Misfolded human tRNA isodecoder binds andneutralizes a 3′ UTR-embedded Alu elementJoëlle Rudinger-Thirion, Alain Lescure, Caroline Paulus, and Magali Frugier1

Architecture et Réactivité de l’ARN (RNA Architecture and Reactivity), Université de Strasbourg, Centre National de la Recherche Scientifique,Institut de Biologie Moléculaire et Cellulaire, 15 rue René Descartes, 67084 Strasbourg Cedex, France

Edited* by Paul Schimmel, The Skaggs Institute for Chemical Biology, La Jolla, CA, and approved August 9, 2011 (received for review March 11, 2011)

Several classes of small noncoding RNAs are key players in cellularmetabolism including mRNA decoding, RNA processing, and mRNAstability. Here we show that a tRNAAsp isodecoder, correspondingto a human tRNA-derived sequence, binds to an embedded AluRNA element contained in the 3′ UTR of the human aspartyl-tRNAsynthetase mRNA. This interaction between two well-knownclasses of RNA molecules, tRNA and Alu RNA, is driven by an un-expected structural motif and induces a global rearrangement ofthe 3′ UTR. Besides, this 3′ UTR contains two functional polyadeny-lation signals. We propose a model where the tRNA/Alu interactionwould modulate the accessibility of the two alternative polyade-nylation sites and regulate the stability of the mRNA. This uniqueregulationmechanismwould link gene expression to RNA polymer-ase III transcription and may have implications in a primate-specificsignal pathway.

aminoacyl-tRNA synthetase ∣ posttranscriptional regulation

Alu elements are the most abundant repetitive element inprimate genomes. They belong to the short interspersed

element family and are classified into subfamilies according totheir appearance during evolution. Typically, there are more than1 million Alu elements in a primate genome, which represents10% of the genome overall. Modern Alu elements are about 300base-pairs (bp) long and adopt a conserved structure composedof two similar, but distinct, domains (left and right arms) joinedby an A-rich linker and followed by a short polyadenylation [poly(A)] stretch. Moreover, Alu elements are transcribed by RNApolymerase III (pol III), and Alu RNA transcripts are present inthe cytosol of primate cells (1).

Alu sequences are considered to be a huge reservoir of poten-tial regulatory elements, which may have been involved in pri-mate evolution and possibly facilitated their divergence fromother mammals (2). Indeed, insertion of Alu elements couldprovide previously undescribed regulatory motifs to neighboringgenes by creating previously undescribed transcription enhancersor promoters (3, 4). Alu elements can also modulate proteinexpression in a posttranscriptional way by at least two differentmechanisms: (i) they are transcribed as free Alu RNA by theRNA PolIII, assembled into Alu ribonucleo-protein particles andact as transregulatory factors (2, 5, 6); or (ii) their transcription asa part of a mRNA will define them as cis-regulatory elements (7).If the Alu sequence is localized within the mRNA open readingframe, it can either affect gene expression by sequence disruptionor, alternatively, simply add to the protein amino acid sequence(8). Nevertheless, most of the time they are present in 5′ and 3′UTRs (2, 9, 10).

Several reports indicate that mRNAs containing Alu elementsin their 3′ UTRs are associated with cell growth and differentia-tion (11–15). Indeed, their presence could affect the processingof mRNAs at multiple levels (16). Specifically, they have beenshown to modulate alternative splicing (e.g., ref. 17), RNA edit-ing (e.g., ref. 18), nuclear retention (19), and STAU1-mediatedmRNA decay (20) and to create AU-rich elements that regulatemRNA stability (21). In addition, Alu elements have been shownto introduce previously undescribed 3′ UTR polyadenylation

sites (22), thereby affecting 3′ end processing efficiency, as wellas alternative 3′ end selection. Remarkably, several examplesstress the essential contribution of 3′ end processing in physiolo-gical (e.g., immunity and inflammation) or pathological processes(e.g., cancer and viral infection) (23). Maturation of the 3′ end ofthe mRNA is a nuclear cotranscriptional process that promotestransport of mRNAs from the nucleus to the cytoplasm andaffects the stability and the translation efficiency of mRNAs. Thisprocess consists of the recognition of defined polyadenylation[poly(A)] signals in the pre-mRNA 3′ UTR by a large cleavage/polyadenylation machinery. For transcripts containing more thanone poly(A) signal, which is the majority of the pre-mRNAs(24–26), the basis of the mechanisms involved in poly(A) selec-tion is still not understood and the role of regulatory factorsremains undefined (27).

Interestingly, we made the observation that the mRNA encod-ing the human aspartyl-tRNA synthetase (AspRS) displays botha partial Alu insertion (3′ end of the AluJ right arm) and twooptimal poly(A) signals in its 3′ UTR. Aminoacyl-tRNA synthe-tases (aaRSs) are ubiquitous enzymes that attach amino acidsto their cognate tRNAs during protein synthesis. They ensure thehigh fidelity of the tRNA aminoacylation process, thereby main-taining the genetic code and contributing to cell viability (28).Our data show that (i) a human tRNAAsp sequence adopts apeculiar structure, (ii) it binds to the Alu insertion within the3′ UTR of AspRS mRNA, (iii) it stimulates specifically the ex-pression of a luciferase reporter gene fused to this 3′ UTR,(iv) it alters the 3′ UTR overall folding, and (iv) the regulatoryfunction of the 3′ UTR is related not only to the Alu insertionbut also to two functional polyadenylation sites. We propose amodel consistent with all these observations, in which thetRNAAsp isodecoder, by binding the Alu insertion, would directalternative polyadenylation of AspRS mRNA and modulate itsexpression. We show that a tRNA isodecoder could act as a non-coding RNA (ncRNA), and we discuss its potential implicationin a pathway important in cellular metabolism.

ResultsAspRS mRNA 3′ UTR Displays Two Poly(A) Signals and a Partial AluSequence.Human AspRS is a protein of 500 amino acids, encodedon chromosome 2. The corresponding mature 2,215 nucleotide(nt) mRNA is characterized by a short 5′ UTR (79 nt) and apredicted 633-nt 3′ UTR containing two polyadenylation signals(Fig. 1A). This transcript is of low abundance and could not bedetected by Northern blotting experiments, as verified by quan-

Author contributions: J.R.-T., A.L., and M.F. designed research; J.R.-T., A.L., C.P., andM.F. performed research; J.R.-T., A.L., and M.F. analyzed data; and J.R.-T., A.L., and M.F.wrote the paper.

The authors declare no conflict of interest.

*This Direct Submission article had a prearranged editor.

See Commentary on page 16489.1To whom correspondence should be addressed. E-mail: M.Frugier@ibmc-cnrs.unistra.fr.

See Author Summary on page 16497.

This article contains supporting information online at www.pnas.org/lookup/suppl/doi:10.1073/pnas.1103698108/-/DCSupplemental.

E794–E802 ∣ PNAS ∣ October 4, 2011 ∣ vol. 108 ∣ no. 40 www.pnas.org/cgi/doi/10.1073/pnas.1103698108

titative PCR. Therefore, we used RNA ligase mediated RACEby PCR (RLM-RT-RACE PCR) to establish the nucleotidesequence of the different 3′ ends of AspRS mRNA transcriptsproduced in humans (Fig. S1A). This approach was performedon three different RNA samples purified from human brain,muscle, and breast tissues. Cloning and sequencing of DNA pro-ducts revealed the presence of two transcripts that matchedthe genomic sequence (Fig. S1B, arrows). The shortest 3′ UTRsequence corresponds to a proximal cleavage site positioned atnt 167 in the 3′ UTR, whereas the longest corresponds to a distalcleavage site located at position 633, both of them ending with acytidine thymidine dinucleotide. Each transcript contains a cano-nical poly(A) signal, defined by two primary sequence elements: aAAUAAA hexamer found 13 and 11 nt upstream and a U/GU-rich region located 15 and 19 nt downstream of both cleavagesites, respectively. Furthermore, UGUA elements, which serve asadditional anchors for the 3′ end processing machinery, are alsopresent in the two transcripts (29).

Another characteristic of this 3′UTR sequence is the presenceof a short insertion 11 nt downstream of the stop codon (boxed inFig. S1B). This insertion is conserved in all primate mRNAsequences identified (Pan troglodytes, Macaca mulatta, Callithrixjacchus, Pongo abelii, and Gorilla gorilla), but absent in othermammal sequences. It matches the sequence of the AluJ rightarm (in the sense orientation) followed by a poly(A) stretch(19 to 29 A). A second insertion specific to primate sequences,not investigated in this study, is found close to the mRNA 3′ end.

Functional Motifs Within the 3′ UTR. To assess the importance ofboth the Alu insertion and the proximal and distal poly(A)signals for gene control, the AspRS mRNA 3′ UTR or differentvariants were fused directly downstream of the stop codon ofthe luciferase (Luc) reporter gene (Fig. 1B). All constructs in-clude the last 23 nt from the AspRS ORF because this sequenceis partially complementary to the Alu insertion, an observationthat was confirmed by in vitro probing experiments. Constructswere transfected into mouse Hepa 1–6 cells and the luciferaseactivity was measured (Fig. 1B). In comparison with the WTAspRS 3′ UTR (WT-3′ UTR), substantial stimulation of lucifer-ase activity was observed when (i) the Alu insertion is mutated(mut-3′ UTR) or deleted (Δ73-3′ UTR) and (ii) the proximalpoly(A) signal is removed [poly(A)1-3′ UTR]. On the contrary,shortening the 3′ UTR at position 213, downstream of the prox-imal poly(A) signal (sh-3′ UTR), leads to a strong reduction inluciferase expression.

In order to measure specifically the amount of the correspond-ing mRNAs, we used Northern blotting and the RACE Poly(A)Test (RACE-PAT) (30). RACE-PAT products derived from Lucfusions were further digested with DraII and two specific frag-ments, corresponding to the longest transcript, were detected:a 210-bp fragment and a 280-bp fragment ending with the poly(A) tail (Fig. 1 A and B). The shortest transcript was not detectedby this technique, indicating that it is highly unstable. Variationsin mRNA expression level correlate with luciferase activity; thissuggests that Luc expression is controlled by mRNA concentra-tion, which in turn is governed by distinct motifs within its 3′UTR: The region 167–633 stabilizes the mRNA, whereas theAlu insertion, as well as the proximal poly(A) signal, destabilizesthe mRNA.

Three Striking tRNAAsp Isodecoders Are Encoded by the Human Gen-ome. Remarkably, we observed that the Alu insertion present inthe AspRS mRNA 3′ UTR is complementary to the tRNAAsp

sequence. A total of 19 human tRNAAsp sequences are refer-enced in the genomic tRNA database (http://lowelab.ucsc.edu/GtRNAdb/), all corresponding to a unique isoacceptor (GUCanticodon), but nine tRNAAsp isodecoders: tRNAs with the sameanticodon, but different cores (31) (Fig. 2A). Three families can

A

moc

k

A19

+63

3 -2

3 +

54

A19

A19

A19

Luc

Luci

fera

seac

tivity

PAT-

RA

CE

C

onst

ruct

s

280

210

0

0,5

1

1,5

2

2,5

3

3,5

*** ***

***

***

***

***

B

Nor

ther

n

A19

+633 -23 +54

AUG UAA

+167

polyA1 polyA2

ORF

AAAAAAA

(1) RTcDNA

(2) PCR

(3) DraIIdigestion > 280 bp210 bp84 bp

Fig. 1. AspRS 3′ UTR variants and luciferase reporter gene expression.(A) Global organization of the complete AspRS mRNA and PAT-RACE prin-ciple: UTRs and ORF are indicated. Positions numbers are relative to theUAA stop codon. The 3′ UTR contains an Alu sequence located downstreamthe stop codon (up to position þ54) and two predicted polyadenylationsignals (polyA1 and polyA2 at positions 167 and 633, respectively). In vitroprobing of the junction between the ORF and the 3′UTR showed that theAlu sequence has the capacity to form a stem loop with the last 23 nts ofthe ORF; therefore, we chose to fuse this entire domain in the reportersystem in order to present the Alu sequence in its native structural context(cotranscriptional folding). In PAT-RACE experiments, this mRNA is first re-verse transcribed using a “PAT adapter” primer. The resulting cDNA is thenamplified using a primer complementary to the adapter and a primer de-signed intentionally to hybridize after the internal polyA sequence (A19) toavoid background. DraII digestion of radioactive PCR products lead tothree fragments of 84, 210, and about 280 nts. This longest fragment isspecified by the presence of different polyA tails, initially used to reversetranscribe the mRNA and the shortest fragment was not visible on gels.(B) Schematic representation of reporter constructs: WT-3′ UTR, wild-typesequence including the 23 last nts of AspRS ORF and the 633 nt of the 3′UTR, Mut-3′ UTR is the Alu mutated version (sequence 31GATGACAG38 wasreplaced by 31TAGTCACT38), Δ73-3′ UTR corresponds to the 3′ UTR missingthe 54-nt-long Alu sequence and the 19-A stretch, poly(A)1-3′ UTR has itsfirst poly(A) signal AATAAA mutated into AATGCA and Sh-3′ UTR ends atnt 213 and displays only the first poly(A) signal. Finally, SV40-3′ UTR wasused as a control. Gene expression is monitored at the protein level withthe luciferase activity (Middle, standard deviation values of three indepen-dent transfections) and at the mRNA level (Bottom); relative mRNA concen-trations are estimated by RACE-PAT (30) and by Northern blotting. Errorbars indicating the standard deviation are given. *** shows statisticalsignificance (AspRS 3′ UTR fusions versus SV40 3′ UTR) at P < 0.001 (Welch’st test).

Rudinger-Thirion et al. PNAS ∣ October 4, 2011 ∣ vol. 108 ∣ no. 40 ∣ E795

BIOCH

EMISTR

YPN

ASPL

US

SEECO

MMEN

TARY

be distinguished: (i) Eleven tRNA sequences are identical andconsidered as the reference molecules (tRNAAsp69, 72, 75, 78,81, 10, 12, 4, 38, 45, and 48), (ii) five contain at most 6 mutationsthat do not affect conserved residues (tRNAAsp46, 22, 6, 144, and5), and (iii) three sequences differ significantly from the referenceby 11 to 13 mutations (tRNAAsp3, 48, and 7). This last family dis-plays major variations in the variable region and/or in the T-loopsequence. Indeed, tRNAAsp48 has a G54 instead of the strictlyconserved U54 in its T loop, whereas tRNAAsp3 and 7 have botha shorter variable region made up of only 2 nt instead of 3. Inaddition, tRNAAsp7 has a T56 instead of a C56 in the conservedmotif TΨC defining the T loop. Despite these major sequencevariations, all three unconventional tRNAAsp sequences couldstill adopt, in theory, the classical cloverleaf tRNA structure;however, tertiary interactions between the D and T loops areunlikely (Fig. S2).

The reference tRNAAsp sequence (tRNAAsp69), as well astRNAAsp3, tRNAAsp48, and tRNAAsp7, were produced by in vitrotranscription and assayed for their capacity to be aminoacylatedby human AspRS. Surprisingly, whereas tRNAAsp69 is efficientlyaspartylated, none of the other isodecoders tested are substratesfor AspRS in vitro (Fig. S2), despite the conservation of the majoraspartate identity nucleotides (32).

All four tRNAs show large sequence complementarity withthe Alu insertion of AspRS mRNA 3′ UTR. Transcripts weretested for their ability to bind AspRS mRNA in vitro (Fig. 2B).Among them, only tRNAAsp7 formed a stable duplex with AspRSmRNA. Indeed, its migration is delayed when the full-lengthAspRS mRNA is added to the binding assay. This indicates thatspecific sequence or structural motifs in the tRNAAsp7 moleculeinduce a stable complex with the mRNA.

A

B

C

Fig. 2. Sequences of Homo sapiens tRNAAsp genes and characterization of the most divergent isodecoders. (A) Sequences of tRNAAsp genes registered in thegenomic tRNA database (http://lowelab.ucsc.edu/GtRNAdb/) are listed with their numbering and chromosome localization. The general 2D organization oftRNAs is specified on the top: “Acc” stands for acceptor arm, “D domain” for D arm and loop, “Ac domain” for anticodon arm and loop, “Δ” symbolizes thevariable region, and “T domain” stands for T arm and loop. Nucleotides in tRNAAsp isodecoders that differ from the most frequent tRNAAsp sequence areunderlined. A unique tRNAAsp7 homologue was identified in three primate genomes, namelyM.mulatta, P. troglodytes, andG. gorilla (boxed). (B) Detection ofputative complexes between tRNA isodecoders and AspRS mRNA. Gel shift assays were performed with radio-labeled tRNAAsp69, 7, 48, or 3 in the presence (+)and absence (−) of 500 nM AspRS mRNA. (C) Detection of tRNAAsp7 in human total RNA. The RNA product corresponding to the trna7 gene, encoded onchromosome 12, was detected only by RT-PCR. A couple of primers have been specifically designed to hybridize (arrows) on the sequences surrounding theputative A and B boxes of tRNAAsp7. For two independent experiments (a and b), PCR controls were performed on the same RNA samples (DNase treated), notsubjected previously to reverse transcription. Resultant PCR products were then cloned and sequenced; they all matched tRNAAsp7 sequence.

E796 ∣ www.pnas.org/cgi/doi/10.1073/pnas.1103698108 Rudinger-Thirion et al.

Expression of endogenous tRNAAsp7 was verified in HeLacells. It was detectable only by RT-PCR and verified by sequen-cing, indicating that it is expressed at a very low level (Fig. 2C).

tRNAAsp7 Binds Specifically the Alu Insertion. Various transcripts ofAspRS mRNAwere tested for their capacity to bind tRNAAsp7 invitro (Fig. 3). P32-labeled tRNAAsp7 transcript was incubated withincreasing concentrations of (i) the full-length mRNA, (ii) the 3′UTR sequence (−23þ 633), (iii) a shorter version of the 3′ UTR(−23þ 279), (iv) the wild-type Alu sequence (−23þ 54), or (v) amutated Alu sequence. Whereas none of the mRNA variantsinteract with the canonical tRNAAsp69 (data shown for thefull-length mRNA only), all constructs, which contain the intactAlu insertion, strongly bind tRNAAsp7. Indeed, apparent KD isabout 250 nM, and only mutations within the Alu sequencehinder completely the interaction.

tRNAAsp7 Does Not Fold as a Cloverleaf. Structure mapping experi-ments were performed on the tRNAAsp7 transcript using enzy-matic probes. Nucleases T1 and S1 are known to specificallycleave unpaired nucleotides, whereas nuclease V1 is specific for

double-stranded and structured regions. Analysis of the cleavagepattern reveals that tRNAAsp7 does not fold into the expectedcanonical cloverleaf structure [see lanes minus Alu (−23þ 54)on the autoradiogram in Fig. S3A]. Indeed, accessibilities to sin-gle-stranded probes T1 and S1 (circled nt in Fig. 4A) are clearlypresent in the T, anticodon (Ac), and D arms, whereas in the dou-ble-stranded probe, V1 (arrows) cuts in the D loop of the putativecloverleaf structure.

Lead (Pb2þ) was further used to probe and compare the globalaccessibility of both tRNAAsp69 (reference tRNAAsp) andtRNAAsp7 (Fig. S3B). Profiles are drastically different betweenthe two molecules. The classical profile expected for the canoni-cal cloverleaf structure was obtained for tRNAAsp69; however,the profile corresponding to tRNAAsp7 reveals clear discrepan-cies, confirming the previous observations obtained with enzy-matic probes (Fig. 3B). In particular, the frequency of leadcleavages (lane 10 mM Pb2þ) is much lower for tRNAAsp7 com-pared to the reference tRNA, suggesting a more compact struc-ture. Only positions 24–30 and 50–59 show stronger hydrolysis.Based on all our in vitro probing data, we propose an alternativestructure (Fig. 3C), where tRNAAsp7 folds into an elongatedstructure containing a large internal loop made up by 16 nt. Theonly tRNA feature conserved in this structure corresponds to theacceptor stem.

However, the presence of two unexpected V1 cleavages (nt 44and 46) as well as the specific reactivity of residue G10, in bothenzymatic (T1, Fig. S3A) and lead (Fig. S3B) probing experi-ments, suggest that this loop may adopt a unique structure. Inter-estingly, the sequence context (nt 9–12 and 44–46) allows thefolding of the internal loop into an E-loop module, originallyfound in 5SrRNAs (33), with the residue G10 protruding fromthe structure. The E-loop structure is dependent on Mg2þ. Thus,lead probing was repeated in the presence of decreasing concen-trations of Mg2þ ions (Fig. S3B). Results indicate that theabsence of Mg2þ ions alters significantly the cleavage profile oftRNAAsp7. Above all, the lead cleavage at positions 10 disappearsand confirms the presence of an E-loop structure. Besides, leadcleavages decrease significantly at positions 13 and 14 and in-crease at positions 53 to 57 in the large internal loop.

Structure mapping experiments were performed on thetRNAAsp7 transcript alone or bound to the Alu (−23þ 54) se-quence, using enzymatic probes (Fig. S3A). The data of thesefootprinting experiments support not only the intermolecularinteraction but also the alternative fold. Indeed, 16 potentialbp can form between tRNAAsp7 and the Alu sequence (Fig. 4C).In particular, disappearance of single stranded specific cleavagesas well as appearance of double-stranded V1 cuts support theexistence of at least two out of three blocks of interactions (1and 3). In addition, most of the nucleotides protected by Alu(−23þ 54) binding are distributed around the E-loop platform.This suggests that this motif has a functional role in properly pre-senting the tRNAAsp7 residues that bind to the mRNA 3′ UTR.This was further confirmed by the progressive disappearance ofthe tRNAAsp7∕Alu sequence duplex in the presence of decreas-ing concentrations of Mg2þ ions in the test (Fig. S3C).

Binding of tRNAAsp7 Has an Allosteric Effect on 3′ UTR Folding. Long-range structural effects triggered by the binding of tRNAAsp7 onthe mRNA were investigated by probing nt 120 to 250 of the 3′UTR. Profiles, in the presence or absence of tRNAAsp7, werecompared, revealing numerous changes in reactivity (Fig. 5A).First, the occurrence of numerous strong stops in the control ex-periment (without RNAse treatment) indicates that the 3′ UTRis structured and interrupts reverse transcription. This observa-tion is supported by the fact that, in general, accessibilities forRNAses are rare in this region. Thus, any precise interpretationwould be difficult. However, we clearly see that, when tRNAAsp7is bound, the global pattern changes drastically, even 200 nt away

tRNAAsp69 tRNAAsp7

0 31 62

125

250

500

0

125

250

500

1,00

0

2,00

0

4,00

0

8,00

0

0 62

125

250

500

1,00

0

-23 +54

-23 +54

-23 A19

+279 +54

A19

+682 -23 +54

0 31 62

125

250

500

0

125

250

500

1,00

0

2,00

0

4,00

0

8,00

0

0

125

250

500

1,00

0

2,00

0

4,00

0

8,00

0

Fig. 3. Complex formation between tRNAAsp7 and AspRS 3′ UTR. The globalorganization of the different 3′ UTR variants is displayed. The resolution ofthe gels was adapted to the length of the tested mRNA: 1% agarose gels forthe longest mRNA transcripts (more than 700 nts) and 6% polyacrylamidegels for shorter ones (less than 300 nts). Increasing mRNA concentrationsare indicated at the tops of the autoradiograms, and dashed boxes designatethe mRNA concentration for which about 50% of the radio-labeled tRNAAsp7

is shifted (Kd). For each variant tested, tRNAAsp69was used as a control; hereonly the experiment performed with the full-length mRNA is presented.

Rudinger-Thirion et al. PNAS ∣ October 4, 2011 ∣ vol. 108 ∣ no. 40 ∣ E797

BIOCH

EMISTR

YPN

ASPL

US

SEECO

MMEN

TARY

from the binding site, indicating that most of the 3′ UTR, includ-ing the proximal poly(A) signal, reorganizes. We propose thattRNAAsp7 binding reshapes the 3′ UTR and, thereby, affects therecognition of the proximal poly(A) signal by the polyadenylationmachinery.

tRNAAsp7 Resides Within the Nucleus and Stimulates Expression of anAlu-ContainingmRNA.Because endogenous tRNAAsp7 is detectableonly by RT-PCR and sequencing, to distinguish it from the refer-ence tRNAAsp, tRNAAsp7 was expressed in culture cells. Two con-structs were designed, one enclosing 700 bp both upstream anddownstream of the tRNAAsp7 sequence, whereas the second wasshortened and conserved only 40 bp upstream of the tRNAAsp7.Both constructs were transfected into HeLa cells and exhibited si-milar expression levels, suggesting that the internal A and B boxsequences (see Fig. 2C) are sufficient for transcription by RNApolymerase III. Interestingly, cell fractionation experiments showthat, whereas tRNAAsp69 is localized in the cytosol, tRNAAsp7 isfound in the nucleus only (Fig. 5B), a prerequisite for this smallncRNA to participate in AspRS mRNA 3′ processing.

Overexpression of AspRS appeared to be toxic in primatecells. These observations support the idea that the concentrationof AspRS is tightly regulated and that any increase (or decrease)in the level of this housekeeping enzyme is poisonous for thecell, a situation we faced already with yeast AspRS (34, 35).Therefore, these experiments could not be performed directlyon the human AspRS mRNA, and we decided to use a luciferasereporter gene strategy. Likewise, overexpression of tRNAAsp7was toxic for primate cells due to interference with the endogen-ous AspRS expression and/or possible off-target effects (recogni-tion of irrelevant Alu sequences). Therefore mouse Hepa 1–6 cellappeared as an interesting alternative model. In addition, notRNAAsp7 homolog is found in the mouse genome, preventingany interference with the reporter system expression.

The Luc reporter gene fused to the wt 3′ UTR (−23þ 682)of AspRS mRNA (Fig. 1) was cotransfected with plasmids encod-ing tRNAAsp69 or tRNAAsp7 in Hepa 1–6 cells (at low concen-tration to mimic HeLa conditions). Fig. 5C shows that Lucactivity is increased about 2-fold in the presence of tRNAAsp7,

compared to the control experiment with tRNAAsp69. This effectis dependent on the presence of the AspRS 3′ UTR, because nostimulatory effect was observed when the SV40 UTR is fused tothe Luc reporter gene (Fig. 5C). This result indicates that bindingof tRNAAsp7 to the Alu insertion in AspRS mRNA 3′ UTR sup-ports protein expression.

DiscussionA Previously Undescribed Model: Alternative Polyadenylation IsDriven by an ncRNA. Most mRNA regulatory elements are foundwithin their mRNA untranslated regions. Whereas the 5′ UTR ismainly involved in controlling mRNA translation (36), the 3′UTRregulates multiple aspects of mRNA metabolism. In particular,3′ end processing, or polyadenylation is necessary to promote nu-clear export of mRNA, to protect mRNA from degradation and toenhance translation (37). This process involves two steps duringwhich pre-mRNA is first cleaved at a specific site and then adenineresidues are added (29). More than 50% of mammalian mRNAsare subjected to polyadenylation at multiple poly(A) sites, thusgenerating distinct mRNA isoforms with 3′ UTRs of variablelengths. Previous studies concluded that alternative polyadenyla-tion shows a higher frequency in tissue-specific regulation thanother forms of alternative events (23). However, little is knownabout how selection is made between different cleavage sites (38).In the proposed model, we considered tRNAAsp7 as a putative ef-fector directing alternative polyadenylation of the human AspRSmRNA. Furthermore, this scenario is supported by previous stu-dies showing that all known cases of aaRS regulation use cognatetRNA or tRNA mimics (39).

Our findings are consistent with a mechanism for RNA-medi-ated alternative polyadenylation wherein the binding of a shortncRNA switches the availability of two poly(A) signals (Fig. 6).When the ncRNA (tRNAAsp7) concentration is low (or absent,as is the case in mouse cells), the newly transcribed mRNA canadopt two alternative structures that expose the proximal or thedistal poly(A) signal (Fig. 6). The occurrence of a short 3′ UTRdestabilizes the mRNA (Fig. 6A) and reduces AspRS expression,whereas 3′ end processing at the distal poly(A) signal (Fig. 6B)produces a long and stable 3′ UTR: a suitable template for trans-

Fig. 4. tRNAAsp7 adopts an alternative secondary structure. Data of enzymatic probing are summarized on tRNAAsp7 (A) putative cloverleaf representationor on (B) an alternative structure. Positions cut by single stranded probes (S1 and T1) are specified with circles and V1 cleavages are indicated with arrows. TheE-loop motif is squared. (C) Putative interactions with the Alu insertion of AspRS mRNA 3′ UTR are distributed within three blocks (1, 2, and 3). Results offootprinting experiments in the presence of Alu (−23þ 54) are indicated: Nt protected from S1 and T1 digestion are gray-colored; increased accessibilities areshown with thick open circles (S1 and T1) and triangles (V1).

E798 ∣ www.pnas.org/cgi/doi/10.1073/pnas.1103698108 Rudinger-Thirion et al.

lation. Conversely, when the ncRNA concentration is high, itsbinding to the primate-specific Alu insertion stabilizes allostericchanges in the 3′UTR folding, burying nucleotides at the proximalpoly(A) site and exposing the distal one (Fig. 6B).

This model is supported by the results of the Alu sequencemutagenesis and deletion, which lead to similar increases inmRNA stability than the removal of the proximal poly(A) signal

(Fig. 1). Indeed, changes in the Alu sequence prevent the pre-dicted intramolecular interaction with nt 184–198 (16 potentialbp), which in turn can cover the proximal poly(A) signal (12potential bp) (Fig. 6). Moreover, the restricted localization oftRNAAsp7 in the nuclear compartment is in agreement with thismodel, because it is accepted that pre-mRNA 3′ end processingoccurs cotranscriptionally (40).

A

B

Fig. 6. Model for the regulation of AspRSexpression via alternative polyadenylationof its mRNA 3′ UTR. (A) Processing of the 3′UTR in absence of tRNAAsp7. Nts 16–34within the Alu insertion hybridizes withnt 184–198 of the 3′ UTR, forming a16 bp duplex. This interaction allows theexposure of the proximal poly(A) signalfor early maturation. The resulting short3′ UTR destabilizes the mRNA and preventsprotein expression. (B) Processing of the 3′UTR in presence of tRNAAsp7. tRNAAsp7

binds cotranscriptionally, nts 19–37 (23-bpduplex) in the Alu insertion, thereforeallowing nts 187–199 to fold back on theproximal poly(A) signal (12 bp with nts147–160) and hide it from the polyadeny-lation machinery. Maturation takes placeat the distal poly(A) signal and producesa stable mRNA for efficient translation.Primate-specific Alu insertion is indicatedin orange, both poly(A) signals (1 and 2)are blue, and tRNAAsp7 is represented ingreen.

AU G C

T1 S1 V1 c - + - + - + tRNAAsp7

200

235

190

180

170

160

150PolyA1

Alu

B

C

tRNAAsp7

Cytosol Nucleus tRNAAsp7 - + - +

SnRNAU6

tRNAAsp69

c

c

0

1

2

3

0

1

2

3 ***

tRNAAsp69 tRNAAsp7

Luc

activ

ity

tRNAAsp69 tRNAAsp7

Luc

activ

ity

Fig. 5. Functional study of tRNAAsp7. (A) Long-range rearrangement of AspRS 3′ UTR upon tRNAAsp7 binding. Autoradiogram of 12% denaturing gels dis-playing probing experiments performed on nt 100 to 250 of the 3′ UTR (in the context of the full-length AspRS mRNA), in the absence (−) or presence (+) oftRNAAsp7. Experiments were performed with RNases T1 (0.4 U), S1 (5.4 × 10−3 U) and V1 (8.3 × 10−3 U). Sequencing (C, G, U) (62) allowed numbering. Thedashed box highlights the position of the proximal poly(A) signal. The Alu insertion, which binds tRNAAsp7, is also indicated about 100 nt upstream (topof the autoradiogram). (B) Nuclear localization of tRNAAsp7. RNA molecules were detected by premature chain termination primer extension, which allowselongation of radio-labeled specific primers by 10, 11 and 8 nt matching tRNAAsp69, tRNAAsp7 and SnRNAU6, respectively. Controls (c) were run on in vitrotranscribed tRNAAsp7 and tRNAAsp69. Nuclear and cytosolic fractionation is identified by the presence of SnRNAU6 and tRNAAsp69, respectively. (C) Luciferaseactivity. Hepa 1–6 cells were cotransfected with pRL-CMV (SV40-3′ UTR) or pRL-CMV-WT-3′ UTR (WT-3′ UTR) and pSK-tRNAAsp69 or pSK-tRNAAsp7 and assayedfor luciferase activity (deviation values of four independent transfections). Errors bars indicating the standard deviation are given. *** shows statisticalsignificance (tRNAAsp7 versus tRNAAsp69) at P ¼ 0.0006 (Welch’s t test).

Rudinger-Thirion et al. PNAS ∣ October 4, 2011 ∣ vol. 108 ∣ no. 40 ∣ E799

BIOCH

EMISTR

YPN

ASPL

US

SEECO

MMEN

TARY

However, because our results were derived from a reportersystem, we cannot exclude that additional mechanisms mightbe involved in the endogenous mRNA regulation, such as nuclearexport, specific localization, degradation, or translational control.

An Alternative Fold of a tRNA-Derived Sequence Is Functional. tRNAisodecoders are defined as tRNA molecules sharing the sameanticodon but diverging elsewhere in their sequence (up to 274different tRNA species are produced from 446 genes in human)(31). Like all tRNA isodecoders, the tRNAAsp7 sequence con-tains all the information necessary to maintain the classicalcloverleaf structure (Fig. S2). It also displays the functional resi-dues identified as aminoacylation determinants (41). However,tRNAAsp7 is not a substrate for aminoacylation; the main reasonis that tRNAAsp7 adopts an alternative fold, deprived of the struc-tural tRNA characteristics. This is consistent with its low tRNAs-can score (32.3) compared to the reference tRNAAsp69 (72.9)(http://gtrnadb.ucsc.edu/). However, the alternative architectureis able to drive duplex formation with the AspRS mRNA 3′UTR.The E-loop module present in the alternative fold plays a majorrole in stabilizing and in organizing the surrounding nucleotidesto properly present the residues involved in the interaction. Thisstudy indicates that among eukaryotic tRNA isodecoders, someof them may direct posttranscriptional regulation. This possibilityhas already been anticipated by colleagues, who proposed thatsuch functional relevance might explain the higher diversity inhuman tRNA isodecoders (42).

On the other hand, Alu insertions are widely spread over thehuman genome, and some of them could also be the target oftRNAAsp7. However, only AspRS mRNA carries this exact Aluinsertion, and a specific scaffold certainly plays also a major roleto permit optimal binding between both RNA molecules.

Toward a Function for a Primate-Specific Control of AspRS Expression:A Bundle of Evidence. Alternative Polyadenylation Regulates AspRS.The involvement of polyadenylation in eukaryotic gene controlis becoming increasingly apparent, and our findings reveal thatprimate cells can use a tRNA-derived ncRNA to select alterna-tive polyadenylation sites. Thus, it controls the stability of AspRSmRNA, which encodes a protein involved in translation, a keybiochemical process. The major housekeeping function of aaRSsis indeed the attachment of amino acids to their cognate tRNAsduring translation (28). As aminoacylation of tRNAs is an essen-tial step in protein synthesis, this process proceeds with high spe-cificity (41) and necessitates the tuned expression of tRNAs andaaRSs. Several aaRS regulation pathways have been studied,especially in bacteria (43). They are not conserved in evolutionand differ from one aaRS to another, the only shared occurrencebeing the involvement of tRNA molecules or tRNA-like struc-tures in the regulatory mechanism (39). In the present study,because tRNAAsp7 is a RNA polymerase III transcript, it couldact as a sensor for tRNA transcription activity. This would linktwo essential processes, transcription and translation for overallcoordination and homeostasis of the cell.

AaRSs Are Housekeeping, yet Moonlighting Proteins. The relevanceof the aminoacylation activities of aaRSs is obvious. However, ithas recently become clear that some human aaRSs also possesstissue-specific functions, distinct from their role in translation.Indeed, different aaRSs define pathways such as angiogenesis[TyrRS, TrpRS, and AIMP1 (44–46)], the immune response[LysRS (47)], inflammation [GluProRS (48)], apoptosis [GlnRS(49)], but also neural development [AIMP1, GlyRS, AIMP2(50–52)], and tumorogenesis [LeuRS (53)]. The switch betweenthe canonical aminoacylation function of an aaRS and otheralternative functions might rely on a different process: (i) the oli-gomerization state, (ii) the subcellular localization, or (iii) the dif-ferential expression of the protein. In our case, the existence

of such a sophisticated regulatory mechanism controlling AspRSexpression suggests that AspRS could also have additional func-tions involved in physiological processes.

Toward Tissue-Specific Expression of AspRS. We propose that thepresent regulation mechanism would control AspRS tissue-spe-cific accumulation in a primate-specific regulation pathway suchas immunity, development, or tumorogenesis. In an attempt toidentify such a putative pathway, we explored the large amountof microarray data available (http://www.ncbi.nlm.nih.gov/sites/GDSbrowser), searching for reliable results where only humanAspRS mRNA would be overexpressed, compared to other aaRSmRNAs. We found four conditions where AspRS mRNA indeedaccumulates (2-fold increase for AspRS mRNA compared to anaverage 2-fold reduction for the other aaRS mRNAs). Interest-ingly, the relevant microarray data concern different cell types,such as macrophages (GDS2036), B lymphocytes (GDS1807),breast cancer cells (GDS2758), and aortic smooth muscle cells(GDS3112). Yet these different tissues commonly overexpressAspRS mRNA when subjected to hypoxia. Hypoxia is a commoncondition present in many pathological situations, including in-flamed tissues, malignant tumors, atherosclerotic plaques,chronic venous insufficiency, healing wounds, etc. For example,tumor-associated macrophages respond to hypoxia by up-regulat-ing a broad array of genes, encoding proteins that promote theproliferation, invasion, and metastasis of cells as well as angiogen-esis (reviewed in refs. 54 and 55). These data support the neces-sity for the control of AspRS accumulation in hypoxic tissues.

ConclusionThe fraction of tRNA isodecoder genes increases all along thephylogenetic spectrum, and the expansion of Alu elements ischaracteristic of primate genomes. For primates, this opens largeperspectives regarding function and structure for the most diver-gent sequences and reveals the reservoir of potential regulatoryfunctions associated with tRNA- and Alu-derived sequences.Finally, the observation of this original posttranscriptional regu-lation mechanism points toward the discovery of a unique phy-siological pathway in which the contribution of AspRS isimplicated besides its usual roles in translation.

MethodsRT-PCR. The cDNA of tRNAAsp7was amplified from HeLa cells total RNA usingthe OneStep RT-PCR (Qiagen) following the supplier’s protocol. Two genespecific primers were designed: 5′- GGACTCAAACTCCAGTC-3′ was first usedfor the reverse transcription and then together with 5′-TCCTTGTTAGTA-TAGTGGTGAG-3′ for the PCR reaction. The PCR products were cloned intopCR2.1 (PCR cloning kit from Qiagen) and sequenced.

3′ RLM-RACE PCR. RLM-RACE by RLM-RACE PCR was run on three differenthuman RNA samples (brain, breast, and muscle, Ambion). Reverse transcrip-tion and nested PCR reactions were performed using the first choice RLM-RACE kit (Ambion). PCRs were run with two primers complementary tothe 3′ adaptor sequence and two nested primers hybridizing (i) at the endof the AspRS mRNA ORF sequence (5′-CCATGTTCCCTCGTGATCCCAAACG-3′)and (ii) directly downstream of the 19 A ending the Alu insertion in themRNA3′ UTR (5′-GTAACCTGCTAGTGCACAGGCTGTACTTTAGG-3′). PCR-amplifiedfragments were cloned into pDrive cloning vector (PCR cloning kit, Qiagen)and sequenced.

Preparation of Templates for in Vitro Transcription. Human tRNAAsp transcriptswere produced in vitro using the “transzyme” system (56). The transcriptswere purified on native 12% PAGE and electroeluted (Schleicher andSchuell). DNA sequences encoding the full-length AspRS mRNA (2,215 nt in-cluding the ORF and both the 5′ and 3′ noncoding regions) as well as the 3′UTR (−23þ 682) were PCR-amplified from a cDNA library (human musclecDNA library, Invitrogen) and cloned between EcoRI and XhoI in pXJ41 down-stream the T7 RNA polymerase promoter. Plasmids were linearized with XhoIbefore in vitro transcription (57). The reaction was stopped by acidic phenol/choloroforme extraction and transcripts were purified on a Sephagex G-25column (NAP-5, GE Healthcare). Shorter 3′ UTR variants, 3′ UTR (−23þ 279)

E800 ∣ www.pnas.org/cgi/doi/10.1073/pnas.1103698108 Rudinger-Thirion et al.

and Alu (−23þ 54), were cloned into pUC119 between BamHI and EcoRIrestriction sites, downstream of the T7 RNA polymerase promoter. In themutated version of the Alu insertion sequence 31GATGACAG38 was replacedby 31TAGTCACT38. Plasmids were linearized with EcoRI before in vitro tran-scription and transcripts were purified on a native 12% gel.

Aspartylation Assays. In vitro aspartylation of human tRNAAsp transcripts wasperformed as described previously (58).

Band-Shift Assays. 32P 3′-labeled tRNAAsp7 (1;000 cpm∕μL) (59) was incubatedfor 20 min at 37 °C in 25 mM Tris-HCl pH 7.5, 10 mMMgCl2, 50 mM NaCl, 10%glycerol, 40 ng∕μL 5SRNA with increasing concentrations of mRNA variants(30 to 8,000 nM). Bound and unbound RNA molecules were separated eitheron a 1% agarose gel, with Tris borate EDTA buffer containing 1 mM MgCl2for 2 h at 50 V [full-length mRNA and 3′ UTR (−23þ 682)] or on a 6% acryl/bisacrylamide (37.5∕1) gel 1 × TBE, for 90 min at 140 V [3′ UTR (−23þ 279)and Alu (−23þ 54)].

Structural Mapping Procedures. Structural mappings of tRNAAsp transcriptsand AspRS mRNA were done using chemical and enzymatic probes (Pb2þ

and T1, S1 and V1 nucleases). RNA digestions were performed in 25 mMTris-HCl pH 7.5, 10 mM MgCl2, and 50 mM NaCl, whereas lead-induced clea-vages were performed in 50 mM Tris acetate pH 7.5, 5 mM Mg acetate,50 mM KOH acetate, and 1 mM lead acetate (60).

tRNA transcripts were 32P 5′-labeled (61) and purified on NAP5. Thismolecule was used in (i) direct probing experiments and (ii) in RNA/RNA foot-printing experiments where tRNAAsp7 was preincubated in the presence of20 pmoles of Alu (−23þ 54) transcript prior modifications.

Longer transcripts such as 3′ UTR (−23þ 682) or full-length mRNA werefirst incubated with structural probes, and cleavage products were then re-vealed by reverse transcription as described elsewhere (62). Radio-labeledfragments were separated on a denaturing (8 M urea) 12% PAGE.

Constructs for Mammalian Cell Transfection. Wild-type 3′ UTR (−23þ 682) ofAspRS mRNA and its variants were PCR-amplified from genomic DNA andinserted into pRL-CMV vector (Promega) between the XbaI and BamHI,downstream of the Rluc reporter gene, instead of the SV40 late polyadenyla-tion signal. The cloned PCR fragment displays 50 nts below the distal poly-adenylation signal, in order to conserve all the downstream elementsnecessary for an efficient maturation. Luciferase activity assays wereachieved as indicated in the dual-Luciferase Reporter Assay System manual(Promega). Statistical significances were assessed using the Welch’s t test.Probability P values were calculated using the GraphPad Prism software.

tRNAAsp genes were PCR-amplified from genomic DNA (previouslydigested with KpnI and SphI). The resulting 1,450-bp amplicon spans posi-tions −700 to þ700 relative to the tRNA sequence and incorporates all the

upstream promoter and downstream regions required for efficient transcrip-tion and maturation. Regarding tRNAAsp7, another construct was designedwith only 40 residues upstream from the tRNA sequence to remove potentialupstream external transcriptional promoters. PCR products were then clonedinto pSK(−), between the NotI and XhoI.

Cell Culture and Transfection. HeLa (human epithelial) and Hepa 1–6 (mousehepatocytes) cells were cultured in DMEM, supplemented with 10% fetal calfserum, and 20 U∕mL streptomycin and penicillin at 37 °C with 5% CO2. At70–80% confluence, cells were transfected using DreamFect Gold reagent(OZBioscience). Hepa 1–6 were transfected using 100 ng pRL-CMV constructs,50 ng pGL3 vector (transfection efficiency control), and 10 ng pSK-tRNA perwell (24 well plate format). After 6 h incubation, the medium was changed,and the cells were further grown for 20 h. Mouse hepatocytes were chosen asa heterologous system because neither tRNAAsp7 nor the Alu insertion ispresent; hence the studied regulatory mechanism is absent in this cellularcontext.

Nucleus Purification. HeLa cells were transfected with 6 μg DNA (tRNAAsp7)per 10-cm dish for 24 h. Nuclei were purified from the cytosolic fractionas described at http://www.lamondlab.com/f7nucleolarprotocol.htm. RNAwas extracted from both nuclear and cytosolic fractions following the Tri-Reagent protocol (Sigma-Aldrich).

RACE-PAT. cDNAs were synthesized from total RNA using a poly-T/adapterprimer (gcgagcacagaattaatacgactcactataggðtÞ12). The amount of mRNAswithin the sample was determined by a standard PCR reaction in the presenceof [α-32P] dCTP.

Northern Blotting. Total cellular RNAs (15 μg) were run on 1% agarose gel andanalyzed by Northern blotting using the NorthernMax kit (Ambion) and 32Plabeled probes prepared with the NonaPrimer kit (Quantum Appligene).

Premature Chain Termination Primer Extension. Different tRNAAsp entitieswere specifically detected by chain termination primer extension (63), usingdideoxyoligonucleotides complementary to tRNAAsp69 (5′-GGGAATC-GAACCCCGGTC-3′), tRNAAsp7 (5′-AGTCTCCACATGACAG-3′), and SnRNAU6

(5′-GCAGGGGCCATGCTAATC-TTCTCTGTAT-3′).

ACKNOWLEDGMENTS. We thank Pascale Romby, Catherine Schuster, andEric Westhof for advice and stimulating discussions; Oliver Miller and MarieMessmer for critical reading of the manuscript. This work was supported bygrants from the Centre National de la Recherche Scientifique, Université deStrasbourg, and “La Ligue Contre Le Cancer.”

1. Batzer MA, Deininger PL (2002) Alu repeats and human genomic diversity. Nat RevGenet 3:370–379.

2. Hasler J, Strub K (2006) Alu elements as regulators of gene expression. Nucleic AcidsRes 34:5491–5497.

3. Tomilin NV (1999) Control of genes bymammalian retroposons. Int Rev Cytol 186:1–48.4. Brosius J (1999) Genomes were forged by massive bombardments with retroelements

and retrosequences. Genetica 107:209–238.5. Yakovchuk P, Goodrich JA, Kugel JF (2009) B2 RNA and AluRNA repress transcription by

disrupting contacts between RNA polymerase II and promoter DNA within assembledcomplexes. Proc Natl Acad Sci USA 106:5569–5574.

6. Mariner PD, et al. (2008) Human Alu RNA is a modular transacting repressor of mRNAtranscription during heat shock. Mol Cell 29:499–509.

7. Landry JR, Medstrand P, Mager DL (2001) Repetitive elements in the 5′ untranslatedregion of a human zinc-finger gene modulate transcription and translation efficiency.Genomics 76:110–116.

8. Britten RJ (2006) Almost all human genes resulted from ancient duplication. Proc NatlAcad Sci USA 103:19027–19032.

9. Hasler J, Samuelsson T, Strub K (2007) Useful ‘junk’: Alu RNAs in the human transcrip-tome. Cell Mol Life Sci 64:1793–1800.

10. Sobczak K, Krzyzosiak WJ (2002) Structural determinants of BRCA1 translational reg-ulation. J Biol Chem 277:17349–17358.

11. Spence J, Duggan BM, Eckhardt C, McClelland M, Mercola D (2006) Messenger RNAsunder differential translational control in Ki-ras-transformed cells. Mol Cancer Res4(1):47–60.

12. Vila MR, et al. (2003) Higher processing rates of Alu-containing sequences in kidneytumors and cell lines with overexpressed Alu-mRNAs. Oncol Rep 10:1903–1909.

13. Stuart JJ, Egry LA, Wong GH, Kaspar RL (2000) The 3′ UTR of human MnSOD mRNAhybridizes to a small cytoplasmic RNA and inhibits gene expression. Biochem BiophysRes Commun 274:641–648.

14. Krichevsky AM,Metzer E, Rosen H (1999) Translational control of specific genes duringdifferentiation of HL-60 cells. J Biol Chem 274:14295–14305.

15. Vidal F, et al. (1993) Coordinated posttranscriptional control of gene expression bymodular elements including Alu-like repetitive sequences. Proc Natl Acad Sci USA90:208–212.

16. Kramerov DA, Vassetzky NS (2005) Short retroposons in eukaryotic genomes. Int RevCytol 247:165–221.

17. Sorek R, Ast G, Graur D (2002) Alu-containing exons are alternatively spliced. GenomeRes 12:1060–1067.

18. Levanon D, Groner Y (2004) Structure and regulated expression of mammalian RUNXgenes. Oncogene 23:4211–4219.

19. Lin-Ling C, DeCerbo JN, Carmichael GG (2008) Alu element-mediated gene silencing.EMBO J 27:1694–1705.

20. Gong C, Maquat LE (2011) IncRNAs transactivate STAU1-mediated mRNA decay byduplexing with 3′ UTRs via Alu elements. Nature 470:284–290.

21. An HJ, Lee D, Lee KH, Bhak J (2004) The association of Alu repeats with the generationof potential AU-rich elements (ARE) at 3′ untranslated regions. BMC Genomics 5:97.

22. Roy-Engel AM, et al. (2005) Human retroelements may introduce intragenic poly-adenylation signals. Cytogenet Genome Res 110:365–371.

23. Wang ET, et al. (2008) Alternative isoform regulation in human tissue transcriptomes.Nature 456:470–476.

24. Koscielny G, et al. (2009) ASTD: The alternative splicing and transcript diversity data-base. Genomics 93(3):213–220.

25. Tian B, Hu J, ZhangH, Lutz CS (2005) A large-scale analysis of mRNApolyadenylation ofhuman and mouse genes. Nucleic Acids Res 33:201–212.

26. Yan J, Marr TG (2005) Computational analysis of 3′-ends of ESTs shows four classes ofalternative polyadenylation in human, mouse, and rat. Genome Res 15:369–375.

27. Lutz CS (2008) Alternative polyadenylation: A twist on mRNA 3′ end formation. ACSChem Biol 3:609–617.

28. Ibba M, Francklyn C, Cusack S (2005) The aminoacyl-tRNA synthetases (LandesBiosciences, Georgetown, TX).

29. Millevoi S, Vagner S (2010) Molecular mechanisms of eukaryotic pre-mRNA 3′ endprocessing regulation. Nucleic Acids Res 38:2757–2774.

Rudinger-Thirion et al. PNAS ∣ October 4, 2011 ∣ vol. 108 ∣ no. 40 ∣ E801

BIOCH

EMISTR

YPN

ASPL

US

SEECO

MMEN

TARY

30. Salles FJ, Richards WG, Strickland S (1999) Assaying the polyadenylation state ofmRNAs. Methods 17:38–45.

31. Goodenbour JM, Pan T (2006) Diversity of tRNA genes in eukaryotes. Nucleic Acids Res34:6137–6146.

32. Pütz J, Puglisi JD, Florentz C, Giegé R (1991) Identity elements for specific aminoacyla-tion of yeast tRNAAsp by cognate aspartyl-tRNA synthetase. Science 252:1696–1699.

33. Leontis NB, Westhof E (1998) The 5S rRNA loop E: Chemical probing and phylogeneticdata versus crystal structure. RNA 4:1134–1153.

34. Frugier M, Ryckelynck M, Giegé R (2005) tRNA-balanced expression of a eukaryal ami-noacyl-tRNA synthetase by an mRNA-mediated pathway. EMBO Rep 6:860–865.

35. Ryckelynck M, Paulus CA, Frugier M (2008) Post-translational modifications guardyeast from misaspartylation. Biochemistry 47:12476–12482.

36. Pickering BM, Willis AE (2005) The implications of structured 5′ untranslated regionson translation and disease. Semin Cell Dev Biol 16:39–47.

37. Moore MJ, Proudfoot NJ (2009) Pre-mRNA processing reaches back to transcriptionand ahead to translation. Cell 136:688–700.

38. Muro EM, et al. (2008) Identification of gene 3′ ends by automated ESTcluster analysis.Proc Natl Acad Sci USA 105:20286–20290.

39. Ryckelynck M, Giegé R, Frugier M (2005) tRNAs and tRNA mimics as cornerstones ofaminoacyl-tRNA synthetase regulations. Biochimie 87:835–845.

40. Colgan DF, Manley JL (1997) Mechanism and regulation of mRNA polyadenylation.Genes Dev 11:2755–2766.

41. Giegé R, Sissler M, Florentz C (1998) Universal rules and idiosyncratic features in tRNAidentity. Nucleic Acids Res 26:5017–5035.

42. Dittmar KA, Goodenbour JM, Pan T (2006) Tissue-specific differences in human trans-fer RNA expression. PLoS Genet 2:e221.

43. Putzer H, Grunberg-Manago M, Springer M (1995) Bacterial aminoacyl-tRNA synthe-tases: Genes and regulation of expression. tRNA: Structure, Biosynthesis, and Function,eds D Söll and UL RajBhandary (American Society for Microbiology, Washington, DC),pp 293–333.

44. Wakasugi K, Schimmel P (1999) Highly differentiated motifs responsible for twocytokine activities of a split human tRNA synthetase. J Biol Chem 274:23155–23159.

45. Otani A, et al. (2002) A fragment of human TrpRS as a potent antagonist of ocularangiogenesis. Proc Natl Acad Sci USA 99:178–183.

46. Park SG, et al. (2002) Dose-dependent biphasic activity of tRNA synthetase-associatingfactor, p43, in angiogenesis. J Biol Chem 277:45243–45248.

47. Yannay-Cohen N, et al. (2009) LysRS serves as a key signaling molecule in the immuneresponse by regulating gene expression. Mol Cell 34:603–611.

48. Mukhopadhyay R, Jia J, Arif A, Ray PS, Fox PL (2009) The GAIT system: A gatekeeper ofinflammatory gene expression. Trends Biochem Sci 34:324–331.

49. Ko YG, et al. (2001) Glutamine-dependent antiapoptotic interaction of humanglutaminyl-tRNA synthetase with apoptosis signal-regulating kinase 1. J Biol Chem276:6030–6036.

50. Zhu X, et al. (2009) MSC p43 required for axonal development in motor neurons. ProcNatl Acad Sci USA 106:15944–15949.

51. Antonellis A, et al. (2003) Glycyl tRNA synthetase mutations in Charcot-Marie-Toothdisease type 2D and distal spinal muscular atrophy type V. Am J Hum Genet72:1293–1299.

52. Choi JW, Um JY, Kundu JK, Surh YJ, Kim S (2009) Multidirectional tumor-suppressiveactivity of AIMP2/p38 and the enhanced susceptibility of AIMP2 heterozygous mice tocarcinogenesis. Carcinogenesis 30:1638–1644.

53. Shin SH, et al. (2008) Implication of leucyl-tRNA synthetase 1 (LARS1) over-expressionin growth and migration of lung cancer cells detected by siRNA targeted knock-downanalysis. Exp Mol Med 40:229–236.

54. Murdoch C, Muthana M, Lewis CE (2005) Hypoxia regulates macrophage functions ininflammation. J Immunol 175:6257–6263.

55. Lewis C, Murdoch C (2005) Macrophage responses to hypoxia: Implications for tumorprogression and anti-cancer therapies. Am J Pathol 167:627–635.

56. Fechter P, Rudinger J, Giegé R, Théobald-Dietrich A (1998) Ribozyme processed tRNAtranscripts with unfriendly internal promoter for T7 RNA polymerase: Production andactivity. FEBS Lett 436:99–103.

57. Ryckelynck M, Giegé R, Frugier M (2003) Yeast tRNAAsp charging accuracy is threa-tened by the N-terminal extension of aspartyl-tRNA synthetase. J Biol Chem278:9683–9690.

58. Bour T, et al. (2009) Plasmodial aspartyl-tRNA synthetases and peculiarities in Plasmo-dium falciparum. J Biol Chem 284:18893–18903.

59. FrugierM,Moulinier L, Giegé R (2000) A domain in the N-terminal extension of class IIbeukaryotic aminoacyl-tRNA synthetases is important for tRNA binding. EMBO J19:2371–2380.

60. Bonnefond L, Florentz C, Giegé R, Rudinger-Thirion J (2008) Decreased aminoacylationin pathology-related mutants of mitochondrial tRNATyr is associated with structuralperturbations in tRNA architecture. RNA 14:641–648.

61. Frugier M, Giegé R (2003) Yeast aspartyl-tRNA synthetase binds specifically its ownmRNA. J Mol Biol 331:375–383.

62. Henriet S, et al. (2005) Cooperative and specific binding of Vif to the 5′ region of HIV-1genomic RNA. J Mol Biol 354:55–72.

63. Rederstorff M, et al. (2008) Ex vivo correction of selenoprotein N deficiency in rigidspine muscular dystrophy caused by a mutation in the selenocysteine codon. NucleicAcids Res 36:237–244.

E802 ∣ www.pnas.org/cgi/doi/10.1073/pnas.1103698108 Rudinger-Thirion et al.