier au Dr Laetitia DOU, mon mentor scientifique et amie, qui a

également encadré cette thèse. Merci…..Merci de m’avoir fait confiance, de m’avoir transmis le

savoir scientifique sans retenue, et de m’encourager toujours à repousser mes limites pour aller plus

loin, dans la joie, l’enthousiasme et la bonne humeur.

4

Remerciements

Je souhaite remercier très fortement le Dr Stéphane POITEVIN de m’avoir soutenu durant ma thèse

jusqu’au bout, et d’avoir été toujours là dans les moments de travail et les moments de rigolade avec

sa bonne humeur et ses bonnes blagues « Mes amitiés….. ».

Un autre remerciement particulier à Lady Nathalie McKAY, mon soutien moral durant cette thèse.

Merci d’avoir été toujours là, de m’avoir soutenu, aider et encourager jusqu’au bout avec ta joie, ta

bonne humeur toujours présente et ton amitié.

Je remercie chaleureusement le Dr Claire CERINI pour ses conseils, son soutien, son sourire

d’encouragement et son amitié tout au long de cette thèse.

Je tiens également à remercier : Marion SALEE, Noémie JOURDE CHICHE, Camélia MAKHLOUFI,

Stanislas BATAILLE et Guillaume LANO, pour leurs conseils apportés.

Je souhaite saluer le courage des patients de la clinique ST-Hubert & Es-Seddikia d’Oran et de

l’hôpital la conception de Marseille. Je les remercie d’avoir participé aux études dans le but de faire

avancer la recherche.

Je tiens à remercier spécialement le groupe Rénadial et les médecins-chefs ; le Dr Nadia FAHSSI et

le Dr Mustapha REMAOUN, de m’avoir permis de réaliser l’étude clinique au sein de leur centre (St-

Hubert Es-Seddikkia). Je remercie également tous les médecins et le personnel des centres

Rénadial qui ont contribué dans cette étude. Mes remerciements vont aussi vers les médecins et

personnels qui ont participé au recrutement des patients à l’hôpital de la conception de Marseille.

Durant mes séjours à Marseille (à ex UMR_S1076), j’ai eu la joie d’être entouré par des amis que je

remercie d’avoir été là, et avec qui nous avons partagé des moments qui resteront à jamais gravés

dans la mémoire :

Tacy SANATANA MACHADO, Anthony BABA, la famille McKAY : Nathalie & Bruno, Karim FALLAGUE,

Célia SARAND, Vivien MABILAT, Cathérine LOY, Muriel BLIN, Clarissa VON KOTZE, la famille TELLIER :

Edwige Nicolas.

Également : Belkacem BRICHI, Amine BECHAR, Romain Nassima VIAL, Karima MOUSSOUNI.

J’adresse également mes remerciements ;

À mes potes-frères de m’avoir supporté tout au long de cette thèse : Ilyes BELHAYARA, Mehdi

MEHADJI, Yacine LEZOUL, Saiid LEZOUL, Wanis KAZI, Kamel KHALOUT, Amine MALTI, Khelifa

BELABASSI, Fethi TEGHLI, Mehdi BOUKACEM, Mehdi KAHOUADJI, Mohammed MALOUFI, Walid SARI,

Saleh ZERROUK, Omar KALAFATE.

Pour leurs soutiens ; à Ilhem MELLOUK, Wiam BRIKCI et Dalel REDOUANE.

Pour leurs amabilités et encouragements ; à tous les membres du laboratoire C2VN de Marseille ; aux

membres du laboratoire LPNSA d’Oran « Lila AMIER, Nawel BOUTIBA », et à tous mes collègues

inscrits en thèse, à qui je souhaite une carrière fructueuse.

5

Résumé

Résumé

La maladie rénale chronique (MRC) a pour principale complication les maladies

cardiovasculaires. Le risque cardiovasculaire est multiplié par 3 à 100 au cours de la MRC. Les

facteurs de risque traditionnels n’expliquent pas le sur risque observé. Il est avéré que

l’accumulation de certaines toxines urémiques chez les patients avec une MRC intervient

dans la survenue des complications cardiovasculaires. Les toxines urémiques dérivées de la

voie indolique du métabolisme du tryptophane, l’indole-3-acétique acide (IAA) et l’Indoxyl

sulfate (IS), sont impliquées dans un phénomène clé des événements cardiovasculaires ; la

thrombose. Notre équipe a montré que les deux toxines urémiques indoliques IAA et IS,

induisent l'expression et l'activité pro coagulante du facteur tissulaire, principal initiateur

cellulaire de la coagulation sanguine. Le facteur de transcription, Aryl Hydrocarbon Receptor

(AHR), un récepteur cellulaire pour les toxines indoliques, est impliqué dans l'induction du FT

endothélial. Les mécanismes par lesquels AhR contrôle l’expression du FT dans les cellules

endothéliales sont peu connus.

L’objectif principal de cette thèse était de déterminer les voies de signalisation et les

facteurs de transcription impliqués dans l'expression du FT médiée par AhR et induit par

l’IAA et l’IS. Nous avons également étudié le lien entre le facteur tissulaire circulant et les

taux d’IAA et d’IS chez les patients hémodialysés de Marseille.

Dans la littérature, nous ne disposons pas des valeurs des toxines indoliques dans des

populations dialysant hors des pays occidentaux. Pour compléter ce manque, nous avons

déterminé et comparé les taux de ces toxines dans une cohorte de patients hémodialysés en

Algérie.

6

Résumé

L’expression du facteur tissulaire induite par l’IAA et l’IS au niveau endothélial est

contrôlée principalement par la transcription. L’IAA et l’IS activent la voie génomique

classique d’AhR. Cependant, l’expression du FT n'est pas médiée par cette voie. L’AhR ne se

fixant pas au promoteur du FT en CHIP. L’activation du FT en réponse à l’IAA passe par une

voie AhR-p38MAPK-NF-B.

Dans une cohorte de 92 patients atteints de MRC sous hémodialyse, le FT circulant était

indépendamment lié à l'IAA sérique en analyse multivariée.

Enfin, les taux sériques d’IS étaient significativement plus élevés chez les patients oranais

par rapport aux patients marseillais. Cependant, après un suivi d’un an, le taux de mortalité

et d’événement cardiovasculaire n’était pas significativement diffèrent entre les deux

populations de patients.

En conclusion, l’induction par l'IAA du FT dans les cellules endothéliales humaines

implique la voie non génomique d’AhR-p38MAPK/NF-B. L’identification de cette voie de

signalisation suggère que nous puissions dissocier l’effet détoxifiant d’AhR dépendant de la

voie génomique, de l’effet prothrombotique. Nous préserverons ainsi les effets positifs de

l’activation d’AhR, en limitant ses effets délétères en particulier prothrombotiques induits

par les toxines urémiques.

7

Abstract

Abstract

Chronic kidney disease (CKD) has as main complication, the cardiovascular pathology. The

cardiovascular risk is multiplied by 3 to 100 during the CKD. Traditional risk factors do not

explain the observed risk. It is known that the accumulation of some uremic toxins is

involved in the occurrence of cardiovascular complications in CKD. Uremic toxins derived

from the indolic pathway of tryptophan metabolism indole-3-acetic acid (IAA) and indoxyl

sulfate (IS) are involved in a key phenomenon of cardiovascular events; the thrombosis. Our

team has previously shown that both indolic uremic toxins, indole-3-acetic acid and indoxyl

sulfate induce the expression and procoagulant activity of tissue factor, the main cellular

initiator of blood coagulation. The transcription factor, Aryl Hydrocarbon Receptor (AHR), a

cellular receptor for indolic toxins, is involved in the induction of endothelial TF. However,

the mechanisms by which AhR controls the expression of TF in endothelial cells are poorly

understood.

The main objective of this thesis was to determine the signaling pathways and

transcription factors involved in AhR mediated TF expression induced by IAA and IS. We also

studied the link between circulating tissue factor and IAA/IS levels in hemodialysis patients

in Marseille.

In the literature, we do not have the values of indole toxins in dialysis populations

outside Western countries. To complete this deficiency, we have determined and compared

the levels of these toxins in a cohort of hemodialysis patients in Algeria.

Tissue factor expression induced by IAA and IS at the endothelial level is mainly

controlled by transcription. IAA and IS activate the classical genomic AhR pathway. However,

the expression of TF is not mediated by this way. AhR does not bind to the TF promoter in

8

Abstract

CHIP. Activation of TF in response to the IAA is mediated by an AhR-p38MAPK-NF-B

pathway.

In a cohort of 92 patients with CKD under hemodialysis, circulating TF was independently

related to serum IAA in multivariate analysis.

Finally, serum IS levels were significantly higher in oran patients than in marseille

patients. However, after a one-year follow-up, the mortality and cardiovascular event rate

was not significantly different between the two patient populations.

In conclusion, induction by IAA of TF in human endothelial cells involves the non-genomic

AhR-p38MAPK/NF-B pathway. The identification of this signaling pathway suggests that we

can dissociate the detoxifying effect of AhR dependent on the genomic pathway, to the

prothrombotic effect. We could thus preserve the positive effects of AhR activation and

limiting its deleterious effects, in particular the prothrombotic effects induced by uremic

toxins.

9

ملخص

ملخص

تضاعف مخاطر القلب واألوعية هو المضاعفات الرئيسية ألمراض القلب واألوعية الدموية. مرض الكلى المزمن

وقد تبين أن تراكم عوامل الخطر التقليدية ال تشرح الخطر المرصود. . مرض الكلى المزمنخالل 100إلى 3الدموية من

تشارك في حدوث مضاعفات القلب واألوعية مرض الكلى المزمنبعض السموم يوريمي في المرضى الذين يعانون من

3 حامض إيندول من التريبتوفان األيض ، وحامض indolic المستمدة من مسار Uremicالسموم الدموية.

أظهر تجلط الدم. : ( ، متورطون في ظاهرة رئيسية من األحداث القلبية الوعائيةIS) األكسدة وكبريتات (IAA) أسيتيك

، والبادئ (FT) ، لحث التعبير والنشاط تجلط الدم الموالية العامل النسيجيISو اإلندول السموم يوريميIAA فريقنا أن كال

( وهو مستقبالت الخلوية AHR) مستقبالت تشارك الهيدروكربون أريل عامل النسخ ، الخلوي الرئيسي لتخثر الدم.

في الخاليا FTفي التعبير عن AhR تتحكم بها التياآلليات فهم ال يتم البطانية. FT، في تحريض اإلندول للسموم

البطانية.

وكان الهدف الرئيسي من هذه الرسالة لتحديد مسارات اإلشارات وعوامل النسخ المشاركة في التعبير عن

FT بوساطة AhR والناجمة عنIAA وIS. درسنا أيضا العالقة بين عامل النسيج المتداولة ومستوياتIAA وIS في

مرضى غسيل الكلى في مرسيليا.

إلكمال هذا في مجموعات غسيل الكلى خارج البلدان الغربية. اإلندول ، ليس لدينا قيم السمومفي األدبيات العلمية

جموعة من مرضى غسيل الكلى في الجزائر.النقص ، قمنا بتحديد ومقارنة مستويات هذه السموم في م

على مستوى البطانية يتم التحكم في المقام األول عن طريق IAA/IS التعبير عن عامل األنسجة الناجم عن

بهذه FTالتعبير عن بوساطة ومع ذلك ، ال يتم . AhR بتفعيل المسار الجيني الكالسيكي لـ ISو IAAتقوم النسخ.

. NF-B/p38/AhR مسار يمر عبر IAAردا على FTتفعيل .CHIP في FTغير ملزم للمروج AhRو الطريقة.

المنتشرة بشكل مستقل إلى مصل FTترتبط الكلى،على غسيل مرض الكلى المزمنمريضا مع 92في مجموعة من

IAA متعدد المتغيرات في التحليل .

ومع ذلك ، في المصل أعلى بشكل ملحوظ في مرضى وهران مقارنة بمرضى مرسيليا. IS وأخيرا ، كانت مستويات

بعد سنة واحدة من المتابعة ، لم يكن معدل الوفيات ومعدل األوعية القلبية مختلفا بشكل كبير بين المجموعتين المريضتين.

في الخاليا البطانية البشرية على المسار غير الجيني ل FTلـ IAAفي الختام ، ينطوي االستقراء بواسطة

B/p38MAPK /AhR ـNF من إزالة السموم يشير تحديد مسار اإلشارة هذا إلى أننا نستطيع فصل تأثيرAhR الذي

، مما يحد من AhR على اآلثار اإليجابية لتنشيط وبالتالي ،سنحافظ . البروثرومبوتيك يعتمد على المسار الجينومي ، تأثير

التي تسببها السموم اليوريمية. البروثروموتيك آثاره الضارة ، خاصة

10

Liste des figures

Liste des figures

Introduction

Figure 1 : L’Expression anormale du FT active la cascade de coagulation ............................ 22

Figure 2 : Induction du promoteur du facteur tissulaire humain (FT) dans les cellules

endothéliales .................................................................................................................. 23

Figure 3 : Activation de la voie classique génomique de l’AhR ............................................ 25

Revue bibliographique

Figure 1 : Mechanisms of tryptophan-derived uremic toxins promoting thrombosis ........... 37

Méthodologie de travail

Figure 1 : Western blot des niveaux de protéines d’AhR dans les HUVEC transfectées avec

un siRNA contrôle ou siRNA AhR ...................................................................................... 48

Figure 2 : Construction des plasmides rapporteurs du promoteur du FT............................. 53

Résultat (5.1.) : Étude de la régulation du Facteur Tissulaire via AhR induit par l’IAA

Figure 1 (A)(B) : Effet de l'IAA sur l'expression du FT en ARNm (A) et en protéines (B) dans

différents types de cellules endothéliales humaines .......................................................... 62

Figure 1 (C)(D) : Effet de l'IAA sur l'induction de l'ARNm (C) et de la protéine (D) du FT

dans les cellules HUVEC, dans un milieu contenant 4% d'albumine sérique humaine .......... 62

Figure 1 (E) : Effet de l'inhibiteur de la transcription Actinomycine D (1 pg/ml)

sur l'expression de l'ARNm du facteur tissulaire induit par l’IAA ......................................... 63

Figure 2 (A)(B) : Effet de l'inhibiteur d’AhR le CH-223191 (10μM) et du siRNA AhR

sur l'expression de l'ARNm (A) et de la protéine (B) du FT induit par l’IAA .......................... 65

Figure 2 (C)(D) : Étude de la liaison d’AhR aux promoteurs et analyse de

la translocation nucléaire d’AhR provoqué par l’IAA .......................................................... 66

Figure 2 (E)(F) : Expression d’ARNm des gènes cibles d’AhR induit par l’IAA ....................... 66

Figure 3 (A) : Identification du site de liaison du facteur de transcription sensible a l'IAA

dans le promoteur du FT .................................................................................................. 69

11

Liste des figures

Figure 3 (B)(C) : Effet de l'inhibiteur de NF- sur l'expression de l'ARNm (B) et de la

protéine (C) du FT induit par l’IAA .................................................................................... 69

Figure 3 (D) : Étude de l'expression de la p50 endothéliale dans les extraits nucléaires

induit par l’IAA ............................................................................................................... 70

Figure 4 (A)(B) : Effet des inhibiteurs de PKC, p38 MAPK, ERK1/2 sur l'expression de

l'ARNm (A) et de la protéine (B) du FT induit par l’IAA ....................................................... 72

Figure 4 (C) : Effet des inhibiteurs de PKC et p38 MAPK sur l'expression de la

p50 endothéliale induit par l’IAA dans les extraits nucléaires ............................................. 73

Figure 5 : Les mécanismes liés à l'AhR sous-jacent à la transcription du FT induit par l'IAA

dans les cellules HUVEC ................................................................................................... 74

Figure supplémentaire 1 : Effet de l'IAA sur les niveaux nucléaires des sous-unités AP-1 ;

c-Jun et c-Fos ................................................................................................................. 80

Figure supplémentaire 2 : Effet de l'IAA sur les niveaux nucléaires de NF-B p65 ............... 80

Figure supplémentaire 3 : Effet du siRNA AhR sur l'expression nucléaire de p50 ................ 81

Résultat (5.2.) : Étude de la régulation du Facteur Tissulaire via AhR induit par l’IS

Figure 1 : Effet de l'inhibiteur de la transcription Actinomycine D (1μg/mL) sur

l'expression de l'ARNm du FT induit par l’IS ...................................................................... 83

Figure 2 (A)(B) : Effet des siRNA AhR sur l'expression de l'ARNm (A) et de la protéine (B)

du FT après incubation des HUVEC avec 200 μM d'IS (Gondouin et al. 2013) ...................... 84

Figure 2 (C)(D) : Étude de la liaison d’AhR aux promoteurs et analyse de la

translocation nucléaire provoquée par l’IS ........................................................................ 85

Figure 2 (E)(F) : Expression d’ARNm des gènes cibles d’AhR induit par l’IS .......................... 85

Figure 3 (A) : Identification du site de liaison du facteur de transcription sensible a l'IS

dans le promoteur du FT .................................................................................................. 87

Figure 3 (B)(C) : Effet de l'inhibiteur de NF- sur l'expression du FT induit par l’IS ............ 87

Figure 4 (A)(B) : Effet des inhibiteurs de PKC, p38MAPK, ERK1/2 sur l'expression

de l'ARNm (A) et de la protéine (B) du FT induit par l’IS .................................................... 89

12

Liste des tableaux

Liste des tableaux

Introduction

Tableau 1 : Pronostic, fréquence et stratégie de suivi des MRC en fonction du débit

de filtration glomérulaire et de l’albuminurie ................................................................... 19

Résultat (5.3.) : Étude du lien entre le FT circulant et les taux sériques d’IAA et d’IS chez

les patients HD de Marseille

Tableau 1 : Caractéristiques de base de la population HD (n=92) ....................................... 95

Tableau 2 : Corrélations de Spearman à Two-tailed des caractéristiques de base avec les

taux plasmatiques de FT dans la cohorte HD (n=92) .......................................................... 96

Tableau 3 : Analyse de régression linéaire multivariée pour évaluer la relation entre

les variables indépendantes et les taux plasmatiques de FT chez les patients

HD (n=92) ....................................................................................................................... 97

Résultat (5.4.) : Étude comparative entre deux cohortes de patients HD (Oran vs Marseille)

Tableau 1 : Caractéristiques des patients HD (Oran/Marseille) ........................................ 102

Tableau 2 : Taux des toxines urémiques chez les patients HD (Oran/Marseille) ................ 103

Tableau 3 : Suivi à 1 an des patients HD.......................................................................... 103

13

Liste des abréviations


AhR : Aryl hydrocarbon receptor

ARNT : Aryl hydrocarbon receptor nuclear translocator

AhRR : Aryl hydrocarbon receptor repressor

AP-1: Activator Protein 1

AVF : Arteriovenous fistula

AA : Anthranilic acid

AVC : Arrêt vasculaire cérébrale

CYP450 : Cytochromes P450

COX-2 : Cyclooxygénase-2

CVD : Cardiovascular disease

CKD : Chronic kidney disease

CRP : Protéine C réactive

DFG : Débit de filtration glomérulaire

DRE : Dioxin response element

Egr-1 : Early Growth Response 1

ERK 1/2 : Extracellular signal-regulated kinase 1/2

FT: Facteur tissulaire

FTc : Facteur tissulaire circulant

HTA : Hypertension artérielle

Hsp 90 : Heat shock protein 90

HUVEC : Human umbilical vein endothelial cell

HD: Hémodialysé

IAA : Indole-3 acetic acid

https://www.google.com/url?sa=t&rct=j&q=&esrc=s&source=web&cd=3&cad=rja&uact=8&ved=2ahUKEwjRydj6jbbgAhVEqHEKHYnoDG4QFjACegQICBAB&url=http%3A%2F%2Fwww.abcell-bio.com%2Ffr%2Fles-produits%2Fhuvec-cellules-endotheliales-veine-cordon-ombilical&usg=AOvVaw0N29s2V-jopBvX3FQymS8N

https://www.google.com/url?sa=t&rct=j&q=&esrc=s&source=web&cd=3&cad=rja&uact=8&ved=2ahUKEwjRydj6jbbgAhVEqHEKHYnoDG4QFjACegQICBAB&url=http%3A%2F%2Fwww.abcell-bio.com%2Ffr%2Fles-produits%2Fhuvec-cellules-endotheliales-veine-cordon-ombilical&usg=AOvVaw0N29s2V-jopBvX3FQymS8N

14


IS : Indoxyl Sulfate

IL-6 : L'interleukine 6

IDO : Indoleamine 2,3-dioxygenaseIDO

IRC : Insuffisance rénale chronique

ICAM-1 : Intercellular Adhesion Molecule 1

KTR : Kynurenine/tryptophan ratio

KYN : Kynurenine

KYNA : Kynurenic acid

MRC : Maladie rénale chronique

MRC 5D : MRC stade 5 dialysée

MRC 5T : MRC stade 5 transplantée

MCP-1 : Monocyte chemoattractant protein 1

NO : Nitric oxide

NF-B : nuclear factor-kappa B

NFAT: Nuclear factor of activated T-cells

NC-XRE : Non-consensus xenobiotic response element

PCS : p-Cresyl sulfate

PBMC : Cellule mononuclée sanguine périphérique

P38 MAPK : P38 mitogen-activated protein kinases

PAH : Hydrocarbure aromatique polycyclique

PAI-1/PAI-2 : Plasminogen activator inhibitor-1/2

PKC : Protéine kinase C

QA : Quinolinic acid

RANTES : Regulated on activation, normal T cell expressed and secreted

https://www.ahajournals.org/doi/full/10.1161/CIRCULATIONAHA.106.685230

15


ROS : Reactive oxygen species

SiRNA: Small interfering RNA

SP1 : Specificity protein 1

TUDT: Toxines urémiques dérivées du tryptophane

TCDD : 2,3,7,8-tetrachlorodibenzo-p-dioxin

t-PA : Tissue plasminogen activator

TFPI : Tissue factor pathway inhibitor

TDO : Tryptophan 2,3-dioxygenase

TNF: Tumor necrosis factor

uPA : Urokinase plasminogen activator

uPAR : Urokinase plasminogen activator receptor

vWF: Facteur Willebrand

vSMC : vascular smooth muscle cells

XRE : Xenobiotic response element

XAP2 : HBV X-associated protein 2

3-HAA : 3 hydroxyanthranilic acid

3-HKYN : 3-hydroxykynurenine

16

Sommaire

Sommaire

Résumé (Français/Anglais/Arabe) ........................................................................5

Liste des figures ...................................................................................................10

Liste des tableaux ................................................................................................12

Liste des abréviations ...........................................................................................13

1. Introduction .....................................................................................................19

2. Revue bibliographique .....................................................................................28

3. Objectif de thèse ..............................................................................................46

4. Méthodologie de travail ...................................................................................47

4.1. Culture de cellules endothéliales ......................................................................... 47

4.2. Traitement avec les toxines urémiques IAA ou IS ................................................. 47

4.3. Extinction de la protéine d’AhR avec le SiRNA (Small interfering RNA) ................... 48

4.4. Extraction de l'ARN et analyse RT-PCR quantitative de l'expression de l'ARNm ...... 49

4.5. Test d'immunoprécipitation de la chromatine (ChIP) ............................................ 50

4.6. Western blot et analyse densitométrique de Western blots ................................. 51

4.7. Transfection transitoire des HUVEC et test d’expression de la luciférase

sous le contrôle du promoteur du facteur tissulaire ............................................. 52

4.8. Translocations nucléaires de NF-B et AP-1 ......................................................... 53

4.9. Étude de corrélation entre la concentration de FT circulant et les taux

sériques d’IAA et d’IS chez les patients HD de Marseille ........................................ 54

4.10. Mesure du FT par dosage immuno-enzymatique ................................................ 55

17

4.11. Étude comparative entre deux cohortes de patients HD (Oran vs Marseille) ........ 55

4.11.1. Critères d’inclusion .................................................................................. 56

4.11.2. Critères d’exclusion .................................................................................. 56

4.11.3. Arrêt d’étude ........................................................................................... 57

4.11.4. Les éléments cliniques et biologiques d’intérêt ......................................... 57

4.11.5. Dosages des toxines ................................................................................. 57

4.11.6. Suivi des patients ..................................................................................... 57

4.12. Analyses statistiques ......................................................................................... 58

5. Résultats et discussions ....................................................................................59

5.1. Étude de la régulation du Facteur Tissulaire via AhR induit par l’IAA .........60

5.1.1. Étude de l'expression du FT induit par l'IAA dans les

cellules endothéliales ............................................................................. 61

5.1.2. L’IAA induit l'expression du FT par l'intermédiaire de l'activation

d’AhR mais sans la liaison d'AhR au promoteur du FT ............................... 64

5.1.3. Le site NF-B du promoteur du FT est nécessaire pour l'induction

du FT par l'IAA ........................................................................................ 67

Coopération entre AhR et NF-B dans l'induction du FT par l'IAA .............. 68

5.1.4. Implication de p38 MAPK dans l'induction du FT par l'IAA ......................... 71

Discussion ....................................................................................................... 75

Figures supplémentaires ................................................................................ 80

5.2. Étude de la régulation du Facteur Tissulaire via AhR induit par l’IS ............82

5.2.1. L’induction de l'expression du FT dans les cellules endothéliales

HUVEC par l’IS est contrôlée au niveau transcriptionnel ........................... 83

5.2.2. L’IS induit une activation d’AhR sans la fixation de ce dernier sur

le promoteur du FT ................................................................................. 84

Sommaire

18

Sommaire

5.2.3. Une voie non-génomique indirecte d’AhR activant d’autres facteurs

de transcription semble être impliquée dans la régulation de l’expression

du FT induit par l'IS ................................................................................. 86

5.2.4. Implication de p38 MAPK et PKC dans l'expression du FT induit

par l'IS ................................................................................................... 88

Discussion ....................................................................................................... 90

5.3. Étude du lien entre le FT circulant et les taux sériques d’IAA et d’IS

chez les patients HD de Marseille ..............................................................93

- Les taux de FT circulants sont indépendamment liés au niveau d'IAA mais

pas d’IS chez les patients hémodialysés de Marseille ................................ 94

Discussion ......................................................................................................... 98

5.4. Étude comparative entre deux cohortes de patients HD

(Oran vs Marseille) .....................................................................................100

5.4.1. Comparaison de la cohorte de patients HD d’Oran et des patients HD

de Marseille ........................................................................................... 103

5.4.2. Les taux d’IS sont significativement plus élevés chez les HD d’Oran ............ 103

5.4.3. Le taux de mortalité et des événements cardiovasculaires ne sont

pas différents entre la cohorte de patients HD d’Oran et celle de

Marseille après un suivi d’un an ............................................................... 103

Discussion ........................................................................................................ 104

6. Conclusion et perspectives ...............................................................................109

Références bibliographiques ................................................................................114

Annexes ...............................................................................................................127

Productions scientifiques .....................................................................................135

19

1. Introduction

L’incidence de la maladie rénale chronique (MRC) augmente régulièrement dans le

monde (Levey et al. 2007). Selon « The Global Burden of Disease », une personne sur dix

dans le monde souffre d'un certain degré de maladie rénale chronique (GBD 2015 Disease

and Injury Incidence and Prevalence ).

La MRC est caractérisée par une altération irréversible et lente des fonctions normales du

rein aussi bien exocrines et qu’endocrines. Sa définition la plus fréquente est un débit de

filtration glomérulaire (DFG) inférieur à 60 ml/min/1,73 m2 ou l’existence d’une protéinurie,

durant au moins 3 mois (Stevens et al. 2013). La MRC est définie par des stades en fonction

de la sévérité de l’altération du DFG et de la protéinurie (tableau 1).

La prévalence du stade 5 (nécessitant le recours à une technique de suppléance, dialyse

« stade 5D » ou transplantation « stade 5T ») varie de 200 à 2400 cas par million selon les

pays (Levey and Coresh 2012). La mortalité chez les patients atteints de MRC stade 5D est de

10 à 20 fois plus élevée que dans la population générale (Parmar 2002). La mortalité dans les

Tableau 1

Introduction

20

stades plus précoces est aussi plus importante essentiellement du fait de la pathologie

cardiovasculaire (Webster et al. 2017).

Les complications cardiovasculaires sont les premières causes de mortalité et de

morbidité chez les patients MRC (Weiner et al. 2004). Ces complications incarnent plus de

50% des causes de décès chez ces patients (Foley et al. 1998; Di Angelantonio et al. 2007;

Perkovic et al. 2008; Wattanakit et al. 2008).

La thrombose est au cœur des principales pathologies cardiovasculaires: la cardiopathie

ischémique (infarctus du myocarde), l’accident vasculaire cérébral et la thromboembolie

veineuse (Perkovic et al. 2008; Wattanakit et al. 2008; ISTH Steering Committee for World

Thrombosis Day 2014). La MRC est associée à un risque thrombotique accru (Daneschvar et

al. 2008; Ocak et al. 2013; Carney 2016). En effet, les patients avec une MRC présentent plus

de risques de thrombose veineuse profonde (Parikh et al. 2011), d’embolie pulmonaire (Lutz

et al. 2014; Parikh et al. 2011), de thrombose des abords vasculaires (Arora et al. 2000;

Pavord and Myers 2011; Ravani et al. 2013; Lutz et al. 2014), d’infarctus du myocarde, d’AVC

ischémique et d’artériopathie des membres inférieurs (Casserly and Dember 2003; Pavord

and Myers 2011; Lutz et al. 2014),. Les facteurs de risque cardiovasculaire classique comme

l’HTA, la dyslipidémie, le diabète ou le tabagisme, n’expliquent pas la fréquence observée au

cours de la MRC. D’autres facteurs non classiques tels que les toxines urémiques jouent un

rôle dans la pathologie cardiovasculaire au cours de la MRC.

Les toxines urémiques sont des composées normalement éliminées par le rein, qui

s’accumulent dans le sang et les tissus des patients avec une MRC (Vanholder et al. 2003).

Ces toxines sont classées en composés de petite taille hydrosoluble comme l’acide urique.

Composés de petite taille liée aux protéines, comme les indoles dont les principaux

représentants sont l’Indole-3 Acetique Acide (IAA) et l’Indoxyl Sulfate (IS), et les phénols

Introduction

21

Introduction

dont le chef de file est le Para Crésol Sulfate (pCS). Enfin, des composés dits moyennes

molécules comme la β2-microglobulin (Vanholder et al. 2003). Nos travaux se sont focalisés

sur les deux toxines urémiques indoliques liées aux protéines, l’Indole-3 Acétique Acide (IAA)

et l’Indoxyl Sulfate (IS). Ces toxines sont issues du métabolisme du tryptophane apporté par

l’alimentation. Du fait de leurs liaisons aux protéines (Jourde-Chiche et al. 2009), elles sont

mal épurées par la dialyse (Neirynck et al. 2013a) et s’accumulent chez les patients en stade

5D. L’accumulation d’indoles IAA et IS chez les patients atteints de MRC est impliqué dans les

évènements thrombotiques. Ces indoles induisent une dysfonction endothéliale et

plaquettaire favorisant la thrombose (Dou et al. 2015; Yang et al. 2017). Ils augmentent la

libération et l’activité de microparticules procoagulantes (Faure et al. 2006; Gondouin et al.

2013). Ils sont également associés à l’augmentation des facteurs plasmatiques

procoagulants, vWF et FT chez les patients MRC (Pawlak et al. 2009; Gondouin et al. 2013;

Kamiński et al. 2017).

Notre équipe a montré que l'IAA et l’IS augmentent l'expression et l'activité

procoagulante du FT dans les cellules endothéliales du cordon ombilical humain (HUVEC) et

dans les cellules mononucléaires périphériques sanguines (PBMC) (Gondouin et al. 2013). Ce

mécanisme est déterminant dans les survenues thrombotiques chez les patients avec une

MRC. Le but de notre travail était d’explorer les mécanismes cellulaires impliqués dans

l’expression du FT induit par l’IAA et l’IS.

Le Facteur Tissulaire (FT), aussi appelé « CD142 », « facteur III » ou « thromboplastine»,

est une glycoprotéine transmembranaire qui est l’initiateur de la voie dite extrinsèque de la

coagulation en cas de brèche vasculaire. La formation du complexe FT-facteur VII activé

déclenche l'activation des cascades de la coagulation, entrainant la génération de thrombine

et la formation de fibrine. Le FT est exprimé de manière constitutive dans les cellules de la

22

paroi vasculaire, comme les fibroblastes et les cellules musculaires lisses (vSMC), afin de

réduire les saignements après une lésion vasculaire (Camerer et al. 1996). En condition

normale, il n'est pas exprimé par les cellules qui sont en contact direct avec la circulation

sanguine, telle que les cellules endothéliales et les monocytes. Cependant, dans des

conditions pathologiques, il peut être exprimé de façon inductible par ces cellules favorisant

ainsi la formation d’un thrombus en activant la cascade de coagulation (Reny 2001,Bode and

Mackman 2014)(Figure 1).

Cette glycoprotéine de 47 kDa est synthétisée sous forme d’un propeptide de 295 AA qui

après clivage du peptide signale de 32 AA donne la protéine mature de 263 AA. Cette

protéine comporte un domaine extracellulaire (1-219 AA), un domaine transmembranaire

(220-242 AA) et un domaine cytoplasmique (243-263 AA). Le gène du FT est situé sur le

chromosome 1 en position 1p21-22, et est constitué de 12 400 paires de bases et comprend

6 exons séparés par 5 introns, une région 5' non transcrite comportant le promoteur du gène

et une région 3' non transcrite. La région codante comporte 885 paires de bases (Ternisien

and Prost 1995). Le promoteur du gène comporte, outre une TATA box, cinq motifs de type

SP1 dont trois sites de chevauchement avec les facteurs de transcription (zinc finger) Egr-1,

Olivier Reynard, et al, Medecine Sciences: M/S 31, no 2 (2015): 143‑50

Figure 1 : L’Expression anormale du FT active la cascade de coagulation

Introduction

23

Introduction

deux sites de type AP-1 et un site de type NF-B chevauchant le site de liaison du facteur

nucléaire des cellules T activées (NFAT) (Ternisien and Prost 1995; Cui et al. 1996; Ruf and

Riewald 2013; Bode and Mackman 2014)(Figure 2). Ces sites sont des séquences consensus

de l'ADN sur lesquelles peuvent se fixer des facteurs de transcription, AP-1, NF-B et Egr-1

responsables de la transcription inductible de F3 (gêne du FT) , et Sp1 qui est nécessaire

pour la transcription constitutive de F3 (Figure 2) (Oeth et al. 1997; Mackman 1997; Li et al.

2009).

L’IAA, l’IS, et la dioxine induisent l’expression du FT via le facteur de transcription l’Aryl

hydrocarbon receptor (AhR) dans les cellules endothéliales HUVEC et les monocytes

(Gondouin et al. 2013). La voie de signalisation responsable de cette expression est

inconnue.

Figure 2 : Induction du promoteur du facteur tissulaire humain (FT) dans les cellules

endothéliales.

24

AhR est un membre de la famille des facteurs de transcriptions basic helix-loop-helix/Per-

Arnt-Sim (bHLH/PAS)(Mandal 2005, Stevens et al. 2009). Il a été découvert dans les années

1990. La protéine de 96 kD (848 AA) est codée par le gène AHR de 47,5 kb, constitué de 11

exons et localisé sur le chromosome 7p21.1. La liaison d’un ligand à AhR permet l’activation

de la voie génomique en induisant sa translocation dans le noyau où il se fixera aux sites XRE

ou DRE dans le promoteur de nombreux gènes (Figure 3). Les ligands classiques sont les

contaminants environnementaux comme la dioxine TCDD (2,3,7,8-tetrachlorodibenzo-p-

dioxin), et les polychlorobiphényles (PCB) (Chevallier et al. 2011). Ces composés lipophiles

diffusent librement à travers les membranes cellulaires, et exercent leurs effets toxiques en

se liant à AhR. En absence de ligand, AhR forme un complexe cytoplasmique avec HSP90

(heat shock protein 90), XAP2 (hepatitis B virus X-associated protein 2) et une protéine

accessoire p23 (Petrulis and Perdew 2002). La fixation des ligands provoque sa libération du

complexe multimérique (Heid et al. 2000), sa translocation dans le noyau permet son

interaction avec ARNT (aryl-hydrocarbon nuclear translocator). L’hétérodimère, localisé dans

le noyau, peut reconnaître des séquences spécifiques sur les promoteurs des gènes cibles

(Dolwick et al. 1993). Il s’agit de motifs XRE (Xenobiotic Response Element), présents par

exemple en 5’ des gènes de la famille des cytochromes P450, dits de la phaseI (Fujii-

Kuriyama and Mimura 2005), comme CYP1A1, CYP1A2 ou CYP1B1 (Zanger and Schwab 2013)

(Figure 3). Ces enzymes jouent un rôle majeur dans le métabolisme des xénobiotiques, dont

les médicaments, et ont un rôle primordial dans la protection de l’organisme contre les

agressions extérieures (polluants, pesticides...). Parmi les gènes cibles d’AhR, on peut

également citer AHRR (Aryl hydrocarbon receptor répressor) qui assure le rétrocontrôle de

la voie AhR.

Introduction

https://en.wikipedia.org/wiki/Basic_helix-loop-helix

https://en.wikipedia.org/wiki/PAS_domain

https://en.wikipedia.org/wiki/PAS_domain

25

Récemment, une nouvelle voie génomique d’AhR indépendante de l'ARNT pour

l'expression génique a été décrite (Jackson et al. 2015), avec un nouveau XRE non-consensus

(NC-XRE), dans les promoteurs de PAI-1 (Huang and Elferink 2012) et de p21Cip1 (Jackson et

al. 2014). Une voie non génomique d’AhR indépendante de l'ARNT induisant l’inflammation

a également été décrite (Zhao et al. 2002; Sciullo et al. 2008; Matsumura 2009; Kim et al.

2012). En effet, il a été montré que des ligands d’AhR, tels que la TCDD, induisent

l'expression de protéines impliquées dans l'inflammation comme l'IL-6, RANTES, TNF et COX-

2 (Zhao et al. 2002; Sciullo et al. 2008; Kim et al. 2012). Dans la voie non-génomique, AhR

agit comme une molécule de signalisation qui interagit avec plusieurs voies de signalisation

(Borlak and Jenke 2008; Henklová et al. 2008; Ma et al. 2009; Puga et al. 2009). Notre équipe

a récemment rapporté que l’IAA induit la COX-2 endothéliale via une voie non-génomique

d’AhR impliquant la signalisation p38MAPK/NF-B (Dou et al. 2015).

L'objectif du travail était de déterminer les voies de signalisation et les facteurs de

transcription impliqués dans l'induction du FT médiée par AhR en réponse à l’IAA et l’IS.

, AHRR

Figure 3 : Activation de la voie classique génomique de l’Aryl Hydrocarbon Receptor (AHR)

Introduction

26

Introduction

L’activation d’AhR est impliquée dans la pathogénie des maladies cardiovasculaires

(Korashy and El-Kadi 2006; Wu et al. 2011; Ansari et al. 2013), dont les événements

thrombotiques chez les patients avec une MRC (Shivanna et al. 2016; Kolachalama et al.

2018). L’induction du FT par l’IAA et l’IS via AhR, semble être un mécanisme clé dans la

survenue des événements thrombotiques chez ces patients. Ce mécanisme pourrait en effet

être lié aux taux élevés de FT circulant (FTc) observés chez les patients MRC (Gondouin et al.

2013; Shivanna et al. 2016). C’est pourquoi dans cette thèse nous avons également étudié le

lien entre les toxines indoliques et le FTc chez des patients MRC hémodialysés (HD).

Outre l’effet thrombotique, l’IAA et l’IS favorisent l’inflammation, le stress oxydant et

l’athérosclérose (Dou et al. 2015; Gao and Liu 2017), augmentant ainsi les risques des

maladies cardiovasculaires. En effet, l’augmentation de ces toxines dans les sérums des

patients MRC est prédicteur des complications cardiovasculaires et de la mortalité chez ces

patients (Lin et al. 2012; Lin et al. 2013; Dou et al. 2015). Chez les patients urémiques, la

concentration sérique moyenne de l’IAA est de 5,9µM, et de 81,04µM pour l’IS (Calaf et al.

2011), tandis que chez des sujets sains la concentration de l’IAA est de 2,12µM et de 1,03µM

d’IS. Cependant, ces taux peuvent varier d’une population à une l’autre (Vanholder et al.

2003). Dans la littérature, nous ne disposons que de données des taux de toxines urémiques

dérivées du tryptophane de patients vivants dans des pays occidentaux. Les taux de l’IAA et

de l’S n’ont jusqu'à présent jamais été dosés dans une population hémodialysée algérienne.

C’est pourquoi, dans ce travail de thèse, nous avons déterminé les taux de ces toxines dans

le sérum d’une population HD en Algérie de la ville d’Oran, puis comparé avec les taux d’une

population HD en France de la ville de Marseille. Les indoles, IAA et IS sont issus du

métabolisme du tryptophane par l’apport nutritionnel, qui est principalement métabolisé

par le microbiote intestinal. Ainsi, il est logique de penser qu’un régime alimentaire différent

27

et une flore intestinale variant d’une population à une autre en fonction des différents

facteurs culturels, sociaux, environnementaux et surtout nutritionnels de différents pays,

puissent jouer un rôle important dans la variabilité des taux sériques de l’IAA et l’IS. Nous

avons fait l’hypothèse que des différences de taux sériques pourraient être observées entre

la cohorte de patients HD oranaise et marseillaise. Il s’agit du premier travail clinique sur ces

toxines dans un pays du Sud.

Introduction

28


2. Revue bibliographique

Je propose un article de synthèse bibliographique comme révision de l’état de la

littérature ;

La revue de synthèse sous le titre de “Tryptophan-Derived Uremic Toxins and Thrombosis

in Chronic Kidney Disease” résume les effets thrombotiques de l’accumulation des toxines

urémiques dérivées du tryptophane (TUDT) chez les patients atteints de maladie rénale

chronique. Cette revue décrit également les différents mécanismes thrombotiques activés

par les TUDT. L’induction du facteur tissulaire via une nouvelle voie dépendante du facteur

de transcription Aryl hydrocarbon receptor, représente un des mécanismes clés dans les

survenues thrombotiques chez les patients MRC. Une meilleure compréhension des

mécanismes prothrombotiques induits par les TUDT pourrait aider à trouver de nouvelles

cibles thérapeutiques pour prévenir la thrombose chez les patients MRC.

29


Abstract: Patients with chronic kidney disease (CKD) display an elevated risk of

thrombosis.

Thrombosis occurs in cardiovascular events, such as venous thromboembolism,

stroke, and acute coronary syndrome, and is a cause of hemodialysis vascular access

dysfunction. CKD leads to the accumulation of uremic toxins, which exerts toxic

effects on blood and the vessel wall. Some uremic toxins result from tryptophan

metabolization in the gut through the indolic and the kynurenine pathways. An

increasing number of studies are highlighting the link between such uremic toxins

and thrombosis in CKD. In this review, we describe the thrombotic mechanisms

induced by tryptophan-derived uremic toxins (TDUT). These mechanisms include an

increase in plasma levels of procoagulant factors, induction of platelet hyperactivity,

induction of endothelial dysfunction/ impairment of endothelial healing, decrease in

nitric oxide (NO) bioavailability, and production of procoagulant microparticles. We

focus on one important prothrombotic mechanism: The induction of tissue factor

(TF), the initiator of the extrinsic pathway of the blood coagulation. This induction

occurs via a new pathway, dependent on the transcription factor Aryl hydrocarbon

receptor (AhR), the receptor of TDUT in cells. A better understanding of the

prothrombotic mechanisms of uremic toxins could help to find novel therapeutic

targets to prevent thrombosis in CKD.

Keywords: uremic toxins; thrombosis; chronic kidney disease; tryptophan

Key Contribution: This review summarizes the thrombotic effects of tryptophan-

derived uremic toxins, and provides an insight into the mechanisms involved.

Toxins 2018,10,412; doi:10.3390/toxins10100412 www.mdpi.com/journal/toxins

30


1. Introduction

Chronic kidney disease (CKD) is defined as the occurrence of abnormalities of

kidney structure or function, present for >3 months [1]. A decreased glomerular

filtration rate (GFR) to less than 60 mL/min per 1.73 m2 is the commonest

manifestation of CKD [2]. The decline of GFR is related to a substantial risk of

mortality and cardiovascular disease (CVD) [3–6]. CVDs such as congestive heart

failure, coronary artery disease, cerebrovascular disease, peripheral arterial diseases,

atrial fibrillation, and sudden cardiac death represent cardiovascular pathologies that

occur in patients with CKD [5,6].

Thrombosis is in the heart of the three major cardiovascular events: Ischemic

stroke, ischemic heart disease, and venous thromboembolism [7]. CKD patients

display an increased thrombotic risk, paradoxically associated with a bleeding

tendency [8,9]. In CKD, thrombotic events occur in the cerebral, coronary, and retinal

arteries, in the deep venous system, heart, and at sites of vascular access in

hemodialysis patients [10]. Thrombus formation in arteries is often associated with

atherosclerosis [8]. The risk of pulmonary embolism and deep vein thrombosis is

significantly increased in CKD patients [11]. Moderate decrease in kidney function

(30 < eGFR < 60 mL/min per 1.73 m2) and severe decrease in kidney function (eGFR <

30 mL/min per 1.73 m2) are respectively associated with a 2.5-fold and a 5.5-fold

increase in venous thrombosis risk [12]. CKD patients display a higher mortality rate

than patients with normal kidney function due to pulmonary embolism [8]. In CKD

patients, the atrial fibrillation risk is higher and associated with an increased

neurovascular risk [13]. In hemodialysis patients, thrombosis can complicate stenosis,

leading to access failure [14].

2. Uremic Toxins from Tryptophan Metabolism

CKD leads to the accumulation of uremic toxins [15]. This accumulation exerts a

deleterious effect on multiple organs/systems [15]. In 2003, the European Uremic

Toxin Work Group (EUTOX) classified 90 uremic compounds. The number of

compounds has been extended since [15]. The classification of uremic toxins includes

three groups: Small water-soluble molecules (≤ 500 Da); middle molecules (>500 Da);

and protein-bound molecules [15].

Some uremic toxins result from tryptophan metabolism through the indolic and

the kynurenine pathways [16]. Dietary tryptophan is metabolized by the gut

microbiota via three major pathways, leading to serotonin, kynurenines, and indole

derivatives [16]. The kynurenine pathway that metabolizes 95% of tryptophan is

mediated by enzymes tryptophan 2,3-dioxygenase (TDO) and indoleamine 2,3-

dioxygenase (IDO). The activity of IDO leads to kynurenine from tryptophan and is

31


reflected by the kynurenine/tryptophan ratio (KTR). Then, various metabolites can

derive from kynurenine (KYN): 3 hydroxyanthranilic acid (3-HAA), 3-

hydroxykynurenine (3-HKYN), kynurenic acid (KYNA), anthranilic acid (AA), and

quinolinic acid (QA) [16]. The concentration of all kynurenine metabolites is

increased in CKD patients, while tryptophan decreases. The indolic pathway leads to

the indolic uremic toxins indoxyl sulfate (IS), indoxyl-β-D-glucuronide, and indole-3-

acetic acid (IAA) [16]. In this pathway, tryptophan is converted to indole by the gut

microbiota and absorbed into the blood circulation, then oxidized and sulfated in the

liver by the microsomal p450 cytochrome CYP2E1 enzyme and sulfatase (SULT1A1)

to form IS [17]. IAA is directly produced in the gut from tryptophan metabolism, or

endogenously in tissue via tryptamine [16]. Because they are protein-bound, IS and

IAA are badly cleared by dialysis [18].

3. Tryptophan-Derived Uremic Toxins and Thrombotic Events

An increasing number of studies are highlighting the link between tryptophan

metabolites and thrombotic events in CKD. Studies support a role of tryptophan-

derived uremic toxins (TDUT) and vascular access thrombosis in hemodialysis

patients. Using multivariate Cox regression analysis in 306 patients undergoing

endovascular interventions for dialysis access dysfunction, Wu et al. reported the

amount of free IS predicts vascular access thrombosis, suggesting serum IS is a new

risk factor for post-angioplasty thrombosis [19]. In 473 patients with advanced CKD,

Chitalia et al. also demonstrated that patients with subsequent arteriovenous fistula

(AVF) thrombosis had higher levels of IS, KYN, and KYNA than those without

thrombosis [20]. Studies also showed the association of TDUT with cardiovascular

events in CKD patients. KYN, 3-HKYN, KYNA, and KTR plasma concentrations are

associated with increased risk of myocardial infarction [21–23]. In a cohort of CKD

patients, Barreto et al. have shown IS predicts cardiovascular mortality [24]. In 120

patients with CKD, we demonstrated serum IAA predicts cardiovascular events and

mortality, even after adjustment for CKD stage [25].

TDUT have an impact on thrombus formation. In Wistar rats, Karbowska et al.

demonstrated that IS increases the weight of thrombus after vascular injury [26]. In

mice exposed to high doses of IS, greater thrombus formation was observed after

laser-induced endothelial injury, compared to non-IS exposed mice [26]. Another

study showed that KYN enhances thrombosis after vascular injury in mice [20].

Chitalia’s group demonstrated that treatment of vascular smooth muscle cells

(vSMC) by IS or IAA increases their thrombogenicity [27]. An important clot

formation was observed in primary human vSMC pretreated with IS or IAA when

exposed to coronary-like blood flow in an ex-vivo flow loop model [28].

32


4. Thrombotic Mechanisms Induced by Tryptophan-Derived Uremic Toxins

After an endothelial lesion or a blood vessel injury, subendothelial components are

exposed to the blood and activate the process of hemostasis to initiate a blood clot

formation [29]. The platelet plug formation involves platelet activation, adhesion to

exposed subendothelial matrix components, and platelet aggregation [29]. Several

platelet receptors and adhesive proteins, like the von Willebrand factor (vWF),

fibrinogen, or collagen, as well as platelet-derived agonists, are involved in the

interactions that normally occur only in the case of a vessel injury [29]. At the site of

injury, the tissue factor (TF) from the vessel wall initiates the extrinsic pathway of the

coagulation cascade. The complex TF/factor VIIa leads to the generation of factor Xa,

which proteolytically cleaves prothrombin to form thrombin. Thrombin then

mediates fibrin generation and platelet activation [29]. The coagulation cascade is

also down-regulated by different factors, such as serine protease inhibitors

antithrombin and tissue factor pathway inhibitor (TFPI) [29]. The deposition of

insoluble fibrin and its incorporation into and around the platelet plug strengthen

and stabilize the blood clot [29]. The fibrinolysis pathway, which breaks down the

fibrin clot, also plays a substantial role in hemostasis [29]. In this pathway, tissue

plasminogen activator (t-PA) released by the injured endothelium, and urokinase

(uPA) in the presence of its receptor (uPAR) convert plasminogen to plasmin, which

cleaves and destroys fibrin. Within the clot, t-PA activates plasminogen, which

decomposes the fibrin mesh. t-PA and urokinase are inhibited by plasminogen

activator inhibitor-1 and -2 (PAI-1 and PAI-2) [29].

A controlled balance between procoagulant and anticoagulant systems is essential,

and a dysregulation can lead to pathological bleeding, or pathological thrombus

formation, that is, thrombosis [29]. CKD, as well as TDUT, induce a profound

deregulation of the mechanisms of hemostasis that affects all the players involved.

4.1. Deregulation of Plasma Coagulation Factors

Several abnormalities in plasma factors of hemostasis are reported in CKD

patients. These abnormalities are in favor of a hypercoagulable state, with enhanced

levels of vWF, fibrinogen, thrombin, factor VII, TF, and PAI-1 [10,30], as well as

reduced antithrombin activity [30]. In patients with CKD, we found that the

concentration of circulating TF positively correlates with plasma levels of IS and IAA

[31]. IS level also correlates with TF procoagulant activity [32] and with vWF in CKD

patients [33]. Kynurenine is positively associated with vWF [34] and with

prothrombin fragments F(1+2), reflecting hypercoagulability in CKD patients [35].

AA is also significantly associated with TF and prothrombin fragments F(1+2) [35],

and negatively correlated with the fibrinolytic system uPA/uPAR in severe-to-end-

33


stage CKD [36]. QA is positively associated with vWF [34], TF, and prothrombin

fragments F(1+2) [35]. 3-hydroxykynurenine is positively associated with vWF [34]

and with the TF/TFPI system [37] in CKD patients.

4.2. Platelet Hyperactivity

CKD is associated with both platelet dysfunction and activation [38,39]. Platelet

activity is increased in CKD mice that display increased IS levels [40]. Ex vivo and in

vitro, IS increases platelet activity, including an enhanced response to collagen and

thrombin, increase in platelet microparticle production, and increase in platelet–

monocyte aggregates [40]. In addition, IS-mediated platelet activation takes part in

thrombus formation ex vivo and in vivo [40]. Reactive oxygen species (ROS)-induced

p38MAPK signaling in platelets plays a crucial role in IS-induced platelet activation

[40]. The inhibition of the ROS/p38 activation pathway by the ROS scavenger N-

acetylcysteine (NAC) suppresses IS-induced platelet hyperactivation and platelet–

monocyte aggregates, and strikingly attenuates IS-induced thrombus formation [40].

4.3. Endothelial Dysfunction

The vascular endothelium is essential for maintaining hemostasis and preventing

thrombosis [41]. Healthy endothelial cells maintain an anticoagulant surface by

expressing molecules that prevent platelet aggregation and fibrin formation [41].

When dysfunctional or activated, the endothelium can become prothrombotic and

proinflammatory [41].

In CKD patients, endothelium dysfunction begins in the early stages of CKD [42]

and takes a substantial part in thrombotic events [43]. In hemodialysis patients,

endothelial injury is associated with an increased risk of AVF thrombosis [44–46].

The modifications of hemodynamic stress in vascular access and the accumulation of

uremic toxins play a major role in endothelium dysfunction [45]. Tryptophan-

derived indolic toxins induce a profound endothelial dysfunction, characterized by a

procoagulant, pro-oxidant and proinflammatory phenotype [16,25]. In case of injury,

these toxins could impair endothelial healing and vessel repair by inhibiting

endothelial proliferation and migration, inducing endothelial senescence [16], and

promoting progenitor cell apoptosis [44]. Another aspect of endothelial function is

the generation of pro- and anticoagulant prostaglandins, which play an important

role in hemostasis. Notably, endothelial cells produce Prostaglandin E2 (PGE2),

which is generated by cyclooxygenases (COX) from arachidonic acid. PGE2 elicits

platelet aggregation via its binding on platelet EP3 receptors and promotes

thrombosis [47,48]. We demonstrated that IAA induces COX-2 expression in cultured

endothelial cells via an aryl hydrocarbon receptor (AhR)/p38MAPK/Nuclear Factor

kappa B (NF-B) pathway [25]. Importantly, this increase in COX-2 enhances

34


endothelial PGE2 synthesis [25], suggesting that IAA could promote platelet

aggregation via endothelial synthesis of COX-2/PGE-2.

4.4. Decrease in NO Bioavailability

Nitric oxide (NO) released from endothelium and platelets prevents platelet

adhesion to the vessel wall and inhibits platelet recruitment, aggregation, and

activity [49]. NO supplies a negative feedback mechanism for thrombus propagation,

and bioactive NO deficiency is associated with platelet dysfunction and arterial

thrombosis [49]. CKD patients display NO deficiency, mainly to high concentration

of the endogenous NO Synthase (NOS) inhibitor asymmetric dimethylarginine

(ADMA), and defects in NOS activity [50]. Importantly, the increase in oxidative

stress in CKD patients further reduces NO bioavailability [50]. Reactive oxygen

species (ROS) have many effects on NO bioavailability: ROS increase ADMA levels,

the ROS superoxide can react with NO to produce peroxynitrite that depletes the

bioactivity of NO, and ROS oxidize tetrahydrobiopterin (BH4), which is crucial for

eNOS activity [50]. Tryptophan-derived indolic toxins affect NO production: IS

inhibits NO production in endothelial cells [51], but increases it in mononuclear cells

[52]. In parallel, these toxins increase ROS production in blood mononuclear cells [52]

and in vascular endothelial cells [25,53] by increasing endothelial NAD(P)H oxidase

activity and decreasing the cellular amount of the antioxidant glutathione [53]. Thus,

by favoring a pro-oxidant environment, indolic toxins could decrease NO

bioavailability and thus contribute to increased platelet reactivity.

4.5. Production of Procoagulant Microparticles

CKD patients display high plasma levels of microparticles from platelet and

endothelium [54,55]. Microparticles are membrane fragments that result from the

remodeling of plasma membrane in response to activation or apoptosis [55].

Microparticles expose on their surfaces both phosphatidylserine, which facilitates the

transformation of prothrombin to thrombin; and TF, which leads to thrombin

generation, thus conferring a procoagulant potential [56,57]. Microparticles

exhibiting TF are able to form a thrombus in vivo [58]. In vitro, we have shown that

IS significantly enhances the release of microparticles by the endothelium [54].

Importantly, microparticles from endothelial cells incubated with indolic toxins

exhibit a higher procoagulant activity [31]. Gao et al. also reported that IS and IAA

enhance the procoagulant activity of red blood cells through releasing microparticles

and exposing phosphatidyserine [59].

35


4.6. Overexpression of Cell Tissue Factor

TF induction in vascular cells by TDUT could be an important prothrombotic

mechanism. TF is constitutively expressed in vascular wall cells, like fibroblasts and

vSMC, to reduce bleeding after a vascular lesion [41]. TF is usually not expressed in

endothelium, but activated endothelium and leukocytes could express active TF after

a vascular lesion or inflammation [41]. Blood-borne TF comes mainly from

leukocytes, platelets, and TF-bearing microparticles or circulates as a soluble protein

[60]. TF exists as an encrypted form, with little or no procoagulant activity, which

becomes activated (decrypted) upon vascular stimulation or injury [41].

In human aortic smooth muscle cells (SMC) that constitutively express TF, IS and

KYN, as well as uremic serum, induce TF overexpression and increase its activity

[20,27,61,62]. A prior treatment with an anti-TF neutralizing antibody reduces clot

formation in vSMC exposed to coronary flow [27]. We reported that indolic toxins IS

and IAA also induce TF expression in various types of cultured human endothelial

cells that usually not express TF [31,63], as well as in leukocytes [31]. IS and IAA

exacerbates the procoagulant activity of TF in endothelial cells and in endothelial

microparticles [31]. In vivo, TF activity is greater in CKD patients with subsequent

arteriovenous thrombosis than in those without thrombosis [20].

We demonstrated that TF induction by IS and IAA in endothelial cells occurred via

a new pathway, dependent on the transcription factor AhR [31]. AhR is a receptor of

some environmental contaminants, like 2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD)

[64]. Indolic toxins IS, IAA, as well as kynurenines are potent endogenous agonists of

AhR [16,65]. In resting cells, AhR forms a complex in the cytoplasm with HSP90,

XAP2, and p23 [65]. Activation of the AhR genomic pathway by ligand binding

causes AhR release from the heterodimeric complex and its interaction with its

nuclear translocator ARNT (Aryl Hydrocarbon Nuclear Translocator) [65]. In the

nucleus, the AhR/ARNT heterodimer recognizes specific XRE (Xenobiotic Response

Elements) sequences on the promoters of AhR target genes, like genes of the

cytochrome P450 family: CYP1A1, CYP1A2, or CYP1B1 [65]. Once activated by

ligand, AhR can also cross-talk with multiple signaling pathways and elicit

inflammation through a non-genomic pathway that does not require ARNT [66]. This

non-genomic inflammatory pathway of AhR is involved in the induction of

inflammatory genes, such as IL-1, IL-8, MCP-1, and COX-2 [25,67].

In endothelial cells, AhR inhibitors and AhR si RNA completely inhibit TF

induction by indolic toxins [31,63]. We further showed that IAA induces endothelial

TF expression via a non-genomic inflammatory pathway of AhR that induces

p38MAPK and NF-B activation [63]. In vSMC, IS extends TF half-life by reducing TF

ubiquitination [27]. Shivanna et al. demonstrated that AhR activated by IS directly

36


interacts with and stabilizes functional TF [32]. AHR regulates TF through STUB1, an

ubiquitin ligase, which interacts with TF and degrades it through ubiquitination [68].

Consequently, IS thrombogenicity is significantly abrogated by the AHR antagonist

in a flow loop ex vivo model [32]. KYN also increases TF expression via AhR in

primary human aortic SMC [20] and regulates thrombosis after a carotid lesion in

mice in an AhR-dependent way [20]. We demonstrated that patients and mice with

CKD have high amounts of AhR agonists associated with cellular activation of AhR

[69]. In 116 CKD patients, we further observed that cardiovascular events are more

frequent in patients with high levels of AhR agonists [69]. In CKD patients, Shivanna

et al. demonstrated IS levels correlate with AHR-inducing activity of serum and with

TF activity [32]. CKD patients with arteriovenous thrombosis have a significant

greater activity of AHR and TF than those without thrombosis [20]. AhR plays an

important role in platelet production [70,71] and function [72]. The activation of the

AhR/p38 MAPK pathway was observed in platelets in response to AhR agonists and

resulted in enhanced platelet aggregation [73]. Therefore, AHR activation by TDUT

could affect primary hemostasis, in addition to activation of coagulation, and could

be a new prothrombotic mechanism in CKD patients. Clinical studies are now

necessary to demonstrate that targeting AhR activation could be a new therapeutic

option for preventing thrombosis in CKD patients.

5. Modulation of Microbiota and Diet to Reduce TDUT Production

Considering that TDUT arise from the metabolization of dietary tryptophan by the

gut microbiota [16] and that gut dysbiosis begins in the initial stages of CKD [74],

modifications of diet and/or use of prebiotics, probiotics, and symbiotics is a

tempting approach. Results on probiotic therapies in CKD are conflicting. In a recent

study, probiotic supplementation failed to reduce plasma levels of IS, IAA, and

inflammatory markers in HD patients [75], whereas it decreased serum levels of IS in

another study [76]. In CKD patients, symbiotic therapy did not significantly reduce

serum IS [77], but probiotics may be interesting to reduce inflammation [74]. Results

from diet modifications seem more promising. A low protein-diet reduces plasma

levels of IS and urine levels of IS, indoxyl glucuronide, KA, and QA in healthy

subjects [78]. In hemodialyzed patients, an increase in dietary fibers reduces the

plasma levels of IS [79]. Finally, a diet with a higher proportion of protein from plant

sources is associated with lower levels of IS [80] and with lower mortality rates in

patients with CKD [81].

37


6. Conclusions

TDUT accumulating in patients with CKD could induce thrombosis via several

mechanisms: Activation of primary hemostasis and coagulation, endothelial

dysfunction, decrease in NO bioavailability, and production of procoagulant

microparticles (Figure 1). One important prothrombotic mechanism is the induction

of tissue factor via AhR (Figure 1). This uremic toxins/AhR/TF axis may offer new

therapeutic options to prevent thrombosis in CKD.

Figure 1. Mechanisms of tryptophan-derived uremic toxins promoting thrombosis.

Tryptophan derived uremic toxins promote thrombosis by inducing platelet

hyperactivity, endothelial dysfunction, production of endothelial and platelet

microparticles, and TF expression on monocytes, vSMC, and EC. TF induction is

mediated by AhR activation. A decrease in NO bioavailability and an induction of

ROS in platelets and endothelial cells participate in the thrombotic effects of

tryptophan derived uremic toxins. AhR: Aryl hydrocarbon Receptor; TF: Tissue

Factor; EC: Endothelial cells, vSMC: Vascular smooth muscle cells; ROS: Reactive

oxygen species; NO: Nitric Oxide.

Author Contributions: All authors participated in the redaction and review of the

manuscript.

Funding: This research received no external funding.

Acknowledgments: We thank University of Oran 1 Ahmed Benbella for the PhD

student granting of T.A.

Conflicts of Interest: The authors declare no conflicts of interest.

38


References

1. Levin, A.; Stevens, P.; Bilous, R.W.; Coresh, J.; De Francisco, A.L.; De Jong, P.E.;

Griffi, K.E.; Hemmelgarn, B.R.; Isek, K.; Lamb, E.J.; et al. KDIGO clinical practice

guideline for the evaluation and management of chronic kidney disease. Chapter 1:

Definition and classification of CKD. Kidney Int. Suppl. 2013, 3, 19–62. [CrossRef]

2. Stevens, P.E.; Levin, A. Kidney Disease: Improving Global Outcomes Chronic

Kidney Disease Guideline DevelopmentWork Group Members Evaluation and

management of chronic kidney disease: Synopsis of the kidney disease: Improving

global outcomes 2012 clinical practice guideline. Ann. Intern. Med. 2013, 158, 825–

830. [CrossRef] [PubMed]

3. Coresh, J.; Turin, T.C.; Matsushita, K.; Sang, Y.; Ballew, S.H.; Appel, L.J.; Arima, H.;

Chadban, S.J.; Cirillo, M.; Djurdjev, O.; et al. Decline in estimated glomerular

filtration rate and subsequent risk of end-stage renal disease and mortality. JAMA

2014, 311, 2518–2531. [CrossRef] [PubMed]

4. Di Angelantonio, E.; Danesh, J.; Eiriksdottir, G.; Gudnason, V. Renal function and

risk of coronary heart disease in general populations: New prospective study and

systematic review. PLoS Med. 2007, 4, e270. [CrossRef] [PubMed]

5. Herzog, C.A.; Asinger, R.W.; Berger, A.K.; Charytan, D.M.; Díez, J.; Hart, R.G.;

Eckardt, K.-U.; Kasiske, B.L.; McCullough, P.A.; Passman, R.S.; et al. Cardiovascular

disease in chronic kidney disease. A clinical update from Kidney Disease: Improving

Global Outcomes (KDIGO). Kidney Int. 2011, 80, 572–586. [CrossRef] [PubMed]

6. Go, A.S.; Chertow, G.M.; Fan, D.; McCulloch, C.E.; Hsu, C.Y. Chronic kidney

disease and the risks of death, cardiovascular events, and hospitalization. N. Engl. J.

Med. 2004, 351, 1296–1305. [CrossRef] [PubMed]

7. Raskob, G.E.; Angchaisuksiri, P.; Blanco, A.N.; Buller, H.; Galluse, A.; Hunt, B.J.;

Hylek, E.M.; Kakkar, A.; Konstantinidesi, S.V.; McCumber, M.; et al. ISTH Steering

Committee for World Thrombosis Day Thrombosis: A major contributor to global

disease burden. Thromb. Res. 2014, 134, 931–938. [CrossRef] [PubMed]

8. Lutz, J.; Menke, J.; Sollinger, D.; Schinzel, H.; Thurmel, K. Haemostasis in chronic

kidney disease. Nephrol. Dial. Transplant. 2014, 29, 29–40. [CrossRef] [PubMed]

9. Parikh, A.M.; Spencer, F.A.; Lessard, D.; Emery, C.; Baylin, A.; Linkletter, C.;

Goldberg, R.J. Venous thromboembolism in patients with reduced estimated GFR: A

population-based perspective. Am. J. Kidney Dis. 2011, 58, 746–755. [CrossRef]

[PubMed]

10. Pavord, S.; Myers, B. Bleeding and thrombotic complications of kidney disease.

Blood Rev. 2011, 25, 271–278. [CrossRef] [PubMed]

39


11. Wattanakit, K.; Cushman, M.; Stehman-Breen, C.; Heckbert, S.R.; Folsom, A.R.

Chronic kidney disease increases risk for venous thromboembolism. J. Am. Soc.

Nephrol. 2008, 19, 135–140. [CrossRef] [PubMed]

12. Ocak, G.; Lijfering, W.M.; Verduijn, M.; Dekker, F.W.; Rosendaal, F.R.;

Cannegieter, S.C.; Vossen, C.Y. Risk of venous thrombosis in patients with chronic

kidney disease: Identification of high-risk groups. J. Thromb. Haemost. 2013, 11, 627–


13. Carrero, J.J.; Trevisan, M.; Sood, M.M.; Bárány, P.; Xu, H.; Evans, M.; Friberg, L.;

Szummer, K. Incident Atrial Fibrillation and the Risk of Stroke in Adults with

Chronic Kidney Disease: The Stockholm CREAtinine Measurements (SCREAM)

Project. Clin. J. Am. Soc. Nephrol. 2018, 13, 1314–1320. [CrossRef] [PubMed]

14. Viecelli, A.K.; Mori, T.A.; Roy-Chaudhury, P.; Polkinghorne, K.R.; Hawley, C.M.;

Johnson, D.W.; Pascoe, E.M.; Irish, A.B. The pathogenesis of hemodialysis vascular

access failure and systemic therapies for its prevention: Optimism unfulfilled. Semin.

Dial. 2018, 31, 244–257. [CrossRef] [PubMed]

15. Vanholder, R.; Pletinck, A.; Schepers, E.; Glorieux, G. Biochemical and Clinical

Impact of Organic Uremic Retention Solutes: A Comprehensive Update. Toxins 2018,


16. Sallee, M.; Dou, L.; Cerini, C.; Poitevin, S.; Brunet, P.; Burtey, S. The aryl

hydrocarbon receptor-activating effect of uremic toxins from tryptophan metabolism:

A new concept to understand cardiovascular complications of chronic kidney

disease. Toxins 2014, 6, 934–949. [CrossRef] [PubMed]

17. Meyer, T.W.; Hostetter, T.H. Uremic solutes from colon microbes. Kidney Int.

2012, 81, 949–954. [CrossRef] [PubMed]

18. Neirynck, N.; Glorieux, G.; Schepers, E.; Pletinck, A.; Dhondt, A.; Vanholder, R.

Review of protein-bound toxins, possibility for blood purification therapy. Blood

Purif. 2013, 35 (Suppl. 1), 45–50. [CrossRef]

19. Wu, C.-C.; Hsieh, M.-Y.; Hung, S.-C.; Kuo, K.-L.; Tsai, T.-H.; Lai, C.-L.; Chen, J.-

W.; Lin, S.-J.; Huang, P.-H.; Tarng, D.-C. Serum Indoxyl Sulfate Associates with

Postangioplasty Thrombosis of Dialysis Grafts. J. Am. Soc. Nephrol. 2016, 27, 1254–


20. Kolachalama, V.B.; Shashar, M.; Alousi, F.; Shivanna, S.; Rijal, K.; Belghasem,

M.E.;Walker, J.; Matsuura, S.; Chang, G.H.; Gibson, C.M.; et al. Uremic Solute-Aryl

Hydrocarbon Receptor-Tissue Factor Axis Associates with Thrombosis after Vascular

Injury in Humans. J. Am. Soc. Nephrol. 2018, 29, 1063–1072. [CrossRef] [PubMed]

21. Eussen, S.J.P.M.; Ueland, P.M.; Vollset, S.E.; Nygård, O.; Midttun, Ø.; Sulo, G.;

Ulvik, A.; Meyer, K.; Pedersen, E.R.; Tell, G.S. Kynurenines as predictors of acute

40


coronary events in the Hordaland Health Study. Int. J. Cardiol. 2015, 189, 18–24.

[CrossRef] [PubMed]

22. Sulo, G.; Vollset, S.E.; Nygård, O.; Midttun, Ø.; Ueland, P.M.; Eussen, S.J.P.M.;

Pedersen, E.R.; Tell, G.S. Neopterin and kynurenine-tryptophan ratio as predictors of

coronary events in older adults, the Hordaland Health Study. Int. J. Cardiol. 2013,

168, 1435–1440. [CrossRef] [PubMed]

23. Yu, E.; Ruiz-Canela, M.; Guasch-Ferré, M.; Zheng, Y.; Toledo, E.; Clish, C.B.;

Salas-Salvadó, J.; Liang, L.; Wang, D.D.; Corella, D.; et al. Increases in Plasma

Tryptophan Are Inversely Associated with Incident Cardiovascular Disease in the

Prevención con Dieta Mediterránea (PREDIMED) Study. J. Nutr. 2017, 147, 314–322.

[CrossRef] [PubMed]

24. Barreto, F.C.; Barreto, D.V.; Liabeuf, S.; Meert, N.; Glorieux, G.; Temmar, M.;

Choukroun, G.; Vanholder, R.; Massy, Z.A. Serum indoxyl sulfate is associated with

vascular disease and mortality in chronic kidney disease patients. Clin. J. Am. Soc.

Nephrol. 2009, 4, 1551–1558. [CrossRef] [PubMed]

25. Dou, L.; Sallée, M.; Cerini, C.; Poitevin, S.; Gondouin, B.; Jourde-Chiche, N.;

Fallague, K.; Brunet, P.; Calaf, R.; Dussol, B.; et al. The cardiovascular effect of the

uremic solute indole-3 acetic acid. J. Am. Soc. Nephrol. 2015, 26, 876–887. [CrossRef]

[PubMed]

26. Karbowska, M.; Kaminski, T.W.; Marcinczyk, N.; Misztal, T.; Rusak, T.; Smyk, L.;

Pawlak, D. The Uremic Toxin Indoxyl Sulfate Accelerates Thrombotic Response after

Vascular Injury in Animal Models. Toxins 2017, 9, 229. [CrossRef] [PubMed]

27. Chitalia, V.C.; Shivanna, S.; Martorell, J.; Balcells, M.; Bosch, I.; Kolandaivelu, K.;

Edelman, E.R. Uremic serum and solutes increase post-vascular interventional

thrombotic risk through altered stability of smooth muscle cell tissue factor.

Circulation 2013, 127, 365–376. [CrossRef] [PubMed]

28. Kolandaivelu, K.; Swaminathan, R.; Gibson, W.J.; Kolachalama, V.B.; Nguyen-

Ehrenreich, K.-L.; Giddings, V.L.; Coleman, L.; Wong, G.K.; Edelman, E.R. Stent

thrombogenicity early in high-risk interventional settings is driven by stent design

and deployment and protected by polymer-drug coatings. Circulation 2011, 123,

1400–1409. [CrossRef] [PubMed]

29. Gale, A.J. Current Understanding of Hemostasis. Toxicol. Pathol. 2011, 39, 273–


30. Jalal, D.I.; Chonchol, M.; Targher, G. Disorders of hemostasis associated with

chronic kidney disease. Semin. Thromb. Hemost. 2010, 36, 34–40. [CrossRef]

[PubMed]

31. Gondouin, B.; Cerini, C.; Dou, L.; Sallée, M.; Duval-Sabatier, A.; Pletinck, A.;

Calaf, R.; Lacroix, R.; Jourde-Chiche, N.; Poitevin, S.; et al. Indolic uremic solutes

41


increase tissue factor production in endothelial cells by the aryl hydrocarbon receptor

pathway. Kidney Int. 2013, 84, 733–744. [CrossRef] [PubMed]

32. Shivanna, S.; Kolandaivelu, K.; Shashar, M.; Belghasim, M.; Al-Rabadi, L.;

Balcells, M.; Zhang, A.;Weinberg, J.; Francis, J.; Pollastri, M.P.; et al. The Aryl

Hydrocarbon Receptor is a Critical Regulator of Tissue Factor Stability and an

Antithrombotic Target in Uremia. J. Am. Soc. Nephrol. 2016, 27, 189–201. [CrossRef]

[PubMed]

33. Kami´ nski, T.W.; Pawlak, K.; Karbowska, M.; My´sliwiec, M.; Pawlak, D. Indoxyl

sulfate-the uremic toxin linking hemostatic system disturbances with the prevalence

of cardiovascular disease in patients with chronic kidney disease. BMC Nephrol.

2017, 18, 35. [CrossRef] [PubMed]

34. Pawlak, K.; Domaniewski, T.; Mysliwiec, M.; Pawlak, D. Kynurenines and

oxidative status are independently associated with thrombomodulin and von

Willebrand factor levels in patients with end-stage renal disease. Thromb. Res. 2009,


35. Pawlak, K.; Mysliwiec, M.; Pawlak, D. Hypercoagulability is independently

associated with kynurenine

pathway activation in dialysed uraemic patients. Thromb. Haemost. 2009, 102, 49–55.

[CrossRef] [PubMed]

36. Kaminski, T.W.; Pawlak, K.; Karbowska, M.; Mysliwiec, M.; Grzegorzewski, W.;

Kuna, J.; Pawlak, D. Association between uremic toxin-anthranilic acid and

fibrinolytic system activity in predialysis patients at different stages of chronic

kidney disease. Int. Urol. Nephrol. 2018, 50, 127–135. [CrossRef] [PubMed]

37. Pawlak, K.; Tankiewicz, J.; Mysliwiec, M.; Pawlak, D. Tissue factor/its pathway

inhibitor system and kynurenines in chronic kidney disease patients on conservative

treatment. Blood Coagul. Fibrin. 2009, 20, 590–594. [CrossRef] [PubMed]

38. Thijs, A.; Nanayakkara, P.W.; Ter Wee, P.M.; Huijgens, P.C.; van Guldener, C.;

Stehouwer, C.D.A. Mild-to-moderate renal impairment is associated with platelet

activation: A cross-sectional study. Clin. Nephrol. 2008, 70, 325–331. [PubMed]

39. Boccardo, P.; Remuzzi, G.; Galbusera, M. Platelet dysfunction in renal failure.

Semin. Thromb. Hemost. 2004, 30, 579–589. [CrossRef] [PubMed]

40. Yang, K.; Du, C.; Wang, X.; Li, F.; Xu, Y.; Wang, S.; Chen, S.; Chen, F.; Shen, M.;

Chen, M.; et al. Indoxyl sulfate induces platelet hyperactivity and contributes to

chronic kidney disease-associated thrombosis in mice. Blood 2017, 129, 2667–2679.

[CrossRef] [PubMed]

41. Yau, J.W.; Teoh, H.; Verma, S. Endothelial cell control of thrombosis. BMC

Cardiovasc. Disord. 2015, 15, 130. [CrossRef] [PubMed]

42


42. Stam, F.; van Guldener, C.; Becker, A.; Dekker, J.M.; Heine, R.J.; Bouter, L.M.;

Stehouwer, C.D.A. Endothelial dysfunction contributes to renal function-associated

cardiovascular mortality in a population with mild renal insufficiency: The Hoorn

study. J. Am. Soc. Nephrol. 2006, 17, 537–545. [CrossRef] [PubMed]

43. Malyszko, J. Mechanism of endothelial dysfunction in chronic kidney disease.

Clin. Chim. Acta 2010, 411, 1412–1420. [CrossRef] [PubMed]

44. Jourde-Chiche, N.; Dou, L.; Sabatier, F.; Calaf, R.; Cerini, C.; Robert, S.; Camoin-

Jau, L.; Charpiot, P.; Argiles, A.; Dignat-George, F.; et al. Levels of circulating

endothelial progenitor cells are related to uremic toxins and vascular injury in

hemodialysis patients. J. Thromb. Haemost. 2009, 7, 1576–1584. [CrossRef] [PubMed]

45. Roy-Chaudhury, P.; Sukhatme, V.P.; Cheung, A.K. Hemodialysis vascular access

dysfunction: A cellular and molecular viewpoint. J. Am. Soc. Nephrol. 2006, 17, 1112–


46. Chen, T.Y.; Lin, T.T.; Hsieh, M.Y.; Lin, L.; Yang, C.W.; Chuang, S.Y.; Huang, P.H.;

Wu, C.C. Circulating Progenitor Cells Affect Thrombosis of Dialysis Arteriovenous

Fistulas. Am. J. Nephrol. 2016, 44, 428–438. [CrossRef] [PubMed]

47. Fabre, J.E.; Nguyen, M.; Athirakul, K.; Coggins, K.; McNeish, J.D.; Austin, S.;

Parise, L.K.; FitzGerald, G.A.; Coffman, T.M.; Koller, B.H. Activation of the murine

EP3 receptor for PGE2 inhibits cAMP production and promotes platelet aggregation.

J. Clin. Investig. 2001, 107, 603–610. [CrossRef] [PubMed]

48. Gross, S.; Tilly, P.; Hentsch, D.; Vonesch, J.L.; Fabre, J.E. Vascular wall–produced

prostaglandin E2 exacerbates

arterial thrombosis and atherothrombosis through platelet EP3 receptors. J. Exp.

Med. 2007, 204, 311–320. [CrossRef] [PubMed]

49. Loscalzo, J. Nitric oxide insufficiency, platelet activation, and arterial thrombosis.

Circ. Res. 2001, 88, 756–762. [CrossRef] [PubMed]

50. Baylis, C. Nitric oxide synthase derangements and hypertension in kidney

disease. Curr. Opin. Nephrol. Hypertens. 2012, 21, 1–6. [CrossRef] [PubMed]

51. Tumur, Z.; Niwa, T. Indoxyl sulfate inhibits nitric oxide production and cell

viability by inducing oxidative stress in vascular endothelial cells. Am. J. Nephrol.

2009, 29, 551–557. [CrossRef] [PubMed]

52. Pieniazek, A.; Gwozdzinski, L.; Hikisz, P.; Gwozdzinski, K. Indoxyl sulfate

generates free radicals, decreases antioxidant defense and leads to damage to

mononuclear blood cells. Chem. Res. Toxicol. 2018. [CrossRef] [PubMed]

53. Dou, L.; Jourde-Chiche, N.; Faure, V.; Cerini, C.; Berland, Y.; Dignat-George, F.;

Brunet, P. The uremic solute indoxyl sulfate induces oxidative stress in endothelial

cells. J. Thromb. Haemost. 2007, 5, 1302–1308. [CrossRef] [PubMed]

43


54. Faure, V.; Dou, L.; Sabatier, F.; Cerini, C.; Sampol, J.; Berland, Y.; Brunet, P.;

Dignat-George, F. Elevation of circulating endothelial microparticles in patients with

chronic renal failure. J. Thromb. Haemost. 2006, 4, 566–573. [CrossRef] [PubMed]

55. Daniel, L.; Dou, L.; Berland, Y.; Lesavre, P.; Mecarelli-Halbwachs, L.; Dignat-

George, F. Circulating microparticles in renal diseases. Nephrol. Dial. Transplant.

2008, 23, 2129–2132. [CrossRef] [PubMed] 56. Freyssinet, J.M.; Toti, F. Formation of

procoagulant microparticles and properties. Thromb. Res. 2010, 125 (Suppl. 1), S46–

S48. [CrossRef]

57. Connor, D.E.; Exner, T.; Ma, D.D.; Joseph, J.E. Detection of the procoagulant

activity of microparticle-associated phosphatidylserine using XACT. Blood Coagul.

Fibrin. 2009, 20, 558–564. [CrossRef] [PubMed]

58. Biró, E.; Sturk-Maquelin, K.N.; Vogel, G.M.; Meuleman, D.G.; Smit, M.J.; Hack,

C.E.; Sturk, A.; Nieuwland, R. Human cell-derived microparticles promote thrombus

formation in vivo in a tissue factor-dependent manner. J. Thromb. Haemost. 2003, 1,

2561–2568. [CrossRef] [PubMed]

59. Gao, C.; Ji, S.; Dong, W.; Qi, Y.; Song, W.; Cui, D.; Shi, J. Indolic uremic solutes

enhance procoagulant activity of red blood cells through phosphatidylserine

exposure and microparticle release. Toxins 2015, 7, 4390–4403. [CrossRef] [PubMed]

60. Chu, A.J. Tissue factor, blood coagulation, and beyond: An overview. Int. J.

Inflam. 2011, 2011, 367284. [CrossRef] [PubMed]

61. Ng, H.Y.; Bolati,W.; Lee, C.T.; Chien, Y.S.; Yisireyili, M.; Saito, S.; Pei, S.N.;

Nishijima, F.; Niwa, T. Indoxyl Sulfate Downregulates Mas Receptor via Aryl

Hydrocarbon Receptor/Nuclear Factor-kappa B, and Induces Cell Proliferation and

Tissue Factor Expression in Vascular Smooth Muscle Cells. Nephron 2016, 133, 205–


62. Yisireyili, M.; Saito, S.; Abudureyimu, S.; Adelibieke, Y.; Ng, H.Y.; Nishijima, F.;

Takeshita, K.; Murohara, T.; Niwa, T. Indoxyl sulfate-induced activation of (pro)renin

receptor promotes cell proliferation and tissue factor expression in vascular smooth

muscle cells. PLoS ONE 2014, 9, e109268. [CrossRef] [PubMed]

63. Addi, T.; Poitevin, S.; McKay, N.; El Mecherfi, K.E.; Kheroua, O.; Jourde-Chiche,

N.; de Macedo, A.; Gondouin, B.; Cerini, C.; Brunet, P.; et al. Mechanisms of tissue

factor induction by the uremic toxin indole-3 acetic acid through aryl hydrocarbon

receptor/nuclear factor kappa B signaling pathway in human endothelial cells. Arch.

Toxicol. In press.

64. Mandal, P.K. Dioxin: A review of its environmental effects and its aryl

hydrocarbon receptor biology. J. Comp. Physiol. B 2005, 175, 221–230. [CrossRef]

[PubMed]

44


65. Hubbard, T.D.; Murray, I.A.; Perdew, G.H. Indole and Tryptophan Metabolism:

Endogenous and Dietary Routes to Ah Receptor Activation. Drug Metab. Dispos.

2015, 43, 1522–1535. [CrossRef] [PubMed]

66. Matsumura, F. The significance of the nongenomic pathway in mediating

inflammatory signaling of the dioxin-activated Ah receptor to cause toxic effects.

Biochem. Pharmacol. 2009, 77, 608–626. [CrossRef] [PubMed]

67. Puga, A.; Ma, C.; Marlowe, J.L. The aryl hydrocarbon receptor cross-talks with

multiple signal transduction pathways. Biochem. Pharmacol. 2009, 77, 713–722.

[CrossRef] [PubMed]

68. Shashar, M.; Belghasem, M.E.; Matsuura, S.;Walker, J.; Richards, S.; Alousi, F.;

Rijal, K.; Kolachalama, V.B.; Balcells, M.; Odagi, M.; et al. Targeting STUB1-tissue

factor axis normalizes hyperthrombotic uremic phenotype without increasing

bleeding risk. Sci. Transl. Med. 2017, 9, eaam8475. [CrossRef] [PubMed]

69. Dou, L.; Poitevin, S.; Sallée, M.; Addi, T.; Gondouin, B.; McKay, N.; Denison, M.S.;

Jourde-Chiche, N.; Duval-Sabatier, A.; Cerini, C.; et al. Aryl hydrocarbon receptor is

activated in patients and mice with chronic kidney disease. Kidney Int. 2018, 93, 986–


70. Lindsey, S.; Papoutsakis, E.T. The aryl hydrocarbon receptor (AHR) transcription

factor regulates megakaryocytic polyploidization. Br. J. Haematol. 2011, 152, 469–484.

[CrossRef] [PubMed]

71. Strassel, C.; Brouard, N.; Mallo, L.; Receveur, N.; Mangin, P.; Eckly, A.; Bieche, I.;

Tarte, K.; Gachet, C.; Lanza, F. Aryl hydrocarbon receptor-dependent enrichment of a

megakaryocytic precursor with a high potential to produce proplatelets. Blood 2016,


72. Lindsey, S.; Jiang, J.; Woulfe, D.; Papoutsakis, E.T. Platelets from mice lacking the

aryl hydrocarbon receptor exhibit defective collagen-dependent signaling. J. Thromb.

Haemost. 2014, 12, 383–394. [CrossRef] [PubMed]

73. Pombo, M.; Lamé, M.W.;Walker, N.J.; Huynh, D.H.; Tablin, F. TCDD and

omeprazole prime platelets through the aryl hydrocarbon receptor (AhR) non-

genomic pathway. Toxicol. Lett. 2015, 235, 28–36. [CrossRef] [PubMed]

74. Simeoni, M.; Citraro, M.L.; Deodato, F.; Provenzano, M.; Capria, M.; Comi, A.;

Libri, E.; Andreucci, M.; Puja, A.; Abenavoli, L.; Cocchi, M.; Fuiano, G. An open-

label, randomized, placebo-controlled study on the effectiveness of a novel probiotics

administration protocol (ProbiotiCKD) in patients with mild renal insufficiency

(stage 3a of CKD). Eur J. Nutr. 2018, 1–12. [CrossRef]

75. Borges, N.A.; Carmo, F.L.; Stockler-Pinto, M.B.; de Brito, J.S.; Dolenga, C.J.;

Ferreira, D.C.; Nakao, L.S.; Rosado, A.; Fouque, D.; Mafra, D. Probiotic

45


Supplementation in Chronic Kidney Disease: A Double-blind, Randomized, Placebo-

controlled Trial. J. Ren Nutr. 2018, 28, 28–36. [CrossRef] [PubMed]

76. Takayama, F.; Taki, K.; Niwa, T. Bifidobacterium in gastro-resistant seamless

capsule reduces serum levels of indoxyl sulfate in patients on hemodialysis. Am. J.

Kidney Dis. 2003, 41, S142–S145. [CrossRef] [PubMed]

77. Rossi, M.; Johnson, D.W.; Morrison, M.; Pascoe, E.M.; Coombes, J.S.; Forbes, J.M.;

Szeto, C.C.; McWhinney, B.C.; Ungerer, J.P.; Campbell, K.L. Synbiotics Easing Renal

Failure by Improving Gut Microbiology (SYNERGY): A Randomized Trial. Clin J.

Am. Soc. Nephrol. 2016, 11, 223–231. [CrossRef] [PubMed]

78. Poesen, R.; Mutsaers, H.A.;Windey, K.; van den Broek, P.H.; Verweij, V.;

Augustijns, P.; Kuypers, D.; Jansen, J.; Evenepoel, P.; Verbeke, K.; et al. The Influence

of Dietary Protein Intake on Mammalian Tryptophan and Phenolic Metabolites. PLoS

ONE 2015, 10, e0140820. [CrossRef] [PubMed]

79. Sirich, T.L.; Plummer, N.S.; Gardner, C.D.; Hostetter, T.H.; Meyer, TW. Effect of

increasing dietary fiber on plasma levels of colon-derived solutes in hemodialysis

patients. Clin. J. Am. Soc. Nephrol. 2014, 9, 1603–1610. [CrossRef] [PubMed]

80. Kandouz, S.; Mohamed, A.S.; Zheng, Y.; Sandeman, S.; Davenport, A. Reduced

protein bound uraemic toxins in vegetarian kidney failure patients treated by

haemodiafiltration. Hemodial. Int. 2016, 20, 610–617. [CrossRef] [PubMed]

81. Chen, X.; Wei, G.; Jalili, T.; Metos, J.; Giri, A.; Cho, M.E.; Boucher, R.; Greene, T.;

Beddhu, S. The Associations of Plant Protein Intake with All-Cause Mortality in

CKD. Am. J. Kidney Dis. 2016, 67, 423–430. [CrossRef] [PubMed]

© 2018 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open

access article distributed under the terms and conditions of the Creative Commons

Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).

46

Objectifs de la thèse

3. Objectifs de la thèse

➢ Étude des mécanismes impliqués dans l’expression du Facteur Tissulaire via AhR

activé par l’IAA et par l’IS ;

- Déterminer si l'induction du FT par l’IAA et l’IS est médiée par une voie

génomique d’AhR, ou par une voie non génomique d’AhR impliquant d'autres

voies de signalisation et facteurs de transcription.

➢ Étude du lien entre le FT circulant et les taux d’IAA et d’IS chez des patients HD de

Marseille.

➢ Étude comparative entre deux cohortes de patients HD (Oran vs Marseille) ;

- Comparaisons des taux sériques de toxine urémique entre les deux cohortes de

patients.

- Comparaison des fréquences d’événements cardiovasculaires et des taux de

mortalité entre les deux populations.

47


4. Méthodologie de travail

4.1. Culture de cellules endothéliales

Dans les expériences in vitro, nous avons cultivé et utilisé des cultures primaires de cellules

endothéliales. Les HUVEC ont été obtenus à partir de la veine du cordon ombilical par

digestion de collagénase comme décrit (Jaffe et al. 1973) et cultivé jusqu'au quatrième

passage dans le milieu EGM-2 (Lonza, France) contenant 2% de sérum fœtal bovin, dans des

conditions de culture cellulaire standard (atmosphère humidifiée à 37 ° C, 5% CO2). Les

cellules endothéliales aortiques humaines (HAoEC) et les cellules endothéliales

microvasculaires (MV) dérivées du cœur (HMVEC-C) ont été obtenues auprès de Lonza. Les

HMVEC-C ont été cultivées jusqu'au cinquième passage dans un milieu EGM-2 MV (Lonza,

France) contenant 5% de sérum fœtal bovin dans des conditions de culture cellulaire

standard. Les HAoEC ont été cultivées jusqu'au cinquième passage dans le milieu EGM-2

dans des conditions de culture cellulaire standard.

4.2. Traitement avec les toxines urémiques IAA ou IS

Les cellules ont été incubées avec de l’IAA à 50µM (Sigma-Aldrich, France) ou avec de l'IS à

200μM (Sigma-Aldrich, France), les concentrations moyennes décrites chez les patients

urémiques (Vanholder et al. 2003). Elles ont été traitées pendant les temps indiqués, avec ou

sans l'inhibiteur d’AhR ; CH-229131 à 10μM (Sigma-Aldrich), l'inhibiteur de NF-B ; BAY 11-

7082 à 10μM (Merck Chemicals), l'inhibiteur de PKC ; Bisindolymaleimide I à 5μM (Merck

Chemicals), l'inhibiteur de p38 ; SB203580 à 10μM (Sigma-Aldrich), l'inhibiteur de ERK1/2 ;

PD98059 à 10μM (Sigma-Aldrich) et l'inhibiteur de transcription ; Actinomycin D à 1μg / ml

(Sigma-Aldrich). L’IS étant vendu sous forme de sels de potassium pour le milieu contrôle, les

cellules étaient incubées en présence de KCl 1/1000e. L’IAA étant dilué dans l’éthanol, pour

48


le milieu contrôle, les cellules étaient incubées en présence d’éthanol 1/1000e. Nous avons

inclus un contrôle pour les inhibiteurs dilués avec le DMSO où les cellules étaient incubées

avec du DMSO 1/1000e en présence de l’IAA ou de l’IS. Dans certaines expériences, de la

sérumalbumine humaine (LFB, France) a été ajoutée dans le milieu de culture, à la

concentration trouvée dans le sérum humain (4 g/dL).

4.3. Extinction de la protéine d’AhR avec le SiRNA (Small interfering RNA)

Les HUVEC ont été transfectées avec 20nM de siRNA contrôle (Contrôle Universel Négatif,

Stealth ™ RNAi, Life Technologies, France) ou un pool contenant trois siRNA Silencer® Select

dirigés contre AhR à 20nM chacun (1200, 1999 et 1998, Life Technologies, France) par

magnétofection en utilisant des billes SilenceMag au 200éme (OZ Biosciences, France) dans du

milieu réduit en sérum Opti-MEMTM (Gibco, Life Technologies, France), selon les instructions

du fabricant. Le knock-out d’AhR a été vérifié par western blot sur des extraits cellulaires

48heures après transfection (Figure 1). L'induction du FT et la translocation nucléaire de p50

ont été réalisées 48 heures après la transfection.

Figure 1. Western blot des niveaux de protéine d’AhR dans les HUVEC transfectées avec un un

siRNA contrôle ou siRNA AhR

L'expression endothéliale d’AhR dans des extraits cellulaires a été mesurée par Western blot 48h

après transfection avec des siRNA contrôle ou siRNA AhR.

AhR

+

-

Si contrôle

SiAhR

- +

Actine

49


4.4. Extraction de l'ARN et analyse RT-PCR quantitative de l'expression de l'ARNm

Après incubation avec de l’IAA50µM ou de l’IS200µM, les cellules ont été lavées avec du PBS

puis lysées avec 350µl de tampon RLT supplémenté en β-mercaptoéthanol. Les ARN totaux

ont été extraits et purifiés à l’aide d’un mini-kit RNeasy (Qiagen, France) selon les

recommandations du fabricant. Une digestion à la DNase (RNAse Free DNAse Set, Qiagen) a

été réalisée afin d’éliminer toutes traces d’ADN dans les échantillons d’ARN. Les

concentrations d’ARN ont été déterminées à l’aide d’un spectrophotomètre nanodrop

(NanoDrop® ND-1000 Spectrophotometer) et tous les échantillons présentaient un rapport

de densité optique de 260 nm sur 280 nm supérieur à 1,9. La reverse transcription (RT) a été

réalisée sur 500 ng d'ARN total en utilisant le kit de réactif Takara PrimeScriptTM RT (Ozyme,

Saint Quentin en Yvelines, France) suivi de qPCR sur 25 ng d'ADNc en utilisant le Takara SYBR

qPCR Premix Ex Taq (Ozyme). Nous avons quantifié les gènes cibles suivants : F3 (gène du

FT), CYP1A1 et CYP1B1. Le gène contrôle HPRT a été utilisé pour la normalisation des valeurs

des gènes cibles. Les séquences d'amorces étaient les suivantes : F3 forward :

5'TGCAGTAGCTCCAACAGTGC 3', F3 reverse : 5'GAGTGTATGGGCCAGGAGAA 3'; CYP1A1

forward : 5'GACAGATCCCATCTGCCCTA 3', CYP1A1 reverse : 5'ATAGCACCATCAGGGGTGAG 3’;

CYP1B1 forward : 5'TGATGGACGCCTTTATCCTC 3', CYP1B1 reverse:

5'CCACGACCTGATCCAATTCT 3'; HPRT forward : 5'GGATTATACTGCCTGACCAAGGAAAGC 3',

HPRT reverse: 5'GAGCTATTGTAATGACCAGTCAACAGG 3'.

Les PCR quantitatives ont été réalisées à l’aide du Light cycleur MX 3000 (Agilent

Technologies). La mesure de la fluorescence émise par le marqueur fluorescent de l’ADN

double brin, le SYBR green, a été mesurée à la fin de la phase d’élongation de chaque cycle,

ce qui permet de suivre la quantité d’ADNc amplifié. Les efficacités de la réaction PCR ont

été déterminées avec le logiciel MxPro (Agilent) et se situaient toujours entre 90% et 110%.

50


Une courbe de fusion, réalisée après la PCR, a permis de s’assurer de la spécificité de la

réaction d’amplification. Les taux d’ARNm des gènes d'intérêt exprimés en facteur

d’augmentation par rapport aux conditions témoins éthanol et KCL ont été calculés en

utilisant la méthode 2−ΔΔCt. La transcription du gène contrôle HPRT a été utilisée pour la

normalisation des données.

4.5. Test d'immunoprécipitation de la chromatine (ChIP)

Des monocouches d'HUVEC (6x106 cellules) ont été traitées avec de l’IAA (50µM) ou de

l’éthanol (contrôle) ou avec de l'IS (200 µM) ou de KCL (contrôle) pendant 60 minutes. Les

cellules ont été fixées (DNA-protein crosslinks) en ajoutant du formaldéhyde directement

dans le milieu à une concentration finale de 1% et incubées pendant 10 minutes à

température ambiante puis 40 minutes à 4°C, puis traiter avec de la glycine à une

concentration finale de 0,125 mol/l pendant 10 minutes à température ambiante. Le test

ChIP (immunoprécipitation de la chromatine) a été réalisé en utilisant le kit

d'immunoprécipitation de la chromatine EZ-Magna ChIP ™ A/G (Merck Millipore, France).

Conformément aux instructions du kit, les cellules ont été collectées après lavage avec du

PBS puis lysées avec des tampons du kit. Les échantillons de chromatines récoltées ont été

soniqués pour obtenir des longueurs d’ADN de 200-1000 pb. Des immunoprécipitations ont

été réalisées pendant une nuit à 4 °C avec 5 µg d'IgG de lapin (IgG témoin) ou d'anticorps

polyclonal de lapin contre AhR (Santa Cruz Biotechnology, Tebu-Bio, France). Après

différents lavages, le complexe a été inversé par digestion par la protéinase K, incubée à

62°C pendant 3 heures avec agitation de 600 tr/min à 95 °C pendant 10 minutes et enfin à

20°C pendant 20 min. Les extraits d'ADN purifiés suivant le kit, la quantification par PCR en

temps réel des enrichissements ChIP ont été effectués sur un instrument MX3000P

(Stratagene) en utilisant le Brilliant II SYBR Green QPCR Master Mix (Takara bio, France). Les

51


séquences d'amorces spécifiques pour les promoteurs étaient les suivantes: FT en forward,

5'-GCCCTCCCTTTCCTGCCATAGA-3 ', FT reverse: 5'-CCTCCCGGTAGGAAACTCCG-3'; CYP1A1 en

forward: 5'-ACGCAGACCTAGACCCTTTGC-3 ', CYP1A1 reverse: 5'-CGGGTGCGCGATTGAA-3';

CYP1B1 forward: 5'-ATATGACTGGAGCCGACTTTCC-3 ', CYP1B1 reverse: 5'-

GGCGAACTTTATCGGGTTGA-3'. L'enrichissement en fold a été calculé en utilisant la méthode

2−ΔΔCt, où ΔΔCt représente la différence entre les cycles de seuil d'anticorps polyclonaux

expérimentaux de lapin dirigés contre AhR sur IgG contrôle de lapin.

4.6. Western blot et analyse densitométrique de Western blots

Après incubation des HUVEC cultivées en flasque de T75 avec 50µM d’IAA ou 200µM d’IS

pendant 30 min, avec ou sans l'inhibiteur d’AhR, le CH-229131 à 10 µM (Sigma-Aldrich), des

extraits nucléaires ont été préparés en utilisant le kit d'extraction nucléaire de Cayman

Chemical (Interchim, France). Des extraits cytosoliques ont été préparés en utilisant 1 ml de

tampon de lyse contenant 20 mM de MOPS, 50 mM de ß-glycerolphosphate, 50 mM de

fluorure de sodium, 1 mM d'orthovanadate de sodium, 5 mM d'EGTA, 2 mM d'EDTA, 1%

NP40, 1 mM de dithiothréitol (DTT) 1mM de benzamidine, 1 mM de

phénylméthanesulfonylfluorure (PMSF) et 10 ug / ml de leupeptine et d'aprotinine. Les

cellules ont été incubées 10 min sur de la glace puis recueillies avec un grattoir. Les extraits

cytosoliques ont été obtenus après centrifugation des lysats cellulaires à 13 000 tr/min

pendant 15 min. Les concentrations en protéines ont été mesurées avec le kit d'acide

bicinchoninique (BCA1, Sigma-Aldrich).

Des quantités de 20µg d’échantillons protéiques avec une qsp 30µl ajusté avec du tampon

de lyse RIPA, ont été mélangés avec du tampon d'échantillon LDS (25% du volume final) et

du β-mercaptoéthanol (5% du VF), puis chauffer 5 minutes à 95°C. Les protéines ont été

séparées en utilisant le gel de protéine 4-12% NuPAGETM (Life technologies) avec un tampon

52


de migration MOPS à 1X. Les protéines ont été transférées sur une membrane de

nitrocellulose avec un tampon de transfert (tris amino acid-glycine-éthanol) et saturé avec

du PBS-lait écrémé à 5% pendant 1h à température ambiante. La membrane a été incubée

pendant une nuit à 4°C avec des anticorps dirigés contre AhR (Santa Cruz, France), contre

NF-B p50 (Cell Signaling, Ozyme, France), ou l'actine (Cell Signaling, France), puis avec

l'anticorps secondaire conjugué à la peroxydase (Beckman-Coulter, France). Les révélations

ont été réalisées par chimiluminescence (ECL Western blotting substrate, Pierce). Les images

de gel ont été capturées en utilisant le Syngene GBox (Ozyme) et analysées avec le logiciel

geneSys (Ozyme).

4.7. Transfection transitoire des HUVEC et test d’expression de la luciférase sous le

contrôle du promoteur du facteur tissulaire

Les plasmides rapporteurs du promoteur du FT de type sauvage humain (-227 hTF WT), du

FT-mutant AP-1 (-227 hTF mAP1), du NF-B mutant (-227 hTF mNF-B) contrôlant

l’expression du gène de la luciférase en pGL2 basic étaient offert par Nigel Mackman

(Addgene plasmid # 15442, 15443, 15444 respectively) (Figure 2).

Les HUVEC (1,5 x 105 cellules) ont été ensemencées dans des plaques de 6 puits dans du

milieu EGM-2 16 h avant la transfection. Les cellules ont ensuite été incubées 1 h avant la

transfection avec du milieu à sérum réduit Opti-MEMTM (Gibco, Life Technologies, France).

La transfection a été réalisée en utilisant la Lipofectamine 2000 (Life Technologies, France)

associée à la magnétofection en utilisant des billes CombimagTMbeads (OZ Bioscience,

Marseille, France) selon les instructions du fabricant. Brièvement, 1µg des plasmides

rapporteurs ont été mélangés avec 2 µl de Lipofectamine dans 200 µl de milieu sérique

réduit d’Opti-MEM pendant 20 minutes, puis 1 µl de billes CombimagTM a été ajouté aux

complexes ADN-Lipofectamine. Les complexes ADN-lipofectamine-billes ont été incubés

53


pendant 20 min à température ambiante, puis incubée avec les HUVEC pendant 1h à 37 °C

sur une plaque magnétique à 5% de CO2, ensuite remplacés par du milieu de croissance.

Après 48h, les HUVEC ont été traitées avec de l’IAA ou éthanol (contrôle) ou avec de l'IS ou

du KCL (contrôle) pendant 6 heures. Les cellules ont été lysées avec le tampon reporter lysis

buffer et les lysats ont été testés pour les activités de luciférase en utilisant le système de

dosage de la luciférase et le système de détection GloMax®-Multi (Promega, France). Le

vecteur témoin le pSV-ß-galactosidase (Promega) a été cotransfecté de sorte que les

efficacités de transfection pourraient être normalisées avec les activités de ß-galactosidase

déterminée en utilisant le système de test b-Glo® (Promega).

4.8. Translocations nucléaires de NF-B et AP-1

Après incubation d’environ 107 d’HUVEC avec 50µM d’IAA pendant 30 min, avec ou sans

l'inhibiteur d’AhR ; CH-229131 à 10μM (Sigma-Aldrich), l'inhibiteur de NF-B ; BAY 11-7082 à

10μM (Merck Chemicals), l'inhibiteur de la PKC Bisindolymaleimide I à 5µM (Merck

Figure 2. Construction des plasmides rapporteurs du promoteur du FT

Les cellules endothéliales HUVEC ont été transféctées avec des plasmides de luciférase contenant un

promoteur de FT de type sauvage (-227 WT), ou un contenant un mutant non-liant NF-B (-227 mNF-B),

ou un contenant des sites non-liants AP-1 (-227 mAP1).

54


Chemicals), l'inhibiteur de p38 SB203580 à 10 µM (Sigma-Aldrich), des extraits nucléaires ont

été préparés en utilisant le kit d'extraction nucléaire de Cayman Chemical (Interchim,France)

La fraction p50 de NF-B a été détectée dans des extraits nucléaires par le kit de dosage du

facteur de transcription combo NF-B (humain p50) de Cayman Chemical (Interchim). Ce kit

est un test ELISA à 96 puits avec une séquence d'ADN double brin spécifique contenant

l'élément de réponse NF-B. La NF-B p50 contenue dans les extraits nucléaires est détectée

avec un anticorps primaire spécifique et un anticorps secondaire conjugué à HRP qui fournit

une lecture colorimétrique à 450 nm. Dans certaines expériences, la localisation de p50 a été

étudiée par Western blots. L'expression de p65 endothéliale dans des extraits nucléaires a

été mesurée après 30 min d'incubation des HUVEC avec l’IAA 50µM, et détectée dans des

extraits nucléaires par le kit de test de facteur de transcription combo NF-B (humain p50 /

p65) de Cayman Chemical (Interchim).

Les sous-unités d’AP-1, c-Fos et c-Jun ont été détectées dans des extraits nucléaires par le kit

de test de facteur de transcription AP1 (c-Fos/Fos/Fra1/c-Jun/JunB/JunD) (Abcam, Paris,

France).

4.9. Étude de corrélation entre la concentration de FT circulant et les taux sériques

d’IAA et d’IS chez les patients HD de Marseille

Nous avons réalisé une étude prospective monocentrique chez 92 patients hémodialysés

marseillais, provenant du centre de néphrologie et transplantation rénale de l’hôpital de la

conception à Marseille, sélectionné selon les critères suivants : âge> 18 ans; aucun

événement cardiovasculaire (infarctus du myocarde, accident vasculaire cérébral, maladie

vasculaire périphérique avec amputation ou besoin d'angioplastie), infection ou intervention

chirurgicale (sauf pour l'angioplastie d'accès vasculaire) au cours des 3 derniers mois; pas de

grossesse; aucun antécédent récent de malignité; pas de prise de corticostéroïdes ou

55


d'agents immunosuppresseurs. Les patients ont été dialysés au moins 3 fois par semaine

pendant un minimum de 6 mois. Des échantillons de sang ont été prélevés chez des patients

pendant la séance d'hémodialyse en milieu de semaine ; dans des tubes citrates pour

récupérer le plasma et doser le FT, et des tubes secs pour doser l’IAA et l’IS dans le sérum.

Des procédures de laboratoire standard ont été utilisées pour les évaluations de la chimie du

sang. L’IAA et IS total ont été mesurés par HPLC suivant la méthode de Calaf et al. 2011.

Un consentement éclairé a été obtenu de tous les participants individuels inclus dans

l'étude. L'étude a été approuvée par le comité d'éthique local (De Marseille) et est conforme

aux principes énoncés dans la Déclaration d'Helsinki.

4.10. Mesure du FT par dosage immuno-enzymatique

Le FT a été quantifié dans du plasma humain citraté et dans des lysats cellulaires d’HUVEC

avec le kit de dosage immuno-enzymatique (ELISA Sandwich) Quantikine Facteur de

coagulation humain III / Tissue Factor (R & D Systems, Lille, France) selon les instructions du

fabricant.

4.11. Étude comparative entre deux cohortes de patients HD (Oran vs Marseille)

L’étude a inclus 103 patients hémodialysés chroniques oranais et 133 patients hémodialysés

chroniques marseillais qui ont donné leur consentement éclairé pour participer à l’étude

(Annexe1). Les patients hémodialysés d’Oran ont été recrutés à la clinique Rénadial ST-

Hubert, et à la clinique Rénadial ES-SEDIKKIA, ils ont été recrutés sur cinq mois (d’Avril à

Septembre 2015). Les patients hémodialysés de Marseille ont été recrutées au centre de

néphrologie et de transplantation rénale de l’hôpital de la conception à Marseille en Juin

2014. Il s’agit de patients hémodialysés avec une MRC terminale à distance de toutes

infections et ne prenant pas d’antibiotique (la prise d’antibiotique peut modifier jusqu’à 1

56


mois après l’arrêt la flore digestive) et ne présentant pas de colectomie. Un interrogatoire à

l’inclusion a été présenté aux patients pour recueillir les informations personnelles, les

antécédents et les médicaments pris par les patients au moment des prélèvements (Annexes

2). Les informations obtenues sont confidentielles et les données privées des patients ont

été anonymisées par l’attribution d’un numéro d’inclusion.

Des prélèvements ont été réalisés dans deux tubes secs de 4,5 ml au début d’une dialyse de

milieu de semaine. L’ensemble des prélèvements biologiques ont été réalisés suivant les

procédures des cliniques d’hémodialyses. La préparation du sérum a été faite de manière

stérile et conservée à -80°. Avec l’accord des patients, nous avons entamé un suivi d’une

année. Cette période appelée la période d’observation consiste à suivre tous les événements

indésirables durant l’année.

4.11.1. Critères d’inclusion

Les critères d’inclusion sont :

- Sujets adultes des 2 sexes âgés de 18 ans ou plus

- Sujets capables de donner leur consentement éclairé

- Patients hémodialysés quelle que soit l’étiologie de leur insuffisance rénale

- Patients n’étant pas sous antibiothérapie

- Acceptant de participer à l’étude et ayant signé un consentement

4.11.2. Critères d’exclusion

Les critères d’exclusion sont :

- Femmes enceintes ou allaitantes

- Personnes hospitalisées sans consentement

- Majeurs sous protection légale ou hors d’état d’exprimer leur consentement

- Refus du patient

57


- Possibilité de récupération d’une fonction rénale (sclérodermie par exemple)

- Patients porteurs d’une infection virale répliquant (HCV, VIH).

- Prise d’une antibiothérapie sur le mois précédent le 1er prélèvement

4.11.3. Arrêt d’étude

- Transplantation rénale

- Décès du patient

- Perdu de vue ou changement de centre

4.11.4. Les éléments cliniques et biologiques d’intérêt :

Les informations concernant les patients et leurs antécédents ont été recueillies à partir de

leur dossier médical.

Des analyses biologiques ont été réalisées au sein de l’hôpital de Marseille à partir des

sérums récoltés lors des prélèvements uniques. Ces analyses ont été réalisées pour avoir une

universalité des résultats des dosages.

4.11.5. Dosages des toxines :

Les dosages des toxines urémiques IAA, IS et PCs ont été réalisés par méthodes d’HPLC. La

méthode d’HPLC (chromatographie en phase liquide de haute performance) d’absorption et

échangeuse d’ion permet un dosage simultané des toxines urémiques à partir du sérum en

utilisant un flux isocratique et quantifié avec une détection de fluorescence. La méthode a

été élaborée au sein du laboratoire UMR-S1076 par R.CALAF et al en 2011.

4.11.6. Suivi des patients :

Un suivi d’un an a été entamé à partir de la date des prélèvements sanguins. La date et la

cause de décès ont été récupérées au cours de l’année (Annexe 3). Les événements

cardiovasculaires tels que ; l’infarctus du myocarde, accident vasculaire cérébral, maladie

vasculaire périphérique avec amputation, arrêt cardiaque fatal et les événements

58


thrombotiques graves tels que l’embolie pulmonaire et la thrombose veineuse profonde ont

été enregistrées avec la date de l’événement.

4.12. Analyses statistiques

Pour les études in vitro, des analyses statistiques ont été effectuées avec le logiciel Prism

(GraphPad Software Inc, CA). Des différences significatives ont été révélées par le test du

rang signé Wilcoxon ou par le test de Mann Whitney. Les données sont exprimées en

moyenne ± SEM d'expériences indépendantes réalisées sur différentes préparations

cellulaires.

Dans les études des patients HD, les données sont exprimées en moyenne ± écart-type (ET)

pour les valeurs avec distribution normale ou médiane (min, max) pour les valeurs non-

normalement distribuées. Les variables numériques ont été testées pour la normalité par le

test de Shapiro-Wilk. Les corrélations entre le FT plasmatique et les variables continues ont

été obtenues en utilisant les coefficients de corrélation de Spearman ; des analyses

statistiques ont été réalisées avec le logiciel Prism (GraphPad Software Inc, CA). Pour

identifier les facteurs indépendamment associés au FT plasmatique, des analyses de

régression linéaire multiple ont été réalisées avec le logiciel R. Les comparaisons entre la

cohorte de patient HD d’Oran et de Marseille ont été obtenues par le test de Mann Whitney

(test non paramétrique) pour les valeurs non-normalement distribué et par le test de

student pour les valeurs qui assume la distribution gaussienne. Les variables qualitatives ont

été comparées avec le test exact de Fisher. Une valeur p inférieure à 0.05 a été considérée

comme significative.

59

Résultats et discussions

5. Résultats et discussions

Les résultats et discussions des travaux de thèse sont présentés en plusieurs études selon le

plan suivant :

5.1. Étude de la régulation du Facteur Tissulaire via AhR induit par l’IAA.

5.2. Étude de la régulation du Facteur Tissulaire via AhR induit par l’IS .

5.3. Étude du lien entre le FT circulant et les taux sériques d’IAA et d’IS chez les

patients HD de Marseille.

5.4. Étude comparative entre deux cohortes de patients HD (Oran vs Marseille).

60

Étude de la régulation du Facteur Tissulaire via AhR induit par l’IAA Résultats et discussion

5.1. Étude de la régulation du Facteur Tissulaire via

AhR induit par l’IAA

61

Étude de la régulation du Facteur Tissulaire via AhR induit par l’IAA Résultats

Résultats

5.1.1. Étude de l'expression du FT induit par l'IAA dans les cellules

endothéliales

Notre équipe a montré que l'IAA régule à la hausse l'expression de FT dans les HUVEC

(Gondouin et al. 2013). Dans ce travail, nous avons étudié l'effet de l'IAA sur l'expression du

FT en ARNm et en protéines dans d'autres types de cellules endothéliales humaines, qui sont

pertinentes pour les événements cardiovasculaires observés chez les patients : artérielle

(HAoEC, cellules endothéliales aortiques) et microvasculaire (HMVEC-C, cellules

endothéliales microvasculaires cardiaques). Dans toutes les cellules endothéliales humaines

étudiées, l’IAA a significativement augmenté l'expression du FT en ARNm (Figure 1A) et en

protéines (Figure 1B) après 4 ou 6 heures d'incubation.

Nous avons réalisé les mêmes expériences avec de l’albumine humain à 4g/dL dans le milieu

de culture pour augmenter la fraction liée à la protéine de l'IAA. Après 4 heures

d'incubation, l'induction de l'ARNm (Figure 1C) et de la protéine (Figure 1D) du FT par l’IAA

était similaire avec ou sans addition d'albumine.

Pour tester si la transcription était la façon principale de contrôler l'expression du FT après

stimulation par l’IAA dans les cellules endothéliales, nous avons ajouté l'inhibiteur de la

transcription Actinomycine D (Figure 1E). L'actinomycine D a aboli l'induction de l'expression

de l'ARNm du FT par l’IAA, ainsi que l'expression basale de l'ARNm du FT. Ces résultats

suggèrent que l'expression du FT induit par l’IAA dans les cellules endothéliales est

contrôlée au niveau transcriptionnel contrairement à la cellule musculaire lisse vasculaire

(Chitalia et al. 2013).

62


Figure 1 (A)(B) : Effet de l'IAA sur l'expression du FT en ARNm (A) et en protéines (B) dans différents

types de cellules endothéliales humaines.

(A) L'induction de l'ARNm du FT par l’IAA dans les HUVEC (veine ombilicale), HAoEC (aortique), et

HMVEC-C (cardiaques microvasculaires), après une incubation de 4 heures avec 50μM d’IAA, a été

étudiée par RT-qPCR comparative et exprimée en facteur de variation d’ARNm vs contrôle. (B) Les

niveaux de protéines du FT dans les HUVEC, HAoEC et HMVEC-C après une incubation de 6 heures

avec 50μM d’IAA ont été étudiés par ELISA. Les données (A)(B) représentent la moyenne ± SEM de 4

expériences indépendantes. * p <0,05, ** p <0,01.

Figure 1 (C) (D) : Effet de l'IAA sur l'induction de l'ARNm (C) et de la protéine (D) du FT dans les

cellules HUVEC, dans un milieu contenant 4% d'albumine sérique humaine.

(C) L'induction de l'ARNm du FT après 4 heures d’incubation des HUVEC avec 50μM d’IAA a été

étudiée par RT-qPCR comparative et exprimée en facteur de variation d’ARNm vs contrôle. (D) Le

niveau de protéines du FT après une incubation de 6 heures des HUVEC avec 50μM d’IAA a été

étudiée par ELISA. Les données représentent la moyenne ± SEM de 5 expériences indépendantes * p

<0,05.

63


Figure 1 (E) : Effet de l'inhibiteur de la transcription Actinomycine D (1 pg/ml) sur l'expression de

l'ARNm du facteur tissulaire induit par l’IAA.

Les HUVEC ont été incubés pendant 4 heures +/- IAA 50µM, +/- Actinomycine D. L’expression

d’ARNm a été étudiée par RT-qPCR comparative. Les données exprimées en facteur de variation de

l'ARNm par rapport au contrôle, représentent la moyenne ± SEM de 4 expériences indépendantes. *

p <0,05, ** p <0,01.

64


5.1.2. L’IAA induit l'expression du FT par l'intermédiaire de l'activation d’AhR

mais sans la liaison d'AhR au promoteur du FT

Nous avons confirmé l'implication d’AhR dans l'expression du FT médiée par l'IAA en utilisant

un inhibiteur pharmacologique d’AhR, le CH223191, et le siRNA d’AhR. L'expression induite

par l’IAA de l'ARNm du FT (Figure 2A) et de la protéine (Figure 2B) a été abolie par le

CH223191 et par le siRNA AhR. Le CH223191 et le siRNA AhR seul n'ont pas d'effet significatif

sur l'expression basale de l'ARNm et de la protéine du FT (Figures 2A et 2B).

L’AhR peut réguler la transcription directement en se liant au promoteur du gène par une

voie dite génomique, ou indirectement en activant d'autres facteurs de transcription par une

voie dite non génomique. Nous avons étudié par des expériences de ChIP, si AhR se lie

directement au promoteur du FT pour induire l'expression du FT dans les HUVEC. Il n’y a

aucun enrichissement d'AhR sur le promoteur du FT, montrant qu’AhR n'était pas

directement recruté au niveau du promoteur du FT dans les cellules endothéliales après

stimulation par l’IAA (Figure 2C). Après stimulation des HUVEC par l’IAA, l’AhR a été retrouvé

au niveau des promoteurs de CYP1A1 et CYP1B1, connus pour contenir des séquences XRE

(Figure 2C). L’IAA induit la liaison d’AhR dans les promoteurs de gènes régulés par la voie

génomique. Nous avons analysé la translocation nucléaire d’AhR en étudiant l'expression

d’AhR dans des extraits nucléaires et cytoplasmiques après stimulation des HUVEC par l’IAA

en présence de l'inhibiteur d’AhR, le CH223191. L’IAA augmente le niveau nucléaire d’AhR,

cet enrichissement est diminué lorsque les cellules sont incubées avec l'inhibiteur CH223191

(Figure 2D). En parallèle, l'IAA a provoqué une diminution du taux cytoplasmique d'AhR, qui

est prévenue par le CH223191. Nous avons ensuite examiné l'effet de l'IAA sur la régulation

positive du CYP1A1 et du CYP1B1 dans les HUVEC en présence de CH223191. L’IAA a induit

65


une augmentation significative de l'expression de l'ARNm de CYP1A1 et CYP1B1, qui a été

aboli en présence du CH223191 (Figure 2E et 2F).

Figure 2 (A)(B) : Effet de l'inhibiteur d’AhR le CH-223191 (10μM) et du siRNA AhR sur l'expression de

l'ARNm (A) et de la protéine (B) du FT induit par l’IAA.

L'expression de l'ARNm du FT a été étudiée par RT-qPCR comparative après une incubation de 4 h

des HUVEC avec 50μM d'IAA, +/- CH-223191, +/-siRNA. Les données sont exprimées en facteur de

variation de l'ARNm par rapport au contrôle. L'expression de la protéine du FT a été étudiée par

ELISA après 6 heures d’incubation. Les données représentent la moyenne ± SEM d'au moins 5

expériences indépendantes. * p <0,05, ** p <0,01, *** p <0,0001.

66


Figure 2 (C)(D) : Étude de la liaison d’AhR aux promoteurs et analyse de la translocation nucléaire

d’AhR provoqué par l’IAA

(C) La liaison de l’AhR aux promoteurs du facteur tissulaire, CYP1A1 et CYP1B1 a été étudiée par

immunoprécipitation de la chromatine (ChIP) après 1 heure de stimulation des HUVEC avec 50μM

d’IAA. Les données exprimées en termes d'enrichissement, représentent la moyenne ± SEM de n = 6

expériences indépendantes. (D) Le taux d'AhR dans les extraits nucléaires et cytoplasmiques a été

étudié par Western blot après 30 min de stimulation des HUVEC avec 50μM d'IAA en présence de

l'inhibiteur d’AhR, le CH223191 (10μM). Les images sont représentatives de 3 expériences

indépendantes.

Figure 2 (E)(F) : Expression d’ARNm des gènes cibles d’AhR induit par l’IAA

L’expression d’ARNm des gènes cibles d’AhR, CYP1A1 (E) et CYP1B1 (F) après 4h d'incubation des

HUVEC avec l’IAA (50μM) a été étudiée par RT-qPCR comparative en présence de l'inhibiteur d’AhR,

le CH-223191 (10μM). Les données exprimées en facteur de variation de l'ARNm par rapport au

contrôle, représentent la moyenne ± SEM de 10 expériences indépendantes. ** p <0,01, *** p

<0,001.

67


5.1.3. Le site NF-B du promoteur du FT est nécessaire pour l'induction du FT

par l'IAA

AhR ne se lie pas au promoteur du FT après stimulation des HUVEC par l’IAA. Nous avons

étudié la régulation de la transcription du FT en utilisant des plasmides contenant le

promoteur du FT contrôlant l’expression de la luciférase, les constructions utilisées

comportent des sites de liaison pour les facteurs de transcription: AP-1, NF -B, Egr-1 et Sp1

et pour certaines d’entre elles des délétions de ces sites de fixation (Oeth et al. 1997; Li et al.

2009). Nous nous sommes concentrés sur les facteurs de transcription impliqués dans la

régulation positive du FT par des stimuli inflammatoires: AP-1 et NF-B (Bode and Mackman

2014). Les plasmides contenant un promoteur de FT non muté (-227 WT), ou un contenant

un mutant ne fixant pas NF-B (-227 mNF-B), ou un contenant des sites ne liants pas AP-1 (-

227 mAP1), ont été transfectés dans des HUVEC. Dans les cellules transfectées avec la

construction de type FT sauvage, l'activité de la luciférase était de 70% plus élevée dans les

cellules stimulées par l’IAA que dans les cellules témoins (Figure 3A). La perte du site AP-1 (-

227-mAP1) a significativement diminué l'activité de la luciférase à la fois dans les cellules

témoins (éthanol) et stimulées par l’IAA (Figure 3A). Cependant, l'activité du promoteur FT -

227-mAP-1 était 53% plus élevée dans les cellules traitées à l'IAA que dans les cellules

témoins traitées à l'éthanol. Ceci nous a conduits à étudier le niveau nucléaire des sous-

unités AP-1 ; c-Fos et c-Jun dans les cellules HUVEC stimulées par l'IAA. Le niveau nucléaire

de c-fos et de c-jun n'était pas plus élevé dans les cellules traitées par l’IAA que dans les

cellules témoins (Figure supplémentaire 1). L'induction de l'activité du promoteur par l’IAA

était significativement plus faible dans la construction NF-B mutante que dans la forme

sauvage. L'activité du promoteur du FT mutée pour le site NF-B était similaire dans les

cellules traitées par l'IAA et dans les cellules témoins traitées à l'éthanol (Figure 3A). De plus,

68


dans les cellules témoins, aucune différence d'activité du promoteur n'a été observée entre

les cellules transfectées avec le promoteur FT -227WT et le FT -227 mNF-B. Ces données

indiquent que le site NF-B est crucial pour la transcription du gène du FT médiée par l'IAA.

Coopération entre AhR et NF-B dans l'induction du FT par l'IAA

Nous avons incubé les HUVEC avec 50 µM d’IAA pendant 4 heures en présence de

l'inhibiteur pharmacologique d’IkB kinase (IkK), le BAY 11-7082 (Inhibiteur de la voie NF-B).

Le BAY 11-7082 a radicalement diminué l'induction de l'ARNm du FT (Figure 3B) et de la

protéine (Figure 3C) en présence d’IAA. Ceci suggère que l'activation de NF-B est impliquée

dans l'induction du FT par IAA.

Par la suite, nous avons étudié le niveau des sous-unités de NF-B p50 et p65 dans des

extraits nucléaires d’HUVEC stimulés pendant 30 min avec de l’IAA. L’IAA a augmenté le

niveau nucléaire de NF-B p50 (figure 3D) et p65 (Figure supplémentaire 2). Nous avons

ensuite analysé l'effet des inhibiteurs pharmacologiques de la voie NF-B (BAY 11-7082) et

d’AhR (CH223191). La translocation nucléaire de p50 a été inhibée par l'inhibiteur BAY 11-

7082 (Figure 3D). L'augmentation du niveau nucléaire de p50 était également inhibée par

l'inhibiteur d’AhR, le CH223191 (Figure 3D) et par le siRNA AhR (Figure supplémentaire 3),

montrant que l'IAA active NF-B via AhR.

69


Figure 3 (A) : Identification du site de liaison du facteur de transcription sensible a l'IAA dans le

promoteur du FT.

Le site de liaison du facteur de transcription sensible à l'IAA dans le promoteur du FT a été étudié en

utilisant le système rapporteur FT promoteur luciférase. Des plasmides de luciférase contenant soit

un promoteur du FT de type sauvage (-227 WT), soit un mutant non-liant NF-B (-227 mNF-B) ou un

site non-liant AP-1 (-227 mAP1) ont été transfectés dans des cellules HUVEC. Après 6 heures de

stimulation des HUVEC par 50μM d’IAA, les données exprimées dans l'activité de la luciférase ont été

normalisées en facteur d’induction. Les données représentent la moyenne ± SEM de 6 expériences

indépendantes, * p <0,05, ** p <0,01.

Figure 3 (B)(C) : Effet de l'inhibiteur de NF- sur l'expression de l'ARNm (B) et de la protéine (C) du

FT induit par l’IAA.

Après incubation des HUVEC +/- IAA (50μM) pendant 4h +/- l'inhibiteur I Kappa Kinase (IkK) BAY 11-

7082 (10μM), l'expression de l'ARNm du FT (B) a été étudiée par RT-qPCR comparative et exprimée

en facteur de variation de l'ARNm vs contrôle. L'expression de la protéine du facteur tissulaire (C) a

été étudiée par ELISA après 6h d’incubation. Les données représentent la moyenne ± SEM de 4 (B)(C)

expériences indépendantes, * p <0,05.

70


Figure 3 (D) : Étude de l'expression de la p50 endothéliale dans les extraits nucléaires induite par

l’IAA.

L'expression de la p50 endothéliale dans les extraits nucléaires a été mesurée après 30 min

d'incubation des HUVEC avec l’IAA 50 µM, en présence de l'inhibiteur d’AhR, le CH223191 (10 µM) ou

de l'inhibiteur IKK, le BAY 11-7082 (10 µM). Les inhibiteurs ont également été utilisés seul. Les

données représentent la moyenne ± SEM de 5 expériences indépendantes, * p <0,05.

71


5.1.4. Implication de p38 MAPK dans l'induction du FT par l'IAA

Nous avons étudié l'implication de la protéine kinase C (PKC) et des MAP kinases p38 et

ERK1/2 dans l'induction du FT par l’IAA. Les cellules HUVEC ont été stimulées par l'IAA

pendant 4 heures en présence de l'inhibiteur de la PKC ; Bisindolymaleimide I, de l'inhibiteur

de la p38 ; SB203580 et de l'inhibiteur de ERK1/2 ; PD98059. L'induction d'ARNm du FT par

l’IAA a été significativement diminuée par les inhibiteurs de p38 et PKC, mais non modifiée

par l'inhibiteur d’ERK1/2 (Figure 4A). Les inhibiteurs de p38 et PKC ont également diminué

l'induction de la protéine du FT par l’IAA (Figure 4B). Ceci suggère que les voies de la p38 et

de la PKC sont impliquées dans la régulation positive du FT induite par l'IAA.

Enfin, nous avons évalué l'effet des inhibiteurs de la p38 et de la PKC sur l'activation de NF-

B induit par l'IAA. L'augmentation du niveau de p50 nucléaire provoquée par l’IAA (Figure

4C) a été inhibée par l’inhibiteur de p38, le SB203580 mais pas par le Bisindolymaléimide I,

suggérant que p38 mais pas la PKC est impliquée dans la translocation nucléaire de NF-B

induite par l’IAA.

Nos données montrent que l’IAA régule l'expression du FT par une voie inflammatoire non

génomique AhR / p38 MAPK / NF-B (Figure 5).

72


Figure 4 (A)(B) : Effet des inhibiteurs de PKC, p38MAPK, ERK1/2 sur l'expression de l'ARNm (A) et de

la protéine (B) du FT induit par l’IAA.

L'expression de l'ARNm (A) du facteur tissulaire a été étudiée par RT-qPCR comparative après 4h

d'incubation des HUVEC avec l’IAA (50μM) en présence de l'inhibiteur de PKC (Bisindolymaleimide I,

5μM), de l'inhibiteur p38 MAPK (SB203580, 10μM), l’inhibiteur de ERK1/2 (PD98059, 10 µM). Les

données sont exprimées en facteur de variation de l'ARNm par rapport au contrôle. L'expression

protéique (B) du facteur tissulaire a été étudiée par ELISA après 6h incubation des HUVEC avec l’IAA

(50μM) en présence de l'inhibiteur de la PKC (Bisindolymaleimide I, 5μM) et de l'inhibiteur de la p38

MAPK (SB203580, 10μM). Les inhibiteurs ont également été utilisés seuls. Les données représentent

la moyenne ± SEM d'au moins 5 expériences indépendantes, * p <0,05.

73


Figure 4 (C) : Effet des inhibiteurs de PKC et p38 MAPK sur l'expression de la p50 endothéliale induite

par l’IAA dans les extraits nucléaires.

Le niveau de p50 endothéliale a été mesuré dans des extraits nucléaires après 30 min d'incubation

des HUVEC avec l’IAA 50µM, en présence de l'inhibiteur de PKC (Bisindolymaléimide I, 5 µM) et de

l'inhibiteur de p38 MAPK (SB203580, 10µM).

Les inhibiteurs ont également été utilisés seul. Les données représentent la moyenne ± SEM d'au

moins 5 expériences indépendantes, * p <0,05.

74


Figure 5. Les mécanismes liés à l'AhR sous-jacent à la transcription du FT induit par l'IAA dans les

cellules HUVEC

La régulation à la hausse du FT par l’IAA dans les HUVEC est médiée par une voie non génomique

AhR/p38 MAPK/NF-B. Cette régulation à la hausse n'implique pas la liaison d'AhR au promoteur du

FT; AhR active p38 MAPK, qui assure la médiation de la translocation nucléaire de NF-B p50/p65 et

la liaison au promoteur du FT, conduisant à la transcription du FT.

75

Étude de la régulation du Facteur Tissulaire via AhR induit par l’IAA Discussion

Discussion

Dans cette étude, nous avons démontré que l'induction du FT par l’IAA est médiée par

une voie non génomique d’AhR impliquant l'activation de p38MAPK et NF-B.

L'IAA est une toxine urémique liée aux protéines, issue principalement de la

métabolisation du tryptophane par les bactéries intestinales (Fernandez-Prado et al. 2017).

L’IAA est un agoniste d’AhR endogène, qui a des effets endothéliaux similaires à ceux des

polluants exogènes activant AhR comme la TCDD, benzo [a] pyrène, PCB126 et PCB77 (Sallée

et al. 2014). Il induit la production des ROS, régule à la hausse l'expression des molécules

inflammatoires COX-2, IL-8, ICAM-1 et MCP-1 (Dou et al. 2015), et augmente l'expression et

l'activité procoagulante du FT dans les HUVEC (Gondouin et al. 2013). Dans ce travail, nous

montrons que l’IAA augmente l'expression du FT dans les cellules endothéliales d'autres

types de vaisseaux : artériel (aortique) et microvasculaire (cardiaque). Nous avons également

observé que l’ajout de sérum albumine humain ne modifie pas l'effet de l'IAA sur l'induction

du facteur tissulaire. l'IAA, qu'il soit libre ou lié aux protéines, induit une régulation positive

du FT.

Le FT n'est généralement pas exprimé par les cellules endothéliales dans des conditions

normales. Cependant, il est exprimé dans certaines conditions pathologiques in vivo (Bode

and Mackman 2014). L'induction in vitro de l'expression du FT dans les cellules endothéliales

est médiée par diverses voies de signalisation intracellulaires et par les facteurs de

transcription NF-B, AP-1 et Egr-1, en fonction du stimulus ; LPS, IL-1β, TNF- α, thrombine et

VEGF (Bode and Mackman 2014). En utilisant le siRNA AhR, notre équipe à précédemment

décrit une nouvelle voie d'induction de FT par l’IAA qui est médiée par l'activation de l’AhR

(Gondouin et al. 2013). Nous confirmons ici qu'un antagoniste spécifique d’AhR, le

CH223191, est capable de diminuer l'expression de FT médiée par l'IAA.

76


L'induction du FT en réponse à des stimuli est principalement régulée au niveau

transcriptionnel; mais certains stimuli peuvent également augmenter la stabilité de l'ARNm

et/ou de la protéine du FT (Crossman et al. 1990; Brand et al. 1991; Ahern et al. 1993; Reddy

et al. 2004). La régulation de FT par l’IAA a été bien étudiée dans les cellules musculaires

lisses vasculaires par le groupe de Chitalia. Ils ont montré que l'IAA prolonge la demi-vie de

la protéine du FT en diminuant son ubiquitination (Chitalia et al. 2013). En outre, Ils ont

démontré dans les cellules musculaires lisses vasculaires que l’AhR interagit directement

avec le FT et réduit le niveau d'ubiquitination de ce dernier (Shivanna et al. 2016). Dans

notre étude sur les cellules endothéliales, la régulation à la hausse de l'ARNm du FT par l’IAA

a été abolie en présence de l'inhibiteur de transcription, l’actinomycine D, montrant que la

transcription est le mécanisme majeur de l'induction de l'ARNm du FT par l'IAA dans les

cellules endothéliales. Cependant, on ne peut pas exclure qu'il puisse exister une régulation

post-traductionnelle de FT, comme dans les cellules musculaires lisses vasculaires.

La voie génomique classique active l’expression des gènes par la dimérisation d’AhR et

d’aryl-hydrocarbon nuclear translocator (ARNT). Lors de la liaison du ligand à AhR, il est

transloqué dans le noyau où il s'associe à son partenaire d'hétérodimérisation ARNT.

L'hétérodimère AHR/ARNT se lie au motif de séquence d'ADN, appelé XRE, dans les

promoteurs des gènes cibles. Dans le XRE (5'-TNGCGTG-3 '), une séquence centrale minimale

de 5'-GCGTG-3' est requise pour la liaison de l’AHR/ARNT (Swanson et al. 1995) et l'induction

de gènes cibles comme les enzymes métabolisant les xénobiotiques, CYP1A1 et CYP1B1

(Dolwick et al. 1993; Fujii-Kuriyama and Mimura 2005). Récemment, une voie génomique

indépendante de l'ARNT d’AhR a été rapportée (Jackson et al. 2015), avec un nouveau XRE

non-consensus (NC-XRE) décrit dans le promoteur de PAI-1 (Huang and Elferink 2012) et

dans le promoteur de p21Cip1 (Jackson et al. 2014). L'expression du gène AhR-dépendante

77


médiée par le NC-XRE n'implique pas l'ARNT en tant que composant du complexe AhR lié à

NC-XRE. Dans ce travail, nous rapportons que l’IAA active la voie génomique classique d’AhR

dans les HUVEC. L’IAA induit la translocation nucléaire d’AhR et AhR se lie aux promoteurs

des gènes cibles CYP1A1 et CYP1B1, conduisant à la régulation positive des ARNm du CYP1A1

et CYP1B1. L'inhibiteur d’AhR, le CH223191 réduit la translocation nucléaire d’AhR médiée

par l’IAA et abolit l'expression induite par l’IAA de CYP1A1 et CYP1B1. Le CH223191 a été

initialement décrit comme un inhibiteur de la liaison de TCDD à AhR, qui inhibe la

translocation nucléaire d’AhR induite par la TCDD (Kim et al. 2006). On peut supposer que le

CH223191 inhibe également la liaison de l'IAA à AhR. À l’inverse, nous avons montré que

l’AhR ne se lie pas au promoteur du FT, la voie génomique classique de l'activation de l’AhR

n'est pas impliquée dans la régulation à la hausse du FT par l'IAA. Ce résultat concorde avec

l'absence de séquences XRE ou NC-XRE dans le promoteur du FT.

Une fois activé par le ligand, l’AhR peut activer une voie non-génomique dite

inflammatoire, ceci ne nécessite pas la participation de l'ARNT (Matsumura 2009). Il a été

démontré que l’AhR pouvait activer d'autres facteurs de transcription tels que ; AP-1 (Di

Meglio et al. 2014; Ito et al. 2016) et NF-B (Borlak and Jenke 2008; Vogel and Matsumura

2009; Øvrevik et al. 2014) pour conduire à l'expression des gènes, par une voie non-

génomique. Notre équipe a précédemment rapporté que l'IAA induit une expression de la

COX-2 endothéliale inflammatoire via une voie non génomique de l’AhR impliquant NF-B

(Dou et al. 2015). Dans mon travail, nous avons clairement démontré le rôle de NF-B dans

l'expression du FT médiée par l'IAA. Nous avons montré que le site NF-B est essentiel dans

l'activité du promoteur du FT induite par l'IAA. De plus, l’inhibiteur de l’IkB-kinase, qui inhibe

la phosphorylation d’IkB et l'activation ultérieure de NF-B, inhibe fortement l'ARNm du FT

et l'induction de la protéine par l'IAA. Ensuite, nous avons montré que l'IAA augmentait le

78


niveau nucléaire des sous-unités p50 et p65 de NF-B, qui sont des régulateurs critiques du

FT (Li et al. 2009). Cela n'exclut pas que d'autres sous-unités de NF-B tels que ; p52, RelB et

c-Rel puissent être activées par l’IAA. Il est intéressant de noter que la translocation

nucléaire de la p50 induite par l'IAA a diminué lorsque l'AhR était inhibée. La translocation

nucléaire de p50 était donc médiée par l'activation de l’AhR. Tous ces résultats ont

démontré le rôle crucial de NF-B dans l'induction de FT induite par l’IAA via AhR. Nous

avons également observé que la mutation du site AP-1 diminuait significativement l'activité

du promoteur du FT dans les cellules témoins et celles stimulées avec l’IAA, mais l’IAA

augmente l'activité du promoteur du FT lorsque le site AP-1 est muté. En outre, l'IAA n'a pas

augmenté le niveau nucléaire des sous-unités c-Jun et c-fos de l'AP-1. Ces résultats

suggèrent que le site AP-1 est requis pour l'expression basale du FT et qu'il n'est que

partiellement impliqué dans l'induction du FT par l'IAA. On ne peut pas exclure que d'autres

sous-unités d’AP-1 ; Fos-B/Fra-1/Fra-2/Jun-B/Jun-D puissent être impliquées, ou qu’AP-1

coopère avec NF-B pour induire l'expression du FT comme décrit pour d'autres agonistes

comme le TNF-alpha et IL-1 bêta (Mackman et al. 1991; Armstead et al. 1999; Xia et al. 2013,

2016).

Plusieurs études ont montré l’interaction d'AhR avec de multiples voies de signalisation,

notamment les MAP kinases (Henklová et al. 2008; Puga et al. 2009); et les activateurs

conventionnels d’AhR tels que le TCDD, le benzo [a] pyrène et les MAP kinases (Henklová et

al. 2008; Puga et al. 2009). Dans une étude précédente, notre équipe a démontré que l'IAA

induit la phosphorylation de p38 MAPK et ERK (Dou et al. 2015). Dans cette étude nous

avons trouvé que p38 MAPK, mais pas ERK, est impliqué dans la régulation du FT par l'IAA.

L'inhibition de p38 diminuait l’expression du FT initialement induit par l’IAA. De plus, la

translocation nucléaire de la p50 induite par l'IAA a été diminuée par les inhibiteurs d'AhR et

79


de p38 MAPK. Par conséquent, en plus de l'activation de la voie génomique classique, la

liaison d'IAA à AhR active une voie de signalisation cytoplasmique passant par p38 MAPK et

NF-B pour induire l'expression du FT.

Nous avons également observé l'implication de PKC dans l’expression du FT induit par

l’IAA, mais l'absence d'inhibition de la translocation nucléaire de p50 par l'inhibiteur PKC

suggère que la PKC n'est pas impliquée dans la voie de signalisation cytoplasmique AhR / p38

qui conduit à la translocation nucléaire de p50. Les PKC sont connus pour leur rôle clé dans

la transduction du signal cytoplasmique; elles peuvent également réguler directement

l'expression génique par la transduction du signal dans le noyau, un processus distinct des

voies de signalisation cytoplasmiques (Lim et al. 2015). Au sein du noyau, les PKC peuvent

réguler directement la transcription génique en phosphorylant des résidus d'histones

spécifiques ou en phosphorylant des facteurs de transcription (Lim et al. 2015). Par exemple,

PKCα peut phosphoryler NF-B p65 à S276, ce qui est nécessaire pour l'activation

transcriptionnelle de NF-B (Lim et al. 2015). Nos résultats permettent de supposer que PKC

pourrait jouer un rôle dans la transcription du FT induite par l’IAA comme un régulateur

épigénétique plutôt que comme un transducteur de signal cytoplasmique impliqué dans la

voie AhR/p38.

En conclusion, l'IAA induit l'expression du FT par l'intermédiaire d'une voie inflammatoire

AhR/p38MAPK/NF-B. Une meilleure compréhension des mécanismes impliqués dans

l'induction du FT par les toxines urémiques pourrait fournir de nouvelles cibles

thérapeutiques pour réduire le risque thrombotique chez les patients atteints de MRC.

80

Étude de la régulation du Facteur Tissulaire via AhR induit par l’IAA Figures supplémentaires

Figures supplémentaires

Figure supplémentaire 1. Effet de l'IAA sur les niveaux nucléaires des sous-unités AP-1 ; c-Jun (A)

et c-Fos (B)

L'expression endothéliale de c-Fos et c-Jun dans les extraits nucléaires a été mesurée après 30

minutes d'incubation des HUVEC avec de l'IAA 50μM. Les données représentent la moyenne ± SEM

de 6 expériences indépendantes, * p<0.05, **p<0.01.

Figure supplémentaire 2. Effet de l'IAA sur les niveaux nucléaires de NF-B p65

L'expression de p65 endothélial dans les extraits nucléaires a été mesurée après 30 min d'incubation

des HUVEC avec de l'IAA 50μM. Les données représentent la moyenne ± SEM de 6 expériences

indépendantes,

* p<0.05.

CTRL IAA

0

10

20

30

40

50

Nor

mal

ized

c-fo

snu

clea

rex

pres

sion

0

50

100

150N

orm

aliz

edc-

jun

nucl

ear

expr

essi

on

CTRL IAA

A B

0.0

0.5

1.0

1.5

2.0

2.5

*

Nor

mal

ized

p65

nucl

ear

exp

ress

ion

CTRL IAA

Exp

ress

ion

de

c-fo

s n

ucl

éair

e

no

rmal

isée

Exp

ress

ion

de

c-ju

n n

ucl

éair

e

no

rmal

isée

81

Étude de la régulation du Facteur Tissulaire via AhR induit par l’IAA Figures supplémentaires

Figure supplémentaire 3. Effet du siRNA AhR sur l'expression nucléaire de p50

Les cellules HUVEC transfectées avec le siRNA contrôle ou AhR ont été stimulées avec de l'IAA 50 µM

ou de l'éthanol (dilution au 1/1000). Le niveau de p50 endothélial dans les extraits nucléaires a été

étudié par Western blot. Les images sont représentatives de 3 expériences indépendantes.

Exp

ress

ion

de

p5

0 n

ucl

éair

e

no

rmal

isée

IAA - + +

Si AhR - - +

p50

Actine

IAA - + +

Si AhR - - +

0

2

4

6

8

82

Étude de la régulation du Facteur Tissulaire via AhR induit par l’IS Résultats et discussion

5.2. Étude de la régulation du Facteur Tissulaire via

AhR induit par l’IS

83

Étude de la régulation du Facteur Tissulaire via AhR induit par l’IS Résultats

Résultats

5.2.1. L’induction de l'expression du FT dans les cellules endothéliales HUVEC

par l’IS est contrôlée au niveau transcriptionnel

Nous avons utilisé l'inhibiteur de la transcription l’actinomycin D pour confirmer que la

transcription était la principale façon de contrôler l'expression du FT après stimulation des

HUVEC par l’IS (Figure 1). L'actinomycine D a aboli l'expression de l'ARNm du FT induit par

l’IS, ainsi que l'expression basale de l'ARNm du FT. Ces résultats suggèrent que l'expression

du FT induit par l’IS dans les cellules endothéliales est contrôlée au niveau transcriptionnel.

Figure 1 : Effet de l'inhibiteur de la transcription Actinomycine D (1μg/mL) sur l'expression de l'ARNm

du FT induit par l’IS.

Les HUVEC ont été incubés pendant 4 heures avec IS200µM en présence de l’Actinomycine D.

L’expression d’ARNm a été étudiée par RT-qPCR comparative. Les données exprimées en facteur de

variation de l'ARNm par rapport au contrôle, représentent la moyenne ± SEM de 4 expériences

indépendantes, ** p <0,01.

84


5.2.2. L’IS induit une activation d’AhR sans la fixation de ce dernier sur le

promoteur du FT

Notre équipe avait montré que l'IS induisait l'expression en ARNm et en protéine du facteur

tissulaire via AhR (Gondouin et al. 2013) (Figure 2 A,B). Nous avons réalisé des expériences

de ChIP, afin de déterminer si l’IS permettait la fixation d’AhR sur le promoteur du FT pour

l’induction de gène du FT dans les HUVEC (Figure 2C). Aucun enrichissement d’AhR sur le

promoteur du FT n’a été observé, montrant qu’AhR n'était pas directement recruté dans le

promoteur du FT après une stimulation par l’IS. L'IS a induit le recrutement d'AhR au niveau

des promoteurs des gènes cibles, CYP1A1 et CYP1B1 (Figure 2C). L’IS a augmenté la

translocation nucléaire d’AhR (Figure 2D). Contrairement aux résultats récemment publiés

avec l’IAA, l'inhibiteur d’AhR , le CH223191 n’a eu aucun effet sur la translocation nucléaire

d’AhR induite par l’IS (Figure 2D). Nous avons ensuite examiné l'effet de l'IS sur la régulation

du CYP1A1 et du CYP1B1 dans les HUVEC. L’IS a induit une augmentation significative de

l'expression en ARNm du CYP1A1 et CYP1B1 (Figure 2E,F). Cette augmentation n’a pas été

inhibée par le CH223191.

Figure 2 (A)(B) : Effet des siRNA AhR sur l'expression de l'ARNm (A) et de la protéine (B) du FT après

incubation des HUVEC avec 200μM d'IS (Gondouin et al. 2013).

85


Figure 2 (C)(D) : Étude de la liaison d’AhR aux promoteurs et analyse de la translocation nucléaire

provoquée par l’IS.

(C) La liaison d'AhR aux promoteurs du FT, CYP1A1, et CYP1B1 a été étudiée par immunoprécipitation

de la chromatine (ChIP) après 1 heure d’incubation des HUVEC avec 200μM d’IS. Les données

exprimées en termes d'enrichissement représentent la moyenne ± SEM de 6 expériences

indépendantes. (D) Le taux d'AhR dans les extraits nucléaires a été étudié par Western blot après 30

min de stimulation des HUVEC avec 200µM d'IS en présence de l'inhibiteur de l’AhR, CH223191 (10

µM). Les images sont représentatives de 3 expériences indépendantes.

Figure 2 (E)(F) : Expression d’ARNm des gènes cibles d’AhR induit par l’IS

L’expression d’ARNm des gènes cible d’AhR, CYP1A1 (E) et CYP1B1 (F) après 4h d'incubation des

HUVEC avec l’IS (200μM) a été étudiée par RT-qPCR comparative en présence de l'inhibiteur d’AhR,

CH223191 (10μM). Les données, exprimées en facteur de variation de l'ARNm par rapport au

contrôle, représentent la moyenne ± SEM de 5 expériences indépendantes, * p<0.05.

86


5.2.3. Une voie non-génomique indirecte d’AhR activant d’autres facteurs de

transcription semble être impliquée dans la régulation de l’expression

du FT induit par l'IS

L’AhR ne se fixe pas directement au promoteur du FT lors de la stimulation des HUVEC par

l’IS. Comme dans l’étude précédente avec l’IAA, nous avons étudié la régulation de la

transcription du FT en utilisant les plasmides. Dans les cellules transfectées avec la

construction du promoteur de FT de type sauvage (-227 WT), l'activité de la luciférase était

57% plus élevée dans les cellules stimulées par l'IS que dans les cellules contrôles (Figure

3A). La mutation des sites AP-1 dans la construction du promoteur de FT (-227-mAP1) a

significativement diminué l'activité de la luciférase à la fois dans les cellules contrôles et

celles stimulées par l'IS (Figure 3A). De plus, l'activité du promoteur de FT muté AP-1 n’était

que 24% plus élevée dans les cellules traitées à l'IS par rapport aux contrôles. Ces résultats

suggèrent qu’AP-1 jouerait un rôle dans l’expression du FT induit par l’IS.

L'induction de l'activité de la luciférase par l’IS était significativement plus faible dans la

construction de promoteur de FT muté pour le site NF-B (-227 mNF-B) que dans le

sauvage (-227WT) (Figure 3A). De manière intéressante, l'activité du promoteur (-227 mNF-

B) n’était pas significativement augmentée dans les cellules traitées par l’IS par rapport aux

cellules contrôles (Figure 3A). Ces résultats confirment le rôle crucial du site NF-B pour la

transcription du gène du FT induit par l'IS.

Nous avons confirmé l'implication de la voie NF-B dans l'induction du FT par l'IS avec

l’inhibiteur pharmacologique de la voie NF-B, le BAY 11-7082. L’inhibiteur a drastiquement

diminué l'induction de l'ARNm du FT (Figure 3B) et de la protéine (Figure 3C) induit par l’IS.

Ceci confirme l’implication de la voie NF-B dans la régulation de l’expression du FT induit

par l'IS.

87


Figure 3 (A) : Identification du site de liaison du facteur de transcription sensible a l'IS dans le

promoteur du FT.

L'identification du site de liaison du facteur de transcription sensible à l'IS dans le promoteur du FT a

été étudiée en utilisant le système rapporteur FT promoteur luciférase. Des plasmides de luciférase

contenant soit un promoteur de FT de type sauvage (-227 WT), soit un mutant non-liant NF-B (-227

mNF-B) ou un site non-liant AP-1 (-227 mAP1) ont été transfectés dans des cellules HUVEC. Après 6

heures de stimulation des HUVEC par 200μM d’IS, les données exprimées en activité de la luciférase

ont été normalisées en facteur d’induction. Les données représentent la moyenne ± SEM de 6

expériences indépendantes, * p <0,05.

Figure 3 (B)(C) : Effet de l'inhibiteur de NF- sur l'expression du FT induit par l’IS.

Après 4h d’incubation des HUVEC avec l’IS (200μM) en présence de l'inhibiteur de ; I Kappa Kinase

(IkK) de la voie NF-B, le BAY 11-7082 (10μM), l'expression de l'ARNm du FT (B) a été étudiée par RT-

qPCR comparative et exprimée en facteur de variation de l'ARNm vs contrôle. L'expression de la

protéine du FT (C) a été étudiée par ELISA après 6h d’incubation. Les données représentent la

moyenne ± SEM de 5 (B) (C) expériences indépendantes, * p <0,05, ** p <0,01.

88


5.2.4. Implication de p38 MAPK et PKC dans l’éxpresion du FT induit par l'IS

Nous avons analysé l'implication de la protéine kinase C (PKC) et des MAP kinases p38 et

ERK1/2 dans l'induction du FT par l’IS. Les cellules HUVEC ont été stimulées par l'IS pendant

4 heures en présence de l'inhibiteur de la PKC ; le Bisindolymaleimide I, de l'inhibiteur de la

p38 ; le SB203580 et de l'inhibiteur de ERK1/2 ; le PD98059. Les inhibiteurs de p38 et PKC

ont diminué l’expression en ARNm et en protéines du FT initialement induit par l’IS, mais pas

de modification significative observée avec l’inhibiteur d’ERK1/2 (Figure 4A, 4B). Ces

résultats suggèrent que p38 MAPK et la PKC seraient impliquées dans la régulation du FT

induit par l'IS comme dans l’IAA.

89


Figure 4 (A)(B) : Effet des inhibiteurs de PKC, p38MAPK, ERK1/2 sur l'expression de l'ARNm (A) et de

la protéine (B) du FT induit par l’IS.

L'expression de l'ARNm (A) du FT a été étudiée par RT-qPCR comparative après 4h d'incubation des

HUVEC avec l’IS (200μM) en présence de l'inhibiteur de PKC (Bisindolymaleimide I, 5μM), de

l'inhibiteur de p38 MAPK (SB203580, 10μM) et l’Inhibiteur de ERK1/2 (PD98059, 10 µM). Les données

sont exprimées en facteur de variation de l'ARNm par rapport au contrôle. L'expression protéique (B)

du FT a été étudiée par ELISA après 6h d’incubation des HUVEC avec l’IS (200μM) en présence de

l'inhibiteur de la PKC (Bisindolymaleimide I, 5μM) et de l'inhibiteur de la p38 MAPK (SB203580,

10μM). Les données représentent la moyenne ± SEM de 5 (A) (B) d’expériences indépendantes, ** p

<0,01.

90

Étude de la régulation du Facteur Tissulaire via AhR induit par l’IS Discussion

Discussion

L’IS induit l’expression du facteur tissulaire endothélial via une voie non-génomique

dépendante d’AhR, impliquant d’autres facteurs de transcription et molécules de

signalisation.

L’IS, comme l’IAA, est une toxine urémique dérivée de la voie indolique du métabolisme

du tryptophane. Contrairement à l’IAA qui est issue principalement après métabolisation du

tryptophane par la flore bactérienne intestinale (Koga et al. 1994), l’IS est issue de la

conversion du tryptophane alimentaire en indole dans l’intestin, et après oxydation et

sulfatation de cet indole au niveau du foie (Aronov et al. 2011). L’IS s’accumule chez les

patients MRC avec une IRC terminale, et est mal épuré par la dialyse du faîte de sa liaison

aux protéines (Neirynck et al. 2013b). L’accumulation de l’IS dans les sérums des patients

MRC est associée à une augmentation du risque de complications cardiovasculaires et de

mortalité (Barreto et al. 2009). L’IS induit une dysfonction endothéliale (Yu et al. 2011;

Jourde-Chiche et al. 2011), un stress oxydant endothélial (Dou et al. 2007), une expression

des molécules inflammatoire MCP-1, ICAM et IL-6 (Tumur et al. 2010; Masai et al. 2010;

Adelibieke et al. 2014), et notamment l’expression du facteur pro-thrombotique, le facteur

tissulaire dans les HUVEC (Gondouin et al. 2013). Notre équipe a précédemment montré que

l’IS induit l’expression du FT endothélial via un nouveau facteur de transcription l’Aryl

hydrocarbon receptor en utilisant des siRNA AhR (Gondouin et al. 2013). Dans cette étude,

l’utilisation de l’inhibiteur de la transcription l’Actinomycine D a aboli l’expression de l’ARNm

du FT induite par l’IS. Ceci suggère que la régulation du facteur tissulaire par AhR est

principalement transcriptionnelle, après stimulation des HUVEC par l’IS. Ce résultat a été

également décrit avec la toxine urémique indolique IAA.

91


Comme dans l’étude précédente avec l’IAA, nous avons montré que l’IS active la voie

génomique classique d’AhR, en induisant une translocation nucléaire d’AhR, une fixation

d’AhR au niveau des promoteurs de ces gènes cibles, et une induction de l’expression de

CYP1A1 et CYP1B1. En outre, nous avons montré avec la chromatine immunoprecipitation

que l’AhR ne se fixe pas directement au niveau du promoteur du facteur tissulaire, après

stimulation des HUVEC avec l’IS.

Nous avons précédemment montré que le CH223191 inhibait l’effet de l’IAA sur

l’activation d’AhR et sur l’induction du FT. Les présents résultats montrent que le CH223191

n’inhibe pas la translocation nucléaire d’AhR et l’expression des gènes cibles d’AhR induit par

l’IS. De plus, nous avons constaté que le CH223191 n’inhibait pas l’expression en ARNm et en

protéines du facteur tissulaire induit par l’IS (Données non présentées).

Le CH223191 est un antagoniste ligand-sélectif de l’AhR (Zhao et al. 2010). En effet, le

CH223191 a la capacité d’inhiber certaines classes d’agonistes d’AhR comme, le 2,3,7,8-

tétrachlorodibenzo-p-dioxine, mais pas d'autres comme certains PAHs, flavonoïdes ou

l’indirubine (Zhao et al. 2010). La diversité structurelle des ligands d’AhR contribue à la

variation sélective de l’effet du CH223191 dans l’inhibition de la liaison des ligands à l’AhR.

Ainsi, la capacité du CH223191 à inhiber l’activation de l’AhR en présence d’IAA, mais pas en

présence de l’IS, pourrait être due aux différences structurelles que présentent les deux

toxines indoliques (Sallée et al. 2014). Cette différence structurelle pourrait également jouer

un rôle dans l’affinité de l’IS et IAA à l’AhR, et/ou dans les variations des régions de fixations

des toxines indoliques sur le site de fixation des ligands sur l’AhR. Une étude récente a

montré qu’une mutation au niveau des sites de liaison des ligands d’AhR, modifie

sélectivement l’affinité des ligands exogènes à l’AhR, mais pas des ligands endogènes d’AhR,

92


suggérant que ces derniers ne se fixent pas dans la même région sur le site de liaison des

ligands de l’AhR (Hubbard et al. 2016).

Les sites de fixation des facteurs de transcriptions NF-B et AP-1 sont primordiaux dans

l’activité du promoteur induite par l’IS. La mutation du site AP-1 a diminué l’activité du

promoteur du facteur tissulaire dans les cellules contrôles et celles stimuler avec l’IS,

suggérant l’importance du facteur de transcription AP-1 dans l’expression basale du facteur

tissulaire, et son implication lors de l’induction du FT par l’S. La mutation du site du facteur

de transcription NF-B a aboli l’activité du promoteur du FT induite par l’IS. En outre,

l’utilisation d’un inhibiteur de la voie NF-B dans les cellules HUVEC stimulées avec l’IS a

inhibé l’expression du facteur tissulaire, ce qui confirme l’implication de la voie NF-B dans

l’expression du FT induit par l’IS. Ces résultats soutiennent que les facteurs de transcription

NF-B et AP-1 sont tous deux nécessaires dans l’induction du facteur tissulaire induit par l’IS.

Des résultats similaires sont observés dans l’étude de l’expression du FT induit par l’IAA.

L’utilisation de l’inhibiteur de p38 et PKC a inhibé l’expression en ARNm et en protéines

du facteur tissulaire induit par l’IS, ceci conforte le rôle de MAPKp38 et PKC dans la

régulation de l’expression du FT induite par l’IS, et suggère une voie similaire à celle décrite

pour l’IAA. Cependant, plus d’investigations sont nécessaires pour confirmer cela.

En conclusion, la voie génomique d’AhR n’est pas impliquée dans la régulation de

l’expression du facteur tissulaire induit par l’IS. Une voie non-génomique d’AhR impliquant

des molécules de signalisation p38MAPK/PKC et les facteurs de transcription NF-B/AP-1

seraient responsable de la régulation du facteur tissulaire induit par l’IS.

93

Étude du lien entre le FT circulant et les taux sériques d’IAA/IS chez les patients HD de Marseille Résultats et discussion

5.3. Étude du lien entre le FT circulant et les taux

sériques d’IAA et d’IS chez les patients HD de

Marseille

94

Étude du lien entre le FT circulant et les taux sériques d’IAA/IS chez les patients HD de Marseille Résultats

Résultats

Les taux de FT circulants sont indépendamment liés au niveau d'IAA mais pas

d’IS chez les patients hémodialysés de Marseille

Les toxines indoliques IAA et l’IS augmentent l’expression du FT dans les cellules

endothéliales et dans les cellules mononuclées sanguines périphériques (PBMC) (Gondouin

et al 2013). L’augmentation de l’expression du FT induit par les toxines indoliques pourrait

expliquer les taux élevés de FT circulant (FTc) observés chez les patients atteints de MRC.

Dans cette étude, nous avons mesuré les taux plasmatiques de FTc d’une cohorte de 92

patients hémodialysés (HD) (Tableau 1). Les valeurs moyennes de FTc étaient de 133 ± 66

pg/mL (médiane 131 pg/mL) et allaient de 36 à 410 pg/mL. En analyse univariée les taux de

FTc étaient négativement corrélés avec la fonction rénale résiduelle (r = -0,27, p <0,01) et

positivement corrélés avec le cholestérol sérique (r = 0,24 p <0,05), le HDL-cholestérol (r =

0,22, p <0,05), et avec les toxines urémiques B2-microglobuline (r = 0,22 p <0,05) et l’IAA (r =

0,32, p <0,01) (Tableau 2). Dans l'analyse de régression linéaire multivariée chez les patients

HD, seule l'IAA sérique (estimation = 3,36, IC 95% [0,41 à 6,3], p <0,05) était

significativement associée au taux de FTc (Tableau 3).

95


Tableau 1. Caractéristiques de base de la population HD (n=92)

Âge (année) 70 (23 ; 91)

Sexe (F/H) 33/59

Indice de masse corporelle (kg/m2) 24.0 (14.3 ; 47)

Maladie rénale

Glomérulopathie (Diabétique incluse) 20 (22%)

PKD* 7 (7%)

Vasculaire 30 (33%)

Interstitiel 11 (12%)

Autre et héréditaire 2 (2%)

Indéterminé 22 (24%)

Hypertension 82 (91%)

Fonction rénale résiduelle 20 (21%)

Pression artérielle systolique (mmHg) 144± 24

Pression artérielle diastolique (mmHg) 73 ± 15

Fumeurs actuels 27 (29%)

Historique de maladie cardiovasculaire 37 (40%)

Médicaments antihypertenseurs 61 (66 %)

Statines 30 (32%)

Médicaments antiplaquettaires 49 (53%)

Médicaments anticoagulants 23 (25%)

Traitement à l’érythropoïétine 71 (77%)

Hémoglobine (g/dL) 11.6 ± 1.1

FT plasmatique (pg/mL) 131 (36 ; 410)

Taux de CRP sérique (mg/L) 7 (0 ; 78)

Taux d’albumine sérique (g/L) 36.3 ± 4.4

Taux de calcium sérique (mmol/L) 2.34 ± 0.14

Taux de phosphate sérique (mmol/L) 1.53 (0.54 ; 3.17)

Taux d’urée sérique (mmol/L) 19.9 ± 5.4

Taux de créatinine sérique (µmol/L) 759 (213 ; 1533)

Taux de cholestérol sérique (mmol/L) 4.3 ± 1.0

Taux de LDL-cholestérol sérique (mmol/L) 2.45 ± 0.87

Taux de HDL-cholestérol sérique (mmol/L) 1.05 (0.28 ; 2.57)

Taux de triglycérides sérique (mmol/L)) 1.3 (0.6 ; 3.7)

Taux de 2microglobulin sérique (mg/L) 32.2 (17.4 ; 66.9)

Taux de p-crésyl sulfate sérique (µM) 104 (4.3 ; 443.6)

Taux d’indole-3 acétique acide (µM) 4.3 (1.0 ; 19.1)

Taux d’indoxyle sulfate sérique (µM) 88.6 (0.2 ; 256.2)

*PKD: maladie rénale polykystique autosomique dominante

Les résultats sont donnés en moyenne ± SD si la distribution est gaussienne, ou en médiane

(min; max) si non.

96


Tableau 2. Corrélations de Spearman à Two-tailed des caractéristiques de base avec les

taux plasmatiques de FT dans la cohorte HD (n=92)

FT

r p

Âge (année) 0.08 0.4

Sexe (F/H) -0.19 0.08

Indice de masse corporelle 0.00 1

Maladie rénale -0.18 0.08

Fonction rénale résiduelle -0.27 <0.01

Pression artérielle systolique -0.01 0.9

Pression artérielle diastolique -0.08 0.4

Fumeurs actuels -0.05 0.6

Historique de maladie cardiovasculaire -0.05 0.6

Médicaments antihypertenseurs -0.08 0.5

Statines -0.18 0.4

Médicaments antiplaquettaires -0.18 0.08

Médicaments anticoagulants 0.12 0.3

Traitement à l’érythropoïétine -0.11 0.3

Hémoglobine 0.17 0.1

Taux de CRP sérique (mg/L) 0.12 0.3

Taux d’albumine sérique (g/L) -0.08 0.4

Taux de calcium sérique (mmol/L) -0.07 0.5

Taux de phosphate sérique (mmol/L) -0.15 0.2

Taux d’urée sérique (mmol/L) -0.05 0.6

Taux de créatinine sérique (µmol/L) 0.03 0.7

Taux de cholestérol sérique (mmol/L) 0.24 <0.05

Taux de LDL-cholestérol sérique (mmol/L) 0.18 0.09

Taux de HDL-cholestérol sérique (mmol/L) 0.22 <0.05

Taux de triglycérides sérique (mmol/L)) 0.04 0.7

Taux de 2microglobulin sérique (mg/L) 0.22 <0.05

Taux de p-crésyl sulfate sérique (µM) 0.07 0.5

Taux d’indole-3 acétique acide (µM) 0.32 <0.01

Taux d’indoxyle sulfate sérique (µM) -0.1 0.3

97


Tableau 3. Analyse de régression linéaire multivariée pour évaluer la relation entre les

variables indépendantes et les taux plasmatiques de FT chez les patients HD (n=92)

FT

Estimation 95% CI p

Âge 0.18 [-0.75 to 1.12] 0.7

Sexe 21.66 [-7.36 to 50.69] 0.14

Fonction rénale résiduelle -23.81 [-55.45 to 7.83] 0.14

Taux d’indole-3acetic acide sérique 3.54 [0.66 to 6.43] <0.05

Taux de 2microglobuline sérique 1.1 [-0.4 to 2.61] 0.15

Taux de cholestérol sérique 11.21 [-3.13 to 25.55] 0.12

Taux de HDL-cholestérol sérique 3.35 [−30.86 to 37.56] 0.8

98

Étude du lien entre le FT circulant et les taux sériques d’IAA/IS chez les patients HD de Marseille Discussion

Discussion

Dans cette étude, nous avons montré que l’IAA était indépendamment lié au FT circulant

chez les patients HD de Marseille. L’augmentation de l’expression du FT induite par l'IAA et

l’IS a des conséquences fonctionnelles sur le risque thrombotique. En effet, l'augmentation

de l'abondance des protéines du FT induite par l'IAA et l’IS, est associée à une activité

procoagulante accrue dans les cellules endothéliales, dans les cellules musculaires lisses

vasculaires (Gondouin et al 2013), et augmente la thrombogénicité dans un modèle ex-vivo

(Chitalia et al. 2013). Il est montré qu’un anticorps contre le FT endothélial empêche le

dépôt plaquettaire sur les cellules endothéliales en culture induit par le sérum urémique

(Serradell et al. 2001), suggérant que la présence du FT endothélial est responsable du dépôt

plaquettaire. Les patients atteints de MRC présentent des taux élevés de FTc et une activité

procoagulante FT-dépendante accrue (Gondouin et al. 2013; Shivanna et al. 2016). Les taux

de FTc chez les patients atteints de MRC sont liés à certaines toxines urémiques qui sont des

agonistes de l'AhR. Les niveaux de kynurénine sont associés aux taux de FTc et à

l'hypercoagulabilité chez les patients HD (Pawlak et al. 2009). Les taux de FTc sont corrélés

avec l'indoxyl sulfate chez les patients atteints MRC non dialysés (Gondouin et al. 2013).

Nous avons montré que le niveau de FTc était positivement corrélé avec le cholestérol

sérique, le HDL-cholestérol, et avec les toxines urémiques B2-microglobuline et l’IAA dans

l'analyse univariée. Cependant, nous n'avons pas trouvé de corrélation positive entre le FTc

et l’indoxyl sulfate chez les patients HD, comme il a été précédemment observé chez les

patients MRC non dialysés (Goundouin et al. 2013). Dans l'analyse de régression linéaire

multivariée, seule l'IAA sérique était significativement et indépendamment associée au taux

de FTc. Notre équipe a déjà identifié l’IAA comme un prédicteur indépendant des

événements cardiovasculaires et de la mortalité chez les patients atteints de MRC (Dou et al.

99

Étude du lien entre le FT circulant et les taux sériques d’IAA/IS chez les patients HD de Marseille Discussion

2015). La régulation positive du FT fait partie des mécanismes par lesquels l'IAA peut induire

une athérothrombose chez les patients MRC. De plus, le FTc était négativement corrélé avec

la fonction rénale résiduelle (en analyse simple) chez les patients HD dans la présente étude,

et avec le DFG estimé chez les patients MRC non dialysés dans une étude précédente

(Gondouin et al. 2013). Ceci suggère que la préservation de la fonction rénale chez les

patients HD pourrait être avantageuse pour prévenir l'augmentation des taux de FTc et

limiter le risque thrombotique.

La stratégie de cibler spécifiquement la voie thrombotique/inflammatoire non

génomique de l'activation de l'AhR pourrait être déterminante pour le contrôle des taux de

FTc chez les patients MRC.

100

Étude comparative entre deux cohortes de patients HD (Oran vs Marseille) Résultats et Discussion

5.4. Étude comparative entre deux cohortes de

patients HD (Oran vs Marseille)

101

Étude comparative entre une cohorte de patient HD d’Oran vs Marseille Résultats

Étude comparative entre deux cohortes de patients HD (Oran vs Marseille) Résultats

Résultats

5.4.1. Comparaison de la cohorte de patients HD d’Oran et des patients HD

de Marseille

Nous avons commencé à comparer les caractéristiques des deux cohortes de patients HD

« Oran vs Marseille » (Tableau 1). Dans la cohorte de patients HD d’Oran nous avons moins

d’hypertendus, moins de fumeurs actifs et moins de patients avec une néphropathie

d’origine glomérulaire et interstitielle. Les patients HD d’Oran avaient plus de créatinine que

les patients HD de Marseille (médiane µmol/l; 852 vs 753 ; P<0.05), de potassium

(médiane mmol/l; 5.54 vs 4.92 ; P<0.001) et moins de HDL cholestérol (médiane mmol/l;

0.74 vs 1.15 ; P<0.0001), de calcium (médiane mmol/l; 2.06 vs 2.32 ; P<0.0001) , de

bicarbonate (moyenne mmol/l; 16.47 vs 20.79 ; P<0.0001), d’hémoglobine (médiane g/dl;

9.6 vs 10.6 ; P<0.0001) et de CRP (médiane mg/l; 1.5 vs 5 ; P<0.0001). L’albuminémie est

aussi plus basse dans la cohorte algérienne.

102

Étude comparative entre deux cohortes de patients HD (Oran vs Marseille)

Résultats

Tableau 1.

Caractéristiques des patients

Patients HD Oran

(n=103)

Patients HD Marseille

(n=133)

P

Âge (année) 56 (18 ; 89) 60 (18 ; 89) 0.208

Sex-ratio (F/H) 45/58 52/81 0.506

Indice de masse corporelle (kg/m2) 23.0 (14.0 ; 40.0) 24.6 (16.4 ; 46,6) <0.01

Initiation de la dialyse (Mois) 48 (0.9 ; 276) 34 (0.3 ; 437) 0.41

Hypertension 74 (72 %) 124 (93 %) <0.0001

Diabète 31 (30 %) 51 (38 %) 0.2

Tabagisme 8 % 23 % <0.01

Origine de la néphropathie

Glomérulaire 7.8 % (8) 19.5 % (26) <0.05

Diabétique 21.4 % (22) 24.0 % (32) 0.6

Interstitielle 7.8 % (8) 18.0 % (24) <0.05

Indéterminé 26.2 % (27) 16.5 % (22) 0.07

Polykystose 15.5 % (16) 6.0 % (8) <0.05

Vasculaire 15.5 % (16) 12.0 % (16) 0.4

Héréditaire 1.9 % (2) 0.75 % (1) 1

Autre 3.88 % (4) 3.0 % (4) 0.6

Urée sérique (mmol/L) 22.9 ± 7.3 22.1 ± 6.7 0.41

Créatinine sérique (µmol/L) 852 (176 ; 1848) 753 (179 ; 1777) <0.05

Albumine sérique (g/L) 37.1 (18.8 ; 43.6) 38.7 (14.3 ; 52.1) <0.05

Cholestérol sérique (mmol/L) 3.96 (1.80 ; 6.72) 4.11 (1.33 ; 8.47) 0.54

HDL-cholestérol sérique (mmol/L) 0.74 (0.36 ; 1.62) 1.15 (0.57 ; 2.77) <0.0001

LDL-cholestérol sérique (mmol/L) 1.99 (1.04 ; 4.02) 1.95 (0.46 ; 5.04) 0.98

Triglycérides sérique (mmol/L) 1.61 (0.44 ; 5.14) 1.42 (0 ; 7.11) 0.12

Calcium sérique (mmol/L) 2.06 (1.04 ; 3.19) 2.32 (1.68 ; 3.09) <0.0001

Phosphate sérique (mmol/L) 1.63 (0.87 ; 2.85) 1.60 (0.38 ; 4.03) 0.79

Potassium sérique (mmol/L) 5.54 (4.31 ; 8.31) 4.92 (3.27 ; 7.26) <0.0001

Bicarbonates sériques (mmol/L) 16.47 ± 2.22 20.79 ± 2.35 <0.0001

Hémoglobine (g/dL) 9.6 (6.0 ; 15.7) 10.6 (7.0 ; 13.4) <0.0001

CRP sérique (mg/L) 1.5 (0.3 ; 46.7) 4.9 (0 ; 94.1) <0.0001

103

Étude comparative entre deux cohortes de patients HD (Oran vs Marseille) Résultats

5.4.2. Les taux d’IS sont significativement plus élevés chez les HD d’Oran

Nous avons comparé les taux de toxines urémiques dérivées du tryptophane, l’IAA et l’IS, et

celles dérivées de la tyrosine/phénylalanine, le PCs. Nous avons constaté que les taux d’IS

étaient significativement plus élevés chez les patients HD d’Oran avec une médiane de

123µM versus 86 µM (P<0.0001) chez les patients HD de Marseille (Tableau 2).

5.4.3. Le taux de mortalité et des événements cardiovasculaires ne sont pas

différents entre la cohorte de patients HD d’Oran et celle de Marseille

après un suivi d’un an

L’accumulation d’IS chez les patients MRC est associée à une augmentation des risques de

complications cardiovasculaires et de mortalité. Ainsi, des taux plus élevés d’IS chez les

patients HD d’Oran, pouvaient faire craindre une augmentation de la mortalité et des

événements cardiovasculaires. Les taux des événements cardiovasculaires et de mortalité

n’étaient pas plus fréquents chez les patients HD d’Oran par rapport aux patients HD de

Marseille sur un suivi d’un an (Tableau 3).

*TVP/EP ; Thrombose veineuse profonde / Embolie pulmonaire

Tableau 2.

Taux des toxines urémiques

Patients HD Oran

(n=103)


(n=133)

P

Indole-3 acétique acide (µM) 3.6 (0 ; 13.1) 3.3 (0.7 ; 33.5) 0.12

Indoxyl sulfate (µM) 123 (10 ; 308) 86 (0 ; 240) <0.0001

P-crésyl sulfate (µM) 155 (0 ; 613) 145 (0 ; 391) 0.82

Tableau 3.

Suivi à 1 an

Patients HD Oran

(n=103)


(n=133)

P

Taux de mortalité 12.6 % (13/103) 9.7 % (13/133) 0.5

Évènement cardiovasculaire 10.6 % (11/103) 11.2 % (15/133) 1

Evènement thrombotique TVP/EP* 1.9 % (2/103) 2.2 % (3/133) 1

104

Étude comparative entre deux cohortes de patients HD (Oran vs Marseille) Discussion

Discussion

Nous avons montré que les taux d’IS, mais pas d’IAA et du PCs, étaient plus élevés chez

les patients HD d’Oran en comparaison avec les patients HD de Marseille. Après un an de

suivi, il n’y a pas de différences significatives des taux des événements cardiovasculaires et

de mortalité entre les deux populations.

L’indoxyl sulfate est issue de la métabolisation du tryptophane alimentaire. Ainsi, un

apport alimentaire plus important et notamment plus riche en protéines pourrait expliquer

les différences des taux d’IS observées chez les HD d’Oran. Il a été montré qu’une

consommation plus importante en protéine augmente les taux plasmatiques d’IS chez les

patients MRC (Marzocco et al. 2013). Inversement, l’apport en fibre diminue les taux

circulants d’IS et de pCS chez les patients hémodialysés (Sirich et al. 2014). Dans une autre

étude, il a été montré que les végétariens ont une production d’IS diminué, en consommant

25% moins de protéine et 69% de fibre de plus par rapport aux personnes ayant une

alimentation non limitée en substance carnée (Patel et al. 2012). Ainsi, les différences des

taux sériques d’IS pourraient être expliquées par des habitudes alimentaires différentes

notamment en termes d’apport protéique entre les deux populations. Ceci est conforté par

des taux significativement plus importants de créatinine dans la population oranaise. La

créatinine est un produit de dégradation du phosphate de créatine dans le muscle. Ce

dernier est synthétisé de manière endogène dans l’organisme et également apporté par

l’alimentation (Patel et al. 2013). Il a été montré qu’un apport alimentaire plus important et

notamment plus riche en protéine augmente les taux sériques de créatinine (Delanghe et al.

1989; Kalantar-Zadeh et al. 2004; Shinaberger et al. 2006; Preiss et al. 2007; Dragsted 2010).

Ainsi, les taux plus élevés de créatinine observés chez les HD d’Oran suggèrent un apport

alimentaire plus conséquent et plus riche en protéine chez ces patients. De même, les taux

https://fr.wikipedia.org/wiki/Phosphocr%C3%A9atine

https://fr.wikipedia.org/wiki/Muscle

105


de bicarbonate plus bas dans la cohorte oranaise peuvent refléter un apport protéique plus

important. En effet, Il est montré qu’un régime alimentaire riche en protéines diminue le

taux de bicarbonate sanguin chez les sujets atteints de MRC (Trilok and Draper 1989; Mitch

2002; Gennari et al. 2006; Di Iorio et al. 2017).

La consommation accrue de protéines alimentaire est également liée à la production

d'urée (Young et al. 2000). Dans notre étude, nous n’avons pas trouvé de différence des taux

d’urée entre les deux populations. De plus, l’albumine qui est un marqueur de l’état

nutritionnel (Gama-Axelsson et al. 2012; Ikizler 2014), semble plus élevée chez la population

HD de Marseille, reflétant ainsi un meilleur état nutritionnel dans cette population. L'apport

en protéines alimentaire est un des facteurs importants dans la détermination de l'albumine

sérique (Kaysen et al. 1989; Thalacker-Mercer and Campbell 2008; Sarwar and Sherman

2016). La différence observée entre les albuminémies bien que statistiquement significatives

n’est pas cliniquement pertinente. L’albuminémie étant dans les deux cohortes normales.

En raison de leurs géolocalisations, les deux populations analysées dans cette étude

devraient partager un régime méditerranéen, caractérisé par une consommation modérée

de protéines animale et une consommation élevée de fruit, de légume, de pain, de haricot,

de noix, de graines et d’autres céréales (Noah and Truswell 2001; Garcia-Closas et al. 2006;

Simopoulos and Visioli 2007). Cependant, le régime méditerranéen varie avec un ratio

d’apports alimentaires différent d’un pays à l’autre, en fonction de la situation socio-

économique, culturelle et traditionnelle entre les différents pays de la méditerranée (Noah

and Truswell 2001; Garcia-Closas et al. 2006; Simopoulos and Visioli 2007; Vernaglione

2009). De plus, dans plusieurs pays méditerranéens, dont l’Algérie et la France, les habitudes

alimentaires ont évolué, s'éloignant du régime méditerranéen pour aller vers une nourriture

plus riche en graisses animales et en sucre.

106


Dans cette étude, nous pensons que les différences des taux d’IS observé entre les

patients HD oranais et marseillais pourraient être dues à un régime alimentaire différent,

notamment en apport protéique. Afin de valider notre hypothèse, il est nécessaire de

réaliser une enquête alimentaire dans les deux cohortes de patients HD.

La flore digestive joue un rôle crucial dans le processus de la métabolisation du

tryptophane et l’absorption des indoles (Mishima et al. 2017; Agus et al. 2018). Il est montré

qu’une altération de la flore intestinale peut influencer les taux sériques des indoles (Holler

et al. 2014; Nazzal et al. 2017). Plusieurs facteurs peuvent contribuer à la diversité de la flore

intestinale (microbiote) le sexe, l’âge, le mode de vie, l’hygiène, l’environnement et surtout

l’alimentation (Lepage et al. 2008 ; Annalisa et al. 2014 ; Xie et al. 2016 ; Smits et al. 2017 ;

McDonald et al. 2018 ; Zhao et al. 2018). Les habitudes alimentaires influent sur la formation

de la composition du microbiote intestinal, et déterminent également le répertoire des

métabolites microbiens produits (Geypens et al. 1997; Filippis et al. 2015; Riaz Rajoka et al.

2017). De plus, l’apport en pré/probiotiques peut modifier la flore digestive et par

conséquent les concentrations d’IS (Takayama et al. 2003). Ainsi, une diversité du microbiote

intestinal soutenu par un écosystème différent entre les deux populations pourrait

également expliquer la variabilité des taux sériques d’IS.

Les toxines indoliques s’accumulent chez les patients atteints de MRC et sont mal

épurées par la dialyse (Neirynck et al. 2013a), car 80% des indoles sont liés aux protéines (De

Smet et al. 2007). Seule la fraction non liée des toxines indoliques peut être éliminée par HD

ou par filtration. La clairance des toxines indoliques liées aux protéines est difficile par HD en

raison de leurs fortes capacités de liaison à l'albumine (Watanabe et al. 2011; Davenport

2014). À l’heure actuelle, aucune technique de dialyse n’a pu montrer une amélioration en

termes d’épuration des toxines indoliques (Krieter et al. 2010; Neirynck et al. 2013a;

107


Yamamoto et al. 2018). Les méthodes de dialyse utilisées dans les deux centres sont des

méthodes conventionnelles avec des membranes de dialyse classiques. Nous pouvons

exclure l’implication de différence de méthode de dialyse entre les centres de recrutements

pour expliquer la différence des taux d’IS observée entre les deux populations d’HD.

La protéine C réactive (CRP), impliquée dans les réactions inflammatoires et qui sert de

marqueurs biologiques à celle-ci (Ballantyne and Nambi 2005), est significativement plus

élevée chez les patients HD de Marseille. Ceci suggère un état inflammatoire plus important

dans la cohorte marseillaise. Cette variabilité entre les deux cohortes pourrait également

être due à la différence ethnique. En effet, dans une étude il a été montré que le taux de CRP

pouvait varier selon l’origine ethnique (Kelley-Hedgepeth et al. 2008). L’effet anti-

inflammatoire d’un régime alimentaire plus riche en légumes et végétaux pourrait

également être impliqué dans la variation des taux sériques de CRP (Krajcovicova-

Kudlackova and Blazicek 2005; Jaceldo-Siegl et al. 2018).

L’augmentation de l’IS chez les patients MRC est associée à un risque de complications

cardiovasculaires et une mortalité élevée (Gao and Liu 2017). Nous avons constaté des taux

plus élevés d’IS chez les patients HD d’Oran sans impact sur le risque cardiovasculaire ou de

décès. Un suivi plus long pourrait permettre d’observer une éventuelle différence entre les

deux populations. Les différences des taux d’IS observé entre la population HD d’Oran et

celle de Marseille, ne sont peut être pas suffisamment importantes pour observer des

différences. Enfin, il est possible que le taux d’IS reflétant un apport protéique plus

important ce dernier qui est recommandé en HD par tous les guidelines permettent de

dégager un bénéfice pour les patients d’Oran sans impact délétère sur un suivi court.

En conclusion, les taux d’IS, mais pas d’IAA, sont significativement plus importants dans la

population HD d’Oran. Les différences culturelles, sociales, environnementales et

108


nutritionnelles pourraient jouer un rôle clé pour expliquer cette différence. La détermination

des taux sériques de toxines urémiques indoliques dans une population algérienne

représente le premier travail de ce type réalisé dans un pays du Sud.

109

Conclusion et perspectives

6. Conclusion et perspectives

L’accumulation des toxines urémiques indoliques IAA et IS jouent un rôle important dans

les survenues des accidents thrombotiques chez les patients avec une maladie rénale

chronique. Ces toxines augmentent l’expression du facteur tissulaire, et par ce biais joue

probablement un rôle majeur dans l’augmentation du risque thrombotique. Les patients

atteints d'insuffisance rénale chronique présentent des taux élevés de FT circulant. Nous

avons constaté que la concentration plasmatique en IAA était indépendamment liée aux

taux circulants de FT chez les hémodialysées de Marseille. AHR est l’élément clé de la

mécanique cellulaire contrôlant l'expression du FT induite par l'IAA et l'IS. Dans cette thèse,

nous avons montré que l’expression du facteur tissulaire induite par IAA et IS, dans les

cellules endothéliales, est médié par la voie non-génomique d’AhR. L’IAA induit l’expression

du facteur tissulaire via la voie inflammatoire AhR/p38 MAPK/NF-B. L’IS induit l’expression

du facteur tissulaire en impliquant des voies de signalisation et des facteurs de transcription

qui semblent similaires à ceux activés par l’IAA. Chez les patients atteints de MRC, nous

avons montré un niveau élevé d'agonistes plasmatiques d’AhR et une activation de la voie

AhR dans les cellules de ces patients (Dou et al. 2018). L’AhR est une cible thérapeutique

pour réduire les taux de FT et ainsi limiter le risque thrombotique chez les patients atteints

de maladie rénale chronique (Shivanna et al. 2016; Mackman and Erlich 2018). Inhiber AhR

entraînerait une inhibition de la voie génomique d’AhR qui est cruciale dans les processus de

détoxification, et une dérégulation de la physiologie cellulaire. Par conséquent, cibler

spécifiquement la voie non génomique prothrombotique/inflammatoire d'AhR, tout en

préservant la voie génomique de l'AhR est une stratégie séduisante. Notre travail permet

d’identifier de nouvelles pistes dans le contrôle de l’activation de la voie non génomique

d’AHR comme le contrôle de l’activation de NF-B ou d’AP1.

110


Approches alternatives

À côté du développement de molécules ciblant les voies de signalisation contrôlées par AhR,

d’autres possibilités existent que nos travaux permettent d’entrevoir ;

➢ Un régime alimentaire adapté aux patients MRC

La diététique fait partie intégrante de la prise en charge des patients souffrant de maladie

rénale chronique. Des modifications de la quantité et de la qualité alimentaire peuvent être

nécessaires afin de réduire l’accumulation des toxiques responsables du processus

pathologique. Effectivement, plusieurs études ont montré qu’un régime alimentaire riche en

protéines augmente les taux plasmatiques d’IS et d’IAA (Marzocco et al. 2013; Poesen et al.

2015). De plus, l’apport en fibres a été montré comme pouvant diminuer les taux circulants

de certains indoles chez les patients hémodialysés (Sirich et al. 2014). Nous avons constaté

que les taux d’IS été significativement plus élevés chez la population HD d’Oran par rapport à

la population HD de Marseille. Nous pensons qu’un régime alimentaire différent et

notamment plus riche en protéines chez les patients HD d’Oran pourrait expliquer les taux

plus élevés d’IS chez cette population. Ainsi, un régime alimentaire limité en protéines en

particulier animal et riche en fibres pourrait être une des alternatives pour diminuer les taux

d’indoles chez les MRC. Le régime méditerranéen doit être conseillé aux patients

(Montemurno et al. 2014, chauveaundt 2018). Le régime méditerranéen diminue les

facteurs de risque cardiovasculaire comme ; la dyslipidémie, l’inflammation et le stress

oxydant (Mekki et al. 2010; Huang et al. 2013; Chauveau et al. 2018).

➢ Contrôles de l’accumulation des indoles à travers le microbiote intestinal

L'utilisation des pré biotiques, glucides non digestibles (fibres) qui stimulent les bactéries

intestinales et des pro biotiques, compléments de bactéries bénéfiques vivantes, est de plus

en plus populaire (Neu 2014). En néphrologie, l'augmentation de la production intestinale

111


des indoles est associée à la perturbation du microbiote chez les patients MRC (Vaziri et al.

2013), suggèrent qu’un traitement en pré et pro biotique dans le but de rétablir

l’homéostasie de la flore pourrait être bénéfique chez les patients. Il a été montré que

l’intervention par des probiotiques « lactobacilles ou bifidobactéries» chez des patients HD,

diminué de 30% l’IS sérique, associée avec une diminution des entérobactéries fécales (E.

coli), qui possède l’une des activités enzymatiques les plus élevées observées pour la

production de toxine indolique (Hida et al. 1996; Takayama et al. 2003). De plus, une

intervention prébiotique chez des individus en bonne santé a montré une réduction

significative du PC (65%) et de l’indole (25%) ainsi qu’une augmentation des bifidobactéries

et des lactobacilles, responsables de la suppression de PCS et de l’IS, et une diminution des

Bacteroidaceae (Ito et al. 1993) productrices de PCS. Dans une autre étude, il est montré que

le pré-biotique, galacto-oligosaccharides, abaisse les niveaux sériques d’IS dans un modèle

animal d’IRC (Furuse et al. 2014). Sirich et al ont également montré que les prébiotiques

diminuer les taux d’IS chez des patients HD (Sirich et al. 2014). Il a été suggéré que la

thérapie symbiotique (co-administration de pré- et pro biotiques) pouvait être prometteuse

afin de réduire les concentrations sériques de certaines toxines indoliques (Rossi et al. 2014).

Il reste à confirmer par des études randomisées en doubles aveugles que ces approches sont

utiles en clinique humaine.

La manipulation des gènes bactériens est une approche possible pour réduire la capacité

des bactéries à synthétiser des précurseurs de toxines urémiques. Dans le cas des toxines

indoliques. Les tryptophanases bactériennes sont responsables de la conversion du

tryptophane en indole, aboutissant à la production d’IAA dans l’intestin, et à l’IS après

absorption et métabolisation de l’indole dans le foie. Devlin S et al ont identifié la famille des

Bacteroides comme les bactéries possèdent les tryptophanases les plus abondantes dans le

112


microbiote humaine (Devlin et al. 2016). Une mutation du gène de la tryptophanase réduit la

synthèse de l’indole in vitro. Dans les modèles animaux, en modifiant l'expression génique

de la tryptophanase des bactéries colonisées dans des souris, ou en réduisant l'abondance

des Bacteroides par des antibiotiques, ils ont pu réduire la production d’IS (Devlin et al.

2016). Ainsi, la manipulation des gènes bactériens pourrait être une clé pour contrôler

l’accumulation des toxines indoliques chez les patients MRC.

➢ Réduction de l’accumulation des toxines indoliques par la thérapie orale

AST 120 : L’AST-120 est un adsorbant intestinal oral microsphérique de carbone à haute

porosité (Schulman et al. 2014). L'administration orale de l’AST 120 peut inhiber l'absorption

gastro-intestinale des précurseurs des toxines urémiques liées aux protéines, dont les

indoles, en adsorbant et en améliorant leur excrétion dans les fèces (Yamaguchi et al. 2017),

diminuant ainsi les taux sériques d’IS (Niwa et al. 1991; Niwa et al. 1997; Schulman et al.

2006; Yamamoto et al. 2015) chez les patients MRC HD ou non, mais pas d’IAA chez les

patients HD (Yamamoto et al. 2015). L’AST-120 est utilisé dans des pays comme le Japon

(depuis 1991), la Corée (depuis 2005) et les Philippines (depuis 2010), principalement pour

réduire les symptômes urémiques et pour la prévention de la progression des maladies

rénales chroniques (Schulman et al. 2014). Cependant, étant un adsorbant oral, il a le

potentiel de se lier à d’autres nutriments bénéfiques avec les toxines urémiques. Il est

associé à la survenue de troubles gastro-intestinaux (Yamaguchi et al. 2017).

Les polyphénols phytochimiques : telle que la quercétine et le resvératrol, réduisent

également la synthèse d’IS chez le rat, par l'inhibition de la sulfotransférase (SULT), une

enzyme impliquée dans la synthèse de l'IS dans le foie (Kusumoto et al. 2011). Cependant,

plus d’investigations sont nécessaires pour évaluer les effets secondaires et valider cette

approche chez les patients MRC.

113


La compréhension des voies de signalisation mise en action par les solutés indoliques doit

nous permettre de proposer de nouvelles pistes thérapeutiques. La modulation de

l’activation d’AHR parait être une piste engageante. Nos travaux apportent une nouvelle

compréhension aux mécanismes en œuvre. La distinction entre une voie génomique plutôt

bénéfique par ses capacités de détoxification des xénobiotiques et d’une voie pro

inflammatoire non génomique trace un modèle qui permet de proposer de nouvelles

stratégies d’intervention.

114

Références bibliographiques


Abramowitz MK (2017) Bicarbonate Balance and Prescription in ESRD. J Am Soc Nephrol 28:726–734.

doi: 10.1681/ASN.2016070780

Adelibieke Y, Yisireyili M, Ng H-Y, et al (2014) Indoxyl Sulfate Induces IL-6 Expression in Vascular

Endothelial and Smooth Muscle Cells through OAT3-Mediated Uptake and Activation of AhR/NF-κB

Pathway. NEE 128:1–8. doi: 10.1159/000365217

Agus A, Planchais J, Sokol H (2018) Gut Microbiota Regulation of Tryptophan Metabolism in Health

and Disease. Cell Host Microbe 23:716–724. doi: 10.1016/j.chom.2018.05.003

Ahern SM, Miyata T, Sadler JE (1993) Regulation of human tissue factor expression by mRNA

turnover. J Biol Chem 268:2154–2159

Annalisa N, Alessio T, Claudette TD, et al (2014) Gut Microbioma Population: An Indicator Really

Sensible to Any Change in Age, Diet, Metabolic Syndrome, and Life-Style. Mediators Inflamm 2014:.

doi: 10.1155/2014/901308

Ansari MA, Maayah ZH, Bakheet SA, et al (2013) The role of aryl hydrocarbon receptor signaling

pathway in cardiotoxicity of acute lead intoxication in vivo and in vitro rat model. Toxicology 306:40–

49. doi: 10.1016/j.tox.2013.01.024

Aparicio M, Chauveau P, Combe C (2001) Low protein diets and outcome of renal patients. J Nephrol

doi 14:433–439

Armstead VE, Opentanova IL, Minchenko AG, Lefer AM (1999) Tissue factor expression in vital organs

during murine traumatic shock: role of transcription factors AP-1 and NF-kappaB. Anesthesiology

91:1844–1852. doi: 10.1097/00000542-199912000-00039

Aronov PA, Luo FJ-G, Plummer NS, et al (2011) Colonic contribution to uremic solutes. J Am Soc

Nephrol 22:1769–1776. doi: 10.1681/ASN.2010121220

Ballantyne CM, Nambi V (2005) Markers of inflammation and their clinical significance. Atheroscler

Suppl 6:21–29. doi: 10.1016/j.atherosclerosissup.2005.02.005

Barreto FC, Barreto DV, Liabeuf S, et al (2009) Serum Indoxyl Sulfate Is Associated with Vascular

Disease and Mortality in Chronic Kidney Disease Patients. CJASN 4:1551–1558. doi:

10.2215/CJN.03980609

Bode M, Mackman N (2014) Regulation of tissue factor gene expression in monocytes and

endothelial cells: Thromboxane A2 as a new player. Vascul Pharmacol 62:57–62. doi:

10.1016/j.vph.2014.05.005

Borlak J, Jenke HS (2008) Cross-talk between aryl hydrocarbon receptor and mitogen-activated

protein kinase signaling pathway in liver cancer through c-raf transcriptional regulation. Mol Cancer

Res 6:1326–1336. doi: 10.1158/1541-7786.MCR-08-0042

115


Bover J, Cozzolino M (2011) Mineral and bone disorders in chronic kidney disease and end-stage

renal disease patients: new insights into vitamin D receptor activation. Kidney International

Supplements 1:122–129. doi: 10.1038/kisup.2011.28

Brand K, Fowler BJ, Edgington TS, Mackman N (1991) Tissue factor mRNA in THP-1 monocytic cells is

regulated at both transcriptional and posttranscriptional levels in response to lipopolysaccharide.

Mol Cell Biol 11:4732–4738

Bueno AL, Czepielewski MA (2008) The importance for growth of dietary intake of calcium and

vitamin D. J Pediatr (Rio J) 84:386–394. doi: doi:10.2223/JPED.1816

Calaf R, Cerini C, Génovésio C, et al (2011) Determination of uremic solutes in biological fluids of

chronic kidney disease patients by HPLC assay. J Chromatogr B Analyt Technol Biomed Life Sci

879:2281–2286. doi: 10.1016/j.jchromb.2011.06.014

Carney EF (2016) Thrombosis: New mechanism of thrombus formation in CKD. In: Nature Reviews

Nephrology. https://www-nature-com.gate2.inist.fr/articles/nrneph.2016.155. Accessed 28 Nov

2017

Casserly LF, Dember LM (2003) Thrombosis in end-stage renal disease. Semin Dial doi: 16:245–256

Chauveau P, Aparicio M, Bellizzi V, et al (2018) Mediterranean diet as the diet of choice for patients

with chronic kidney disease. Nephrol Dial Transplant 33:725–735. doi: 10.1093/ndt/gfx085

Chevallier A, Bui L-C, Coumoul X (2011) Le récepteur de la dioxine : rôle endogène et médiateur de la

toxicité de la dioxine. Cahiers de Nutrition et de Diététique 46:67–74. doi: 10.1016/j.cnd.2011.01.002

Chitalia VC, Shivanna S, Martorell J, et al (2013) Uremic serum and solutes increase post-vascular

interventional thrombotic risk through altered stability of smooth muscle cell tissue factor.

Circulation 127:365–376. doi: 10.1161/CIRCULATIONAHA.112.118174

Cibulka R, Racek J (2007) Metabolic disorders in patients with chronic kidney failure. Physiol Res doi:

56:697–705

Crossman DC, Carr DP, Tuddenham EG, et al (1990) The regulation of tissue factor mRNA in human

endothelial cells in response to endotoxin or phorbol ester. J Biol Chem 265:9782–9787

Cui MZ, Parry GC, Oeth P, et al (1996) Transcriptional regulation of the tissue factor gene in human

epithelial cells is mediated by Sp1 and EGR-1. J Biol Chem 271:2731–2739

Daneschvar HL, Seddighzadeh A, Piazza G, Goldhaber SZ (2008) Deep vein thrombosis in patients with

chronic kidney disease. Thromb Haemost 99:1035–1039. doi: 10.1160/TH08-02-0107

Davenport A (2014) How can dialyzer designs improve solute clearances for hemodialysis patients?

Hemodial Int 18 Suppl 1:S43-47. doi: 10.1111/hdi.12223

De Smet R, Dhondt A, Eloot S, et al (2007) Effect of the super-flux cellulose triacetate dialyser

membrane on the removal of non-protein-bound and protein-bound uraemic solutes. Nephrol Dial

Transplant 22:2006–2012. doi: 10.1093/ndt/gfm065

116


Delanghe J, De Slypere JP, De Buyzere M, et al (1989) Normal reference values for creatine,

creatinine, and carnitine are lower in vegetarians. Clin Chem 35:1802–1803

Denison MS, Soshilov AA, He G, et al (2011) Exactly the same but different: promiscuity and diversity

in the molecular mechanisms of action of the aryl hydrocarbon (dioxin) receptor. Toxicol Sci 124:1–

22. doi: 10.1093/toxsci/kfr218

Devlin AS, Marcobal A, Dodd D, et al (2016) Modulation of a Circulating Uremic Solute via Rational

Genetic Manipulation of the Gut Microbiota. Cell Host Microbe 20:709–715. doi:

10.1016/j.chom.2016.10.021

Di Angelantonio E, Danesh J, Eiriksdottir G, Gudnason V (2007) Renal function and risk of coronary

heart disease in general populations: new prospective study and systematic review. PLoS Med

4:e270. doi: 10.1371/journal.pmed.0040270

Di Iorio BR, Di Micco L, Marzocco S, et al (2017) Very Low-Protein Diet (VLPD) Reduces Metabolic

Acidosis in Subjects with Chronic Kidney Disease: The “Nutritional Light Signal” of the Renal Acid

Load. Nutrients 9:. doi: 10.3390/nu9010069

Di Meglio P, Duarte JH, Ahlfors H, et al (2014) Activation of the aryl hydrocarbon receptor dampens

the severity of inflammatory skin conditions. Immunity 40:989–1001. doi:

10.1016/j.immuni.2014.04.019

Dolecek TA, Olson MB, Caggiula AW, et al (1995) Registered dietitian time requirements in the

Modification of Diet in Renal Disease Study. J Am Diet Assoc 95:1307–1312

Dolwick KM, Swanson HI, Bradfield CA (1993) In vitro analysis of Ah receptor domains involved in

ligand-activated DNA recognition. Proc Natl Acad Sci USA 90:8566–8570

Dou L, Jourde-Chiche N, Faure V, et al (2007) The uremic solute indoxyl sulfate induces oxidative

stress in endothelial cells. J Thromb Haemost 5:1302–1308. doi: 10.1111/j.1538-7836.2007.02540.x

Dou L, Poitevin S, Sallée M, et al (2018) Aryl hydrocarbon receptor is activated in patients and mice

with chronic kidney disease. Kidney Int. doi: 10.1016/j.kint.2017.11.010

Dou L, Sallée M, Cerini C, et al (2015) The cardiovascular effect of the uremic solute indole-3 acetic

acid. J Am Soc Nephrol 26:876–887. doi: 10.1681/ASN.2013121283

Dragsted LO (2010) Biomarkers of meat intake and the application of nutrigenomics. Meat Sci

84:301–307. doi: 10.1016/j.meatsci.2009.08.028

Drake TA, Morrissey JH, Edgington TS (1989) Selective cellular expression of tissue factor in human

tissues. Implications for disorders of hemostasis and thrombosis. Am J Pathol 134:1087–1097

Fernandez-Prado R, Esteras R, Perez-Gomez MV, et al (2017) Nutrients Turned into Toxins:

Microbiota Modulation of Nutrient Properties in Chronic Kidney Disease. Nutrients 9:. doi:

10.3390/nu9050489

117


Filippis FD, Pellegrini N, Vannini L, et al (2015) High-level adherence to a Mediterranean diet

beneficially impacts the gut microbiota and associated metabolome. Gut gutjnl-2015-309957. doi:

10.1136/gutjnl-2015-309957

Foley RN, Parfrey PS, Sarnak MJ (1998) Epidemiology of cardiovascular disease in chronic renal

disease. J Am Soc Nephrol 9:S16-23

Fouque D, Laville M (2009) Low protein diets for chronic kidney disease in non diabetic adults.

Cochrane Database Syst Rev CD001892. doi: 10.1002/14651858.CD001892.pub3

Fujii-Kuriyama Y, Mimura J (2005) Molecular mechanisms of AhR functions in the regulation of

cytochrome P450 genes. Biochem Biophys Res Commun 338:311–317. doi:

10.1016/j.bbrc.2005.08.162

Furuse SU, Ohse T, Jo-Watanabe A, et al (2014) Galacto-oligosaccharides attenuate renal injury with

microbiota modification. Physiol Rep 2:. doi: 10.14814/phy2.12029

Gama-Axelsson T, Heimbürger O, Stenvinkel P, et al (2012) Serum albumin as predictor of nutritional

status in patients with ESRD. Clin J Am Soc Nephrol 7:1446–1453. doi: 10.2215/CJN.10251011

Gao H, Liu S (2017) Role of uremic toxin indoxyl sulfate in the progression of cardiovascular disease.

Life Sci 185:23–29. doi: 10.1016/j.lfs.2017.07.027

Garcia-Closas R, Berenguer A, González CA (2006) Changes in food supply in Mediterranean countries

from 1961 to 2001. Public Health Nutr 9:53–60

GBD 2015 Disease and Injury Incidence and Prevalence Collaborators (2016) Global, regional, and

national incidence, prevalence, and years lived with disability for 310 diseases and injuries, 1990-

2015: a systematic analysis for the Global Burden of Disease Study 2015. Lancet 388:1545–1602. doi:

10.1016/S0140-6736(16)31678-6

Gennari FJ, Hood VL, Greene T, et al (2006) Effect of dietary protein intake on serum total CO2

concentration in chronic kidney disease: Modification of Diet in Renal Disease study findings. Clin J

Am Soc Nephrol 1:52–57. doi: 10.2215/CJN.00060505

Geypens B, Claus D, Evenepoel P, et al (1997) Influence of dietary protein supplements on the

formation of bacterial metabolites in the colon. Gut 41:70–76

Gondouin B, Cerini C, Dou L, et al (2013) Indolic uremic solutes increase tissue factor production in

endothelial cells by the aryl hydrocarbon receptor pathway. Kidney Int 84:733–744. doi:

10.1038/ki.2013.133

Hakim RM, Lazarus JM (1988) Biochemical parameters in chronic renal failure. Am J Kidney Dis

11:238–247

Heid SE, Pollenz RS, Swanson HI (2000) Role of heat shock protein 90 dissociation in mediating

agonist-induced activation of the aryl hydrocarbon receptor. Mol Pharmacol 57:82–92

Henklová P, Vrzal R, Ulrichová J, Dvorák Z (2008) Role of mitogen-activated protein kinases in aryl

hydrocarbon receptor signaling. Chem Biol Interact 172:93–104. doi: 10.1016/j.cbi.2007.12.005

118


Hida M, Aiba Y, Sawamura S, et al (1996) Inhibition of the accumulation of uremic toxins in the blood

and their precursors in the feces after oral administration of Lebenin, a lactic acid bacteria

preparation, to uremic patients undergoing hemodialysis. Nephron 74:349–355. doi:

10.1159/000189334

Holler E, Butzhammer P, Schmid K, et al (2014) Metagenomic analysis of the stool microbiome in

patients receiving allogeneic stem cell transplantation: loss of diversity is associated with use of

systemic antibiotics and more pronounced in gastrointestinal graft-versus-host disease. Biol Blood

Marrow Transplant 20:640–645. doi: 10.1016/j.bbmt.2014.01.030

Huang G, Elferink CJ (2012) A novel nonconsensus xenobiotic response element capable of mediating

aryl hydrocarbon receptor-dependent gene expression. Mol Pharmacol 81:338–347. doi:

10.1124/mol.111.075952

Huang X, Jiménez-Moleón JJ, Lindholm B, et al (2013) Mediterranean diet, kidney function, and

mortality in men with CKD. Clin J Am Soc Nephrol 8:1548–1555. doi: 10.2215/CJN.01780213

Hubbard TD, Murray IA, Bisson WH, et al (2016) Divergent Ah Receptor Ligand Selectivity during

Hominin Evolution. Mol Biol Evol 33:2648–2658. doi: 10.1093/molbev/msw143

Ikizler HO, Zelnick L, Ruzinski J, et al (2016) Dietary acid load is associated with serum bicarbonate

but not insulin sensitivity in chronic kidney disease. J Ren Nutr 26:93–102. doi:

10.1053/j.jrn.2015.08.008

Ikizler TA (2014) Using and interpreting serum albumin and prealbumin as nutritional markers in

patients on chronic dialysis. Semin Dial 27:590–592. doi: 10.1111/sdi.12288

ISTH Steering Committee for World Thrombosis Day (2014) Thrombosis: a major contributor to global

disease burden. Thromb Res 134:931–938. doi: 10.1016/j.thromres.2014.08.014

Ito M, Kimura M, Deguchi Y, et al (1993) Effects of transgalactosylated disaccharides on the human

intestinal microflora and their metabolism. J Nutr Sci Vitaminol 39:279–288

Ito S, Osaka M, Edamatsu T, et al (2016) Crucial Role of the Aryl Hydrocarbon Receptor (AhR) in

Indoxyl Sulfate-Induced Vascular Inflammation. J Atheroscler Thromb 23:960–975. doi:

10.5551/jat.34462

Jaceldo-Siegl K, Haddad E, Knutsen S, et al (2018) Lower C-reactive protein and IL-6 associated with

vegetarian diets are mediated by BMI. Nutr Metab Cardiovasc Dis. doi:

10.1016/j.numecd.2018.03.003

Jackson DP, Joshi AD, Elferink CJ (2015) Ah Receptor Pathway Intricacies; Signaling Through Diverse

Protein Partners and DNA-Motifs. Toxicol Res (Camb) 4:1143–1158

Jackson DP, Li H, Mitchell KA, et al (2014) Ah receptor-mediated suppression of liver regeneration

through NC-XRE-driven p21Cip1 expression. Mol Pharmacol 85:533–541. doi:

10.1124/mol.113.089730

119


Jaffe EA, Nachman RL, Becker CG, Minick CR (1973) Culture of human endothelial cells derived from

umbilical veins. Identification by morphologic and immunologic criteria. J Clin Invest 52:2745–2756.

doi: 10.1172/JCI107470

Jourde-Chiche N, Dou L, Cerini C, et al (2009) Protein-bound toxins--update 2009. Semin Dial 22:334–

339. doi: 10.1111/j.1525-139X.2009.00576.x

Jourde-Chiche N, Dou L, Cerini C, et al (2011) Vascular incompetence in dialysis patients--protein-

bound uremic toxins and endothelial dysfunction. Semin Dial 24:327–337. doi: 10.1111/j.1525-

139X.2011.00925.x

Kalantar-Zadeh K, Block G, McAllister CJ, et al (2004) Appetite and inflammation, nutrition, anemia,

and clinical outcome in hemodialysis patients. Am J Clin Nutr 80:299–307. doi: 10.1093/ajcn/80.2.299

Kamiński TW, Pawlak K, Karbowska M, et al (2017) Indoxyl sulfate - the uremic toxin linking

hemostatic system disturbances with the prevalence of cardiovascular disease in patients with

chronic kidney disease. BMC Nephrol 18:35. doi: 10.1186/s12882-017-0457-1

Kaysen GA (1998) Biological basis of hypoalbuminemia in ESRD. J Am Soc Nephrol 9:2368–2376

Kaysen GA, Jones H, Hutchison FN (1989) High protein diets stimulate synthesis at the site of albumin

mRNA transcription. Current Topics in Neurochemistry, KIDNEY INT, Kidney international, Kidney

international 36:

Kaysen GA, Rathore V, Shearer GC, Depner TA (1995) Mechanisms of hypoalbuminemia in

hemodialysis patients. Kidney Int 48:510–516

Kelley-Hedgepeth A, Lloyd-Jones DM, Colvin A, et al (2008) Ethnic differences in C-reactive protein

concentrations. Clin Chem 54:1027–1037. doi: 10.1373/clinchem.2007.098996

Kim MJ, Pelloux V, Guyot E, et al (2012) Inflammatory pathway genes belong to major targets of

persistent organic pollutants in adipose cells. Environ Health Perspect 120:508–514. doi:

10.1289/ehp.1104282

Kim S-H, Henry EC, Kim D-K, et al (2006) Novel compound 2-methyl-2H-pyrazole-3-carboxylic acid (2-

methyl-4-o-tolylazo-phenyl)-amide (CH-223191) prevents 2,3,7,8-TCDD-induced toxicity by

antagonizing the aryl hydrocarbon receptor. Mol Pharmacol 69:1871–1878. doi:

10.1124/mol.105.021832

Koga J, Syono K, Ichikawa T, Adachi T (1994) Involvement of L-tryptophan aminotransferase in indole-

3-acetic acid biosynthesis in Enterobacter cloacae. Biochim Biophys Acta 1209:241–247

Kolachalama VB, Shashar M, Alousi F, et al (2018) Uremic Solute-Aryl Hydrocarbon Receptor-Tissue

Factor Axis Associates with Thrombosis after Vascular Injury in Humans. J Am Soc Nephrol. doi:

10.1681/ASN.2017080929

Korashy HM, El-Kadi AOS (2006) The Role of Aryl Hydrocarbon Receptor in the Pathogenesis of

Cardiovascular Diseases. Drug Metabolism Reviews 38:411–450. doi: 10.1080/03602530600632063

120


Krajcovicova-Kudlackova M, Blazicek P (2005) C-reactive protein and nutrition. Bratisl Lek Listy

106:345–347

Krieter DH, Hackl A, Rodriguez A, et al (2010) Protein-bound uraemic toxin removal in haemodialysis

and post-dilution haemodiafiltration. Nephrol Dial Transplant 25:212–218. doi: 10.1093/ndt/gfp437

Kusumoto M, Kamobayashi H, Sato D, et al (2011) Alleviation of cisplatin-induced acute kidney injury

using phytochemical polyphenols is accompanied by reduced accumulation of indoxyl sulfate in rats.

Clin Exp Nephrol 15:820–830. doi: 10.1007/s10157-011-0524-z

Lepage P, Colombet J, Marteau P, et al (2008) Dysbiosis in inflammatory bowel disease: a role for

bacteriophages? Gut 57:424–425. doi: 10.1136/gut.2007.134668

Levey AS, Atkins R, Coresh J, et al (2007) Chronic kidney disease as a global public health problem:

approaches and initiatives - a position statement from Kidney Disease Improving Global Outcomes.

Kidney Int 72:247–259. doi: 10.1038/sj.ki.5002343

Levey AS, Coresh J (2012) Chronic kidney disease. Lancet 379:165–180. doi: 10.1016/S0140-

6736(11)60178-5

Levey AS, Coresh J, Balk E, et al (2003) National Kidney Foundation practice guidelines for chronic

kidney disease: evaluation, classification, and stratification. Ann Intern Med 139:137–147

Li Y-D, Ye B-Q, Zheng S-X, et al (2009) NF-kappaB transcription factor p50 critically regulates tissue

factor in deep vein thrombosis. J Biol Chem 284:4473–4483. doi: 10.1074/jbc.M806010200

Lim PS, Sutton CR, Rao S (2015) Protein kinase C in the immune system: from signalling to chromatin

regulation. Immunology 146:508–522. doi: 10.1111/imm.12510

Lin C-J, Chuang C-K, Jayakumar T, et al (2013) Serum p-cresyl sulfate predicts cardiovascular disease

and mortality in elderly hemodialysis patients. Arch Med Sci 9:662–668. doi:

10.5114/aoms.2013.36901

Lin C-J, Liu H-L, Pan C-F, et al (2012) Indoxyl Sulfate Predicts Cardiovascular Disease and Renal

Function Deterioration in Advanced Chronic Kidney Disease. Archives of Medical Research 43:451–

456. doi: 10.1016/j.arcmed.2012.08.002

Lutz J, Menke J, Sollinger D, et al (2014) Haemostasis in chronic kidney disease. Nephrol Dial

Transplant 29:29–40. doi: 10.1093/ndt/gft209

Ma C, Marlowe JL, Puga A (2009) The aryl hydrocarbon receptor at the crossroads of multiple

signaling pathways. In: Molecular, Clinical and Environmental Toxicology. Birkhäuser Basel, pp 231–

257

Mackman N (1997) Regulation of the tissue factor gene. Thromb Haemost 78:747–754

Mackman N, Brand K, Edgington TS (1991) Lipopolysaccharide-mediated transcriptional activation of

the human tissue factor gene in THP-1 monocytic cells requires both activator protein 1 and nuclear

factor kappa B binding sites. J Exp Med 174:1517–1526

121


Mackman N, Erlich JH (2018) The uremic solute-AHR-tissue factor axis in vascular cells, mouse models

and thrombosis in chronic kidney disease patients. Ann Transl Med 6:. doi: 10.21037/atm.2018.04.27

Mandal PK (2005) Dioxin: a review of its environmental effects and its aryl hydrocarbon receptor

biology. J Comp Physiol B 175:221–230. doi: 10.1007/s00360-005-0483-3

Marzocco S, Piaz FD, Micco LD, et al (2013) Very Low Protein Diet Reduces Indoxyl Sulfate Levels in

Chronic Kidney Disease. BPU 35:196–201. doi: 10.1159/000346628

Masai N, Tatebe J, Yoshino G, Morita T (2010) Indoxyl sulfate stimulates monocyte chemoattractant

protein-1 expression in human umbilical vein endothelial cells by inducing oxidative stress through

activation of the NADPH oxidase-nuclear factor-κB pathway. Circ J 74:2216–2224

Matsumura F (2009) The significance of the nongenomic pathway in mediating inflammatory

signaling of the dioxin-activated Ah receptor to cause toxic effects. Biochem Pharmacol 77:608–626.

doi: 10.1016/j.bcp.2008.10.013

McDonald D, Hyde E, Debelius JW, et al (2018) American Gut: an Open Platform for Citizen Science

Microbiome Research. mSystems 3:e00031-18. doi: 10.1128/mSystems.00031-18

Mekki K, Bouzidi-bekada N, Kaddous A, Bouchenak M (2010) Mediterranean diet improves

dyslipidemia and biomarkers in chronic renal failure patients. Food Funct 1:110–115. doi:

10.1039/c0fo00032a

Mishima E, Fukuda S, Mukawa C, et al (2017) Evaluation of the impact of gut microbiota on uremic

solute accumulation by a CE-TOFMS–based metabolomics approach. Kidney International 92:634–

645. doi: 10.1016/j.kint.2017.02.011

Mitch WE (2002) Insights into the abnormalities of chronic renal disease attributed to malnutrition. J

Am Soc Nephrol 13 Suppl 1:S22-27

Montemurno E, Cosola C, Dalfino G, et al (2014) What would you like to eat, Mr CKD Microbiota? A

Mediterranean Diet, please! Kidney Blood Press Res 39:114–123. doi: 10.1159/000355785

Murray IA, Patterson AD, Perdew GH (2014) Aryl hydrocarbon receptor ligands in cancer: friend and

foe. Nat Rev Cancer 14:801–814. doi: 10.1038/nrc3846

Naylor HL, Jackson H, Walker GH, et al (2013) British Dietetic Association evidence-based guidelines

for the protein requirements of adults undergoing maintenance haemodialysis or peritoneal dialysis.

J Hum Nutr Diet 26:315–328. doi: 10.1111/jhn.12052

Nazzal L, Roberts J, Singh P, et al (2017) Microbiome perturbation by oral vancomycin reduces

plasma concentration of two gut-derived uremic solutes, indoxyl sulfate and p-cresyl sulfate, in end-

stage renal disease. Nephrol Dial Transplant 32:1809–1817. doi: 10.1093/ndt/gfx029

Neirynck N, Glorieux G, Schepers E, et al (2013a) Review of protein-bound toxins, possibility for blood

purification therapy. Blood Purif 35 Suppl 1:45–50. doi: 10.1159/000346223

Neirynck N, Glorieux G, Schepers E, et al (2013b) Review of Protein-Bound Toxins, Possibility for

Blood Purification Therapy. BPU 35:45–50. doi: 10.1159/000346223

122


Neu J (2014) The developing intestinal microbiome: probiotics and prebiotics. World Rev Nutr Diet

110:167–176. doi: 10.1159/000358465

Niwa T, Emoto Y, Maeda K, et al (1991) Oral sorbent suppresses accumulation of albumin-bound

indoxyl sulphate in serum of haemodialysis patients. Nephrol Dial Transplant 6:105–109

Niwa T, Nomura T, Sugiyama S, et al (1997) The protein metabolite hypothesis, a model for the

progression of renal failure: an oral adsorbent lowers indoxyl sulfate levels in undialyzed uremic

patients. Kidney Int Suppl 62:S23-28

Noah A, Truswell AS (2001) There are many Mediterranean diets. Asia Pac J Clin Nutr 10:2–9

Ocak G, Lijfering WM, Verduijn M, et al (2013) Risk of venous thrombosis in patients with chronic

kidney disease: identification of high-risk groups. J Thromb Haemost 11:627–633. doi:

10.1111/jth.12141

Oeth P, Parry GC, Mackman N (1997) Regulation of the tissue factor gene in human monocytic cells.

Role of AP-1, NF-kappa B/Rel, and Sp1 proteins in uninduced and lipopolysaccharide-induced

expression. Arterioscler Thromb Vasc Biol 17:365–374

O’Halloran SA, Grimes CA, Lacy KE, et al (2016) Dietary Intake and Sources of Potassium and the

Relationship to Dietary Sodium in a Sample of Australian Pre-School Children. Nutrients 8:. doi:

10.3390/nu8080496

Øvrevik J, Låg M, Lecureur V, et al (2014) AhR and Arnt differentially regulate NF-κB signaling and

chemokine responses in human bronchial epithelial cells. Cell Commun Signal 12:48. doi:

10.1186/s12964-014-0048-8

Parikh AM, Spencer FA, Lessard D, et al (2011) Venous thromboembolism in patients with reduced

estimated GFR: a population-based perspective. Am J Kidney Dis 58:746–755. doi:

10.1053/j.ajkd.2011.06.021

Parmar MS (2002) Chronic renal disease. BMJ 325:85–90

Patel KP, Luo FJ-G, Plummer NS, et al (2012) The Production of p-Cresol Sulfate and Indoxyl Sulfate in

Vegetarians Versus Omnivores. CJASN 7:982–988. doi: 10.2215/CJN.12491211

Patel SS, Molnar MZ, Tayek JA, et al (2013) Serum creatinine as a marker of muscle mass in chronic

kidney disease: results of a cross-sectional study and review of literature. Journal of Cachexia,

Sarcopenia and Muscle 4:19. doi: 10.1007/s13539-012-0079-1

Pavord S, Myers B (2011) Bleeding and thrombotic complications of kidney disease. Blood Reviews

25:271–278. doi: 10.1016/j.blre.2011.07.001

Pawlak K, Mysliwiec M, Pawlak D (2009) Hypercoagulability is independently associated with

kynurenine pathway activation in dialysed uraemic patients. Thromb Haemost 102:49–55. doi:

10.1160/TH08-10-0696

Perkovic V, Verdon C, Ninomiya T, et al (2008) The relationship between proteinuria and coronary

risk: a systematic review and meta-analysis. PLoS Med 5:e207. doi: 10.1371/journal.pmed.0050207

123


Petrulis JR, Perdew GH (2002) The role of chaperone proteins in the aryl hydrocarbon receptor core

complex. Chem Biol Interact 141:25–40

Poesen R, Mutsaers HAM, Windey K, et al (2015) The Influence of Dietary Protein Intake on

Mammalian Tryptophan and Phenolic Metabolites. PLoS ONE 10:. doi:

10.1371/journal.pone.0140820

Preiss DJ, Godber IM, Lamb EJ, et al (2007) The influence of a cooked-meat meal on estimated

glomerular filtration rate. Ann Clin Biochem 44:35–42. doi: 10.1258/000456307779595995

Puga A, Ma C, Marlowe JL (2009) The aryl hydrocarbon receptor cross-talks with multiple signal

transduction pathways. Biochemical Pharmacology 77:713–722. doi: 10.1016/j.bcp.2008.08.031

Ravani P, Palmer SC, Oliver MJ, et al (2013) Associations between hemodialysis access type and

clinical outcomes: a systematic review. J Am Soc Nephrol 24:465–473. doi: 10.1681/ASN.2012070643

Reddy KV, Bhattacharjee G, Schabbauer G, et al (2004) Dexamethasone enhances LPS induction of

tissue factor expression in human monocytic cells by increasing tissue factor mRNA stability. J Leukoc

Biol 76:145–151. doi: 10.1189/jlb.0204068

Reny J-L (2001) Facteur tissulaire et athérothrombose. Sang Thrombose Vaisseaux 13:609–11

Riaz Rajoka MS, Shi J, Mehwish HM, et al (2017) Interaction between diet composition and gut

microbiota and its impact on gastrointestinal tract health. Food Science and Human Wellness 6:121–

130. doi: 10.1016/j.fshw.2017.07.003

Rossi M, Johnson DW, Morrison M, et al (2014) SYNbiotics Easing Renal failure by improving Gut

microbiologY (SYNERGY): a protocol of placebo-controlled randomised cross-over trial. BMC Nephrol

15:106. doi: 10.1186/1471-2369-15-106

Ruf W, Riewald M (2013) Regulation of Tissue Factor Expression. Landes Bioscience

Sallée M, Dou L, Cerini C, et al (2014) The Aryl Hydrocarbon Receptor-Activating Effect of Uremic

Toxins from Tryptophan Metabolism: A New Concept to Understand Cardiovascular Complications of

Chronic Kidney Disease. Toxins 6:934–949. doi: 10.3390/toxins6030934

Sandeman SR, Howell CA, Phillips GJ, et al (2014) An adsorbent monolith device to augment the

removal of uraemic toxins during haemodialysis. J Mater Sci Mater Med 25:1589–1597. doi:

10.1007/s10856-014-5173-9

Sarnatskaya VV, Yushko LA, Sakhno LA, et al (2007) New approaches to the removal of protein-bound

toxins from blood plasma of uremic patients. Artif Cells Blood Substit Immobil Biotechnol 35:287–

308. doi: 10.1080/10731190701378618

Sarwar S, Sherman RA (2016) How Well Does Serum Albumin Correlate With Dietary Protein Intake in

Dialysis Patients? Kidney Int Rep 2:90–93. doi: 10.1016/j.ekir.2016.09.004

Schulman G, Agarwal R, Acharya M, et al (2006) A multicenter, randomized, double-blind, placebo-

controlled, dose-ranging study of AST-120 (Kremezin) in patients with moderate to severe CKD. Am J

Kidney Dis 47:565–577. doi: 10.1053/j.ajkd.2005.12.036

124


Schulman G, Vanholder R, Niwa T (2014) AST-120 for the management of progression of chronic

kidney disease. Int J Nephrol Renovasc Dis 7:49–56. doi: 10.2147/IJNRD.S41339

Sciullo EM, Vogel CF, Li W, Matsumura F (2008) Initial and extended inflammatory messages of the

nongenomic signaling pathway of the TCDD-activated Ah receptor in U937 macrophages. Arch

Biochem Biophys 480:143–155. doi: 10.1016/j.abb.2008.09.017

Serradell M, Díaz-Ricart M, Cases A, et al (2001) Uremic medium disturbs the hemostatic balance of

cultured human endothelial cells. Thromb Haemost 86:1099–1105

Shinaberger CS, Kilpatrick RD, Regidor DL, et al (2006) Longitudinal associations between dietary

protein intake and survival in hemodialysis patients. Am J Kidney Dis 48:37–49. doi:

10.1053/j.ajkd.2006.03.049

Shivanna S, Kolandaivelu K, Shashar M, et al (2016) The Aryl Hydrocarbon Receptor is a Critical

Regulator of Tissue Factor Stability and an Antithrombotic Target in Uremia. J Am Soc Nephrol

27:189–201. doi: 10.1681/ASN.2014121241

Simopoulos AP, Visioli F (2007) More on Mediterranean Diets. Karger Medical and Scientific

Publishers

Sirich TL, Plummer NS, Gardner CD, et al (2014) Effect of increasing dietary fiber on plasma levels of

colon-derived solutes in hemodialysis patients. Clin J Am Soc Nephrol 9:1603–1610. doi:

10.2215/CJN.00490114

Siri-Tarino PW (2011) Effects of diet on high-density lipoprotein cholesterol. Curr Atheroscler Rep

13:453–460. doi: 10.1007/s11883-011-0207-y

Smits SA, Leach J, Sonnenburg ED, et al (2017) Seasonal cycling in the gut microbiome of the Hadza

hunter-gatherers of Tanzania. Science 357:802–806. doi: 10.1126/science.aan4834

Sorg O, Zennegg M, Schmid P, et al (2009) 2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD) poisoning in

Victor Yushchenko: identification and measurement of TCDD metabolites. Lancet 374:1179–1185.

doi: 10.1016/S0140-6736(09)60912-0

Stevens EA, Mezrich JD, Bradfield CA (2009) The aryl hydrocarbon receptor: a perspective on

potential roles in the immune system. Immunology 127:299–311. doi: 10.1111/j.1365-

2567.2009.03054.x

Stevens PE, Levin A, Kidney Disease: Improving Global Outcomes Chronic Kidney Disease Guideline

Development Work Group Members (2013) Evaluation and management of chronic kidney disease:

synopsis of the kidney disease: improving global outcomes 2012 clinical practice guideline. Ann

Intern Med 158:825–830. doi: 10.7326/0003-4819-158-11-201306040-00007

Stockinger B, Hirota K, Duarte J, Veldhoen M (2011) External influences on the immune system via

activation of the aryl hydrocarbon receptor. Semin Immunol 23:99–105. doi:

10.1016/j.smim.2011.01.008

Swanson HI, Chan WK, Bradfield CA (1995) DNA binding specificities and pairing rules of the Ah

receptor, ARNT, and SIM proteins. J Biol Chem 270:26292–26302

125


Takayama F, Taki K, Niwa T (2003) Bifidobacterium in gastro-resistant seamless capsule reduces

serum levels of indoxyl sulfate in patients on hemodialysis. Am J Kidney Dis 41:S142-145. doi:

10.1053/ajkd.2003.50104

Ternisien C, Prost D de (1995) Le facteur tissulaire : structure, expression normale et pathologique,

fonctions et régulation. Hématologie 1:379–84

Thalacker-Mercer AE, Campbell WW (2008) Dietary protein intake affects albumin fractional

synthesis rate in younger and older adults equally. Nutr Rev 66:91–95. doi: 10.1111/j.1753-

4887.2007.00012.x

Trilok G, Draper HH (1989) Sources of protein-induced endogenous acid production and excretion by

human adults. Calcif Tissue Int 44:335–338

Tumur Z, Shimizu H, Enomoto A, et al (2010) Indoxyl Sulfate Upregulates Expression of ICAM-1 and

MCP-1 by Oxidative Stress-Induced NF-ĸB Activation. AJN 31:435–441. doi: 10.1159/000299798

Vanholder R, De Smet R, Glorieux G, et al (2003) Review on uremic toxins: classification,

concentration, and interindividual variability. Kidney Int 63:1934–1943. doi: 10.1046/j.1523-

1755.2003.00924.x

Vaziri ND, Wong J, Pahl M, et al (2013) Chronic kidney disease alters intestinal microbial flora. Kidney

Int 83:308–315. doi: 10.1038/ki.2012.345

Vernaglione L (2009) The Mediterranean diet: a matter of history, tradition, culture and health. J

Nephrol 22 Suppl 14:149–158

Vogel CFA, Li W, Wu D, et al (2011) Interaction of Aryl hydrocarbon receptor and NF-κB subunit RelB

in breast cancer is associated with Interleukin-8 overexpression. Arch Biochem Biophys 512:78–86.

doi: 10.1016/j.abb.2011.05.011

Vogel CFA, Matsumura F (2009) A new cross-talk between the Aryl hydrocarbon receptor and RelB, a

member of the NF-κB family. Biochem Pharmacol 77:734–745. doi: 10.1016/j.bcp.2008.09.036

Watanabe H, Miyamoto Y, Otagiri M, Maruyama T (2011) Update on the pharmacokinetics and redox

properties of protein-bound uremic toxins. J Pharm Sci 100:3682–3695. doi: 10.1002/jps.22592

Wattanakit K, Cushman M, Stehman-Breen C, et al (2008) Chronic Kidney Disease Increases Risk for

Venous Thromboembolism. J Am Soc Nephrol 19:135–140. doi: 10.1681/ASN.2007030308

Webster AC, Nagler EV, Morton RL, Masson P (2017) Chronic Kidney Disease. Lancet 389:1238–1252.

doi: 10.1016/S0140-6736(16)32064-5

Weiner DE, Tighiouart H, Amin MG, et al (2004) Chronic kidney disease as a risk factor for

cardiovascular disease and all-cause mortality: a pooled analysis of community-based studies. J Am

Soc Nephrol 15:1307–1315

Wu D, Nishimura N, Kuo V, et al (2011) Activation of Aryl Hydrocarbon Receptor Induces Vascular

Inflammation and Promotes Atherosclerosis in Apolipoprotein E−/− Mice. Arteriosclerosis,

Thrombosis, and Vascular Biology 31:1260–1267. doi: 10.1161/ATVBAHA.110.220202

126


Xia L, Xie H, Yu Y, et al (2016) The Effects of NF-κB and c-Jun/AP-1 on the Expression of Prothrombotic

and Proinflammatory Molecules Induced by Anti-β2GPI in Mouse. PLoS ONE 11:e0147958. doi:

10.1371/journal.pone.0147958

Xia L, Zhou H, Hu L, et al (2013) Both NF-κB and c-Jun/AP-1 involved in anti-β2GPI/β2GPI-induced

tissue factor expression in monocytes. Thromb Haemost 109:643–651. doi: 10.1160/TH12-09-0655

Xie H, Guo R, Zhong H, et al (2016) Shotgun Metagenomics of 250 Adult Twins Reveals Genetic and

Environmental Impacts on the Gut Microbiome. Cell Syst 3:572-584.e3. doi:

10.1016/j.cels.2016.10.004

Yamaguchi J, Tanaka T, Inagi R (2017) Effect of AST-120 in Chronic Kidney Disease Treatment: Still a

Controversy? NEF 135:201–206. doi: 10.1159/000453673

Yamamoto S, Kazama JJ, Omori K, et al (2015) Continuous Reduction of Protein-Bound Uraemic

Toxins with Improved Oxidative Stress by Using the Oral Charcoal Adsorbent AST-120 in

Haemodialysis Patients. Sci Rep 5:14381. doi: 10.1038/srep14381

Yamamoto S, Sato M, Sato Y, et al (2018) Adsorption of Protein-Bound Uremic Toxins Through Direct

Hemoperfusion With Hexadecyl-Immobilized Cellulose Beads in Patients Undergoing Hemodialysis.

Artif Organs 42:88–93. doi: 10.1111/aor.12961

Yang K, Du C, Wang X, et al (2017) Indoxyl sulfate induces platelet hyperactivity and contributes to

chronic kidney disease-associated thrombosis in mice. Blood 129:2667–2679. doi: 10.1182/blood-

2016-10-744060

Yeun JY, Kaysen GA (1998) Factors influencing serum albumin in dialysis patients. Am J Kidney Dis

32:S118-125

Young VR, El-Khoury AE, Raguso CA, et al (2000) Rates of urea production and hydrolysis and leucine

oxidation change linearly over widely varying protein intakes in healthy adults. J Nutr 130:761–766.

doi: 10.1093/jn/130.4.761

Yu M, Kim YJ, Kang D-H (2011) Indoxyl sulfate-induced endothelial dysfunction in patients with

chronic kidney disease via an induction of oxidative stress. Clin J Am Soc Nephrol 6:30–39. doi:

10.2215/CJN.05340610

Zanger UM, Schwab M (2013) Cytochrome P450 enzymes in drug metabolism: Regulation of gene

expression, enzyme activities, and impact of genetic variation. Pharmacology & Therapeutics

138:103–141. doi: 10.1016/j.pharmthera.2012.12.007

Zhao B, DeGroot DE, Hayashi A, et al (2010) CH223191 Is a Ligand-Selective Antagonist of the Ah

(Dioxin) Receptor. Toxicol Sci 117:393–403. doi: 10.1093/toxsci/kfq217

Zhao D, Pritts EA, Chao VA, et al (2002) Dioxin stimulates RANTES expression in an in-vitro model of

endometriosis. Mol Hum Reprod 8:849–854

Zhao J, Yao Y, Li D, et al (2018) Characterization of the Gut Microbiota in Six Geographical

Populations of Chinese Rhesus Macaques (Macaca mulatta), Implying an Adaptation to High-Altitude

Environment. Microb Ecol 76:565–577. doi: 10.1007/s00248-018-1146-8

127

Annexes

Annexes

128

Annexes

Annexe 1 : Lettre d’information et consentement

Titre de l’étude : Étude comparative entre deux cohortes de patients HD (Oran vs Marseille)

Promoteur de l’étude : (Université Oran 1, Faculté de science de la nature et de la vie, BP

1524 EL M_Naouer 31000 Oran ,Algérie). (Aix-Marseille Université, Faculté de

Pharmacie, 27 Bd Jean Moulin 13385 Marseille cedex 05, France).

Organisme de recherche : Laboratoire de physiologie de la nutrition et de la sécurité

alimentaire LPNSA, BP 1524 EL M_Naouer 31000 Oran ,Algérie).ex UMR_S 1076

endothélium, pathologies vasculaires et cibles thérapeutiques, Faculté de Pharmacie,

27 Bd Jean Moulin 13385 Marseille cedex 05, France). (LPNSA/ C2VN ex UMR_S1076)

Médecins investigateurs locaux et chercheurs:( Dr Fahssi Nadia, Dr Remaoui Mustapha,

Néphrologue, centre d’hémodialyse Renadial, ST-Hubert ES-SEDIKKIA),(Dr Kamel El

Mecherfi (MCA),Doctorant Addi Tawfik, Pr Kheroua Omar, Université Oran 1) , International ;

(Pr Stéphane Burtey, Néphrologue, AMU, Marseille France).

I Information essentielle à votre décision de participer (4 pages)

Introduction

Vous êtes invité à participer à une étude clinique destinée à évaluer le dosage de plusieurs toxines

urémiques dans le sang. Le but de ce travail est d’évaluer la quantité de toxines urémiques

s’accumulant chez les patients avec une maladie rénale chronique hémodialysé. Nous évaluerons si

la quantité de toxines urémiques est associée à la survenue d’événements indésirables pendant un

an.

Il n’y a aucun bénéfice de votre participation à cette étude.

Avant que vous n’acceptiez d’y participer, nous vous invitons à prendre connaissance de ses

implications en termes d’organisation, avantages et risques éventuels, afin que vous puissiez prendre

une décision en toute connaissance de cause. Ceci s’appelle donner un « consentement éclairé ».

Veuillez lire attentivement ces quelques pages d’information et poser toutes les questions que vous

souhaitez à l’investigateur ou à la personne qui le représente. Ce document comprend 3 parties :

l’information essentielle à votre prise de décision, votre consentement écrit et des informations

complémentaires (annexes) qui détaillent certaines parties de l’information de base.

Si vous participez à cette étude clinique, vous devez savoir que :

➢ Votre participation est volontaire et doit rester libre de toute contrainte. Elle nécessite la signature d’un document exprimant votre consentement. Même après l’avoir signé, vous pouvez arrêter de participer en informant le médecin investigateur. Votre décision de ne pas ou de ne plus participer à l’étude n’aura aucun impact sur la qualité de vos soins ni sur vos relations avec le médecin investigateur.

➢ Les données recueillies à cette occasion sont confidentielles et votre anonymat est garanti lors de la publication des résultats.

➢ Aucuns frais ne vous seront facturés pour les visites / consultations, ou prélèvements. ➢ Vous pouvez toujours contacter le médecin investigateur ou un membre de son équipe si vous

avez besoin d’informations complémentaires.

129

Annexes

➢ Objectifs et description du protocole de l’étude Nous vous proposons de participer à une étude clinique portant sur le dosage de lindoxyl sulfate de

l’indole-3 acétique acide et du para crésol sulfate qui devrait inclure environ 100 patients

hémodialysés en Algérie.

Le but du travail est de déterminer le taux de ces toxines dans une population hémodialysée en

Algérie .

Il s’agit d’une étude observationnelle.

Déroulement de l’étude

L’étude sera basée sur un interrogatoire à l’inclusion. Il sera prélevé uniquement deux tubes secs

avant une dialyse de milieu de semaine.

Votre participation à l’étude s’inscrivant dans le cadre de la prise en charge de votre situation clinique,

une partie des visites et examens que nous allons décrire font partie de la norme de soin en usage

dans votre hôpital (centre) tandis que d’autres sont proposées par l’étude.

Si vous acceptez de participer à l’étude et si vous répondez à toutes les conditions requises pour être

enrôlé(e) dans l’étude, vous passerez les tests et examens décrits ci-dessous :

Interrogatoire

Deux tubes secs au branchement en dialyse du milieu de semaine

Suivi d’une année

Risques et inconvénients

Les informations obtenues grâce à cette étude peuvent contribuer à une meilleure connaissance des

complications de l’insuffisance rénale chronique. Il n’y a pas de risque supplémentaire si vous

participez à cette étude qui s’intègre dans vos soins habituels.

Échantillons de matériel biologique collectés au cours de l’étude

Le promoteur de l’étude s’engage à ce que les échantillons soient utilisés exclusivement dans le

contexte défini dans la rubrique « Déroulement de la recherche clinique » et ses annexes.

1) Échantillons collectés pour les analyses décrites pour l’étude dans ce document

Le surplus de vos échantillons sera détruit dès que les analyses décrites dans ce document auront été

effectuées soit en principe dans 2 années.

Si vous participez à cette étude clinique, nous vous demandons :

➢ De collaborer pleinement au bon déroulement de cette recherche.

➢ De ne masquer aucune information relative à votre état de santé, aux médicaments que vous prenez (plus précisément les antibiotiques) ou aux symptômes que vous ressentez.

➢ De ne pas modifie vos habitudes quotidiennes (alimentation, régime..etc).

➢ De transmettre certaines données personnelles pour le recueil d’information.

➢ De faire certaines analyses supplémentaires pour le recueil des paramètres biologiques, cité dans l’annexe (interrogatoire), dans le cas où elles sont gratuites.

Contact

Si vous avez besoin d’informations complémentaires, mais aussi en cas de problème ou d’inquiétude,

vous pouvez contacter votre médecin (Le Dr Fahssi Nadia, Dr Remaoui Mustapha (médecin

investigateur)) ou un membre de l’équipe de recherche (ADDI, Tawfik).

130

Annexes

Titre de l’étude : Étude comparative entre deux cohortes de patients HD (Oran vs Marseille)

II Consentement éclairé (de 1 à 2 pages)

Participant

Je déclare que j’ai été informé sur la nature de l’étude, son but, sa durée, les éventuels bénéfices et

ce que l’on attend de moi. J’ai pris connaissance du document d’information et des annexes à ce

document.

J’ai eu suffisamment de temps pour y réfléchir et en parler avec une personne de mon choix comme

mon médecin ou un membre de ma famille.

J’ai eu l’occasion de poser toutes les questions qui me sont venues à l’esprit et j’ai obtenu une

réponse satisfaisante à mes questions.

J’ai compris que ma participation à cette étude est volontaire et que je suis libre de mettre fin à ma

participation à cette étude sans que cela ne modifie mes relations avec l’équipe thérapeutique en

charge de ma santé.

J’ai compris que des données me concernant seront récoltées pendant toute ma participation à cette

étude et que le médecin investigateur et le promoteur de l’étude se portent garants de la

confidentialité de ces données.

Je consens au traitement de mes données personnelles selon les modalités décrites dans la rubrique

traitant de garanties de confidentialité (annexe I). Je donne également mon accord au transfert et au

traitement de ces données dans d’autres pays que l’Algérie.

[En fonction des études] J’accepte / n’accepte pas (biffer la mention inutile) que les données de

recherche récoltées pour les objectifs de la présente étude puissent être traitées ultérieurement pour

autant que ce traitement soit limité au contexte de la présente étude pour une meilleure connaissance

et prise en charge de la maladie.

[En fonction des études] J’accepte / n’accepte pas (biffer la mention inutile) que le promoteur conserve

des échantillons de matériel biologique récolté en cours d’étude pendant 2 années à des fins de

recherches ultérieures, mais limitées au contexte de la présente étude.

J’accepte/ n’accepte pas (biffer la mention inutile) que mon médecin généraliste ou d'autres médecins

spécialistes en charge de ma santé soient informés de ma participation à cette étude clinique.

J’ai reçu une copie de l’information au participant et du consentement éclairé.

Nom, prénom, date et signature du volontaire.

131

Annexes

Médecin investigateur

Je soussigné [Dr Fahssi Nadia, Dr Remaoui Mustapha] médecin investigateur / assistant de recherche

clinique confirme avoir fourni oralement les informations nécessaires sur l'étude et avoir fourni un

exemplaire du document d’information au participant.

Je confirme qu'aucune pression n'a été exercée pour que le patient accepte de participer à l'étude et

que je suis prêt à répondre à toutes les questions supplémentaires, le cas échéant.

Je confirme travailler en accord avec les principes éthiques énoncés dans la dernière version de la

« Déclaration d’Helsinki », des « Bonnes pratiques cliniques » et de la loi belge du 7 mai 2004, relative

aux expérimentations sur la personne humaine.

Nom, prénom, Date et signature Nom, Prénom, Date et signature

Promoteur de l’étude du médecin investigateur

132

Annexes

Annexe 2 : Interrogatoire Centre : Numéro d’inclusion patient :

I. Identification du patient

Nom : Prénom : Date de naissance :

Sexe : F M

Tel :

Adresse :

Situation familiale : Mariée Divorcé Célibataire Veuve

Profession et lieu de travail :

II. Antécédent médical :

Colectomie : oui non

Maladies cardiovasculaires

Infarctus du myocarde : (oui/non) :

Coronaropathie :

AVC :

Insuffisance cardiaque :

Artériopathie des membres inférieurs :

Amputation :

Phlébite :

Embolie pulmonaire :

Autre :

Maladie chronique associée à l’IRC :

HTA Diabètes Hypercholestérolémie Autre ;

Maladie non chronique : infectieuse troubles digestifs Autre ;

III. Autres facteurs

Résidence prés :

D’une Zone industrielle ou usine Zone urbaine en campagne

Fumeur : Oui jamais À arrêter rarement Nombre de paquets par

années ;

F Passif : Oui Non

Alimentation et Appétit :

Bonne Moyenne Faible

Habitude alimentaire : XXX (+/-)

viande Légumes Fruit Poisson fruit sec légume sec café

Sous régime alimentaire : oui non

Médication : Sous Antibiotique : oui non Date de la dernière prise d’antibiotique :

Autre mdt : Catégorie de mdt :

133

Annexes

IV. Diagnostic de l’IRC

Âge de l’IRC :

Degré d’IRC

Modérer Sévère Terminale

Nombre de dialyse par semaine :

Paramètres cliniques :

Date d'Inclusion :

Néphropathie :

Date de survenue de l'IRCT (Date de mise en

dialyse) :

Antécédents de Transplantation rénale :

Voie d’abord :

Poids :

Taille :

Diurèse (estimée par l'interrogatoire du patient) :

Troubles du transit intestinal : constipation,

diarrhée.

Les paramètres de dialyse :

Les traitements :

Paramètres biologiques :

GB :

Lymphocytes :

Plaquettes :

Hémoglobine :

Ferritine :

Coefficient de Saturation :

INR en cas de prise d’anticoagulant :

Calcium :

Phosphate :

Potassium :

CRP :

Albumine :

Réserve alcaline :

Urée sanguine :

β2-microglobuline (si faite) :

Acide urique :

TSH (si faite) :

HbA1c (si faite) :

Créatinine :

Clairance de la Créatinine :

Bicarbonate :

Cholestérol :

HDL-cholestérol :

LDL-cholestérol :

Triglycérides :

Prélèvement : Avant Dialyse Après Dialyse

134

Annexes

Annexe 3 : fiche de suivi

Nom et prénom du patient :

Date de l’inclusion du patient :

Date d’initiation du suivi du patient :

Taux de toxines urémiques sériques trouvées chez le patient :

IS : IAA : PCs :

Information concernant les survenues cardiovasculaires du patient

sur une période d’une année

Visite trois mois après l’initiation du suivi

Nombre et Type de complications :

Date de manifestation clinique :

Six mois après l’initiation



Décès (Cause, date) ;

Neuf mois après l’initiation

Type de complication :


Douze mois après l’initiation



135

Productions scientifiques

Productions scientifiques

Publications

➢ Article original publié dans ‘Archives of toxicology’ « Mechanisms Of Tissue Factor Induction

By The Uremic Toxin Indol-3 Acetic Acid Through Aryl Hydrocarbon Receptor/Nuclear

Factor-Kappa B Signaling Pathway in Human Endothelial Cells».

DOI : https://doi.org/10.1007/s00204-018-2328-3. (1erauteur) (Publié en Octobre 2018).

➢ Revue scientifique publié dans ‘Toxins’ « Tryptophan-Derived Uremic Toxins and

Thrombosis in Chronic Kidney Disease ».

DOI: https://doi.org/10.3390/toxins10100412. (1erauteur) (Publié en Octobre 2018).

➢ Article original publié dans ‘Kidney International’ « Aryl hydrocabon receptor is activated

in humans and mice with chronic kidney disease»

DOI: https://doi.org/10.1016/j.kint.2017.11.010. (4emeauteur, 2017).

Communications

➢ “Travel Grants” pour une communication orale, 1er auteur, à « European congress on

thrombosis and Haemostasis, ECTH 2018, 24/25/26 October 2018, Marseille » “Aryl

Hydrocarbon Receptor-Related Mechanisms Of Endothelial Tissue Factor Induction By

The Uremic Toxin Indole-3 Acetic Acid”.

➢ Communication 2eme auteur « Comment Aryl hydrocarbon receptor active-t-il

l’expression du facteur tissulaire dans l’endothélium humain en réponse à l’indole-3

acétique acide ? » Néphrologie & Thérapeutique, 3e congrès de la Société francophone

de néphrologie, dialyse et transplantation, Lille – 1 au 5 octobre 2018.

➢ Communication orale poster, 1er auteur « Cooperative roles of Aryl hydrocarbon

Receptor and NF-B in Tissue Factor expression induced by indolic uremic toxins »,

Journée de la Recherche Faculté de pharmacie, Marseille (19 Octobre 2017).

➢ Communication 2eme auteur « Aryl hydrocarbon receptor est activé in vivo au cours de

l’insuffisance rénale chronique » Néphrologie & Thérapeutique, 17e Réunion commune

de la Société de néphrologie (SN) et de la Société francophone de dialyse (SFD) Lyon –

29 septembre au 2 octobre 2015.

https://doi.org/10.3390/toxins10100412

https://doi.org/10.1016/j.kint.2017.11.010

Vol.:(0123456789)1 3

Archives of Toxicology https://doi.org/10.1007/s00204-018-2328-3

MOLECULAR TOXICOLOGY

Mechanisms of tissue factor induction by the uremic toxin indole-3 acetic acid through aryl hydrocarbon receptor/nuclear factor-kappa B signaling pathway in human endothelial cells

Tawfik Addi1,2 · Stéphane Poitevin1 · Nathalie McKay1 · Kamel Eddine El Mecherfi2,3 · Omar Kheroua2 · Noémie Jourde‑Chiche1,4 · Alix de Macedo5 · Bertrand Gondouin6 · Claire Cerini1 · Philippe Brunet1,4 · Françoise Dignat‑George1 · Stéphane Burtey1,4 · Laetitia Dou1

Received: 1 February 2018 / Accepted: 9 October 2018 © Springer-Verlag GmbH Germany, part of Springer Nature 2018

AbstractChronic kidney disease (CKD) is associated with high risk of thrombosis. Indole-3 acetic acid (IAA), an indolic uremic toxin, induces the expression of tissue factor (TF) in human umbilical vein endothelial cells (HUVEC) via the transcription factor aryl hydrocarbon receptor (AhR). This study aimed to understand the signaling pathways involved in AhR-mediated TF induc-tion by IAA. We incubated human endothelial cells with IAA at 50 µM, the maximal concentration found in patients with CKD. IAA induced TF expression in different types of human endothelial cells: umbilical vein (HUVEC), aortic (HAoEC), and cardiac-derived microvascular (HMVEC-C). Using AhR inhibition and chromatin immunoprecipitation experiments, we showed that TF induction by IAA in HUVEC was controlled by AhR and that AhR did not bind to the TF promoter. The analysis of TF promoter activity using luciferase reporter plasmids showed that the NF-κB site was essential in TF induction by IAA. In addition, TF induction by IAA was drastically decreased by an inhibitor of the NF-κB pathway. IAA induced the nuclear translocation of NF-κB p50 subunit, which was decreased by AhR and p38MAPK inhibition. Finally, in a cohort of 92 CKD patients on hemodialysis, circulating TF was independently related to serum IAA in multivariate analysis. In conclusion, TF up-regulation by IAA in human endothelial cells involves a non-genomic AhR/p38 MAPK/NF-κB pathway. The understanding of signal transduction pathways related to AhR thrombotic/inflammatory pathway is of interest to find therapeutic targets to reduce TF expression and thrombotic risk in patients with CKD.

Keywords Tissue factor · Uremic toxins · Aryl hydrocarbon receptor · Nuclear factor kappa-B · Indole-3 acetic acid · Chronic kidney disease

Introduction

Cardiovascular disease (CVD) is the leading cause of death in patients with chronic kidney disease (CKD) (Go et al. 2004; Tonelli et al. 2006). Thrombosis is a key event in CVD; and CKD is associated with an increased thrombotic risk Electronic supplementary material The online version of this

article (https ://doi.org/10.1007/s0020 4-018-2328-3) contains supplementary material, which is available to authorized users.

* Laetitia Dou [email protected]

1 Faculté de pharmacie, Aix-Marseille Université, INSERM, INRA, C2VN, 27 bd Jean Moulin, 13005 Marseille, France

2 Département de Biologie, Université d’Oran 1 Ahmed Benbella, LPNSA, Oran, Algeria

3 Université Mohamed Boudiaf USTO, Dpt génétique Moléculaire Appliquée (GMA), Oran, Algeria

4 Centre de Néphrologie et Transplantation Rénale, AP-HM, Marseille, France

5 Service de Pédiatrie-Néonatologie, Hôpital Fondation Saint Joseph, Marseille, France

6 Association des dialysés Provence-Corse (ADPC), Marseille, France

http://crossmark.crossref.org/dialog/?doi=10.1007/s00204-018-2328-3&domain=pdf

https://doi.org/10.1007/s00204-018-2328-3

Archives of Toxicology

1 3

(Daneschvar et al. 2008; Wattanakit and Cushman 2009; Car-ney 2016). In patients with CKD, the balance of the coagula-tion system is dysregulated, with higher levels of factor VII, factor VIII, thrombin and tissue factor (TF) (Jalal et al. 2010; Huang et al. 2017). Accumulation of some uremic toxins nor-mally eliminated by the kidney is correlated with CVD and mortality in patients with CKD (Barreto et al. 2009; Moradi et al. 2013; Han et al. 2015; Storino et al. 2015). The uremic toxin indole-3 acetic acid (IAA) is an independent predictor of cardiovascular events and mortality in patients with CKD (Dou et al. 2015). IAA is a uremic indolic toxin derived from the metabolization of dietary tryptophan by the gut micro-biota (Fernandez-Prado et al. 2017). Because of its protein-binding (Jourde-Chiche et al. 2009), IAA is poorly removed by dialysis (Neirynck et al. 2013). In cultured endothelial cells, IAA promotes the expression of a proinflammatory phenotype (Gondouin et al. 2013; Dou et al. 2015). IAA also increases the endothelial expression and procoagulant activity of TF (Gon-douin et al. 2013), the principal initiator of blood coagulation (Camerer et al. 1996).

Tissue factor expression is induced by various stimuli, such as pro-inflammatory cytokines, lipopolysaccharides (LPS), growth factors, or thromboxane A2, via different transcrip-tion factors: NF-κB, AP-1, NFAT or Egr-1 (Bode and Mack-man 2014). Interestingly, we have described that indolic toxins induce TF expression by a new pathway: the aryl hydrocar-bon receptor (AhR) pathway (Gondouin et al. 2013). AhR was initially described as a receptor of some environmental contaminants, especially 2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD) (Hankinson 1995; Mandal 2005); and IAA is an endogenous agonist of AhR (Heath-Pagliuso et al. 1998). In resting cells, AhR forms a complex with HSP90, XAP2 and p23 in the cytoplasm (Heid et al. 2000; Petrulis and Perdew 2002). After ligand binding to AhR, the complex dissociates, resulting in AhR translocation into the nucleus and dimeriza-tion with the aryl hydrocarbon nuclear translocator (ARNT). The AHR/ARNT heterodimer binds to the XRE (Xenobiotic Response Element) sequences on the promoters of AhR target genes such as CYP1A1, CYP1A2, or CYP1B1 (Dolwick et al. 1993; Fujii-Kuriyama and Mimura 2005). In addition to this direct genomic pathway, a non-genomic inflammatory AhR pathway, independent of ARNT, has been described (Zhao et al. 2002; Sciullo et al. 2008; Matsumura 2009; Kim et al. 2012). AhR ligands, such as TCDD, induce the expression of proteins involved in inflammation such as IL-6, RANTES, TNF, and COX-2 (Zhao et al. 2002; Sciullo et al. 2008; Mat-sumura 2009; Kim et al. 2012). In the non-genomic pathway, AhR acts as a signaling molecules that interacts with multiple signaling pathways (Borlak and Jenke 2008; Henklová et al. 2008; Ma et al. 2009; Puga et al. 2009a). We recently reported that a non-genomic pathway of AhR involving p38MAPK/NF-κB signaling is crucial for the induction of endothelial COX-2 by IAA (Dou et al. 2015).

Until now, the mechanisms through which AhR controls TF expression in endothelial cells were poorly understood. The objective of the present work was, therefore, to deter-mine the signaling pathways and the transcriptions factors involved in AhR-mediated TF induction by IAA.

Methods

Endothelial cell culture

HUVEC were obtained from umbilical cord vein by colla-genase digestion as described (Jaffe et al. 1973) and grown to the fourth passage in EGM-2 medium (Lonza, France) (containing 2% fetal bovine serum), under standard cell culture conditions (humidified atmosphere at 37 °C, 5% CO2). Human aortic endothelial cells (HAoEC) and cardiac-derived microvascular endothelial cells (HMVEC-C) were obtained from Lonza. HMVEC-C were grown to the fifth passages in EGM-2 MV medium (Lonza, France) (contain-ing 5% fetal bovine serum) under standard cell culture con-ditions. HAoEC were grown to the fifth passage in EGM-2 medium under standard cell culture conditions.

Effect of the uremic toxin IAA

Cells were incubated in the presence of IAA (Sigma-Aldrich, France) at 50 µM, the highest concentration described in uremic patients (Vanholder et al. 2003). They were treated during indicated times, with or without the AhR Inhibitor CH-229131 at 10 µM (Sigma-Aldrich), the NF-κB inhibi-tor BAY 11-7082 at 10 µM (Merck Chemicals), the PKC inhibitor Bisindolymaleimide I at 5 µM (Merck Chemicals), the p38 inhibitor SB203580 at 10 µM (Sigma-Aldrich), the ERK1/2 inhibitor PD98059 at 10 µM (Sigma-Aldrich), and the transcription inhibitor Actinomycin D at 1 µg/ml (Sigma-Aldrich). Because IAA was diluted in ethanol, ethanol 1/1000 was used as control. In some experiments, human serum albumin (LFB, France) was added in the cul-ture medium, at the concentration found in human serum (4 g/dL).

SiRNA knockdown of AhR

HUVEC were transfected with siRNA control (Negative Universal Control, Stealth™ RNAi, Life Technologies, France) or a pool containing three Silencer® Select siRNA directed against AhR (1200, 1999 and 1998, Life Technolo-gies, France) by magnetofection using SilenceMag beads (OZ Biosciences, France), according to the manufacturer’s instructions. The knockdown of AhR was verified by western blot on cell extracts 48 h after transfection (Supplemental


1 3

Fig. 1). TF induction and p50 nuclear translocation were determined 48 h after transfection.

RNA extraction and quantitative RT‑PCR analysis of mRNA expression

Total RNA was extracted by an RNeasy mini-kit (Qia-gen, France). RT was performed on 500 ng of total RNA using the Takara PrimeScript™ RT reagent Kit (Ozyme, Saint Quentin en Yvelines, France) followed by qPCR on 25 ng of cDNA using the Takara SYBR qPCR Premix Ex Taq (Ozyme). We quantified the following target genes: TF, CYP1A1, and CYP1B1. The housekeeping gene HPRT was used for normalization of the target gene values. The sequences of primers were as follows: TF forward: 5′TGC AGT AGC TCC AAC AGT GC3’, TF reverse: 5′GAG TGT ATG GGC CAG GAG AA3’; CYP1A1 forward: 5′GAC AGA TCC CAT CTG CCC TA 3′, CYP1A1 reverse: 5′ATA GCA CCA TCA GGG GTG AG 3; CYP1B1 forward: 5′ TGA TGG ACG CCT TTA TCC TC 3′, CYP1B1 reverse: 5′ CCA CGA CCT GAT CCA ATT CT 3′; HPRT forward: 5′GGA TTA TAC TGC CTG ACC AAG GAA AGC 3′, HPRT reverse: 5′ GAG CTA TTG TAA TGA CCA GTC AAC AGG3′.

All PCR reaction efficiencies were determined with MxPro software (Agilent) and were always between 90 and 110%. The fusion curves were analyzed to assess the specificity of detected fluorescence. Fold change of mRNA expression vs. control condition (ethanol) was calculated using the 2− ΔΔCt method. The transcript for the housekeep-ing gene HPRT was used for data normalization.

Western blotting and densitometry analysis of Western blots

HUVEC were incubated with 50 µM IAA, or with etha-nol diluted 1/1000 (vehicle control) during 30 min, with or without the AhR Inhibitor CH-229131 at 10 µM (Sigma-Aldrich). Some experiments were also performed on HUVECs transfected with AhR siRNA or control siRNA, and cells were stimulated with IAA 50 µM 48 h after trans-fection. Nuclear extracts were prepared using Cayman Chemical’s Nuclear Extraction Kit (interchim, France). Cytosolic extracts were prepared using 1 ml of lysis buffer containing 20 mM MOPS, 50 mM β-glycerolphosphate, 50 mM sodium fluoride, 1 mM sodium orthovanadate, 5 mM EGTA, 2 mM EDTA, 1% NP40, 1 mM dithiothreitol (DTT), 1 mM benzamidine, 1 mM phenylmethanesulpho-nylfluoride (PMSF) and 10 µg/mL leupeptin and aprotinin. The cells were incubated 10 min on ice and then collected with a scraper. The cytosolic extracts were obtained after centrifugation of cell lysates at 18,000 g for 15 min. Protein

concentrations were measured with the Bicinchoninic Acid Kit (BCA1, Sigma-Aldrich).

Samples were mixed with LDS sample buffer and pro-teins were separated using 4–12% NuPAGE™ protein gel (Life technologies). Proteins were transferred to nitrocel-lulose membrane and blocked with 5% skim milk for 1 h at room temperature. The membrane was incubated over-night at 4 °C with antibodies directed against AhR (Santa Cruz, France), against NF-kB p50 (Cell Signaling, Ozyme, France), or actin (Cell Signaling, France), and then with the secondary peroxidase-conjugated antibody (Beckman-Coul-ter, France). Revelations were done by chemiluminescence (ECL Western blotting substrate, Pierce). Gel images were captured using the Syngene GBox (Ozyme) and analyzed with the software geneSys (Ozyme).

Study of NF‑κB and AP‑1 nuclear levels

After HUVEC incubation with 50 µM IAA during 30 min, with or without the AhR Inhibitor CH-229131 at 10 µM (Sigma-Aldrich), the NF-κB inhibitor BAY 11-7082 at 10 µM (Merck Chemicals), the PKC inhibitor Bisindoly-maleimide I at 5 µM, the p38 inhibitor SB203580 at 10 µM (Sigma-Aldrich), nuclear extracts were prepared using Cay-man Chemical’s Nuclear Extraction Kit (interchim, France). NF-κB p50 was detected in nuclear extracts by Cayman Chemical’s NF-κB (human p50) combo transcription factor assay kit (interchim). This kit is a 96-well ELISA with a spe-cific double stranded DNA sequence containing the NF-KB response element. NF-KB p50 contained in nuclear extracts is detected with a specific primary antibody and a second-ary antibody HRP-conjugated that provides a colorimetric readout à 450 nm.

Endothelial p65 expression in nuclear extracts was meas-ured after 30 min incubation of HUVEC with IAA 50 µM and detected in nuclear extracts by the Cayman Chemical’s NF-κB (human p50/p65) combo transcription factor assay kit (interchim).

AP-1 subunits c-Fos and c-Jun were detected in nuclear extracts by the AP1 (c-Fos/FosB/Fra1/c-Jun/JunB/JunD) transcription factor assay kit (Abcam, Paris, France).

Chromatin immunoprecipitation (ChIP) assay

HUVEC monolayers (6 × 106 cells) were treated with IAA (50 µM) or ethanol (vehicle) for 60 min. Cells were fixed by adding formaldehyde directly to the medium to a final con-centration of 1% and incubated for 10 min at room tempera-ture then 40 min at 4 °C. ChIP assay was performed using the EZ-Magna ChIP™ A/G Chromatin Immunoprecipitation Kit (Merck Millipore, France), according to the kit instruc-tions. Immunoprecipitations were performed overnight at


1 3


1 3

4 °C with 5 µg of rabbit IgG (control IgG) or rabbit poly-clonal antibody against AhR (Santa Cruz Biotechnology, Tebu-Bio, France). Real-time PCR quantification of ChIP enrichments was run on a MX3000P instrument (Strata-gene) using the Brilliant II SYBR Green QPCR Master Mix (Takara bio, France). Specific primer sequences for promot-ers were as follows: TF forward, 5′-GCC CTC CCT TTC CTG CCA TAGA-3′, TF reverse: 5′-CCT CCC GGT AGG AAA CTC CG-3′; CYP1A1 forward: 5′-ACG CAG ACC TAG ACC CTT TGC-3′, CYP1A1 reverse: 5′-CGG GTG CGC GAT TGAA-3′; CYP1B1 forward: 5′-ATA TGA CTG GAG CCG ACT TTCC-3′, CYP1B1 reverse: 5′-GGC GAA CTT TAT CGG GTT GA-3′. Fold enrichment was calculated using the 2− ΔΔCt method, where ΔΔCt represents the difference between threshold cycles of experimental rabbit polyclonal antibodies against AhR over rabbit control IgG.

Transient transfection of HUVEC and Luciferase Promoter Assay

The human TF wild-type promoter (− 227 hTF WT), the TF mutant AP-1 (− 227 hTF mAP1) and the TF-κB mutant (− 227 hTF mTF-κB) reporter plasmids in pGL2 basic were a gift from Nigel Mackman (Addgene plasmid # 15442, 15443, 15444 respectively).

HUVEC (1.5 × 105 cells) were plated into 6-well plates in EGM-2 medium 16 h before transfection. Cells were then incubated 1 h before transfection with Opti-MEM™ reduced-serum medium (Gibco, Life Technologies, France). Transfection was performed using Lipofectamine 2000 (Life Technologies, France) associated with magnetofec-tion using CombimagTMbeads (OZ Bioscience, Marseille, France) according to the manufacturer’s instructions. Briefly, reporter plasmids (1 µg) were mixed with 2 µl of Lipo-fectamine in 200 µl of Opti-MEM reduced serum medium for 20 min then 1 µl of Combimag™ beads was added to DNA-Lipofectamine complexes. The DNA-Lipofectamine-beads complexes were incubated for 20 min at room

temperature, incubated with HUVEC for 1 h at 37 °C on a magnetic plate in the 5% CO2 incubator and then replaced with growth medium. After 48 h, HUVEC were treated with IAA or ethanol (vehicle control) for 6 h. Cells were lysed in a reporter lysis buffer and lysates were assayed for lucif-erase activities using the luciferase assay system and the GloMax®-Multi detection system (Promega, France). The pSV-β-Galactosidase control vector (Promega) was cotrans-fected so that the transfection efficiencies could be normal-ized with the β-galactosidase activities determined using the b-Glo® assay system (Promega).

Patients

We performed a single center prospective study in 92 hemodialyzed patients, selected according to the follow-ing criteria: age > 18 years; no cardiovascular event (myo-cardial infarction, stroke, peripheral vascular disease with amputation or need for angioplasty), infection, or surgical intervention (except for vascular access angioplasty) in the last 3 months; no pregnancy; no recent history of malig-nancy; no intake of corticosteroids or immunosuppressive agents. Patients had been dialyzed at least 3 times a week for a minimum of 6 months. Patients’ blood samples were drawn before the mid-week hemodialysis session. Blood samples were drawn in BD Vacutainer → tubes containing lithium heparin for biochemical analyses, EDTA for hemo-globin measurement, citrate for TF measurement, and in BD Vacutainer → SST tubes for IS, IAA, p-cresylsulfate, and β2-microglobulin measurement. Standard laboratory proce-dures were used for blood chemistry evaluations. Total IS, IAA, and p-cresylsulfate were measured by HPLC, accord-ing to Calaf et al. (2011).

Informed consent was obtained from all individual par-ticipants included in the study. The study was approved by the local ethics committee and conforms to the principles outlined in the Declaration of Helsinki.

Measurement of TF by enzyme‑linked immunosorbent assay

TF was quantified in citrated human plasma and in cell lysates of HUVEC with the enzyme-linked immunosorbent assay (ELISA) kit Quantikine Human Coagulation Factor III/Tissue Factor (R&D Systems, Lille, France) according to the instructions of the manufacturer.

Statistical analyses

For in vitro studies, statistical analyses were performed with the Prism (GraphPad Software Inc, CA). Significant differ-ences were revealed by the Wilcoxon signed rank test or by

Fig. 1 IAA induces endothelial Tissue Factor transcription. a The induction of TF mRNA by IAA in different types of endothelial cells: HUVEC (umbilical vein), HAoEC (aortic), and HMVEC-C (car-diac-derived microvascular) were studied by comparative RT-qPCR and expressed in mRNA fold change vs. control. Data represent the mean ± SEM of 4 independent experiments. *p < 0.05, **p < 0.01. b TF protein level in HUVEC, HAoEC, and HMVEC-C after a 4-h incubation with 50 µM IAA was studied by ELISA. Data represent the mean ± SEM of 4 independent experiments. *p < 0.05. Effect of 50 µM IAA on Tissue Factor mRNA (C) and protein (D) induction in HUVEC, in medium containing 4% human serum albumin. Data represent the mean ± SEM of 5 independent experiments *p < 0.05. e Effect of the transcription inhibitor Actinomycin D (1 µg/mL) on Tissue Factor mRNA expression after a 4-h incubation with IAA at 50 µM. Data, expressed in mRNA fold change vs. control, represent the mean ± SEM of 4 independent experiments. *p < 0.05, **p < 0.01

◂


1 3

the Mann Whitney test. Data are expressed as mean ± SEM of independent experiments performed on different cell preparations.

In CKD patients, data are expressed as mean ± standard deviation (SD) for values with normal distribution or median (min; max) for non-normally distributed values. Numerical

variables were tested for normality by the Shapiro–Wilk test. Correlations between plasma TF and continuous variables were obtained using Spearman correlation coefficients; sta-tistical analyses were performed with the Prism (GraphPad Software Inc, CA) software. To identify factors indepen-dently associated with plasma TF, multiple linear regression


1 3

analyses were performed with the R software. A p value lower than 0.05 was considered significant.

Ethical approval

All procedures performed in studies involving human par-ticipants were in accordance with the ethical standards of the institutional and/or national research committee and with the 1964 Helsinki declaration and its later amendments or comparable ethical standards.

Results

Study of IAA‑induced TF expression in endothelial cells

We previously demonstrated that IAA up-regulates TF expression in HUVEC (Gondouin et al. 2013). Here, we studied the effect of IAA on TF mRNA and protein expres-sion in other types of human endothelial cells that are rel-evant to the cardiovascular events observed in patients: arte-rial (HAoEC, aortic endothelial cells), and microvascular (HMVEC-C, cardiac-derived microvascular endothelial cells). In all human endothelial cells studied, IAA signifi-cantly increased the mRNA (Fig. 1a) and protein (Fig. 2b) expression of TF after 4 h of incubation.

We then added human serum albumin at 4 g/dL in the culture medium to increase the protein-bound fraction of IAA. After 4 h of incubation, the mRNA (Fig. 1c) and pro-tein (Fig. 1d) induction of TF by IAA was similar with or without the addition of albumin.

To test whether transcription was the main way control-ling TF expression after IAA stimulation in endothelial

cells, we added the transcription inhibitor Actinomycin D (Fig. 1e). Actinomycin D abolished the induction of TF mRNA expression by IAA, as well as the basal expression of TF mRNA. These findings suggest that the expression of TF induced by IAA in endothelial cells is controlled at the transcriptional level.

IAA induces TF expression via AhR activation but no AhR binding on TF promoter

We confirmed the involvement of AhR in IAA-mediated TF expression using an AhR pharmacological inhibitor CH223191, and AhR siRNA. The up-regulation by IAA of TF mRNA (Fig. 2a) and protein (Fig. 2b) expression was abolished by CH223191 and by AhR siRNA. CH223191 and AhR siRNA alone had no significant effect on basal TF mRNA and protein expression (Fig. 2a, b).

AhR can regulate transcription directly by binding on gene promoter in a so called genomic pathway, or indirectly by activating other transcription factors in a non-genomic pathway. We first studied by ChIP experiments whether AhR binds directly to the TF promoter to induce TF expression in HUVEC. ChIP experiments demonstrated no enrichment of AhR on the promoter of TF, showing that AhR was not directly recruited to the TF promoter in endothelial cells following IAA stimulation (Fig. 2c). As expected, AhR was recruited to the CYP1A1 and CYP1B1 promoters, known to contain XRE sequences, after HUVEC stimulation by IAA (Fig. 2c). This confirms that IAA induces AhR recruitment to the promoters of target genes known to be up-regulated by the genomic pathway. We next analyzed the nuclear trans-location of AhR by studying AhR expression in nuclear and cytoplasmic extracts after stimulation of HUVEC by IAA in presence of the AhR inhibitor CH223191. IAA increased the nuclear level of AhR, which was strongly decreased when cells were incubated with the AhR inhibitor CH223191 (Fig. 2d). In parallel, IAA caused a decrease in the cyto-plasmic level of AhR, which was prevented by CH223191. We next examined the effect of IAA on the up-regulation of CYP1A1 and CYP1B1 in HUVEC in presence of CH223191. IAA induced a marked increase in mRNA expression of CYP1A1 and CYP1B1, which was abolished by the pres-ence of CH223191 (Fig. 2e, f).

The NF‑κB site in TF promoter is necessary for TF induction by IAA

Because AhR did not directly bind to TF promoter after HUVEC stimulation by IAA, we studied the regulation of TF transcription using a TF promoter-luciferase reporter system, containing upstream binding sites for transcrip-tion factors known to up-regulate TF: AP-1, NF-κB, Egr-1, and Sp1 (Oeth et al. 1997; Li et al. 2009). We focused

Fig. 2 IAA induces AHR activation but no binding of AhR on TF promoter. Effect of the AhR inhibitor CH-223191 (10 μM) and of AhR siRNA on Tissue Factor mRNA (a) and protein (b) expres-sion after a 4-h incubation with 50 μM IAA. TF mRNA expression was studied by comparative RT-qPCR and expressed in mRNA fold change vs. control. TF protein expression was studied by ELISA. Data represent the mean ± SEM of at least 5 independent experi-ments. *p < 0.05, **p < 0.01, ***p < 0.0001. c AhR binding to the promoters of Tissue Factor, CYP1A1, and CYP1B1 was studied by chromatin immunoprecipitation (ChIP) after 1 h of HUVEC stimu-lation by 50 µM IAA. Data, expressed in fold enrichment, represent the mean ± SEM of n = 6 independent experiments. d AhR level in nuclear and cytoplasmic extracts was studied by Western blot after 30 min stimulation of HUVEC with 50 μM IAA in presence of the AhR inhibitor CH223191 (10 μM). Pictures are representative of 3 independent experiments. mRNA expression of AhR-target genes CYP1A1 (e) and CYP1B1 (f) after 4-h incubation with IAA (50 µM) was studied by comparative RT-qPCR in presence of the AhR inhibi-tor CH-223191 (10 µM). Data, expressed in mRNA fold change vs. control, represent the mean ± SEM of 10 independent experiments. **p < 0.01, ***p < 0.001

◂


1 3

here on transcription factors involved in TF up-regulation by inflammatory stimuli: AP-1 and NF-κB (Bode and Mack-man 2014). Luciferase plasmids containing either a wild-type TF promoter (− 227 WT), or one containing a NF-κB non-binding mutant (− 227 mNF-κB), or one containing

AP-1 non-binding sites (− 227 mAP1), were transfected into HUVEC. In cells transfected with the wild-type TF construct, the luciferase activity was 70% higher in IAA-stimulated cells that in control cells (Fig. 3a). The mutation of AP-1 sites in the TF promoter construct (− 227 mAP1)


1 3

significantly decreased the luciferase activity in both con-trol and IAA-stimulated cells (Fig. 3a). However, the − 227-mAP-1 promoter activity was 53% higher in IAA-treated cells than in ethanol-treated control cells. This led us to study the nuclear level of the AP-1 subunits c-Fos and c-Jun in IAA-stimulated HUVEC. The nuclear level of both c-fos and c-jun was not higher in IAA-treated cells than in control cells (Supplemental Fig. 2).

We next studied the role of NF-κB in the effect of IAA on TF transcription in using the NF-κB non-binding mutant (− 227 mNF-κB) construct. The induction of the promoter activity by IAA was significantly lower in the mutant NF-κB construct than in the wild-type. Interestingly, the activity of the TF promoter mutated for the NF-κB site was simi-lar in IAA-treated cells and in ethanol-treated control cells (Fig. 3a). In addition, in control cells, no difference in pro-moter activity was observed between cells transfected with the − 227WT and the − 227 mNF-κB. These data indicate that the NF-κB site is crucial for IAA-mediated TF gene transcription.

Cooperative role between AhR and NF‑κB in TF induction by IAA

Because the mutation of the NF-κB site resulted in decrease in TF promoter activity, we studied the involvement of NF-κB pathway in TF induction by IAA. We incubated HUVEC with IAA for 4 h in the presence of the pharmaco-logical inhibitor of IκB kinase (IκK) BAY 11-7082. BAY 11-7082 drastically decreased the induction of TF mRNA (Fig. 3b) and protein (Fig. 3c) by IAA. This suggests that NF-κB activation is involved in TF induction by IAA. Sub-sequently, we studied the level of the NF-κB p50 subunits in nuclear extracts of HUVEC stimulated during 30 min by IAA. IAA increased the nuclear level of NF-κB p50 (Fig. 3d) and p65 (Supplemental Fig. 3). We then analyzed the effect of pharmacological inhibitors of IκK (BAY 11-7082) and

AhR (CH223191). Nuclear translocation of p50 was inhib-ited by the IκK inhibitor BAY 11-7082 (Fig. 3d). Interest-ingly, the increase in p50 nuclear level was also inhibited by the AhR inhibitor CH223191 (Fig. 3d) and by AhR siRNA (Supplemental Fig. 4), showing that IAA activated NF-κB via AhR.

Involvement of p38 MAPK in IAA‑mediated TF induction

We studied the involvement of Protein Kinase C (PKC) and of p38 and ERK1/2 MAP Kinases in TF induction by IAA. HUVEC were stimulated by IAA for 4 h in presence of the PKC inhibitor Bisindolymaleimide I, the p38 inhibitor SB203580, and the ERK1/2 inhibitor PD98059. TF mRNA induction by IAA was significantly decreased by the p38 and PKC inhibitors, but not significantly modified by the ERK1/2 inhibitor (Fig. 4a). The p38 and PKC inhibitors also decreased TF protein induction by IAA (Fig. 4b). This suggests that the p38 and the PKC pathways are involved in IAA-mediated TF up-regulation.

We finally evaluated the effect of p38 and PKC inhibi-tors on IAA-induced NF-κB activation. The increase in nuclear p50 level caused by IAA (Fig. 4c) was inhibited by SB203580 but not by Bisindolymaleimide I, suggesting that p38 but not PKC is involved in IAA-induced NF-κB nuclear translocation.

Taken together, our data showed that IAA up-regulates TF expression by an inflammatory non genomic AhR/p38 MAPK/NF-κB pathway (Fig. 5).

Circulating TF levels are independently related to IAA levels in hemodialyzed patients

We studied a cohort of 92 hemodialyzed (HD) patients (Table 1) and measured the plasma levels of circulating TF (cTF). Mean cTF values were 133 ± 66 pg/mL (median 131 pg/mL) and ranged from 36 to 410 pg/mL. At baseline, cTF levels negatively correlated with residual renal function (r = − 0.27, p < 0.01), and positively correlated with serum cholesterol (r = 0.24 p < 0.05), HDL-cholesterol (r = 0.22, p < 0.05), and with the uremic toxins β2-microglobulin (r = 0.22 p < 0.05) and IAA (r = 0.32, p < 0.01) (Table 2). In multivariate linear regression analysis in HD patients, only serum IAA [estimate = 3.36, 95% CI (0.41–6.3), p < 0.05] was significantly associated with cTF level (Table 3).

Fig. 3 NF-κB is activated by IAA and is involved in Tissue Factor up-regulation. a The identification of the IAA-sensitive transcrip-tion factor binding site in the TF promoter was studied using TF promoter-luciferase reporter system. Luciferase plasmids containing either a wild-type TF promoter (− 227 WT), or NF-κB non-binding mutant (− 227 mNF-κB) or AP-1 non-binding site (− 227 mAP1) were transfected into HUVEC. After 6 h of HUVEC stimulation by 50 µM IAA, data expressed in fold induction normalized luciferase activity. After HUVEC incubation with IAA (50 µM) in presence of the I Kappa Kinase (IκK) inhibitor BAY 11-7082 (10 µM), Tissue Factor mRNA expression (b) was studied by comparative RT-qPCR and expressed in mRNA fold change vs. control; Tissue Factor pro-tein expression (c) was studied by ELISA. Endothelial p50 expression in nuclear extracts (d) was measured after 30 min incubation with IAA 50 µM, in presence of the AhR inhibitor CH223191 (10 µM) or the IκK inhibitor BAY 11-7082 (10 µM). Data represent the mean ± SEM of 6 (a) or 4 (b–d) independent experiments, *p < 0.05, **p < 0.01

◂


1 3

Discussion

In this study, we demonstrated that TF induction by IAA is mediated by an AhR non genomic pathway involving p38MAPK and NF-κB activation.

IAA is a protein-bound uremic toxin, mostly produced from tryptophan metabolism by intestinal bacteria (Fernan-dez-Prado et al. 2017). IAA is an endogenous AhR agonist, which has similar endothelial effects to those of exogenous AhR-activating pollutants like TCDD, benzo [a] pyrene,

Fig. 4 Study of MAPK and PKC involvement in Tissue Factor up-regulation by IAA. mRNA expression (a) of Tissue Factor was studied by com-parative RT-qPCR after 4-h incubation with IAA (50 µM) in presence of the PKC inhibitor (Bisindolymaleimide I, 5 µM), the p38 MAPK inhibitor (SB203580, 10 µM), and the ERK1/2 inhibitor (PD98059, 10 µM). Data are expressed in mRNA fold change vs. control. Protein expression (b) of Tissue Factor was studied by ELISA after incubation with IAA (50 µM) in presence of the PKC inhibitor (Bisindolymaleimide I, 5 µM), and the p38 MAPK inhibitor (SB203580, 10 µM). Endothelial p50 level (c) was measured in nuclear extracts after 30 min incubation with IAA 50 µM, in presence of the PKC inhibitor (Bisindolyma-leimide I, 5 µM), and the p38 MAPK inhibitor (SB203580, 10 µM). Data represent the mean ± SEM of at least 4 inde-pendent experiments, *p < 0.05


1 3

PCB126, and PCB77 (Sallée et al. 2014). It induces the pro-duction of reactive oxygen species, up-regulates the expres-sion of inflammatory molecules COX-2, IL-8, ICAM-1, and MCP-1 (Dou et al. 2015), and increases the expression and the procoagulant activity of TF in HUVEC (Gondouin et al. 2013). Here, we show that IAA increases TF expression in endothelial cells from other vessel types: arterial (aortic) and microvascular (cardiac-derived). We also observed that human serum albumin did not modify IAA effect on tis-sue factor induction, supporting that IAA, whether free or protein-bound, induces TF up-regulation.

TF is usually not expressed by endothelial cells under normal conditions. However, it could be expressed in some pathologic conditions in vivo (Bode and Mackman 2014). In vitro induction of TF expression in endothelial cells is mediated by various intracellular signaling pathways and by the transcription factors NF-κB, AP-1, NFAT, and Egr-1, depending on the stimulus (LPS, IL-1β, TNF-α, thrombin and VEGF) (Bode and Mackman 2014). Using AhR siRNA, we previously described a new pathway of TF induction by IAA that is mediated by AhR activation (Gondouin et al. 2013). We confirm here that an AhR-specific antagonist, CH223191, is able to reduce IAA-mediated TF expression.

The induction of TF in response to stimuli is mainly regu-lated at the transcriptional level; but some stimuli may also increase the stability of TF mRNA and/or protein (Crossman et al. 1990; Brand et al. 1991; Ahern et al. 1993; Reddy et al. 2004). The regulation of TF by IAA was well studied in vascular smooth muscle cells by the group of Chitalia. They showed that IAA prolongs the half-life of TF protein by decreasing its ubiquitination (Chitalia et al. 2013). They further demonstrated in vascular smooth muscle cells that

AhR directly interacts with TF and reduces the level of TF ubiquitination (Shivanna et al. 2016) and that the ubiquitin ligase STUB1 dynamically interacts with TF (Shashar et al. 2017). In our study in endothelial cells, TF mRNA up-reg-ulation by IAA was abolished in presence of the transcrip-tion inhibitor actinomycin D, supporting that transcription is the major mechanism of TF mRNA induction by IAA in endothelial cells. However, one cannot exclude that a post-translational regulation of TF exists, like in vascular smooth muscle cells.

Fig. 5 A diagram shows the AhR-related mechanisms underlying IAA-induced TF transcription in HUVEC. TF up-regulation by IAA in HUVEC is mediated by a non-genomic AhR/p38 MAPK/NF-κB pathway. This up-regulation does not involve AhR binding to the TF promoter; AhR activates p38 MAPK, which mediates NF-KB p50 nuclear translocation and binding to the TF promoter, leading to TF transcription

Table 1 Baseline characteristics of the HD population (n = 92)

Results are given as mean ± SD if distribution is Gaussian, or in median (min; max) if not*ADPKD autosomal dominant polycystic kidney disease

Age (years) 70 (23; 91)Gender ratio (W/M) 33/59Body Mass Index (kg/m2) 24.0 (14.3; 47)Kidney disease Glomerulonephritis 20 (22%) ADPKD* 7 (7%) Vascular 30 (33%) Interstitial 11 (12%) Other hereditary 2 (2%) Unknown 22 (24%)

Hypertension 82 (91%)Residual renal function 20 (21%)Systolic blood pressure (mmHg) 144 ± 24Diastolic blood pressure (mmHg) 73 ± 15Current smokers 27 (29%)History of cardiovascular diseases 37 (40%)Antihypertensive drugs 61 (66%)Statins 30 (32%)Antiplatelet drugs 49 (53%)Anticoagulant drugs 23 (25%)Erythropoietin therapy 71 (77%)Hemoglobin (g/dL) 11.6 ± 1.1Plasma TF (pg/mL) 131 (36; 410)Serum CRP level (mg/L) 7 (0; 78)Serum albumin level (g/L) 36.3 ± 4.4Serum calcium level (mmol/L) 2.34 ± 0.14Serum phosphate level (mmol/L) 1.53 (0.54; 3.17)Serum urea level (mmol/L) 19.9 ± 5.4Serum creatinine level (µmol/L) 759 (213; 1533)Serum cholesterol level (mmol/L) 4.3 ± 1.0Serum LDL-cholesterol level (mmol/L) 2.45 ± 0.87Serum HDL-cholesterol level (mmol/L) 1.05 (0.28; 2.57)Serum triglyceride level (mmol/L) 1.3 (0.6; 3.7)Serum β2microglobulin level (mg/L) 32.2 (17.4; 66.9)Serum p-cresylsulfate level (µM) 104 (4.3; 443.6)Serum Indole-3 acetic acid level (µM) 4.3 (1.0; 19.1)Serum indoxyl sulfate level (µM) 88.6 (0.2; 256.2)


1 3

The classical genomic pathway of AhR target genes up-regulation is based on dimers of ligand-activated AhR and AhR nuclear translocator (ARNT), which directly activate gene expression. Upon ligand binding to AhR, it is trans-located into the nucleus where it associates with its heter-odimerization partner ARNT. The AHR/ARNT heterodimer binds to DNA sequence motif, referred to as XRE, within the promoters of target genes. In the XRE (5′-TNGCGTG-3′), a minimum core sequence of 5′-GCGTG-3′ is required for AHR/ARNT binding (Swanson et al. 1995) and induc-tion of target genes like xenobiotic-metabolizing enzymes CYP1A1 and CYP1B1 (Dolwick et al. 1993; Fujii-Kuriyama and Mimura 2005). Recently, a genomic, ARNT-independ-ent pathway for AhR-mediated gene expression has been reported (Jackson et al. 2015), with a novel non-consensus XRE (NC-XRE) described in the promoter of PAI-1 (Huang and Elferink 2012) and in p21Cip1 promoter (Jackson et al. 2014). The AhR-dependent gene expression mediated through the NC-XRE does not involve the ARNT as a com-ponent of the NC-XRE bound AhR complex. We report here that IAA activates the classical genomic pathway of AhR in HUVEC. IAA induces AhR nuclear translocation and AhR binding to the promoters of its target genes CYP1A1 and CYP1B1, leading to upregulation of CYP1A1 and CYP1B1 mRNA. The AhR inhibitor CH223191 reduces AhR nuclear translocation mediated by IAA and abolishes IAA-induced expression of CYP1A1 and CYP1B1. CH223191 was ini-tially described as an inhibitor of TCDD binding to AhR, which inhibits AhR nuclear translocation induced by TCDD (Kim et al. 2006). One can suppose that CH223191 also inhibits IAA binding to AhR. Importantly, we showed that AhR does not directly bind to the TF promoter, support-ing that the classical genomic pathway of AhR activation is not involved in TF up-regulation by IAA. This result agrees with the absence of description in the literature of an XRE sequence in the TF promoter, excludes the presence of a NC-XRE in the TF promoter, and suggests the activation of the non-genomic pathway of AhR by IAA.

Once activated by ligand, AhR can also elicit inflam-mation through the non-genomic pathway, which does not require the participation of ARNT (Matsumura 2009). We supposed that AhR activation could initiate alterna-tive signaling pathways without direct DNA binding of AhR on TF gene promoter. It has been shown that AhR could activate others transcription factors such as AP-1 (Di Meglio et al. 2014; Ito et al. 2016) and NF-κB (Borlak and Jenke 2008; Vogel and Matsumura 2009; Vogel et al. 2011, 2013; Øvrevik et al. 2014) to drive expression of genes, by a protein kinase-dependent non-genomic route. We previously reported that IAA induces inflammatory endothelial COX-2 expression via non-genomic pathway of AhR involving NF-κB (Dou et al. 2015). To determine the transcription factors involved in TF up-regulation by

Table 2 Two-tailed Spearman correlations of baseline characteristics with TF plasma levels in the HD cohort (n = 92)

TF

r p

Age 0.08 0.4Gender − 0.19 0.08Body Mass Index 0.00 1Kidney disease − 0.18 0.08Residual renal function − 0.27 < 0.01Systolic Blood Pressure − 0.01 0.9Diastolic Blood Pressure − 0.08 0.4Current smoking − 0.05 0.6History of cardiovascular diseases − 0.05 0.6Antihypertensive drugs − 0.08 0.5Statins − 0.18 0.4Antiplatelet drugs − 0.18 0.08Anticoagulant drugs 0.12 0.3Erythropoietin therapy − 0.11 0.3Hemoglobin 0.17 0.1Serum CRP level 0.12 0.3Serum albumin level − 0.08 0.4Serum calcium level − 0.07 0.5Serum phosphate level − 0.15 0.2Serum urea level − 0.05 0.6Serum creatinine level 0.03 0.7Serum cholesterol level 0.24 < 0.05Serum LDL-cholesterol level 0.18 0.09Serum HDL-cholesterol level 0.22 < 0.05Serum triglyceride level 0.04 0.7Serum β2microglobulin level 0.22 < 0.05Serum p-cresylsulfate level 0.07 0.5Serum Indole-3 acetic acid level 0.32 < 0.01Serum indoxyl sulfate level − 0.1 0.3

Table 3 Multivariate linear regression analysis for evaluating the relation between independent variables and TF plasma levels in HD patients (n = 92)

TF

Estimate 95% CI p value

Age 0.18 [− 0.75 to 1.12] 0.7Gender 21.66 [− 7.36 to 50.69] 0.14Residual renal function − 23.81 [− 55.45 to 7.83] 0.14Serum Indole-3 acetic acid

level3.54 [0.66 to 6.43] < 0.05

Serum β2microglobulin 1.1 [− 0.4 to 2.61] 0.15Serum cholesterol level 11.21 [− 3.13 to 25.55] 0.12Serum HDL-cholesterol level 3.35 [− 30.86 to 37.56] 0.8


1 3

IAA, we studied IAA-induced TF transcription using a classic proximate TF promoter model, with binding sites for transcription factors AP-1, NF-κB, Egr-1, and Sp1. We clearly demonstrated the role of NF-κB in IAA-mediated TF expression. We showed that the NF-κB site is essential in TF promoter activity induced by IAA. In addition, an inhibitor of IκB Kinase, which avoids the phosphoryla-tion of IκB and the subsequent NF-κB activation, strongly inhibited TF mRNA and protein induction by IAA. Then, we showed that IAA increased the nuclear level of the NF-κB p50 and p65 subunits, which are critical regulators of TF (Li et al. 2009). This does not exclude that other NF-KB subunits could be activated by IAA. Interestingly, IAA-induced p50 nuclear translocation was decreased when AhR was inhibited; supporting that nuclear translo-cation of p50 was mediated by AhR activation. All these results demonstrated the crucial role of NF-κB in AhR-mediated TF induction by IAA. We also observed that the mutation of the AP-1 site significantly decreased TF promoter activity in both control and IAA-stimulated cells, but IAA still increased TF promoter activity when the AP-1 site was mutated. Furthermore, IAA did not increase nuclear level of c-Jun and c-fos subunits of AP-1. These results suggest than the AP-1 site is required for basal TF expression and is only partially involved in TF induction by IAA. One cannot exclude that other AP-1 subunits may be involved, or that AP-1 cooperates with NF-κB to induce TF expression as described in the literature for other ago-nists (Mackman et al. 1991; Parry and Mackman 1995; Armstead et al. 1999; Xia et al. 2013, 2016).

Studies show the cross-talk of AhR and multiple signal transduction pathways, notably MAP Kinases (Henklová et al. 2008; Puga et al. 2009a); and conventional AhR acti-vators such as TCDD and benzo [a] pyrene activate MAP kinases (Henklová et al. 2008; Puga et al. 2009a). In our previous study, we demonstrated that IAA induces p38 MAPK and ERK phosphorylation (Dou et al. 2015). We found here that p38 MAPK, but not ERK, is involved in TF up-regulation by IAA. We previously showed that AhR inhibition decreases IAA-induced p38 phosphorylation (Dou et al. 2015), supporting that AhR is the upstream regula-tor of p38. Here, we observed that p38 inhibition decreased TF up-regulation by IAA. Furthermore, IAA-induced p50 nuclear translocation was decreased by inhibitors of both AhR and p38 MAPK. Therefore, in addition to the activa-tion of the classical genomic pathway, the binding of IAA to AhR initiates a cytoplasmic signaling pathway that acti-vates p38 MAPK, which then activates NF-κB to induce TF expression.

We also observed the involvement of PKC in TF up-reg-ulation by IAA, but the absence of inhibition of p50 nuclear translocation by the PKC inhibitor suggests that PKC is not

involved in the AhR/p38 cytoplasmic signaling pathway that leads to p50 nuclear translocation. PKCs are usually known for their key role in cytoplasmic signal transduction; they can also directly regulate gene expression through signal transduction within the nucleus, a process distinct from the cytoplasmic signaling pathways (Lim et al. 2015). Within the nucleus, PKCs can directly regulate gene transcription through either phosphorylating specific histone residues or phosphorylating transcription factors (Lim et al. 2015). For example, PKCα can phosphorylate NF-κB p65 at S276, which is important for transcriptional activation of NF-κB (Lim et al. 2015). Our results allow to hypothesize that PKC could play a role in IAA-induced TF transcription as an epi-genetic regulator that could be involved in histone or NF-KB phosphorylation, rather than as a cytoplasmic signal trans-ducer involved in AhR/p38 signaling pathway.

TF upregulation induced by IAA has functional conse-quences on thrombogenicity. Indeed, the increase TF pro-tein abundance induced by IAA, such as uremic serum and the indolic uremic toxin indoxyl sulfate, is associated with increased procoagulant activity in endothelial cells and vascular smooth muscle cells (Chitalia et al. 2013; Gon-douin et al. 2013), and increases thrombogenicity in an ex-vivo model (Chitalia et al. 2013). An antibody against endothelial TF prevents platelet deposition on cultured endothelial cells induced by uremic serum (Serradell et al. 2001), suggesting that the presence of endothelial TF is responsible for the enhanced platelet deposition. Patients with CKD display high levels of cTF and increased TF-dependent procoagulant activity (Gondouin et al. 2013; Shivanna et al. 2016).

cTF levels in CKD patients are related to some ure-mic toxins that are AhR agonists. Kynurenine levels are associated with cTF levels and hypercoagulability in HD patients (Pawlak et al. 2009); cTF levels are correlated with indoxyl sulfate in CKD patients not on dialysis (Gon-douin et al. 2013). We found here that cTF level positively correlated with serum cholesterol, HDL-cholesterol, and with the uremic toxins β2-microglobulin and IAA in sim-ple correlation analysis. However, we did not found a posi-tive correlation between cTF and indoxyl sulfate in HD patients, as we had previously observed in not dialyzed CKD patients (Goundouin et al. 2013). In multivariate linear regression analysis, only serum IAA was signifi-cantly and independently associated with cTF level. We previously identified IAA as an independent predictor of cardiovascular events and mortality in CKD patients (Dou et al. 2015). TF up-regulation is part of the mechanisms by which IAA may induce atherothrombosis in patients with CKD. Furthermore, cTF negatively correlated with residual renal function (in simple analysis) in HD patients in the present study, and with estimated GFR in not


1 3

dialyzed CKD patients in our previous study (Gondouin et al. 2013). This suggests that the preservation of renal function in HD patients could be advantageous to prevent the increase in cTF levels.

In CKD patients, we recently showed high level of AhR agonists and an activation of the AhR pathway in cells from CKD patients (Dou et al. 2018). AhR has been proposed as a therapeutic target to reduce TF levels, for a better manage-ment of increased thrombosis in CKD (Shivanna et al. 2016). However, targeting AhR would also result in inhibition of the AhR genomic pathway that is crucial in detoxification processes. Therefore, it would be interesting to specifically target the thrombotic/inflammatory non genomic pathway of AhR activation, while preserving the AhR genomic pathway. Thus, understanding of signal transduction pathways related to AhR thrombotic/inflammatory non genomic pathway is of interest to find therapeutic targets.

In conclusion, we demonstrated that IAA induces TF expression via an AhR/ p38 MAPK/ NF-κB inflamma-tory pathway. A better understanding of the mechanisms involved in TF induction by uremia/uremic toxins could provide new therapeutic targets to reduce the thrombotic risk in patients with CKD.

Acknowledgements This work was supported by funding from the Aix-Marseille University, the Institut National de la santé et de la Recherche médicale (INSERM), the European Uremic Toxins (EUTox) Work Group, the University of Oran 1 Ahmed Benbella, and the Alge-rian Ministry of Higher Education and Scientific Research. We thank K. Fallague and C. Scagliarini for technical assistance.

Compliance with ethical standards

Conflict of interest The authors declare that they have no conflict of interest.

Ethical approval All procedures performed in studies involving human participants were in accordance with the ethical standards of the insti-tutional and/or national research committee and with the 1964 Helsinki declaration and its later amendments or comparable ethical standards.

References

Ahern SM, Miyata T, Sadler JE (1993) Regulation of human tissue fac-tor expression by mRNA turnover. J Biol Chem 268:2154–2159

Armstead VE, Opentanova IL, Minchenko AG, Lefer AM (1999) Tis-sue factor expression in vital organs during murine traumatic shock: role of transcription factors AP-1 and NF-kappaB. Anes-thesiology 91:1844–1852. https ://doi.org/10.1097/00000 542-19991 2000-00039

Barreto FC, Barreto DV, Liabeuf S, Meert N, Glorieux G, Temmar M, Choukroun G, Vanholder R, Massy ZA, Group (EUTox) on behalf of the EUTW (2009) Serum indoxyl sulfate is associated with vascular disease and mortality in chronic kidney disease patients. CJASN 4:1551–1558. https ://doi.org/10.2215/CJN.03980 609

Bode M, Mackman N (2014) Regulation of tissue factor gene expres-sion in monocytes and endothelial cells: thromboxane A2 as a new player. Vascul Pharmacol 62:57–62. https ://doi.org/10.1016/j.vph.2014.05.005

Borlak J, Jenke HS (2008) Cross-talk between aryl hydrocarbon recep-tor and mitogen-activated protein kinase signaling pathway in liver cancer through c-raf transcriptional regulation. Mol Cancer Res 6:1326–1336. https ://doi.org/10.1158/1541-7786.MCR-08-0042

Brand K, Fowler BJ, Edgington TS, Mackman N (1991) Tissue factor mRNA in THP-1 monocytic cells is regulated at both transcrip-tional and posttranscriptional levels in response to lipopolysac-charide. Mol Cell Biol 11:4732–4738

Calaf R, Cerini C, Génovésio C, Verhaeghe P, Jourde-Chiche N, Bergé-Lefranc D, Gondouin B, Dou L, Morange S, Argilés A, Rathelot P, Dignat-George F, Brunet P, Charpiot P (2011) Deter-mination of uremic solutes in biological fluids of chronic kidney disease patients by HPLC assay. J Chromatogr B Anal Technol Biomed Life Sci 879:2281–2286. https ://doi.org/10.1016/j.jchro mb.2011.06.014

Camerer E, Kolstø AB, Prydz H (1996) Cell biology of tissue fac-tor, the principal initiator of blood coagulation. Thromb Res 81:1–41

Carney EF (2016) Thrombosis: new mechanism of thrombus forma-tion in CKD. Nat Rev Nephrol 12:715. https ://doi.org/10.1038/nrnep h.2016.155

Chitalia VC, Shivanna S, Martorell J, Balcells M, Bosch I, Kolan-daivelu K, Edelman ER (2013) Uremic serum and solutes increase post-vascular interventional thrombotic risk through altered stabil-ity of smooth muscle cell tissue factor. Circulation 127:365–376. https ://doi.org/10.1161/CIRCU LATIO NAHA.112.11817 4

Crossman DC, Carr DP, Tuddenham EG, Pearson JD, McVey JH (1990) The regulation of tissue factor mRNA in human endothe-lial cells in response to endotoxin or phorbol ester. J Biol Chem 265:9782–9787

Daneschvar HL, Seddighzadeh A, Piazza G, Goldhaber SZ (2008) Deep vein thrombosis in patients with chronic kidney disease. Thromb Haemost 99:1035–1039. https ://doi.org/10.1160/TH08-02-0107

Di Meglio P, Duarte JH, Ahlfors H, Owens NDL, Li Y, Villanova F, Tosi I, Hirota K, Nestle FO, Mrowietz U, Gilchrist MJ, Stockinger B (2014) Activation of the aryl hydrocarbon receptor dampens the severity of inflammatory skin conditions. Immunity 40:989–1001. https ://doi.org/10.1016/j.immun i.2014.04.019

Dolwick KM, Swanson HI, Bradfield CA (1993) In vitro analysis of Ah receptor domains involved in ligand-activated DNA recognition. Proc Natl Acad Sci USA 90:8566–8570

Dou L, Sallée M, Cerini C, Poitevin S, Gondouin B, Jourde-Chiche N, Fallague K, Brunet P, Calaf R, Dussol B, Mallet B, Dignat-George F, Burtey S (2015) The cardiovascular effect of the uremic solute indole-3 acetic acid. J Am Soc Nephrol 26:876–887. https ://doi.org/10.1681/ASN.20131 21283

Dou L, Poitevin S, Sallée M, Addi T, Gondouin B, McKay N, Deni-son MS, Jourde-Chiche N, Duval-Sabatier A, Cerini C, Brunet P, Dignat-George F, Burtey S (2018) Aryl hydrocarbon receptor is activated in patients and mice with chronic kidney disease. Kidney Int 93:986–999. https ://doi.org/10.1016/j.kint.2017.11.010

Fernandez-Prado R, Esteras R, Perez-Gomez MV, Gracia-Iguacel C, Gonzalez-Parra E, Sanz AB, Ortiz A, Sanchez-Niño MD (2017) Nutrients turned into toxins: microbiota modulation of nutri-ent properties in chronic kidney disease. Nutrients. https ://doi.org/10.3390/nu905 0489

Fujii-Kuriyama Y, Mimura J (2005) Molecular mechanisms of AhR functions in the regulation of cytochrome P450 genes. Biochem Biophys Res Commun 338:311–317. https ://doi.org/10.1016/j.bbrc.2005.08.162

https://doi.org/10.1097/00000542-199912000-00039

https://doi.org/10.1097/00000542-199912000-00039

https://doi.org/10.2215/CJN.03980609

https://doi.org/10.1016/j.vph.2014.05.005

https://doi.org/10.1016/j.vph.2014.05.005

https://doi.org/10.1158/1541-7786.MCR-08-0042

https://doi.org/10.1016/j.jchromb.2011.06.014

https://doi.org/10.1016/j.jchromb.2011.06.014

https://doi.org/10.1038/nrneph.2016.155

https://doi.org/10.1038/nrneph.2016.155

https://doi.org/10.1161/CIRCULATIONAHA.112.118174

https://doi.org/10.1160/TH08-02-0107

https://doi.org/10.1160/TH08-02-0107

https://doi.org/10.1016/j.immuni.2014.04.019

https://doi.org/10.1681/ASN.2013121283

https://doi.org/10.1681/ASN.2013121283

https://doi.org/10.1016/j.kint.2017.11.010

https://doi.org/10.3390/nu9050489

https://doi.org/10.3390/nu9050489

https://doi.org/10.1016/j.bbrc.2005.08.162

https://doi.org/10.1016/j.bbrc.2005.08.162


1 3

Go AS, Chertow GM, Fan D, McCulloch CE, Hsu C (2004) Chronic kidney disease and the risks of death, cardiovascular events, and hospitalization. N Engl J Med 351:1296–1305. https ://doi.org/10.1056/NEJMo a0410 31

Gondouin B, Cerini C, Dou L, Sallée M, Duval-Sabatier A, Pletinck A, Calaf R, Lacroix R, Jourde-Chiche N, Poitevin S, Arnaud L, Van-holder R, Brunet P, Dignat-George F, Burtey S (2013) Indolic ure-mic solutes increase tissue factor production in endothelial cells by the aryl hydrocarbon receptor pathway. Kidney Int 84:733–744. https ://doi.org/10.1038/ki.2013.133

Han H, Zhu J, Zhu Z, Ni J, Du R, Dai Y, Chen Y, Wu Z, Lu L, Zhang R (2015) p-Cresyl sulfate aggravates cardiac dysfunction associated with chronic kidney disease by enhancing apoptosis of cardio-myocytes. J Am Heart Assoc 4:e001852. https ://doi.org/10.1161/JAHA.115.00185 2

Hankinson O (1995) The Aryl Hydrocarbon Receptor Complex. Annu Rev Pharmacol Toxicol 35:307–340. https ://doi.org/10.1146/annur ev.pa.35.04019 5.00151 5

Heath-Pagliuso S, Rogers WJ, Tullis K, Seidel SD, Cenijn PH, Brouwer A, Denison MS (1998) Activation of the Ah receptor by trypto-phan and tryptophan metabolites. Biochemistry 37:11508–11515. https ://doi.org/10.1021/bi980 087p

Heid SE, Pollenz RS, Swanson HI (2000) Role of heat shock protein 90 dissociation in mediating agonist-induced activation of the aryl hydrocarbon receptor. Mol Pharmacol 57:82–92

Henklová P, Vrzal R, Ulrichová J, Dvorák Z (2008) Role of mitogen-activated protein kinases in aryl hydrocarbon receptor signal-ing. Chem Biol Interact 172:93–104. https ://doi.org/10.1016/j.cbi.2007.12.005

Huang G, Elferink CJ (2012) A novel nonconsensus xenobiotic response element capable of mediating aryl hydrocarbon receptor-dependent gene expression. Mol Pharmacol 81:338–347. https ://doi.org/10.1124/mol.111.07595 2

Huang M-J, Wei R-B, Wang Y, Su T-Y, Di P, Li Q-P, Yang X, Li P, Chen X-M (2017) Blood coagulation system in patients with chronic kidney disease: a prospective observational study. BMJ Open 7:e014294. https ://doi.org/10.1136/bmjop en-2016-01429 4

Ito S, Osaka M, Edamatsu T, Itoh Y, Yoshida M (2016) Crucial role of the aryl hydrocarbon receptor (AhR) in indoxyl sulfate-induced vascular inflammation. J Atheroscler Thromb 23:960–975. https ://doi.org/10.5551/jat.34462

Jackson DP, Li H, Mitchell KA, Joshi AD, Elferink CJ (2014) Ah receptor-mediated suppression of liver regeneration through NC-XRE-driven p21Cip1 expression. Mol Pharmacol 85:533–541. https ://doi.org/10.1124/mol.113.08973 0

Jackson DP, Joshi AD, Elferink CJ (2015) Ah receptor pathway intrica-cies; signaling through diverse protein partners and DNA-motifs. Toxicol Res (Camb) 4:1143–1158

Jaffe EA, Nachman RL, Becker CG, Minick CR (1973) Culture of human endothelial cells derived from umbilical veins. Identifi-cation by morphologic and immunologic criteria. J Clin Invest 52:2745–2756. https ://doi.org/10.1172/JCI10 7470

Jalal DI, Chonchol M, Targher G (2010) Disorders of hemostasis associated with chronic kidney disease. Semin Thromb Hemost 36:34–40. https ://doi.org/10.1055/s-0030-12487 22

Jourde-Chiche N, Dou L, Cerini C, Dignat-George F, Vanholder R, Brunet P (2009) Protein-bound toxins–update 2009. Semin Dial 22:334–339. https ://doi.org/10.1111/j.1525-139X.2009.00576 .x

Kim S-H, Henry EC, Kim D-K, Kim Y-H, Shin KJ, Han MS, Lee TG, Kang J-K, Gasiewicz TA, Ryu SH, Suh P-G (2006) Novel compound 2-methyl-2H-pyrazole-3-carboxylic acid (2-methyl-4-o-tolylazo-phenyl)-amide (CH-223191) prevents 2,3,7,8-TCDD-induced toxicity by antagonizing the aryl hydrocarbon recep-tor. Mol Pharmacol 69:1871–1878. https ://doi.org/10.1124/mol.105.02183 2

Kim MJ, Pelloux V, Guyot E, Tordjman J, Bui L-C, Chevallier A, Forest C, Benelli C, Clément K, Barouki R (2012) Inflammatory pathway genes belong to major targets of persistent organic pol-lutants in adipose cells. Environ Health Perspect 120:508–514. https ://doi.org/10.1289/ehp.11042 82

Li Y-D, Ye B-Q, Zheng S-X, Wang J-T, Wang J-G, Chen M, Liu J-G, Pei X-H, Wang L-J, Lin Z-X, Gupta K, Mackman N, Slungaard A, Key NS, Geng J-G (2009) NF-kappaB transcription factor p50 critically regulates tissue factor in deep vein thrombosis. J Biol Chem 284:4473–4483. https ://doi.org/10.1074/jbc.M8060 10200

Lim PS, Sutton CR, Rao S (2015) Protein kinase C in the immune system: from signalling to chromatin regulation. Immunology 146:508–522. https ://doi.org/10.1111/imm.12510

Ma C, Marlowe JL, Puga A (2009) The aryl hydrocarbon receptor at the crossroads of multiple signaling pathways. In: Molecular, clini-cal and environmental toxicology. Birkhäuser, Basel, pp 231–257

Mackman N, Brand K, Edgington TS (1991) Lipopolysaccharide-medi-ated transcriptional activation of the human tissue factor gene in THP-1 monocytic cells requires both activator protein 1 and nuclear factor kappa B binding sites. J Exp Med 174:1517–1526

Mandal PK (2005) Dioxin: a review of its environmental effects and its aryl hydrocarbon receptor biology. J Comp Physiol B 175:221–230. https ://doi.org/10.1007/s0036 0-005-0483-3

Matsumura F (2009) The significance of the nongenomic pathway in mediating inflammatory signaling of the dioxin-activated Ah receptor to cause toxic effects. Biochem Pharmacol 77:608–626. https ://doi.org/10.1016/j.bcp.2008.10.013

Moradi H, Sica DA, Kalantar-Zadeh K (2013) Cardiovascular burden associated with uremic toxins in patients with chronic kidney dis-ease. Am J Nephrol 38:136–148. https ://doi.org/10.1159/00035 1758

Neirynck N, Glorieux G, Schepers E, Pletinck A, Dhondt A, Vanholder R (2013) Review of protein-bound toxins, possibility for blood purification therapy. Blood Purif 35(Suppl 1):45–50. https ://doi.org/10.1159/00034 6223

Oeth P, Parry GC, Mackman N (1997) Regulation of the tissue factor gene in human monocytic cells. Role of AP-1, NF-kappa B/Rel, and Sp1 proteins in uninduced and lipopolysaccharide-induced expression. Arterioscler Thromb Vasc Biol 17:365–374

Øvrevik J, Låg M, Lecureur V, Gilot D, Lagadic-Gossmann D, Refsnes M, Schwarze PE, Skuland T, Becher R, Holme JA (2014) AhR and Arnt differentially regulate NF-κB signaling and chemokine responses in human bronchial epithelial cells. Cell Commun Sig-nal 12:48. https ://doi.org/10.1186/s1296 4-014-0048-8

Parry GC, Mackman N (1995) Transcriptional regulation of tissue fac-tor expression in human endothelial cells. Arterioscler Thromb Vasc Biol 15:612–621

Pawlak K, Mysliwiec M, Pawlak D (2009) Hypercoagulability is inde-pendently associated with kynurenine pathway activation in dia-lysed uraemic patients. Thromb Haemost 102:49–55. https ://doi.org/10.1160/TH08-10-0696

Petrulis JR, Perdew GH (2002) The role of chaperone proteins in the aryl hydrocarbon receptor core complex. Chem Biol Interact 141:25–40

Puga A, Ma C, Marlowe JL (2009a) The aryl hydrocarbon receptor cross-talks with multiple signal transduction pathways. Biochem Pharmacol 77:713–722. https ://doi.org/10.1016/j.bcp.2008.08.031

Puga A, Ma C, Marlowe JL (2009b) The aryl hydrocarbon receptor cross-talks with multiple signal transduction pathways. Biochem Pharmacol 77:713. https ://doi.org/10.1016/j.bcp.2008.08.031

Reddy KV, Bhattacharjee G, Schabbauer G, Hollis A, Kempf K, Ten-cati M, O’Connell M, Guha M, Mackman N (2004) Dexametha-sone enhances LPS induction of tissue factor expression in human monocytic cells by increasing tissue factor mRNA stability. J Leu-koc Biol 76:145–151. https ://doi.org/10.1189/jlb.02040 68

https://doi.org/10.1056/NEJMoa041031

https://doi.org/10.1056/NEJMoa041031

https://doi.org/10.1038/ki.2013.133

https://doi.org/10.1161/JAHA.115.001852

https://doi.org/10.1161/JAHA.115.001852

https://doi.org/10.1146/annurev.pa.35.040195.001515

https://doi.org/10.1146/annurev.pa.35.040195.001515

https://doi.org/10.1021/bi980087p

https://doi.org/10.1016/j.cbi.2007.12.005

https://doi.org/10.1016/j.cbi.2007.12.005

https://doi.org/10.1124/mol.111.075952

https://doi.org/10.1124/mol.111.075952

https://doi.org/10.1136/bmjopen-2016-014294

https://doi.org/10.5551/jat.34462

https://doi.org/10.5551/jat.34462

https://doi.org/10.1124/mol.113.089730

https://doi.org/10.1172/JCI107470

https://doi.org/10.1055/s-0030-1248722

https://doi.org/10.1111/j.1525-139X.2009.00576.x

https://doi.org/10.1124/mol.105.021832

https://doi.org/10.1124/mol.105.021832

https://doi.org/10.1289/ehp.1104282

https://doi.org/10.1074/jbc.M806010200

https://doi.org/10.1111/imm.12510

https://doi.org/10.1007/s00360-005-0483-3

https://doi.org/10.1016/j.bcp.2008.10.013

https://doi.org/10.1159/000351758

https://doi.org/10.1159/000351758

https://doi.org/10.1159/000346223

https://doi.org/10.1159/000346223

https://doi.org/10.1186/s12964-014-0048-8

https://doi.org/10.1160/TH08-10-0696

https://doi.org/10.1160/TH08-10-0696



https://doi.org/10.1189/jlb.0204068


1 3

Sallée M, Dou L, Cerini C, Poitevin S, Brunet P, Burtey S (2014) The aryl hydrocarbon receptor-activating effect of uremic toxins from tryptophan metabolism: a new concept to understand cardiovas-cular complications of chronic kidney disease. Toxins 6:934–949. https ://doi.org/10.3390/toxin s6030 934

Sciullo EM, Vogel CF, Li W, Matsumura F (2008) Initial and extended inflammatory messages of the nongenomic signaling pathway of the TCDD-activated Ah receptor in U937 macrophages. Arch Biochem Biophys 480:143–155. https ://doi.org/10.1016/j.abb.2008.09.017

Serradell M, Díaz-Ricart M, Cases A, Zurbano MJ, Aznar-Salatti J, López-Pedret J, Ordinas A, Escolar G (2001) Uremic medium disturbs the hemostatic balance of cultured human endothelial cells. Thromb Haemost 86:1099–1105

Shashar M, Belghasem ME, Matsuura S, Walker J, Richards S, Alousi F, Rijal K, Kolachalama VB, Balcells M, Odagi M, Nagasawa K, Henderson JM, Gautam A, Rushmore R, Francis J, Kirchhofer D, Kolandaivelu K, Sherr DH, Edelman ER, Ravid K, Chitalia VC (2017) Targeting STUB1-tissue factor axis normalizes hyper-thrombotic uremic phenotype without increasing bleeding risk. Sci Transl Med. https ://doi.org/10.1126/scitr anslm ed.aam84 75

Shivanna S, Kolandaivelu K, Shashar M, Belghasim M, Al-Rabadi L, Balcells M, Zhang A, Weinberg J, Francis J, Pollastri MP, Edel-man ER, Sherr DH, Chitalia VC (2016) The aryl hydrocarbon receptor is a critical regulator of tissue factor stability and an antithrombotic target in Uremia. J Am Soc Nephrol 27:189–201. https ://doi.org/10.1681/ASN.20141 21241

Storino G, Moraes C, Saldanha J, Mafra D (2015) Cardiovascular mortality in chronic kidney patients: the role of uremic toxins. Int J Cardiovasc Sci 28:327–334. https ://doi.org/10.5935/2359-4802.20150 047

Swanson HI, Chan WK, Bradfield CA (1995) DNA binding specifici-ties and pairing rules of the Ah receptor, ARNT, and SIM pro-teins. J Biol Chem 270:26292–26302

Tonelli M, Wiebe N, Culleton B, House A, Rabbat C, Fok M, McAlis-ter F, Garg AX (2006) Chronic kidney disease and mortality risk:

a systematic review. JASN 17:2034–2047. https ://doi.org/10.1681/ASN.20051 01085

Vanholder R, De Smet R, Glorieux G, Argilés A, Baurmeister U, Bru-net P, Clark W, Cohen G, De Deyn PP, Deppisch R, Descamps-Latscha B, Henle T, Jörres A, Lemke HD, Massy ZA, Passlick-Deetjen J, Rodriguez M, Stegmayr B, Stenvinkel P, Tetta C, Wanner C, Zidek W, European Uremic Toxin Work Group (EUTox) (2003) Review on uremic toxins: classification, concen-tration, and interindividual variability. Kidney Int 63:1934–1943. https ://doi.org/10.1046/j.1523-1755.2003.00924 .x

Vogel CFA, Matsumura F (2009) A new cross-talk between the Aryl hydrocarbon receptor and RelB, a member of the NF-κB fam-ily. Biochem Pharmacol 77:734–745. https ://doi.org/10.1016/j.bcp.2008.09.036

Vogel CFA, Li W, Wu D, Miller JK, Sweeney C, Lazennec G, Fujisawa Y, Matsumura F (2011) Interaction of Aryl hydrocarbon recep-tor and NF-κB subunit RelB in breast cancer is associated with Interleukin-8 overexpression. Arch Biochem Biophys 512:78–86. https ://doi.org/10.1016/j.abb.2011.05.011

Wattanakit K, Cushman M (2009) Chronic kidney disease and venous thromboembolism: epidemiology and mechanisms. Curr Opin Pulm Med 15:408–412. https ://doi.org/10.1097/MCP.0b013 e3283 2ee37 1

Xia L, Zhou H, Hu L, Xie H, Wang T, Xu Y, Liu J, Zhang X, Yan J (2013) Both NF-κB and c-Jun/AP-1 involved in anti-β2GPI/β2GPI-induced tissue factor expression in monocytes. Thromb Haemost 109:643–651. https ://doi.org/10.1160/TH12-09-0655

Xia L, Xie H, Yu Y, Zhou H, Wang T, Yan J (2016) The effects of NF-κB and c-Jun/AP-1 on the expression of prothrombotic and proinflammatory molecules induced by anti-β2GPI in mouse. PLoS One 11:e0147958. https ://doi.org/10.1371/journ al.pone.01479 58

Zhao D, Pritts EA, Chao VA, Savouret J-F, Taylor RN (2002) Dioxin stimulates RANTES expression in an in-vitro model of endome-triosis. Mol Hum Reprod 8:849–854

https://doi.org/10.3390/toxins6030934

https://doi.org/10.1016/j.abb.2008.09.017


https://doi.org/10.1126/scitranslmed.aam8475

https://doi.org/10.1681/ASN.2014121241

https://doi.org/10.5935/2359-4802.20150047

https://doi.org/10.5935/2359-4802.20150047

https://doi.org/10.1681/ASN.2005101085

https://doi.org/10.1681/ASN.2005101085

https://doi.org/10.1046/j.1523-1755.2003.00924.x




https://doi.org/10.1097/MCP.0b013e32832ee371

https://doi.org/10.1097/MCP.0b013e32832ee371

https://doi.org/10.1160/TH12-09-0655

https://doi.org/10.1371/journal.pone.0147958

https://doi.org/10.1371/journal.pone.0147958

toxins

Review

Tryptophan-Derived Uremic Toxins and Thrombosisin Chronic Kidney Disease

Tawfik Addi 1,2, Laetitia Dou 1 and Stéphane Burtey 1,3,*1 Aix Marseille University, INSERM, INRA, C2VN, 13005 Marseille, France; [email protected] (T.A.);

[email protected] (L.D.)2 LPNSA, Département de Biologie, Université d’Oran 1 Ahmed Benbella, 31000 Oran, Algérie3 Centre de Néphrologie et Transplantation Rénale, AP-HM, 13005 Marseille, France* Correspondence: [email protected]; Tel.: +33-491-835-531

Received: 20 September 2018; Accepted: 10 October 2018; Published: 12 October 2018��

Abstract: Patients with chronic kidney disease (CKD) display an elevated risk of thrombosis.Thrombosis occurs in cardiovascular events, such as venous thromboembolism, stroke, and acutecoronary syndrome, and is a cause of hemodialysis vascular access dysfunction. CKD leads to theaccumulation of uremic toxins, which exerts toxic effects on blood and the vessel wall. Some uremictoxins result from tryptophan metabolization in the gut through the indolic and the kynureninepathways. An increasing number of studies are highlighting the link between such uremic toxinsand thrombosis in CKD. In this review, we describe the thrombotic mechanisms induced bytryptophan-derived uremic toxins (TDUT). These mechanisms include an increase in plasma levelsof procoagulant factors, induction of platelet hyperactivity, induction of endothelial dysfunction/impairment of endothelial healing, decrease in nitric oxide (NO) bioavailability, and production ofprocoagulant microparticles. We focus on one important prothrombotic mechanism: The inductionof tissue factor (TF), the initiator of the extrinsic pathway of the blood coagulation. This inductionoccurs via a new pathway, dependent on the transcription factor Aryl hydrocarbon receptor (AhR),the receptor of TDUT in cells. A better understanding of the prothrombotic mechanisms of uremictoxins could help to find novel therapeutic targets to prevent thrombosis in CKD.

Keywords: uremic toxins; thrombosis; chronic kidney disease; tryptophan

Key Contribution: This review summarizes the thrombotic effects of tryptophan-derived uremictoxins, and provides an insight into the mechanisms involved.

1. Introduction

Chronic kidney disease (CKD) is defined as the occurrence of abnormalities of kidney structureor function, present for >3 months [1]. A decreased glomerular filtration rate (GFR) to less than60 mL/min per 1.73 m2 is the commonest manifestation of CKD [2]. The decline of GFR is related to asubstantial risk of mortality and cardiovascular disease (CVD) [3–6]. CVDs such as congestive heartfailure, coronary artery disease, cerebrovascular disease, peripheral arterial diseases, atrial fibrillation,and sudden cardiac death represent cardiovascular pathologies that occur in patients with CKD [5,6].

Thrombosis is in the heart of the three major cardiovascular events: Ischemic stroke, ischemicheart disease, and venous thromboembolism [7]. CKD patients display an increased thromboticrisk, paradoxically associated with a bleeding tendency [8,9]. In CKD, thrombotic events occurin the cerebral, coronary, and retinal arteries, in the deep venous system, heart, and at sites ofvascular access in hemodialysis patients [10]. Thrombus formation in arteries is often associatedwith atherosclerosis [8]. The risk of pulmonary embolism and deep vein thrombosis is significantly

Toxins 2018, 10, 412; doi:10.3390/toxins10100412 www.mdpi.com/journal/toxins

http://www.mdpi.com/journal/toxins

http://www.mdpi.com

https://orcid.org/0000-0003-1813-7884

http://www.mdpi.com/2072-6651/10/10/412?type=check_update&version=1

http://dx.doi.org/10.3390/toxins10100412

http://www.mdpi.com/journal/toxins

Toxins 2018, 10, 412 2 of 11

increased in CKD patients [11]. Moderate decrease in kidney function (30 < eGFR < 60 mL/min per1.73 m2) and severe decrease in kidney function (eGFR < 30 mL/min per 1.73 m2) are respectivelyassociated with a 2.5-fold and a 5.5-fold increase in venous thrombosis risk [12]. CKD patients displaya higher mortality rate than patients with normal kidney function due to pulmonary embolism [8].In CKD patients, the atrial fibrillation risk is higher and associated with an increased neurovascularrisk [13]. In hemodialysis patients, thrombosis can complicate stenosis, leading to access failure [14].

2. Uremic Toxins from Tryptophan Metabolism

CKD leads to the accumulation of uremic toxins [15]. This accumulation exerts a deleterious effecton multiple organs/systems [15]. In 2003, the European Uremic Toxin Work Group (EUTOX) classified90 uremic compounds. The number of compounds has been extended since [15]. The classificationof uremic toxins includes three groups: Small water-soluble molecules (≤500 Da); middle molecules(>500 Da); and protein-bound molecules [15].

Some uremic toxins result from tryptophan metabolism through the indolic and the kynureninepathways [16]. Dietary tryptophan is metabolized by the gut microbiota via three major pathways,leading to serotonin, kynurenines, and indole derivatives [16]. The kynurenine pathway thatmetabolizes 95% of tryptophan is mediated by enzymes tryptophan 2,3-dioxygenase (TDO) andindoleamine 2,3-dioxygenase (IDO). The activity of IDO leads to kynurenine from tryptophan andis reflected by the kynurenine/tryptophan ratio (KTR). Then, various metabolites can derive fromkynurenine (KYN): 3-hydroxyanthranilic acid (3-HAA), 3-hydroxykynurenine (3-HKYN), kynurenicacid (KYNA), anthranilic acid (AA), and quinolinic acid (QA) [16]. The concentration of all kynureninemetabolites is increased in CKD patients, while tryptophan decreases. The indolic pathway leadsto the indolic uremic toxins indoxyl sulfate (IS), indoxyl-β-D-glucuronide, and indole-3-acetic acid(IAA) [16]. In this pathway, tryptophan is converted to indole by the gut microbiota and absorbedinto the blood circulation, then oxidized and sulfated in the liver by the microsomal p450 cytochromeCYP2E1 enzyme and sulfatase (SULT1A1) to form IS [17]. IAA is directly produced in the gut fromtryptophan metabolism, or endogenously in tissue via tryptamine [16]. Because they are protein-bound,IS and IAA are badly cleared by dialysis [18].

3. Tryptophan-Derived Uremic Toxins and Thrombotic Events

An increasing number of studies are highlighting the link between tryptophan metabolites andthrombotic events in CKD. Studies support a role of tryptophan-derived uremic toxins (TDUT) andvascular access thrombosis in hemodialysis patients. Using multivariate Cox regression analysis in306 patients undergoing endovascular interventions for dialysis access dysfunction, Wu et al. reportedthe amount of free IS predicts vascular access thrombosis, suggesting serum IS is a new risk factor forpost-angioplasty thrombosis [19]. In 473 patients with advanced CKD, Chitalia et al. also demonstratedthat patients with subsequent arteriovenous fistula (AVF) thrombosis had higher levels of IS, KYN,and KYNA than those without thrombosis [20]. Studies also showed the association of TDUT withcardiovascular events in CKD patients. KYN, 3-HKYN, KYNA, and KTR plasma concentrationsare associated with increased risk of myocardial infarction [21–23]. In a cohort of CKD patients,Barreto et al. have shown IS predicts cardiovascular mortality [24]. In 120 patients with CKD, wedemonstrated serum IAA predicts cardiovascular events and mortality, even after adjustment for CKDstage [25].

TDUT have an impact on thrombus formation. In Wistar rats, Karbowska et al. demonstratedthat IS increases the weight of thrombus after vascular injury [26]. In mice exposed to high doses of IS,greater thrombus formation was observed after laser-induced endothelial injury, compared to non-ISexposed mice [26]. Another study showed that KYN enhances thrombosis after vascular injury inmice [20]. Chitalia’s group demonstrated that treatment of vascular smooth muscle cells (vSMC) by ISor IAA increases their thrombogenicity [27]. An important clot formation was observed in primary

Toxins 2018, 10, 412 3 of 11

human vSMC pretreated with IS or IAA when exposed to coronary-like blood flow in an ex-vivo flowloop model [28].

4. Thrombotic Mechanisms Induced by Tryptophan-Derived Uremic Toxins

After an endothelial lesion or a blood vessel injury, subendothelial components are exposed to theblood and activate the process of hemostasis to initiate a blood clot formation [29]. The platelet plugformation involves platelet activation, adhesion to exposed subendothelial matrix components, andplatelet aggregation [29]. Several platelet receptors and adhesive proteins, like the von Willebrandfactor (vWF), fibrinogen, or collagen, as well as platelet-derived agonists, are involved in theinteractions that normally occur only in the case of a vessel injury [29]. At the site of injury, the tissuefactor (TF) from the vessel wall initiates the extrinsic pathway of the coagulation cascade. The complexTF/factor VIIa leads to the generation of factor Xa, which proteolytically cleaves prothrombin to formthrombin. Thrombin then mediates fibrin generation and platelet activation [29]. The coagulationcascade is also down-regulated by different factors, such as serine protease inhibitors antithrombinand tissue factor pathway inhibitor (TFPI) [29]. The deposition of insoluble fibrin and its incorporationinto and around the platelet plug strengthen and stabilize the blood clot [29]. The fibrinolysis pathway,which breaks down the fibrin clot, also plays a substantial role in hemostasis [29]. In this pathway,tissue plasminogen activator (t-PA) released by the injured endothelium, and urokinase (uPA) in thepresence of its receptor (uPAR) convert plasminogen to plasmin, which cleaves and destroys fibrin.Within the clot, t-PA activates plasminogen, which decomposes the fibrin mesh. t-PA and urokinaseare inhibited by plasminogen activator inhibitor-1 and -2 (PAI-1 and PAI-2) [29].

A controlled balance between procoagulant and anticoagulant systems is essential, and adysregulation can lead to pathological bleeding, or pathological thrombus formation, that is,thrombosis [29]. CKD, as well as TDUT, induce a profound deregulation of the mechanisms ofhemostasis that affects all the players involved.

4.1. Deregulation of Plasma Coagulation Factors

Several abnormalities in plasma factors of hemostasis are reported in CKD patients.These abnormalities are in favor of a hypercoagulable state, with enhanced levels of vWF, fibrinogen,thrombin, factor VII, TF, and PAI-1 [10,30], as well as reduced antithrombin activity [30]. In patientswith CKD, we found that the concentration of circulating TF positively correlates with plasma levelsof IS and IAA [31]. IS level also correlates with TF procoagulant activity [32] and with vWF in CKDpatients [33]. Kynurenine is positively associated with vWF [34] and with prothrombin fragmentsF(1+2), reflecting hypercoagulability in CKD patients [35]. AA is also significantly associated withTF and prothrombin fragments F(1+2) [35], and negatively correlated with the fibrinolytic systemuPA/uPAR in severe-to-end-stage CKD [36]. QA is positively associated with vWF [34], TF, andprothrombin fragments F(1+2) [35]. 3-hydroxykynurenine is positively associated with vWF [34] andwith the TF/TFPI system [37] in CKD patients.

4.2. Platelet Hyperactivity

CKD is associated with both platelet dysfunction and activation [38,39]. Platelet activity isincreased in CKD mice that display increased IS levels [40]. Ex vivo and in vitro, IS increases plateletactivity, including an enhanced response to collagen and thrombin, increase in platelet microparticleproduction, and increase in platelet–monocyte aggregates [40]. In addition, IS-mediated plateletactivation takes part in thrombus formation ex vivo and in vivo [40]. Reactive oxygen species(ROS)-induced p38MAPK signaling in platelets plays a crucial role in IS-induced platelet activation [40].The inhibition of the ROS/p38 activation pathway by the ROS scavenger N-acetylcysteine (NAC)suppresses IS-induced platelet hyperactivation and platelet–monocyte aggregates, and strikinglyattenuates IS-induced thrombus formation [40].

Toxins 2018, 10, 412 4 of 11

4.3. Endothelial Dysfunction

The vascular endothelium is essential for maintaining hemostasis and preventing thrombosis [41].Healthy endothelial cells maintain an anticoagulant surface by expressing molecules that preventplatelet aggregation and fibrin formation [41]. When dysfunctional or activated, the endothelium canbecome prothrombotic and proinflammatory [41].

In CKD patients, endothelium dysfunction begins in the early stages of CKD [42] and takes asubstantial part in thrombotic events [43]. In hemodialysis patients, endothelial injury is associatedwith an increased risk of AVF thrombosis [44–46]. The modifications of hemodynamic stress in vascularaccess and the accumulation of uremic toxins play a major role in endothelium dysfunction [45].Tryptophan-derived indolic toxins induce a profound endothelial dysfunction, characterized by aprocoagulant, pro-oxidant and proinflammatory phenotype [16,25]. In case of injury, these toxins couldimpair endothelial healing and vessel repair by inhibiting endothelial proliferation and migration,inducing endothelial senescence [16], and promoting progenitor cell apoptosis [44]. Another aspectof endothelial function is the generation of pro- and anticoagulant prostaglandins, which play animportant role in hemostasis. Notably, endothelial cells produce Prostaglandin E2 (PGE2), whichis generated by cyclooxygenases (COX) from arachidonic acid. PGE2 elicits platelet aggregationvia its binding on platelet EP3 receptors and promotes thrombosis [47,48]. We demonstratedthat IAA induces COX-2 expression in cultured endothelial cells via an aryl hydrocarbon receptor(AhR)/p38MAPK/Nuclear Factor kappa B (NF-κB) pathway [25]. Importantly, this increase in COX-2enhances endothelial PGE2 synthesis [25], suggesting that IAA could promote platelet aggregation viaendothelial synthesis of COX-2/PGE-2.

4.4. Decrease in NO Bioavailability

Nitric oxide (NO) released from endothelium and platelets prevents platelet adhesion to thevessel wall and inhibits platelet recruitment, aggregation, and activity [49]. NO supplies a negativefeedback mechanism for thrombus propagation, and bioactive NO deficiency is associated withplatelet dysfunction and arterial thrombosis [49]. CKD patients display NO deficiency, mainly tohigh concentration of the endogenous NO Synthase (NOS) inhibitor asymmetric dimethylarginine(ADMA), and defects in NOS activity [50]. Importantly, the increase in oxidative stress in CKDpatients further reduces NO bioavailability [50]. Reactive oxygen species (ROS) have many effects onNO bioavailability: ROS increase ADMA levels, the ROS superoxide can react with NO to produceperoxynitrite that depletes the bioactivity of NO, and ROS oxidize tetrahydrobiopterin (BH4), which iscrucial for eNOS activity [50]. Tryptophan-derived indolic toxins affect NO production: IS inhibits NOproduction in endothelial cells [51], but increases it in mononuclear cells [52]. In parallel, these toxinsincrease ROS production in blood mononuclear cells [52] and in vascular endothelial cells [25,53] byincreasing endothelial NAD(P)H oxidase activity and decreasing the cellular amount of the antioxidantglutathione [53]. Thus, by favoring a pro-oxidant environment, indolic toxins could decrease NObioavailability and thus contribute to increased platelet reactivity.

4.5. Production of Procoagulant Microparticles

CKD patients display high plasma levels of microparticles from platelet and endothelium [54,55].Microparticles are membrane fragments that result from the remodeling of plasma membrane inresponse to activation or apoptosis [55]. Microparticles expose on their surfaces both phosphatidylserine,which facilitates the transformation of prothrombin to thrombin; and TF, which leads to thrombingeneration, thus conferring a procoagulant potential [56,57]. Microparticles exhibiting TF are able toform a thrombus in vivo [58]. In vitro, we have shown that IS significantly enhances the release ofmicroparticles by the endothelium [54]. Importantly, microparticles from endothelial cells incubatedwith indolic toxins exhibit a higher procoagulant activity [31]. Gao et al. also reported that IS and IAA

Toxins 2018, 10, 412 5 of 11

enhance the procoagulant activity of red blood cells through releasing microparticles and exposingphosphatidyserine [59].

4.6. Overexpression of Cell Tissue Factor

TF induction in vascular cells by TDUT could be an important prothrombotic mechanism. TF isconstitutively expressed in vascular wall cells, like fibroblasts and vSMC, to reduce bleeding aftera vascular lesion [41]. TF is usually not expressed in endothelium, but activated endothelium andleukocytes could express active TF after a vascular lesion or inflammation [41]. Blood-borne TF comesmainly from leukocytes, platelets, and TF-bearing microparticles or circulates as a soluble protein [60].TF exists as an encrypted form, with little or no procoagulant activity, which becomes activated(decrypted) upon vascular stimulation or injury [41].

In human aortic smooth muscle cells (SMC) that constitutively express TF, IS and KYN, as wellas uremic serum, induce TF overexpression and increase its activity [20,27,61,62]. A prior treatmentwith an anti-TF neutralizing antibody reduces clot formation in vSMC exposed to coronary flow [27].We reported that indolic toxins IS and IAA also induce TF expression in various types of culturedhuman endothelial cells that usually not express TF [31,63], as well as in leukocytes [31]. IS and IAAexacerbates the procoagulant activity of TF in endothelial cells and in endothelial microparticles [31].In vivo, TF activity is greater in CKD patients with subsequent arteriovenous thrombosis than in thosewithout thrombosis [20].

We demonstrated that TF induction by IS and IAA in endothelial cells occurred via a new pathway,dependent on the transcription factor AhR [31]. AhR is a receptor of some environmental contaminants,like 2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD) [64]. Indolic toxins IS, IAA, as well as kynureninesare potent endogenous agonists of AhR [16,65]. In resting cells, AhR forms a complex in the cytoplasmwith HSP90, XAP2, and p23 [65]. Activation of the AhR genomic pathway by ligand binding causesAhR release from the heterodimeric complex and its interaction with its nuclear translocator ARNT(Aryl Hydrocarbon Nuclear Translocator) [65]. In the nucleus, the AhR/ARNT heterodimer recognizesspecific XRE (Xenobiotic Response Elements) sequences on the promoters of AhR target genes,like genes of the cytochrome P450 family: CYP1A1, CYP1A2, or CYP1B1 [65]. Once activated byligand, AhR can also cross-talk with multiple signaling pathways and elicit inflammation through anon-genomic pathway that does not require ARNT [66]. This non-genomic inflammatory pathway ofAhR is involved in the induction of inflammatory genes, such as IL-1, IL-8, MCP-1, and COX-2 [25,67].

In endothelial cells, AhR inhibitors and AhR si RNA completely inhibit TF induction by indolictoxins [31,63]. We further showed that IAA induces endothelial TF expression via a non-genomicinflammatory pathway of AhR that induces p38MAPK and NF-kB activation [63]. In vSMC, IS extendsTF half-life by reducing TF ubiquitination [27]. Shivanna et al. demonstrated that AhR activatedby IS directly interacts with and stabilizes functional TF [32]. AHR regulates TF through STUB1,an ubiquitin ligase, which interacts with TF and degrades it through ubiquitination [68]. Consequently,IS thrombogenicity is significantly abrogated by the AHR antagonist in a flow loop ex vivo model [32].KYN also increases TF expression via AhR in primary human aortic SMC [20] and regulates thrombosisafter a carotid lesion in mice in an AhR-dependent way [20]. We demonstrated that patients andmice with CKD have high amounts of AhR agonists associated with cellular activation of AhR [69].In 116 CKD patients, we further observed that cardiovascular events are more frequent in patients withhigh levels of AhR agonists [69]. In CKD patients, Shivanna et al. demonstrated IS levels correlate withAHR-inducing activity of serum and with TF activity [32]. CKD patients with arteriovenous thrombosishave a significant greater activity of AHR and TF than those without thrombosis [20]. AhR playsan important role in platelet production [70,71] and function [72]. The activation of the AhR/p38MAPK pathway was observed in platelets in response to AhR agonists and resulted in enhancedplatelet aggregation [73]. Therefore, AHR activation by TDUT could affect primary hemostasis, inaddition to activation of coagulation, and could be a new prothrombotic mechanism in CKD patients.

Toxins 2018, 10, 412 6 of 11

Clinical studies are now necessary to demonstrate that targeting AhR activation could be a newtherapeutic option for preventing thrombosis in CKD patients.


Considering that TDUT arise from the metabolization of dietary tryptophan by the gutmicrobiota [16] and that gut dysbiosis begins in the initial stages of CKD [74], modifications ofdiet and/or use of prebiotics, probiotics, and symbiotics is a tempting approach. Results on probiotictherapies in CKD are conflicting. In a recent study, probiotic supplementation failed to reduce plasmalevels of IS, IAA, and inflammatory markers in HD patients [75], whereas it decreased serum levelsof IS in another study [76]. In CKD patients, symbiotic therapy did not significantly reduce serumIS [77], but probiotics may be interesting to reduce inflammation [74]. Results from diet modificationsseem more promising. A low protein-diet reduces plasma levels of IS and urine levels of IS, indoxylglucuronide, KA, and QA in healthy subjects [78]. In hemodialyzed patients, an increase in dietaryfibers reduces the plasma levels of IS [79]. Finally, a diet with a higher proportion of protein fromplant sources is associated with lower levels of IS [80] and with lower mortality rates in patients withCKD [81].

6. Conclusions

TDUT accumulating in patients with CKD could induce thrombosis via several mechanisms:Activation of primary hemostasis and coagulation, endothelial dysfunction, decrease in NObioavailability, and production of procoagulant microparticles (Figure 1). One important prothromboticmechanism is the induction of tissue factor via AhR (Figure 1). This uremic toxins/AhR/TF axis mayoffer new therapeutic options to prevent thrombosis in CKD.

Toxins 2018, 10, x FOR PEER REVIEW 6 of 11


Considering that TDUT arise from the metabolization of dietary tryptophan by the gut microbiota [16] and that gut dysbiosis begins in the initial stages of CKD [74], modifications of diet and/or use of prebiotics, probiotics, and symbiotics is a tempting approach. Results on probiotic therapies in CKD are conflicting. In a recent study, probiotic supplementation failed to reduce plasma levels of IS, IAA, and inflammatory markers in HD patients [75], whereas it decreased serum levels of IS in another study [76]. In CKD patients, symbiotic therapy did not significantly reduce serum IS [77], but probiotics may be interesting to reduce inflammation [74]. Results from diet modifications seem more promising. A low protein-diet reduces plasma levels of IS and urine levels of IS, indoxyl glucuronide, KA, and QA in healthy subjects [78]. In hemodialyzed patients, an increase in dietary fibers reduces the plasma levels of IS [79]. Finally, a diet with a higher proportion of protein from plant sources is associated with lower levels of IS [80] and with lower mortality rates in patients with CKD [81].

6. Conclusions

TDUT accumulating in patients with CKD could induce thrombosis via several mechanisms: Activation of primary hemostasis and coagulation, endothelial dysfunction, decrease in NO bioavailability, and production of procoagulant microparticles (Figure 1). One important prothrombotic mechanism is the induction of tissue factor via AhR (Figure 1). This uremic toxins/AhR/TF axis may offer new therapeutic options to prevent thrombosis in CKD.

Figure 1. Mechanisms of tryptophan-derived uremic toxins promoting thrombosis. Tryptophan-derived uremic toxins promote thrombosis by inducing platelet hyperactivity, endothelial dysfunction, production of endothelial and platelet microparticles, and TF expression on monocytes, vSMC, and EC. TF induction is mediated by AhR activation. A decrease in NO bioavailability and an induction of ROS in platelets and endothelial cells participate in the thrombotic effects of tryptophan-derived uremic toxins. AhR: Aryl hydrocarbon Receptor; TF: Tissue Factor; EC: Endothelial cells, vSMC: Vascular smooth muscle cells; ROS: Reactive oxygen species; NO: Nitric Oxide.

Author Contributions: All authors participated in the redaction and review of the manuscript.


Acknowledgments: We thank University of Oran 1 Ahmed Benbella for the PhD student granting of T.A.

Figure 1. Mechanisms of tryptophan-derived uremic toxins promoting thrombosis. Tryptophan-derived uremic toxins promote thrombosis by inducing platelet hyperactivity, endothelial dysfunction,production of endothelial and platelet microparticles, and TF expression on monocytes, vSMC, and EC.TF induction is mediated by AhR activation. A decrease in NO bioavailability and an induction of ROSin platelets and endothelial cells participate in the thrombotic effects of tryptophan-derived uremictoxins. AhR: Aryl hydrocarbon Receptor; TF: Tissue Factor; EC: Endothelial cells, vSMC: Vascularsmooth muscle cells; ROS: Reactive oxygen species; NO: Nitric Oxide.

Toxins 2018, 10, 412 7 of 11

Author Contributions: All authors participated in the redaction and review of the manuscript.


Acknowledgments: We thank University of Oran 1 Ahmed Benbella for the PhD student granting of T.A.

Conflicts of Interest: The authors declare no conflicts of interest.

References

1. Levin, A.; Stevens, P.; Bilous, R.W.; Coresh, J.; De Francisco, A.L.; De Jong, P.E.; Griffi, K.E.; Hemmelgarn, B.R.;Isek, K.; Lamb, E.J.; et al. KDIGO clinical practice guideline for the evaluation and management of chronickidney disease. Chapter 1: Definition and classification of CKD. Kidney Int. Suppl. 2013, 3, 19–62. [CrossRef]

2. Stevens, P.E.; Levin, A. Kidney Disease: Improving Global Outcomes Chronic Kidney Disease GuidelineDevelopment Work Group Members Evaluation and management of chronic kidney disease: Synopsis ofthe kidney disease: Improving global outcomes 2012 clinical practice guideline. Ann. Intern. Med. 2013,158, 825–830. [CrossRef] [PubMed]

3. Coresh, J.; Turin, T.C.; Matsushita, K.; Sang, Y.; Ballew, S.H.; Appel, L.J.; Arima, H.; Chadban, S.J.; Cirillo, M.;Djurdjev, O.; et al. Decline in estimated glomerular filtration rate and subsequent risk of end-stage renaldisease and mortality. JAMA 2014, 311, 2518–2531. [CrossRef] [PubMed]

4. Di Angelantonio, E.; Danesh, J.; Eiriksdottir, G.; Gudnason, V. Renal function and risk of coronary heartdisease in general populations: New prospective study and systematic review. PLoS Med. 2007, 4, e270.[CrossRef] [PubMed]

5. Herzog, C.A.; Asinger, R.W.; Berger, A.K.; Charytan, D.M.; Díez, J.; Hart, R.G.; Eckardt, K.-U.; Kasiske, B.L.;McCullough, P.A.; Passman, R.S.; et al. Cardiovascular disease in chronic kidney disease. A clinical updatefrom Kidney Disease: Improving Global Outcomes (KDIGO). Kidney Int. 2011, 80, 572–586. [CrossRef][PubMed]

6. Go, A.S.; Chertow, G.M.; Fan, D.; McCulloch, C.E.; Hsu, C.Y. Chronic kidney disease and the risks of death,cardiovascular events, and hospitalization. N. Engl. J. Med. 2004, 351, 1296–1305. [CrossRef] [PubMed]

7. Raskob, G.E.; Angchaisuksiri, P.; Blanco, A.N.; Buller, H.; Galluse, A.; Hunt, B.J.; Hylek, E.M.; Kakkar, A.;Konstantinidesi, S.V.; McCumber, M.; et al. ISTH Steering Committee for World Thrombosis Day Thrombosis:A major contributor to global disease burden. Thromb. Res. 2014, 134, 931–938. [CrossRef] [PubMed]

8. Lutz, J.; Menke, J.; Sollinger, D.; Schinzel, H.; Thurmel, K. Haemostasis in chronic kidney disease.Nephrol. Dial. Transplant. 2014, 29, 29–40. [CrossRef] [PubMed]

9. Parikh, A.M.; Spencer, F.A.; Lessard, D.; Emery, C.; Baylin, A.; Linkletter, C.; Goldberg, R.J. Venousthromboembolism in patients with reduced estimated GFR: A population-based perspective. Am. J.Kidney Dis. 2011, 58, 746–755. [CrossRef] [PubMed]

10. Pavord, S.; Myers, B. Bleeding and thrombotic complications of kidney disease. Blood Rev. 2011, 25, 271–278.[CrossRef] [PubMed]

11. Wattanakit, K.; Cushman, M.; Stehman-Breen, C.; Heckbert, S.R.; Folsom, A.R. Chronic kidney diseaseincreases risk for venous thromboembolism. J. Am. Soc. Nephrol. 2008, 19, 135–140. [CrossRef] [PubMed]

12. Ocak, G.; Lijfering, W.M.; Verduijn, M.; Dekker, F.W.; Rosendaal, F.R.; Cannegieter, S.C.; Vossen, C.Y.Risk of venous thrombosis in patients with chronic kidney disease: Identification of high-risk groups.J. Thromb. Haemost. 2013, 11, 627–633. [CrossRef] [PubMed]

13. Carrero, J.J.; Trevisan, M.; Sood, M.M.; Bárány, P.; Xu, H.; Evans, M.; Friberg, L.; Szummer, K. Incident AtrialFibrillation and the Risk of Stroke in Adults with Chronic Kidney Disease: The Stockholm CREAtinineMeasurements (SCREAM) Project. Clin. J. Am. Soc. Nephrol. 2018, 13, 1314–1320. [CrossRef] [PubMed]

14. Viecelli, A.K.; Mori, T.A.; Roy-Chaudhury, P.; Polkinghorne, K.R.; Hawley, C.M.; Johnson, D.W.; Pascoe, E.M.;Irish, A.B. The pathogenesis of hemodialysis vascular access failure and systemic therapies for its prevention:Optimism unfulfilled. Semin. Dial. 2018, 31, 244–257. [CrossRef] [PubMed]

15. Vanholder, R.; Pletinck, A.; Schepers, E.; Glorieux, G. Biochemical and Clinical Impact of Organic UremicRetention Solutes: A Comprehensive Update. Toxins 2018, 10. [CrossRef] [PubMed]

16. Sallee, M.; Dou, L.; Cerini, C.; Poitevin, S.; Brunet, P.; Burtey, S. The aryl hydrocarbon receptor-activating effectof uremic toxins from tryptophan metabolism: A new concept to understand cardiovascular complicationsof chronic kidney disease. Toxins 2014, 6, 934–949. [CrossRef] [PubMed]

http://dx.doi.org/10.1038/kisup.2012.64

http://dx.doi.org/10.7326/0003-4819-158-11-201306040-00007

http://www.ncbi.nlm.nih.gov/pubmed/23732715

http://dx.doi.org/10.1001/jama.2014.6634


http://dx.doi.org/10.1371/journal.pmed.0040270


http://dx.doi.org/10.1038/ki.2011.223


http://dx.doi.org/10.1056/NEJMoa041031


http://dx.doi.org/10.1016/j.thromres.2014.08.014


http://dx.doi.org/10.1093/ndt/gft209


http://dx.doi.org/10.1053/j.ajkd.2011.06.021


http://dx.doi.org/10.1016/j.blre.2011.07.001


http://dx.doi.org/10.1681/ASN.2007030308


http://dx.doi.org/10.1111/jth.12141


http://dx.doi.org/10.2215/CJN.04060318


http://dx.doi.org/10.1111/sdi.12658






Toxins 2018, 10, 412 8 of 11

17. Meyer, T.W.; Hostetter, T.H. Uremic solutes from colon microbes. Kidney Int. 2012, 81, 949–954. [CrossRef][PubMed]

18. Neirynck, N.; Glorieux, G.; Schepers, E.; Pletinck, A.; Dhondt, A.; Vanholder, R. Review of protein-boundtoxins, possibility for blood purification therapy. Blood Purif. 2013, 35 (Suppl. 1), 45–50. [CrossRef]

19. Wu, C.-C.; Hsieh, M.-Y.; Hung, S.-C.; Kuo, K.-L.; Tsai, T.-H.; Lai, C.-L.; Chen, J.-W.; Lin, S.-J.; Huang, P.-H.;Tarng, D.-C. Serum Indoxyl Sulfate Associates with Postangioplasty Thrombosis of Dialysis Grafts. J. Am.Soc. Nephrol. 2016, 27, 1254–1264. [CrossRef] [PubMed]

20. Kolachalama, V.B.; Shashar, M.; Alousi, F.; Shivanna, S.; Rijal, K.; Belghasem, M.E.; Walker, J.; Matsuura, S.;Chang, G.H.; Gibson, C.M.; et al. Uremic Solute-Aryl Hydrocarbon Receptor-Tissue Factor Axis Associateswith Thrombosis after Vascular Injury in Humans. J. Am. Soc. Nephrol. 2018, 29, 1063–1072. [CrossRef][PubMed]

21. Eussen, S.J.P.M.; Ueland, P.M.; Vollset, S.E.; Nygård, O.; Midttun, Ø.; Sulo, G.; Ulvik, A.; Meyer, K.;Pedersen, E.R.; Tell, G.S. Kynurenines as predictors of acute coronary events in the Hordaland HealthStudy. Int. J. Cardiol. 2015, 189, 18–24. [CrossRef] [PubMed]

22. Sulo, G.; Vollset, S.E.; Nygård, O.; Midttun, Ø.; Ueland, P.M.; Eussen, S.J.P.M.; Pedersen, E.R.; Tell, G.S.Neopterin and kynurenine-tryptophan ratio as predictors of coronary events in older adults, the HordalandHealth Study. Int. J. Cardiol. 2013, 168, 1435–1440. [CrossRef] [PubMed]

23. Yu, E.; Ruiz-Canela, M.; Guasch-Ferré, M.; Zheng, Y.; Toledo, E.; Clish, C.B.; Salas-Salvadó, J.; Liang, L.;Wang, D.D.; Corella, D.; et al. Increases in Plasma Tryptophan Are Inversely Associated with IncidentCardiovascular Disease in the Prevención con Dieta Mediterránea (PREDIMED) Study. J. Nutr. 2017,147, 314–322. [CrossRef] [PubMed]

24. Barreto, F.C.; Barreto, D.V.; Liabeuf, S.; Meert, N.; Glorieux, G.; Temmar, M.; Choukroun, G.; Vanholder, R.;Massy, Z.A. Serum indoxyl sulfate is associated with vascular disease and mortality in chronic kidneydisease patients. Clin. J. Am. Soc. Nephrol. 2009, 4, 1551–1558. [CrossRef] [PubMed]

25. Dou, L.; Sallée, M.; Cerini, C.; Poitevin, S.; Gondouin, B.; Jourde-Chiche, N.; Fallague, K.; Brunet, P.; Calaf, R.;Dussol, B.; et al. The cardiovascular effect of the uremic solute indole-3 acetic acid. J. Am. Soc. Nephrol. 2015,26, 876–887. [CrossRef] [PubMed]

26. Karbowska, M.; Kaminski, T.W.; Marcinczyk, N.; Misztal, T.; Rusak, T.; Smyk, L.; Pawlak, D. The UremicToxin Indoxyl Sulfate Accelerates Thrombotic Response after Vascular Injury in Animal Models. Toxins 2017,9, 229. [CrossRef] [PubMed]

27. Chitalia, V.C.; Shivanna, S.; Martorell, J.; Balcells, M.; Bosch, I.; Kolandaivelu, K.; Edelman, E.R. Uremicserum and solutes increase post-vascular interventional thrombotic risk through altered stability of smoothmuscle cell tissue factor. Circulation 2013, 127, 365–376. [CrossRef] [PubMed]

28. Kolandaivelu, K.; Swaminathan, R.; Gibson, W.J.; Kolachalama, V.B.; Nguyen-Ehrenreich, K.-L.;Giddings, V.L.; Coleman, L.; Wong, G.K.; Edelman, E.R. Stent thrombogenicity early in high-riskinterventional settings is driven by stent design and deployment and protected by polymer-drug coatings.Circulation 2011, 123, 1400–1409. [CrossRef] [PubMed]

29. Gale, A.J. Current Understanding of Hemostasis. Toxicol. Pathol. 2011, 39, 273–280. [CrossRef] [PubMed]30. Jalal, D.I.; Chonchol, M.; Targher, G. Disorders of hemostasis associated with chronic kidney disease.

Semin. Thromb. Hemost. 2010, 36, 34–40. [CrossRef] [PubMed]31. Gondouin, B.; Cerini, C.; Dou, L.; Sallée, M.; Duval-Sabatier, A.; Pletinck, A.; Calaf, R.; Lacroix, R.;

Jourde-Chiche, N.; Poitevin, S.; et al. Indolic uremic solutes increase tissue factor production in endothelialcells by the aryl hydrocarbon receptor pathway. Kidney Int. 2013, 84, 733–744. [CrossRef] [PubMed]

32. Shivanna, S.; Kolandaivelu, K.; Shashar, M.; Belghasim, M.; Al-Rabadi, L.; Balcells, M.; Zhang, A.; Weinberg, J.;Francis, J.; Pollastri, M.P.; et al. The Aryl Hydrocarbon Receptor is a Critical Regulator of Tissue FactorStability and an Antithrombotic Target in Uremia. J. Am. Soc. Nephrol. 2016, 27, 189–201. [CrossRef][PubMed]

33. Kaminski, T.W.; Pawlak, K.; Karbowska, M.; Mysliwiec, M.; Pawlak, D. Indoxyl sulfate-the uremic toxinlinking hemostatic system disturbances with the prevalence of cardiovascular disease in patients withchronic kidney disease. BMC Nephrol. 2017, 18, 35. [CrossRef] [PubMed]

34. Pawlak, K.; Domaniewski, T.; Mysliwiec, M.; Pawlak, D. Kynurenines and oxidative status are independentlyassociated with thrombomodulin and von Willebrand factor levels in patients with end-stage renal disease.Thromb. Res. 2009, 124, 452–457. [CrossRef] [PubMed]

http://dx.doi.org/10.1038/ki.2011.504


http://dx.doi.org/10.1159/000346223





http://dx.doi.org/10.1016/j.ijcard.2015.03.413


http://dx.doi.org/10.1016/j.ijcard.2012.12.090


http://dx.doi.org/10.3945/jn.116.241711








http://dx.doi.org/10.1161/CIRCULATIONAHA.112.118174


http://dx.doi.org/10.1161/CIRCULATIONAHA.110.003210


http://dx.doi.org/10.1177/0192623310389474


http://dx.doi.org/10.1055/s-0030-1248722


http://dx.doi.org/10.1038/ki.2013.133




http://dx.doi.org/10.1186/s12882-017-0457-1




Toxins 2018, 10, 412 9 of 11

35. Pawlak, K.; Mysliwiec, M.; Pawlak, D. Hypercoagulability is independently associated with kynureninepathway activation in dialysed uraemic patients. Thromb. Haemost. 2009, 102, 49–55. [CrossRef] [PubMed]

36. Kaminski, T.W.; Pawlak, K.; Karbowska, M.; Mysliwiec, M.; Grzegorzewski, W.; Kuna, J.; Pawlak, D.Association between uremic toxin-anthranilic acid and fibrinolytic system activity in predialysis patients atdifferent stages of chronic kidney disease. Int. Urol. Nephrol. 2018, 50, 127–135. [CrossRef] [PubMed]

37. Pawlak, K.; Tankiewicz, J.; Mysliwiec, M.; Pawlak, D. Tissue factor/its pathway inhibitor system andkynurenines in chronic kidney disease patients on conservative treatment. Blood Coagul. Fibrin. 2009,20, 590–594. [CrossRef] [PubMed]

38. Thijs, A.; Nanayakkara, P.W.; Ter Wee, P.M.; Huijgens, P.C.; van Guldener, C.; Stehouwer, C.D.A.Mild-to-moderate renal impairment is associated with platelet activation: A cross-sectional study.Clin. Nephrol. 2008, 70, 325–331. [PubMed]

39. Boccardo, P.; Remuzzi, G.; Galbusera, M. Platelet dysfunction in renal failure. Semin. Thromb. Hemost. 2004,30, 579–589. [CrossRef] [PubMed]

40. Yang, K.; Du, C.; Wang, X.; Li, F.; Xu, Y.; Wang, S.; Chen, S.; Chen, F.; Shen, M.; Chen, M.; et al. Indoxylsulfate induces platelet hyperactivity and contributes to chronic kidney disease-associated thrombosis inmice. Blood 2017, 129, 2667–2679. [CrossRef] [PubMed]

41. Yau, J.W.; Teoh, H.; Verma, S. Endothelial cell control of thrombosis. BMC Cardiovasc. Disord. 2015, 15, 130.[CrossRef] [PubMed]

42. Stam, F.; van Guldener, C.; Becker, A.; Dekker, J.M.; Heine, R.J.; Bouter, L.M.; Stehouwer, C.D.A. Endothelialdysfunction contributes to renal function-associated cardiovascular mortality in a population with mildrenal insufficiency: The Hoorn study. J. Am. Soc. Nephrol. 2006, 17, 537–545. [CrossRef] [PubMed]

43. Malyszko, J. Mechanism of endothelial dysfunction in chronic kidney disease. Clin. Chim. Acta 2010,411, 1412–1420. [CrossRef] [PubMed]

44. Jourde-Chiche, N.; Dou, L.; Sabatier, F.; Calaf, R.; Cerini, C.; Robert, S.; Camoin-Jau, L.; Charpiot, P.;Argiles, A.; Dignat-George, F.; et al. Levels of circulating endothelial progenitor cells are related to uremictoxins and vascular injury in hemodialysis patients. J. Thromb. Haemost. 2009, 7, 1576–1584. [CrossRef][PubMed]

45. Roy-Chaudhury, P.; Sukhatme, V.P.; Cheung, A.K. Hemodialysis vascular access dysfunction: A cellular andmolecular viewpoint. J. Am. Soc. Nephrol. 2006, 17, 1112–1127. [CrossRef] [PubMed]

46. Chen, T.Y.; Lin, T.T.; Hsieh, M.Y.; Lin, L.; Yang, C.W.; Chuang, S.Y.; Huang, P.H.; Wu, C.C. CirculatingProgenitor Cells Affect Thrombosis of Dialysis Arteriovenous Fistulas. Am. J. Nephrol. 2016, 44, 428–438.[CrossRef] [PubMed]

47. Fabre, J.E.; Nguyen, M.; Athirakul, K.; Coggins, K.; McNeish, J.D.; Austin, S.; Parise, L.K.; FitzGerald, G.A.;Coffman, T.M.; Koller, B.H. Activation of the murine EP3 receptor for PGE2 inhibits cAMP production andpromotes platelet aggregation. J. Clin. Investig. 2001, 107, 603–610. [CrossRef] [PubMed]

48. Gross, S.; Tilly, P.; Hentsch, D.; Vonesch, J.L.; Fabre, J.E. Vascular wall–produced prostaglandin E2 exacerbatesarterial thrombosis and atherothrombosis through platelet EP3 receptors. J. Exp. Med. 2007, 204, 311–320.[CrossRef] [PubMed]

49. Loscalzo, J. Nitric oxide insufficiency, platelet activation, and arterial thrombosis. Circ. Res. 2001, 88, 756–762.[CrossRef] [PubMed]

50. Baylis, C. Nitric oxide synthase derangements and hypertension in kidney disease. Curr. Opin.Nephrol. Hypertens. 2012, 21, 1–6. [CrossRef] [PubMed]

51. Tumur, Z.; Niwa, T. Indoxyl sulfate inhibits nitric oxide production and cell viability by inducing oxidativestress in vascular endothelial cells. Am. J. Nephrol. 2009, 29, 551–557. [CrossRef] [PubMed]

52. Pieniazek, A.; Gwozdzinski, L.; Hikisz, P.; Gwozdzinski, K. Indoxyl sulfate generates free radicals, decreasesantioxidant defense and leads to damage to mononuclear blood cells. Chem. Res. Toxicol. 2018. [CrossRef][PubMed]

53. Dou, L.; Jourde-Chiche, N.; Faure, V.; Cerini, C.; Berland, Y.; Dignat-George, F.; Brunet, P. The uremicsolute indoxyl sulfate induces oxidative stress in endothelial cells. J. Thromb. Haemost. 2007, 5, 1302–1308.[CrossRef] [PubMed]

54. Faure, V.; Dou, L.; Sabatier, F.; Cerini, C.; Sampol, J.; Berland, Y.; Brunet, P.; Dignat-George, F. Elevationof circulating endothelial microparticles in patients with chronic renal failure. J. Thromb. Haemost. 2006,4, 566–573. [CrossRef] [PubMed]

http://dx.doi.org/10.1160/TH08-10-0696


http://dx.doi.org/10.1007/s11255-017-1729-1


http://dx.doi.org/10.1097/MBC.0b013e32832da16d



http://dx.doi.org/10.1055/s-2004-835678


http://dx.doi.org/10.1182/blood-2016-10-744060


http://dx.doi.org/10.1186/s12872-015-0124-z




http://dx.doi.org/10.1016/j.cca.2010.06.019


http://dx.doi.org/10.1111/j.1538-7836.2009.03540.x




http://dx.doi.org/10.1159/000452428


http://dx.doi.org/10.1172/JCI10881


http://dx.doi.org/10.1084/jem.20061617


http://dx.doi.org/10.1161/hh0801.089861


http://dx.doi.org/10.1097/MNH.0b013e32834d54ca


http://dx.doi.org/10.1159/000191468


http://dx.doi.org/10.1021/acs.chemrestox.8b00065


http://dx.doi.org/10.1111/j.1538-7836.2007.02540.x


http://dx.doi.org/10.1111/j.1538-7836.2005.01780.x


Toxins 2018, 10, 412 10 of 11

55. Daniel, L.; Dou, L.; Berland, Y.; Lesavre, P.; Mecarelli-Halbwachs, L.; Dignat-George, F. Circulatingmicroparticles in renal diseases. Nephrol. Dial. Transplant. 2008, 23, 2129–2132. [CrossRef] [PubMed]

56. Freyssinet, J.M.; Toti, F. Formation of procoagulant microparticles and properties. Thromb. Res. 2010,125 (Suppl. 1), S46–S48. [CrossRef]

57. Connor, D.E.; Exner, T.; Ma, D.D.; Joseph, J.E. Detection of the procoagulant activity ofmicroparticle-associated phosphatidylserine using XACT. Blood Coagul. Fibrin. 2009, 20, 558–564. [CrossRef][PubMed]

58. Biró, E.; Sturk-Maquelin, K.N.; Vogel, G.M.; Meuleman, D.G.; Smit, M.J.; Hack, C.E.; Sturk, A.; Nieuwland, R.Human cell-derived microparticles promote thrombus formation in vivo in a tissue factor-dependent manner.J. Thromb. Haemost. 2003, 1, 2561–2568. [CrossRef] [PubMed]

59. Gao, C.; Ji, S.; Dong, W.; Qi, Y.; Song, W.; Cui, D.; Shi, J. Indolic uremic solutes enhance procoagulant activityof red blood cells through phosphatidylserine exposure and microparticle release. Toxins 2015, 7, 4390–4403.[CrossRef] [PubMed]

60. Chu, A.J. Tissue factor, blood coagulation, and beyond: An overview. Int. J. Inflam. 2011, 2011, 367284.[CrossRef] [PubMed]

61. Ng, H.Y.; Bolati, W.; Lee, C.T.; Chien, Y.S.; Yisireyili, M.; Saito, S.; Pei, S.N.; Nishijima, F.; Niwa, T. IndoxylSulfate Downregulates Mas Receptor via Aryl Hydrocarbon Receptor/Nuclear Factor-kappa B, and InducesCell Proliferation and Tissue Factor Expression in Vascular Smooth Muscle Cells. Nephron 2016, 133, 205–212.[CrossRef] [PubMed]

62. Yisireyili, M.; Saito, S.; Abudureyimu, S.; Adelibieke, Y.; Ng, H.Y.; Nishijima, F.; Takeshita, K.; Murohara, T.;Niwa, T. Indoxyl sulfate-induced activation of (pro)renin receptor promotes cell proliferation and tissuefactor expression in vascular smooth muscle cells. PLoS ONE 2014, 9, e109268. [CrossRef] [PubMed]

63. Addi, T.; Poitevin, S.; McKay, N.; El Mecherfi, K.E.; Kheroua, O.; Jourde-Chiche, N.; de Macedo, A.;Gondouin, B.; Cerini, C.; Brunet, P.; et al. Mechanisms of tissue factor induction by the uremic toxinindole-3 acetic acid through aryl hydrocarbon receptor/nuclear factor-kappa B signaling pathway in humanendothelial cells. Arch. Toxicol. In press.

64. Mandal, P.K. Dioxin: A review of its environmental effects and its aryl hydrocarbon receptor biology.J. Comp. Physiol. B 2005, 175, 221–230. [CrossRef] [PubMed]

65. Hubbard, T.D.; Murray, I.A.; Perdew, G.H. Indole and Tryptophan Metabolism: Endogenous and DietaryRoutes to Ah Receptor Activation. Drug Metab. Dispos. 2015, 43, 1522–1535. [CrossRef] [PubMed]

66. Matsumura, F. The significance of the nongenomic pathway in mediating inflammatory signaling of thedioxin-activated Ah receptor to cause toxic effects. Biochem. Pharmacol. 2009, 77, 608–626. [CrossRef][PubMed]

67. Puga, A.; Ma, C.; Marlowe, J.L. The aryl hydrocarbon receptor cross-talks with multiple signal transductionpathways. Biochem. Pharmacol. 2009, 77, 713–722. [CrossRef] [PubMed]

68. Shashar, M.; Belghasem, M.E.; Matsuura, S.; Walker, J.; Richards, S.; Alousi, F.; Rijal, K.; Kolachalama, V.B.;Balcells, M.; Odagi, M.; et al. Targeting STUB1-tissue factor axis normalizes hyperthrombotic uremicphenotype without increasing bleeding risk. Sci. Transl. Med. 2017, 9, eaam8475. [CrossRef] [PubMed]

69. Dou, L.; Poitevin, S.; Sallée, M.; Addi, T.; Gondouin, B.; McKay, N.; Denison, M.S.; Jourde-Chiche, N.;Duval-Sabatier, A.; Cerini, C.; et al. Aryl hydrocarbon receptor is activated in patients and mice with chronickidney disease. Kidney Int. 2018, 93, 986–999. [CrossRef] [PubMed]

70. Lindsey, S.; Papoutsakis, E.T. The aryl hydrocarbon receptor (AHR) transcription factor regulatesmegakaryocytic polyploidization. Br. J. Haematol. 2011, 152, 469–484. [CrossRef] [PubMed]

71. Strassel, C.; Brouard, N.; Mallo, L.; Receveur, N.; Mangin, P.; Eckly, A.; Bieche, I.; Tarte, K.; Gachet, C.;Lanza, F. Aryl hydrocarbon receptor-dependent enrichment of a megakaryocytic precursor with a highpotential to produce proplatelets. Blood 2016, 127, 2231–2240. [CrossRef] [PubMed]

72. Lindsey, S.; Jiang, J.; Woulfe, D.; Papoutsakis, E.T. Platelets from mice lacking the aryl hydrocarbon receptorexhibit defective collagen-dependent signaling. J. Thromb. Haemost. 2014, 12, 383–394. [CrossRef] [PubMed]

73. Pombo, M.; Lamé, M.W.; Walker, N.J.; Huynh, D.H.; Tablin, F. TCDD and omeprazole prime platelets throughthe aryl hydrocarbon receptor (AhR) non-genomic pathway. Toxicol. Lett. 2015, 235, 28–36. [CrossRef][PubMed]

http://dx.doi.org/10.1093/ndt/gfn029



http://dx.doi.org/10.1097/MBC.0b013e32832ee915


http://dx.doi.org/10.1046/j.1538-7836.2003.00456.x




http://dx.doi.org/10.4061/2011/367284


http://dx.doi.org/10.1159/000447096


http://dx.doi.org/10.1371/journal.pone.0109268


http://dx.doi.org/10.1007/s00360-005-0483-3


http://dx.doi.org/10.1124/dmd.115.064246


http://dx.doi.org/10.1016/j.bcp.2008.10.013


http://dx.doi.org/10.1016/j.bcp.2008.08.031


http://dx.doi.org/10.1126/scitranslmed.aam8475


http://dx.doi.org/10.1016/j.kint.2017.11.010


http://dx.doi.org/10.1111/j.1365-2141.2010.08548.x


http://dx.doi.org/10.1182/blood-2015-09-670208


http://dx.doi.org/10.1111/jth.12490


http://dx.doi.org/10.1016/j.toxlet.2015.03.005


Toxins 2018, 10, 412 11 of 11

74. Simeoni, M.; Citraro, M.L.; Deodato, F.; Provenzano, M.; Capria, M.; Comi, A.; Libri, E.; Andreucci, M.;Puja, A.; Abenavoli, L.; Cocchi, M.; Fuiano, G. An open-label, randomized, placebo-controlled study onthe effectiveness of a novel probiotics administration protocol (ProbiotiCKD) in patients with mild renalinsufficiency (stage 3a of CKD). Eur J. Nutr. 2018, 1–12. [CrossRef]

75. Borges, N.A.; Carmo, F.L.; Stockler-Pinto, M.B.; de Brito, J.S.; Dolenga, C.J.; Ferreira, D.C.; Nakao, L.S.;Rosado, A.; Fouque, D.; Mafra, D. Probiotic Supplementation in Chronic Kidney Disease: A Double-blind,Randomized, Placebo-controlled Trial. J. Ren Nutr. 2018, 28, 28–36. [CrossRef] [PubMed]

76. Takayama, F.; Taki, K.; Niwa, T. Bifidobacterium in gastro-resistant seamless capsule reduces serum levels ofindoxyl sulfate in patients on hemodialysis. Am. J. Kidney Dis. 2003, 41, S142–S145. [CrossRef] [PubMed]

77. Rossi, M.; Johnson, D.W.; Morrison, M.; Pascoe, E.M.; Coombes, J.S.; Forbes, J.M.; Szeto, C.C.;McWhinney, B.C.; Ungerer, J.P.; Campbell, K.L. Synbiotics Easing Renal Failure by Improving GutMicrobiology (SYNERGY): A Randomized Trial. Clin J. Am. Soc. Nephrol. 2016, 11, 223–231. [CrossRef][PubMed]

78. Poesen, R.; Mutsaers, H.A.; Windey, K.; van den Broek, P.H.; Verweij, V.; Augustijns, P.; Kuypers, D.; Jansen, J.;Evenepoel, P.; Verbeke, K.; et al. The Influence of Dietary Protein Intake on Mammalian Tryptophan andPhenolic Metabolites. PLoS ONE 2015, 10, e0140820. [CrossRef] [PubMed]

79. Sirich, T.L.; Plummer, N.S.; Gardner, C.D.; Hostetter, T.H.; Meyer, TW. Effect of increasing dietary fiber onplasma levels of colon-derived solutes in hemodialysis patients. Clin. J. Am. Soc. Nephrol. 2014, 9, 1603–1610.[CrossRef] [PubMed]

80. Kandouz, S.; Mohamed, A.S.; Zheng, Y.; Sandeman, S.; Davenport, A. Reduced protein bound uraemictoxins in vegetarian kidney failure patients treated by haemodiafiltration. Hemodial. Int. 2016, 20, 610–617.[CrossRef] [PubMed]

81. Chen, X.; Wei, G.; Jalili, T.; Metos, J.; Giri, A.; Cho, M.E.; Boucher, R.; Greene, T.; Beddhu, S. The Associationsof Plant Protein Intake with All-Cause Mortality in CKD. Am. J. Kidney Dis. 2016, 67, 423–430. [CrossRef][PubMed]

© 2018 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open accessarticle distributed under the terms and conditions of the Creative Commons Attribution(CC BY) license (http://creativecommons.org/licenses/by/4.0/).

http://dx.doi.org/10.1007/s00394-018-1785-z

http://dx.doi.org/10.1053/j.jrn.2017.06.010


http://dx.doi.org/10.1053/ajkd.2003.50104




http://dx.doi.org/10.1371/journal.pone.0140820




http://dx.doi.org/10.1111/hdi.12414


http://dx.doi.org/10.1053/j.ajkd.2015.10.018


http://creativecommons.org/

http://creativecommons.org/licenses/by/4.0/.

Résumé

La maladie rénale chronique a pour principale complication les maladies cardiovasculaires. L’accumulation des

toxines urémiques dérivées de la voie indolique du métabolisme du tryptophane, l’indole-3-acétique acide

(IAA) et l’Indoxyl sulfate (IS), sont impliquées dans un phénomène clé des événements cardiovasculaires ; la

thrombose. Ces toxines induisent l'expression et l'activité pro coagulante du facteur tissulaire (FT), principal

initiateur cellulaire de la coagulation sanguine. Le facteur de transcription, Aryl Hydrocarbon Receptor (AHR),

un récepteur cellulaire pour les toxines indoliques, est impliqué dans l'induction du FT endothélial. Les

mécanismes par lesquels AhR contrôle l’expression du FT dans les cellules endothéliales sont peu connus.

L’objectif principal de cette thèse était de déterminer les voies de signalisation et les facteurs de transcription

impliqués dans l'expression du FT médiée par AhR et induit par l’IAA et l’IS. L’expression du FT induite par l’IAA

et l’IS au niveau endothélial est contrôlée principalement par la transcription. L’IAA et l’IS activent la voie

génomique classique d’AhR. Cependant, l’expression du FT n'est pas médiée par cette voie. L’activation du FT

en réponse à l’IAA passe par une voie AhR-p38MAPK-NF-kB.En conclusion, l'IAA induit l’expression du FT

endothéliale via la voie non génomique d’AhR-p38MAPK/NF-KB. Cette voie pourrait être une cible

thérapeutique pour diminuer les effets pro thrombotiques chez les MRC.

Mots clés :

Maladie rénale chronique; Complication cardiovasculaire; Thrombose; Toxines urémique; Indole-3-acétique

acide; Indoxyl sulfate; Aryl Hydrocarbon Receptor; MAPKP38/NF-B; Facteur tissulaire; Cellule endothéliale

Thèse en cotutelle - univ-oran1.dz · Célia SARAND, Vivien MABILAT, Cathérine LOY, Muriel BLIN,...

Documents

Transcript of Thèse en cotutelle - univ-oran1.dz · Célia SARAND, Vivien MABILAT, Cathérine LOY, Muriel BLIN,...