PATRICK VAN HOVE

LIMNOLOGIE DU NORD DE L’ÎLE D’ELLESMERE: RÉPONSE ET SENSIBILITÉ AUX CHANGEMENTS DE CLIMAT DANS LES ENVIRONNEMENTS EXTRÊMES

Thèse présentée à la Faculté des études supérieures de l’Université Laval

dans le cadre du programme de doctorat en Biologie pour l’obtention du grade de Philosophiae Doctor (Ph.D)

FACULTÉ DES SCIENCES ET DE GÉNIE UNIVERSITÉ LAVAL

QUÉBEC

NOVEMBRE 2005 © Patrick Van Hove, 2005

I

Résumé

Les lacs et les fjords du nord de l’Île d’Ellesmere, au Nunavut, renferment des écosystèmes

uniques qui dépendent de la glace pour le maintien de leur structure. Certains de ces « cryo-

écosystèmes » sont stratifiés en permanence, formés d’une couche d’eau douce flottant sur une

couche d’eau de mer. Ces stratifications sont entre autres dues à la limitation du brassage par le

vent en raison de la présence d’un couvert de glace permanent. Les travaux présentés ici ont

comme objectif principal d’évaluer la diversité limnologique et biologique des lacs côtiers du

nord de l’Île d’Ellesmere afin de mieux comprendre leur réponse aux changements

environnementaux et climatiques à deux échelles temporelles : leurs variations à long terme à

l’échelle de l’Holocène et leur réponse récente au climat dans le cours des dernières décennies.

D’abord, les différents environnements sont présentés comme faisant partie d’une

chronoséquence limnologique d’évolution du paysage à l’échelle de l’Holocène, à partir d’un

fjord stratifié jusqu’à un lac d’eau douce en passant par un lac méromictique stratifié en

permanence. Les facteurs de changements des environnements sont ensuite explorés en observant

leur réponse aux changements climatiques récents. Puis, une étude de l’écologie microbienne de

ces lacs et de ces fjords est présentée, insistant sur la dominance des picocyanobactéries dans

leurs eaux de surface, en contraste avec les eaux de l’Océan Arctique, d’où sont issus ces milieux

aquatiques. Une analyse moléculaire de la diversité génétique des cyanobactéries a été également

effectuée et celle-ci met en valeur les grandes tolérances des cyanobactéries. Enfin, les

communautés de zooplancton présentes dans ces environnements sont étudiées, afin d’élargir le

portrait de ces environnements, et d’établir un point de base pour les études futures des

transformations causées par les changements climatiques. Cette région du globe est très sensible

aux changements climatiques, et les propriétés de ces écosystèmes tels que décrits ici sont un

point de départ pour l’évaluation des changements futurs.

II

Abstract

The lakes and fjords of northern Ellesmere Island, Nunavut, harbor unique ice-dependant

ecosystems. Some of these “cryo-ecosystems” are permanently stratified, with a freshwater layer

overlying sea water. This extreme stratification is due in part to the limitation of

wind-derived mixing because of the presence of a perennial ice-cover. The main objective of the

work presented here was to evaluate the limnological and biological diversity of coastal lakes of

northern Ellesmere Island in order to better understand their response to environmental change at

two timescales: their long term variations over the Holocene and their recent responses to climate

over the last few decades. The environments were shown to form a limnological chronosequence

that reflected landscape evolution at the Holocene timescale, from stratified fjords to freshwater

lakes, via phases in which the water bodies were stratified, meromictic lakes with different

degrees of wind-induced mixing depending on the duration of ice cover, from perennial to

seasonally open water conditions under warmer climates. Each of these phases is represented

today in northern Nunavut. The sensitivity of these stratified ecosystems to environmental change

at shorter timescales was then explored, by observing the limnological impacts of current climate

change in the Ellesmere Island region. As a first step towards addressing the question of

biodiversity and microbial community structure in these ecosystems, a molecular ecology

analysis of the lake and fjord biota was made, and underscored the dominance of

picocyanobacteria in their surface waters, in contrast with the low abundance of these microbes in

the Arctic Ocean, from which those aquatic environments originate. The DNA analysis of the

picocyanobacteria implied broad tolerances among these organisms, with the same genetic groups

found in a great variety of environments, both on a local and a planetary scale. Finally, a study

was undertaken of the zooplankton communities in a lake and fjord of northern Ellesmere Island

to develop a broader portrait of these unique ecosystems, and to establish a baseline for future

studies of the ongoing impacts of climate changes. This region of the globe is highly sensitive to

climate change, and the properties of these ecosystems as discovered and described here are

likely to undergo great transformations in the years to come.

III

Avant-propos

Cette thèse présente mes travaux de maîtrise et de doctorat qui ont été effectués sous la direction

du Professeur Warwick F. Vincent. Elle est composée de six chapitres dont quatre sont présentés

sous forme d’articles. Je suis premier auteur de tous ces articles et responsable pour la

planification, les travaux en équipe sur le terrain, la plupart des analyses en laboratoire ainsi que

pour le processus d’analyse des données et de rédaction.

Chapitre 1 - Introduction générale

Chapitre 2 – Coupled landscape-lake evolution in the coastal high Arctic.

Patrick Van Hove, Claude Belzile, John A.E. Gibson, Warwick F. Vincent

Soumis à Canadian Journal of Earth Sciences, sous rrévision

Chapitre 3 - Climate warming, loss of ice and impact on stratified lakes and fjords.

Patrick Van Hove, Derek Mueller, Warwick F. Vincent, Martin O. Jeffries

Sera intégré dans un manuscrit couvrant d’autres aspects des impacts des changements

climatiques au Nord d’Ellesmere

Chapitre 4 - Genetic diversity and distribution of picocyanobacteria in High Arctic lakes and

fjords: microbial generalists in diverse habitats.

Patrick Van Hove, Warwick F.Vincent, Annick Wilmotte

Sera soumis à Applied and Environmental Microbiology

Chapitre 5 - Farthest north lake and fjord populations of calanoid copepods Limnocalanus

macrurus and Drepanopus bungei in the Canadian High Arctic.

Patrick Van Hove, Kerrie M. Swadling, John A.E. Gibson, Claude Belzile, Warwick F. Vincent

Publié dans Polar Biology, 2001, volume 24, pages 202 à 207

Chapitre 6 - Conclusion générale

IV

En plus des articles présentés ici, j’ai participé durant mon doctorat à la rédaction d’autres articles

en lien avec les travaux présentés ici, principalement sur le Lac A :

.Bio-optical characteristics of the snow, ice and water column of a perenially ice-covered lake :

sensitivity to global change in the High Arctic.

Claude Belzile, Warwick F. Vincent, John A.E. Gibson, Patrick Van Hove

Publié dans Canadian Journal of Fisheries and Aquatic Sciences, 2001, 58: 2405-2418

Geochemistry of ice-covered, meromictic Lake A in the Canadian High Arctic.

John A.E. Gibson, Warwick F. Vincent, Patrick Van Hove, Claude Belzile, Xiaowa Wang, Derek

Muir

Publié dans Aquatic Geochemistry, 2002, 8: 97-119

Break-up and climate change at Canada’s northern coast, Quttinirpaaq National Park.

Warwick F. Vincent, Derek R. Mueller, Patrick Van Hove

Publié dans Meridian, 2004, Printemps/Été, 1-6

Glacial periods on early Earth and implications for the evolution of life.

Warwick F. Vincent, Derek R. Mueller, Patrick Van Hove, Clive Howard-Williams

Publié dans Origins : Genesis, Evolution and Diversity of Life, livre édité par Joseph Seckbach

and published by Kluwer Academic Publishers

V

Remerciements

J’aimerais tout d’abord remercier mon directeur de recherche, M. Warwick F. Vincent, qui est

demeuré un support et une inspiration par son dynamisme et son intérêt pour mes travaux. Mes

travaux n’auraient pas été possibles sans le support financier du Fonds pour la Formation des

Chercheurs et l’Aide à la Recherche (FCAR, maintenant FQRNT) qui m’a accordé une bourse

tout au long de mes études graduées. Les travaux sur le terrain qui ont été nécessaires pour la

poursuite de mes recherches comportaient d’énormes contraintes logistiques, et ont pu avoir lieu

grâce au support du CRSNG, du FCAR, de l’ArcticNet/Northern RiSCC, de l’ÉPCP et aussi de

Parcs Canada qui nous a autorisé à travailler sur le territoire du parc de Quttinirpaaq.

J’aimerais remercier Mme Annick Wilmotte pour m’avoir accueilli pendant cinq mois à son

laboratoire à l’Université de Liège, afin de compléter les travaux moléculaires présentés au

chapitre 4. Je voudrais souligner la contribution de mes co-auteurs qui ont collaboré à la rédaction

des articles qui forment cette thèse : Claude Belzile, John A.E. Gibson, Martin O. Jeffries, Derek

Mueller, Kerrie M. Swadling, Warwick Vincent et Annick Wilmotte. Je voudrais remercier les

membres de mon comité d’encadrement qui ont suivi le développement de mon projet depuis le

début de mes travaux de maîtrise : Sylvain Moineau et Reinhard Pienitz. Je voudrais aussi

grandement remercier M. Pienitz pour son rôle de prélecteur de cette thèse et M. Antonio

Quesada (Universidad Autonoma de Madrid) pour son rôle d’examinateur externe.

Des travaux de cette ampleur ne pourraient être accomplis seul, alors je voudrais remercier toute

l’équipe du laboratoire des études aquatiques de l’Université Laval qui m’a supporté pendant ces

cinq années, autant au laboratoire que sur le terrain, et spécialement Marie-Josée Martineau qui a

effectué certaines des analyses dont les résultats sont présentés ici et Derek Mueller qui a fourni

des données précieuses.

Je voudrais remercier ma famille, qui m’a épaulé tout au long de mon cheminement académique,

mes parents qui m’ont donné le goût du savoir et mon épouse qui est restée derrière moi malgré

les longues semaines de séparation dûes aux séjours à l’étranger ou sur le terrain.

À tous ceux qui ont contribué de près ou de loin à cette thèse et que j’oublie, j’envoie mes plus

sincères remerciements.

VI

À Elyse et Antoine,

VII

Table des matières

Résumé ............................................................................................................................................. I Abstract ........................................................................................................................................... II Avant-propos ..................................................................................................................................III Table des matières ........................................................................................................................ VII Liste des tableaux ...........................................................................................................................IX Liste des figures...............................................................................................................................X Chapitre 1 - Introduction Générale...................................................................................................1

1.1 Limnologie arctique ...............................................................................................................4 1.2 Changements de climat ..........................................................................................................4

1.2.1 Changements à long terme ..............................................................................................5 1.2.2 Changements à court terme .............................................................................................5

1.3 Biodiversité aquatique polaire................................................................................................6 1.4 Sites d’étude ...........................................................................................................................9 1.5 Objectifs de cette étude ........................................................................................................11

Chapitre 2 – Coupled landscape-lake evolution in the coastal high Arctic....................................13 2.1 Résumé .................................................................................................................................13 2.2 Abstract ................................................................................................................................14 2.3 Introduction ..........................................................................................................................15 2.4 Materials and Methods .........................................................................................................16

2.4.1 Sampling sites................................................................................................................16 2.4.2 Physico-chemical and biological characteristics ...........................................................19 2.4.3 Statistical analysis .........................................................................................................20

2.5 Results ..................................................................................................................................20 2.5.1 Physical properties ........................................................................................................20 2.5.2 Geochemical properties.................................................................................................22 2.5.3 Biological properties .....................................................................................................26 2.5.4 Statistical Analysis ........................................................................................................26

2.6 Discussion ............................................................................................................................27 Chapitre 3- Threshold effects of climate warming on stratified lakes and fjords of northern Ellesmere Island, Canada. ..............................................................................................................40

3.1 Résumé .................................................................................................................................40 3.2 Abstract ................................................................................................................................41 3.3 Introduction ..........................................................................................................................42 3.4 Materials and methods..........................................................................................................44

3.4.1 Description of study sites ..............................................................................................44 3.4.2 RADARSAT .................................................................................................................45 3.4.3 Profiling.........................................................................................................................45 3.4.4 Climate data...................................................................................................................46

3.5 Results ..................................................................................................................................46 3.5.1 Ice cover ........................................................................................................................46 3.5.2 Water column structure .................................................................................................47 3.5.3 Climate data...................................................................................................................50

3.6 Discussion ............................................................................................................................51

VIII

Chapitre 4 - Genetic diversity and distribution of picocyanobacteria in high Arctic lakes and fjords: microbial generalists in diverse habitats. ............................................................................63

4.1 Résumé .................................................................................................................................63 4.2 Abstract ................................................................................................................................64 4.3 Introduction ..........................................................................................................................65 4.4 Methods ................................................................................................................................67

4.4.1 Sampling sites................................................................................................................67 4.4.2 Sampling methods .........................................................................................................69 4.4.3 Molecular studies ..........................................................................................................70 4.4.4 Cloning ..........................................................................................................................71 4.4.5 Phylogenetic analysis ....................................................................................................71 4.4.6 Statistical analysis .........................................................................................................72

4.5 Results ..................................................................................................................................72 4.5.1 Limnological conditions................................................................................................72 4.5.2 Biological communities................................................................................................73 4.5.3 Molecular analyses ........................................................................................................73

4.6 Discussion ............................................................................................................................76 4.6.1 Cyanobacteria in polar lakes .........................................................................................76 4.6.2 Microbial endemism and climate change......................................................................77

Chapitre 5 - Farthest north lake and fjord populations of calanoid copepods Limnocalanus macrurus and Drepanopus bungei in the Canadian high Arctic ....................................................84

5.1 Résumé .................................................................................................................................84 5.2 Abstract ................................................................................................................................85 5.3 Introduction ..........................................................................................................................86 5.4 Materials and methods..........................................................................................................86 5.5 Results and Discussion.........................................................................................................88

Chapitre 6 – Conclusion générale ..................................................................................................96 Références bibliographiques ........................................................................................................100 Annexe 1 Données chimique des Lacs et Fjords de l’Ile d’Ellesmere. Chemical data from Lakes and Fjords of Ellesmere Island..........................................................109 Annexe 2 Alignement des séquences d’ADN des picocyanobactéries provenant des lacs et fjords du nord d’Ellesmere, et de quelques sites comparatifs. DNA sequences for picocyanobacteria from northern Ellesmere lakes and fjords, and from some comparative sites. .........................................................................................................................117

IX

Liste des tableaux

Table 2.1 : Location, date of visit, average ice thickness (± 1 SD), maximum depth (Zmax), and lake area of the ice-covered lakes and fjords. Lake A (1999), Disraeli Fjord and Taconite Inlet had multi-year ice cover while annual ice cover prevailed at the other sites. Water load was estimated as the product of the catchment area and annual precipitation divided by the lake area. Chl a values are given as an index of trophic status, and are the maximum concentrations observed in the water column. .......................................................................18

Table 2.2 : Concentrations of reactive nutrients in the high arctic aquatic environments. Total nitrogen (TN), total phosphorus (TP), TN:TP ratio, silicate (SiO2), Nitrate (NO3-N) and soluble reactive phosphorus (SRP). (n/r : not recorded). .......................................................23

Table 2.3 : Enrichment ratios of major ions and indicator constituents (Ba, total Mn and total Fe) compared to seawater in surface and sub-halocline waters (n/r : not recorded). ...................25

Table 3.1 : The depth and magnitude of thermal maxima in the meromictic lakes of northern Ellesmere Island for all reported dates of sampling, 1967-2004............................................48

Table 3.2 : Trend statistics for the climate data from Alert and Eureka presented in Fig 3.8, for the period 1967-present................................................................................................................50

Table 4.1 : Environmental conditions at sampled sites (sampling dates are given in Chapter 2). .68 Table 4.2 : Distribution of phylotypes among sampled sites. ........................................................74 Table 5.1 : Number of individuals of each species and life-cycle stage of zooplankton found in

net tows in Lake A, and sizes for these stages. For the number of individuals per tow, each value is the mean of two net hauls (range in parentheses)……………………………….….89

Table 5.2 : Number of each species and life-cycle stage of zooplankton in Disraeli Fjord from a 20 m tow (0.63 m3 filtered assuming a 100 % efficiency) .....................................................90

X

Liste des figures Figure 1.1 : Localisation des principaux sites d’étude en limnologie de haute latitude auxquels le

texte fait référence .....................................................................................................................2 Figure 2.1 : Map of the sampling sites. Pane A shows the whole Canadian Arctic Archipelago

(map from http://maps.grida.no/arctic/). Pane B shows the main study area on the northwestern shore of Ellesmere Island. Pane C shows the Taconite Inlet area, with the catchment areas for lakes C1, C2 and C3 outlined.................................................................32

Figure 2.2 : Physical limnology of the different studied environments. Conductivity profiles in mS.cm-1 are indicated by open triangles (note the different scales for Lakes C3 and Romulus). Temperature profiles are indicated by black circles (note the different scales for all of the environments)..........................................................................................................33

Figure. 2.3. Water column profiles at Char Lake, June 1999. A, conductivity (black circles) and temperature (open triangles); B, dissolved oxygen (black circles) and pH (open diamonds); C, dissolved organic carbon (DOC; open diamonds) and dissolved inorganic carbon (DIC; open triangles). .......................................................................................................................34

Figure 2.4 : Profiles of the oxydoreduction indicators. Dissolved oxygen profiles are shown by black circles, the profiles extend down to anoxic layer or end of cable. In Lake C1, the dissolved oxygen concentration exeeded the sensitivity of our sensor (>200% of saturation). Concentrations of total manganese (open diamonds) and total iron (open triangles) are also plotted. Note different scales for each site. ............................................................................35

Figure 2.5 : Profiles for pH (black circles), dissolved organic carbon (DOC) (open diamonds) and dissolved inorganic carbon (DIC) (open triangles). pH values are given on the same scale for all environments except Disraeli Fjord. DIC and DOC scales are different for all the sites. 36

Figure 2.6 : Beam attenuation coefficient profiles (c660) and particle absorption (ap) spectra at selected depths in Lake C1 on 19 June 2001 (panels A and C), and Lake A on 3 August 2001 (panels B and D). The numbers in panels C and D refer to the sample depths in metres. The dashed line marks the depth limit of the oxic zone. ...............................................................37

Figure 2.7 : Principal Component Analysis (PCA) of limnological descriptors for the 8 lakes and fiords. Eigenvalues for the two first axes were 0.412 and 0.282. CLratio = ratio of catchment area to lake area; DOC = maximum dissolved organic carbon concentrations measured in the water column; maxCond = maximum conductivity; Max T= maximum temperature; TP max = maximum total phosphorus concentrations; ZTmax = depth of the maximum temperature.................................................................................................................................................38

Figure 2.8 : Postulated evolutionary sequence for coastal, high latitude landscapes, embayments and lakes. ................................................................................................................................39

Figure 3.1 : Map of the Northern Ellesmere region. A : the Canadian Arctic Archipelago. B : the study region around the Marvin Peninsula.............................................................................54

Figure 3.2 : RADARSAT images of Lake A and B in the top panes and of Lakes C1, C2 and C3 in the lower panes. The RADARSAT data are © Canadian Space Agency/Agence spatiale canadienne. ..............................................................................................................................55

Figure. 3.3. Fine Beam RADARSAT-1 images of the northern end of Quttinirpaaq National Park, Nunavut, Canada. Note the recent ice break-up in Disraeli Fjord in 2003 and in Lake A and B in 2000 (black = recent open water). The RADARSAT data are © Canadian Space Agency/Agence spatiale canadienne 2003. ............................................................................56

Figure 3.4a : Lake A temperature profiles for the different years of sampling. The temperature data from 1967 are given as a dashed line in each plot for reference. ...................................57

XI

Figure 3.4b : Lake A salinity profiles for the different years of sampling. The salinity data from 1967 are given as a dashed line in each plot for reference. The arrows in 2003 and 2004 profiles point to a density feature that has moved down the water column between the years. Note the different depth scale than Fig. 3.4a..........................................................................58

Figure 3.5 : Temperature profiles from Lake B from three different years of sampling. The insert shows the salinity profiles. .....................................................................................................59

Figure 3.6 : Temperature profiles from Lakes C1, C2 and C3, salinity profiles from Lake C1 and Lake C2 and conductivity profiles from Lake C3. .................................................................60

Figure 3.7 : Salinity profiles from five High Arctic Fjords. The left panel shows the evolution of Disraeli Fjord from 1967 to 2004. Note different depth scale for both panels, dashed line in left panel indicates the depth of the right pane. Right panel shows the stratification of four other fjords. 2001 for Taconite, and 2004 for the other three. ...............................................61

Figure 3.8 : Temperature data from Alert and Eureka Station. Trendlines are given with 95% confidence limits and are plotted for the period of limnological observation of the region, from 1967 to 2004 inclusive...................................................................................................62

Figure 4.1 : The geographical location of sampling sites and the sources of cyanobacterial strains and clones analyzed in the present study. Pane A: the Canadian Arctic Archipelago, pane B: area surrounding the Marvin Peninsula..................................................................................80

Figure 4.2 : Profiles of temperature (black circles) and conductivity (open triangles) in two lakes where the clones were obtained..............................................................................................81

Figure 4.3 : Profiles of Chl a concentration (open triangles) and picocyanobacterial cell counts (black circles) in seven sampled environments from which samples for cloning and DGGE were obtained. Note two different years for Lake A. .............................................................82

Figure 4.4 : Phylogenetic tree of cyanobacterial strains from 16S rRNA sequences constructed using Jukes and Cantor’s parameters (1969) by the neighbor joining method, using TREECON software package. The sequences from this study are given in bold. Each cluster is identified with its signature sequence................................................................................ 83

Figure 5.1 : Location of Lake A and Disraeli Fjord on northern Ellesmere Island, Canadian High Arctic. .....................................................................................................................................92

Figure 5.2 : Water column properties of Lake A (8 June 1999). ...................................................93 Figure 5.3 : Water column properties of Disraeli Fjord (9 June 1999). .........................................94 Figure 5.4 : Stratum density of copepods in Lake A, northern Ellesmere Island, calculated from

differences between concentrations in tows from adjacent depths. .......................................95

1

Chapitre 1 - Introduction Générale

Le paysage du nord du Canada est dominé par les lacs et les rivières. La forêt boréale regorge de

milliers de lacs, et toute la portion du bouclier canadien au nord de la limite des arbres est une

vaste étendue de lacs, rivières, étangs et ruisseaux. Aux plus hautes latitudes de l’archipel

arctique canadien, les lacs sont encore une composante importante du paysage, même à l’extrême

nord des terres de l’Île d’Ellesmere, Nunavut (Fig. 1.1).

Les premières études sur les lacs polaires, effectuées à la fin des années 60, en particulier dans

l’Arctique, les présentaient en tant que systèmes extrêmes et presque abiotiques, caractérisés par

une biodiversité et une productivité biologique faibles. Au cours des décennies suivantes, cette

conception a été mise à l’épreuve et réfutée, suite à la découverte d’une grande diversité

d’écosystèmes aquatiques dans les régions polaires (Gibson 1999; Vincent et Hobbie 2000). Dans

la région arctique, cette diversité inclut des lacs proglaciaires, des étangs thermokarstiques, des

rivières riches en carbone organique, des lacs dilués et des rivières de glace, en plus d’une grande

variété de lacs d’eau douce et de lacs d’eau salée qui diffèrent tous par leurs structures physique,

chimique et biologique. Le nouvel intérêt sur la microbiologie de ces eaux a aussi réfuté la

conception de simplicité biologique. Dans beaucoup de ces écosystèmes on a maintenant décrit

des consortia microbiens complexes au sein de leurs communautés benthiques et pélagiques. Par

exemple, le Lac Bonney en Antarctique a déjà été considéré comme un environnement fermé et

un des systèmes biologiques les plus simples. Aujourd’hui par contre une myriade de taxons

microbiens avec des fonctions biogéochimiques complexes a été décrite dans ce lac et dans les

lacs voisins des Vallées Sèches de McMurdo (Lee et al. 2004; Lizotte et al. 1996; Vincent et al.

1981). Avec leurs propriétés limnologiques fascinantes, les lacs des régions polaires sont en ce

moment des sites majeurs de recherche (e.g., les sites Limnopolar, Toolik Lake, Québec

subarctique et Labrador, Vallées Sèches McMurdo, Île Signy, Svalbard, Mackenzie Delta lakes,

Vestfold Hills; Fig. 1.1) scrutés par les spécialistes de plusieurs disciplines, principalement de

l’écologie microbienne, de la biodiversité des milieux extrêmes, de la biogéochimie et de la

paléolimnologie.

2

Figure 1.1. Localisation des principaux sites d’étude en limnologie de haute latitude auxquels

le texte fait référence :

1. Nord de l’Île d’Ellesmere (étude présente) 2. Lac Char 3. Lacs du Delta du fleuve Mackenzie; Toolik Lake 4. Territoires du Nord Ouest 5. Nord du Québec et Labrador 6. Svalbard 7. Programme LIMNOPOLAR, Île Livingstone 8. Île Signy 9. Vestfold Hills 10. Vallées Sèches de McMurdo

3

La sensibilité des lacs polaires aux changements de climat et la grande valeur de ces écosystèmes

en tant que sentinelles des changements passés et présents est un autre thème important pour la

limnologie de haute latitude. Les modèles de circulation générale prédisent que les changements

les plus marqués au cours du prochain siècle seront localisés dans les régions circumpolaires,

avec le réchauffement le plus important en Arctique (Dai et al. 2004; Overland et al. 2004). Les

observations présentes de l’Arctique et de l’Antarctique (Mueller et al. 2003; Quayle et al. 2003)

suggèrent que ces changements sont déjà amorcés. Les lacs polaires se retrouvent dans des

bassins désertiques avec des apports minimes en carbone organique de la part de la végétation

éparse. De faibles changements liés au climat dans l’apport en matière organique peuvent avoir

un effet radical sur la couleur et la transparence de l’eau, affectant la transparence des lacs au

rayonnement ultraviolet (RUV) et à la radiation utilisable pour la photosynthèse (PAR). Pour

cette raison, les lacs de haute latitude ont été utilisés comme indicateurs optiques des

changements climatiques (Pienitz et Vincent 2000; Vincent et al. 1998; Vincent et al. 2005).

L’influence d’un couvert de glace permanent sur les propriétés limnologiques des lacs polaires est

un facteur qui dépend fortement du climat. De petites variations dans leur balance thermique

peuvent changer l’épaisseur et la durée du couvert de glace, ce qui aura une grande influence sur

leurs caractéristiques physiques, chimiques et biologiques (Doran et al. 1996; Quayle et al. 2003;

Vincent et al. 2005).

Cette étude doctorale porte sur la diversité limnologique des écosystèmes lacustres à la limite

nord du Canada, sur leur structure en tant qu’habitats pour la vie planctonique, autant au niveau

microscopique que macroscopique, et sur leur sensibilité aux changements climatiques passés et

présents. Je présente premièrement une brève introduction portant sur ces thèmes et ensuite

j’introduirai notre site d’étude au nord de l’Île d’Ellesmere. Cette introduction générale se

terminera avec un résumé des objectifs principaux qui ont motivé cette étude.

4

1.1 Limnologie arctique

Les lacs de l’Arctique sont souvent conceptualisés comme étant des lacs simples, peu productifs,

à l’eau claire, peu profonds et d’eau douce, par opposition aux lacs Antarctiques, qui sont un

groupe hétéroclite d’environnements étranges, de lacs hypersalins, de lacs au couvert de glace

permanent de plusieurs mètres d’épaisseur et aux tapis microbiens sortis tout droit du

précambrien. Cette vision est née de la grande attention qu’ont reçus deux lacs arctiques, le lac

Char et le lac Toolik (Fig. 1.1). Le premier, sur l’Île de Cornwallis, fut l’objet d’un programme

intensif de recherche dans les années 60 et 70 (Kalff et Welch 1974; Schindler et al. 1974; Welch

et Kalff 1974), et il est encore visité régulièrement par les limnologistes. Le lac Toolik, en

Alaska, est le site d’un LTER (Long-Term Ecological Research) et d’une base permanente de

recherche, construisant sur les travaux précédents de ce groupe sur les étangs de toundra dans les

années 70. Le fait est que l’Arctique renferme aussi des lacs et des environnements aquatiques

fascinants qui sortent du moule de la conception générale. Plusieurs fjords et lacs du Haut

Arctique demeurent couverts de glace pour une très grande partie de l’année, et même parfois

durant toute l’année. Ce couvert de glace permanent amène des conséquences importantes pour le

régime de stratification des lacs et des fjords, créant des environnements hautement stratifiés où

les influences marines et lacustres se rencontrent. Ces environnements sont malheureusement

encore mal décrits et peu connus, une lacune que la présente thèse se propose de commencer à

combler.

1.2 Changements de climat

Le débat sur les changements climatiques globaux est très actif depuis quelques années, et le

grand rapport du IPCC de 2001 a mis en évidence la situation : les connaissances actuelles

permettent sans grand doute d’affirmer que la planète est en train de se réchauffer. Les doutes

sont cependant plus grands quand vient le temps de déterminer si les températures actuelles

sortent de la « variabilité naturelle » et des oscillations cycliques du climat. L’emphase mise sur

les changements à l’échelle humaine tend à faire oublier que les derniers millénaires ont connu de

grands changements au niveau climatique.

5

1.2.1 Changements à long terme

Les changements climatiques à l’échelle de la dernière période postglaciaire ont une amplitude

beaucoup plus grande que les changements qui préoccupent les médias aujourd’hui. L’Amérique

du Nord, lors du dernier maximum glaciaire il y a près de 20 000 ans, était presque entièrement

couverte d’une calotte glaciaire de plusieurs kilomètres d’épaisseur, ce qui exerçait une pression

énorme sur le continent qui descendit de plusieurs centaines de mètres. Lors du retrait des

glaciers, une fois la pression relâchée, les terres remontèrent lentement. La grande quantité d’eau

douce relâchée par la fonte fit remonter le niveau des mers de concert avec le relèvement des

terres, ce qui a donné comme résultat que le niveau relatif des mers a augmenté à certains

endroits et a diminué à d’autres, dépendant de la pression qui avait été exercée sur différents

endroits du continent par la masse glaciaire (Peltier 2002). C’est cette caractéristique qui permet,

en détectant des terrasses marines fossiles, de déterminer l’histoire glaciaire des régions côtières

du Haut Arctique (England 1997). C’est ce phénomène de déglaciation qui a formé le paysage

actuel et qui forge encore le paysage dans le Haut Arctique. Les milieux aquatiques côtiers sont

grandement influencés par cette évolution et la compréhension des environnements côtiers de

haute latitude peut permettre de comprendre l’évolution des lacs des régions plus tempérées qui

ont subi ces changements il y a déjà plusieurs millénaires (Saulnier-Talbot et al. 2003).

1.2.2 Changements à court terme

Les changements climatiques actuels commencent à affecter directement les environnements

arctiques, là où la plupart des projections supposent le plus grand réchauffement pour le prochain

siècle dans l’hémisphère nord. Des indices concrets de ces changements sont déjà observables

dans les environnements qui dépendent de la glace pour maintenir leur intégrité, comme la

banquise arctique ou les plate-formes de glace (Mueller et al. 2003; Rothrock et al. 1999).

Des changements ont aussi été observés sur la côte nord de l’Île d’Ellesmere, près de notre site

d’étude dans la région de la Péninsule de Marvin, au cours du vingtième siècle et jusqu’à

maintenant. La disparition de la grande frange glaciaire qui couvrait la côte nord d’Ellesmere

jusqu’à l’Île d’Axel Heiberg est un des changements les plus dramatiques, détruisant des

6

écosystèmes aquatiques entiers sur la plate-forme de glace elle-même et aussi dans les fjords que

cette plate-forme bouchait (Mueller et al. 2003; Vincent et al. 2001). Des travaux

paléolimnologiques à Cap Herschel, dans la partie est de l’Île d’Ellesmere, suggèrent que ces

changements peuvent avoir commencé dès la moitié du 19e siècle (Douglas et al. 1994).

1.3 Biodiversité aquatique polaire

Les études faites sur les écosystèmes aquatiques arctiques ont commencé à révéler une diversité

insoupçonnée d’habitats et ceci a été accompagné par la découverte de nouveaux assemblages

d’espèces aux niveaux micro- et macroscopiques. Les études portant sur les réseaux alimentaires

ont principalement insisté sur le zooplancton, les animaux planctoniques se retrouvant entre les

producteurs primaires et les poissons. Ces animaux ont des cycles de vie s’étalant sur des

semaines ou sur des années, et sont donc des intégrateurs des environnements aquatiques à ces

échelles temporelles. Les études sur le zooplancton dans le Québec subarctique ont démontré un

assemblage diversifié d’espèces, principalement des copépodes (Swadling et al. 2001). Avant

l'étude présente, par contre, le zooplancton des lacs salins du nord du Nunavut n’était pas connu.

La plus grande révolution dans notre compréhension de la biodiversité des environnements

polaires, comme ailleurs dans la biosphère, est au niveau microbien. Les améliorations des

techniques d’observation (e.g., microscopie à fluorescence) et les approches moléculaires (e.g.,

librairie de clones du gène 16S tiré d’un échantillon d’ADN environnemental) ont ouvert un

nouvel horizon de richesse biologique, tel que noté dans une revue récente (Nee, 2004):

"...by any criterion – biomass or numbers of individuals – life on Earth is microscopic. It is the

new generation of explorers of this 'invisible' world who are transforming our world view beyond

recognition.... Our awareness of the astonishing range of environments in which microbial life

can thrive continues to expand."

L’application de ces nouvelles perspectives aux lacs des régions polaires commence à montrer

que ces environnements renferment une abondance et une diversité de microorganismes excitante

quoique mal connue encore. Cette diversité inclut les virus, les bactéries et les protistes (algues et

protozoaires), trois groupes qui seront examinés dans l’étude présente.

7

La recherche de virus environnementaux dans les lacs polaires est dans les premières étapes de

son développement. Des particules ayant l’apparence de virus (ou VLP, pour “viral-like

particles”) ont été détectées pour la première fois dans un lac des Vallées Sèches de McMurdo en

Antarctique où elles ont été observées en relativement haute concentration dans la colonne d’eau.

Les auteurs suggéraient qu’une grande partie de ces particules devait être des bactériophages,

incluant des cyanophages attaquant les tapis microbiens épais qui couvrent le fond de ces lacs.

Une des rares études quantitatives des populations virales dans l’Arctique a porté sur les tapis

microbiens dans les lacs de fonte à la surface de la plate-forme de Glace de Ward Hunt. Ces

consortiums microbiens contenaient de grandes concentrations de VLP ainsi que des bactéries

hétérotrophes (Vincent et al. 2000b).

Les bactéries hétérotrophes et autotrophes sont une composante importante du réseau alimentaire

des lacs Arctiques et Antarctiques, jouant un rôle clé dans le recyclage des nutriments comme

l’azote (Vincent et al. 1981) et le soufre (Lee et al. 2004). La transformation du carbone

organique en dioxyde de carbone par les espèces hétérotrophes a beaucoup attiré l’attention des

écologistes marins et d’eau douce, puisque le réservoir principal de carbone dans la biosphère est

le carbone organique dissous, et que son oxydation par les bactéries pourrait accélérer de façon

drastique l’accumulation de gaz à effet de serre dans l’atmosphère. Les études classiques faites au

lac Char précédaient le développement de techniques telles la microscopie à épifluorescence, et,

par conséquent, peu d’information sur ces communautés est disponible dans la littérature du

début de la limnologie polaire. Ces études commencent à arriver à l’avant-plan de la recherche

limnologique, et dans l’étude présente nous présentons certaines des premières mesures

d’abondance bactérienne dans les lacs à la limite nord du Haut Arctique.

Un groupe de bactéries autotrophes qui joue un rôle très important dans plusieurs écosystèmes

polaires est les cyanobactéries. Il existe trois groupes principaux de ces organismes

photosynthétiques oxygéniques : celles qui forment des tapis, celles qui forment des floraisons, et

les picoplanctoniques. Les cyanobactéries formant des tapis microbiens se retrouvent souvent

dans les lacs, les étangs, les rivières et les ruisseaux de l’Arctique et de l’Antarctique, où elles

recouvrent le substrat de ces systèmes, et dans les systèmes peu profonds contribuent à une

fraction très importante de la production totale de biomasse de l’écosystème (Tang et al. 1997;

8

Vézina et Vincent 1997). Les cyanobactéries formant des floraisons telles que Aphanizomenon,

Anabaena et Microcystis sont très communes aux plus basses latitudes, mais pratiquement

absentes dans les régions polaires, probablement à cause de leur besoin d’une colonne d’eau

chaude et stratifiée pour arriver à la dominance (Vincent 2000a). Elles pourraient devenir plus

importantes, avec tous les problèmes de qualité d’eau, de toxines et de perturbation des réseaux

alimentaires qui les accompagnent avec la transformation du climat aux hautes latitudes. Le

troisième groupe, qui est l’intérêt principal de cette thèse, est les picocyanobactéries. Celles-ci

sont des cellules coccoïdes individuelles de très petites dimensions (moins de 2 µm de diamètre).

Elles peuvent être détectées par microscopie à épifluorescence ou par microscopie électronique,

et même si elles pourraient constituer une partie importante de la biomasse planctonique totale,

elles sont passées inaperçues dans les études classiques sur les lacs polaires.

Un des groupes à la plus grande diversité fonctionnelle présentement à l’étude dans les lacs

polaires est celui des protistes, les eucaryotes uni-cellulaires qui incluent des taxons algaux et

protozoaires. Certains de ces organismes sont hétérotrophes, d’autres sont phototrophes, et

d’autres enfin sont mixotrophes, combinant les deux modes de capture d’énergie. Par exemple, le

genre Dinobryon, commun dans les lacs nordiques (Villeneuve et al. 2001), est un mixotrophe

bien connu, et des expériences de broutage effectuées sur l’Île Svalbard (Norvège) ont montré

qu’il pourrait utiliser directement les bactéries hétérotrophes comme source de nourriture

(Laybourn-Parry et Marshall 2003). Un autre taxon d’intérêt se retrouvant dans les lacs

Antarctiques et détecté pour la première fois dans la région arctique dans l’étude présente est

Mesodinium rubrum (un cilié). Cet organisme avait été décrit auparavant des les lacs des Vestfold

Hills en Antarctique (Perriss et al. 1995), et il contient des symbiotes algaux qui permettent au

cilié de profiter de la photosynthèse.

Il y a beaucoup d’intérêt sur les systèmes microbiens polaires pour plusieurs raisons et les études

microbiologiques ont été entreprises dans les lacs arctiques et antarctiques afin de déterminer la

structure biologique de ces écosystèmes et pour élargir notre compréhension de la diversité

microbienne de la biosphère. Certaines des études les plus récentes en Antarctique ont été faites

dans un but de « bioprospecting », en recherchant des organismes qui vivent dans ces

environnements inhabituels et qui pourraient avoir des applications pharmaceutiques,

9

biotechnologiques ou commerciales (Bull 2004). Ces écosystèmes extrêmes fournissent des

environnements dans lesquels certains processus sont amplifiés ou réduits en complexité,

permettant de former des modèles de compréhension plus profonds qui peuvent être appliqués à

d’autres écosystèmes aquatiques aux latitudes plus basses. Les zones polaires sont des lieux

excellents pour adresser des questions fondamentales sur l’endémisme et la biodiversité

microbienne. Finalement, et d’intérêt fondamental dans la présente étude, les microorganismes

sont une part importante des écosystèmes de haute latitude qui doivent être définis et suivis afin

de comprendre toute la magnitude et le rythme des processus de changements globaux.

1.4 Sites d’étude

Les Îles de la Reine-Élizabeth, les îles les plus nordiques de l’archipel arctique canadien,

renferment une diversité remarquable d’environnements qui ont été à ce jour très peu explorés.

Les travaux présentés ici sont principalement basés sur la côte nord-ouest de l’île d’Ellesmere

(site 1 en Fig. 1.1). Cette région a été visitée pour la première fois par l’expédition de Aldrich en

1876, puis décrite plus en détail par Robert E. Peary et le professeur Ross G. Marvin durant

l’expédition de 1906 vers le pôle (Peary 1907). Il fit un relevé détaillé de la région entourant la

plate-forme de glace de Ward Hunt et la Péninsule de Marvin. Il faut attendre l’Année

Géophysique Internationale en 1957-58 pour voir l’organisation d’un programme d’exploration à

grande échelle pour cette région et l’élaboration d’un programme de support logistique sous la

forme de l’Étude du Plateau Continental Polaire (ÉPCP, ou Polar Continental Shelf Project,

PCSP).

Le nord de l’Île d’Ellesmere est le site du Parc national le plus nordique au Canada, le parc de

Quttinirpaaq (« le sommet du monde » en inuktitut), qui abrite entre autres la plate-forme de

glace de Ward Hunt et le lac Hazen, le plus grand lac au nord du 74e parallèle qui crée un

microclimat unique dans le haut arctique. La région est caractérisée par un relief montagneux

comprenant le sommet le plus élevé à l’est de l’Amérique du nord, le pic Barbeau, culminant à

2655 m, une végétation de désert polaire, de multiples glaciers, de grands plateaux glaciaires ainsi

que des lacs et des fjords profonds.

10

La découverte de lacs méromictiques (stratifiés de façon permanente, avec une couche d’eau

douce flottant sur de l’eau salée) d’origine marine remonte à la description d’un lac en Norvège

qui semblait contenir de l’eau de mer sous une couche d’eau douce (Strøm 1957). Ce lac était

localisé à une altitude qui le plaçait sous le niveau de la mer postglaciaire lors de la dernière

glaciation, et semblait donc être un bassin marin isolé. En 1960 – 1961, l’exploration des vallées

sèches de McMurdo en Antarctique révèle la présence de deux lacs stratifiés, les lacs Bonney et

Vanda (Armitage et House 1962). Dans l’Arctique Canadien, un lac glaciaire comportant une

couche marine au fond fut plus tard décrit dans la région du Fjord Tanquary sur l’Île

d’Ellesmere : le Lac Tuborg (Hattersley-Smith et Serson 1964), qui était en fait un ancien bassin

marin retenu dans une vallée par un glacier perpendiculaire. La structure générale et le

mécanisme de formation par accumulation d’énergie solaire du maximum thermique à la mi-

colonne d’eau, typique des lacs meromictiques polaires, a été décrit pour le lac Bonney

(Shirtcliffe et Benseman 1964; Wilson et Wellman 1962). Cette capacité des lacs méromictiques

avait alors été suggéré pour la production d’énergie solaire pour l’utilisation humaine (Tabor

1963). Les lacs de la région nord-ouest d’Ellesmere ont été décrits suite aux explorations menées

au nord de l’île par le Bureau de recherche de la défense du Canada, programme sous la direction

de Geoffrey Hattersley-Smith (Hattersley-Smith et al. 1970). C’est à cette époque que les lacs

reçurent leurs appellations alors temporaires mais qui survivent dans la littérature jusqu’à

présent : Lac A, Lac B et la série de lacs C1, C2 et C3.

Les lacs méromictiques arctiques ont reçu de l’attention à la fin des années 80 avec les travaux

effectués sur deux lacs hypersalins de la région de Resolute : les lacs Garrow, sur l’Île de Little

Cornwallis, et Sophia, sur la côte est de l’Île de Cornwallis (Ouellet et al. 1987; Ouellet et al.

1989; Stewart et Platford 1986). Ces lacs présentent une structure étonnante, avec des couches

profondes hypersalines qui ont été attribuées à l’apport en sels lors de la formation de pergélisol à

partir du sol marin. Au début des années 90, un autre lac méromictique fut découvert, à proximité

de la station de Eureka : le lac Romulus à 80°N sur l’île d’Ellesmere (Davidge 1994; Egginton et

Hudgson 1990). Cette période vit aussi la mise sur pied d’un important projet de recherche en

1990-1992 aux lacs adjacents au Taconite Inlet, près du Lac C, où principalement les processus

sédimentaires ont été étudiés afin de pouvoir décrypter les informations tirées des carottes de

sédiments obtenues dans les fonds anoxiques de ceux-ci (Bradley et al. 1996).

11

1.5 Objectifs de cette étude

L’objectif principal de cette thèse est d’évaluer la diversité limnologique et biologique des lacs

côtiers du Nord de l’Île d’Ellesmere afin de mieux comprendre leur réponse aux changements

environnementaux et climatiques à l’échelle Holocène et à l’échelle des changements climatiques

présents et futurs. Spécifiquement je me suis attardé à l’hypothèse centrale que ces

environnements nordiques extrêmes sont susceptibles d’avoir des caractéristiques uniques

relativement aux systèmes de plus basse latitude et même relativement aux systèmes antarctiques,

et qu’ils sont susceptibles d’être très sensibles aux changements climatiques globaux. Cet objectif

principal est poursuivi dans le cadre des travaux présentés ici au courant des quatres chapitres

suivants qui comportent chacun un objectif secondaire :

Le chapitre 2 a pour objectif de comprendre comment la structure des environnements actuels

découle de leur évolution à l’échelle Holocène. Ce chapitre décrit ces différents environnements

aquatiques uniques au niveau physico-chimique, et explore leur évolution à l’échelle millénaire.

J’ai échantillonné 5 lacs et 2 fjords et examiné leur paramètres physico-chimiques, afin de tracer

un portrait des différents environnements aquatiques, et de construire une séquence évolutive des

environnements.

Le chapitre 3 a pour objectif de comprendre l’effet des changements climatiques à court terme qui

ont un impact important sur les systèmes aquatiques qui dépendent de la glace pour maintenir leur

structure unique. Dans cette étude, nous avons fait la synthèse de plusieurs types de données

environnementales : les informations de structure des lacs données par des profils de température

et de salinité, les informations de présence de couvert de glace tirés d’images satellitaires

RADARSAT et les informations climatiques provenant des stations météorologiques de la région.

Le chapitre 4 a pour objectif d’évaluer comment la diversité génétique des organismes à la base

du réseau alimentaire, les cyanobactéries, est reliée à la grande diversité environnementale. Cette

étude inclut une analyse de l’abondance des bactéries hétérotrophes et autotrophes, et insiste sur

une composante importante du réseau alimentaire microbien : les cyanobactéries. Une étude

12

moléculaire a été effectuée en utilisant des échantillons environnementaux et des souches isolées

en culture, afin de tracer un portrait de la diversité génétique de ces organismes.

Enfin, le chapitre 5 a pour objectif de comprendre la structure unique de la communauté

zooplanctonique qui se retrouve dans ces environnements stratifiés, spécifiquement le lac A et le

Fjord Disraeli, où plusieurs espèces de copépodes ont été étudiées.

Dans le chapitre de conclusion de cette thèse, j’ai fait une synthèse des résultats principaux et j’ai

réexaminé l’hypothèse centrale à la lumière de ces nouveaux résultats. J’ai considéré aussi le

besoin pour des mesures additionnelles et donné des suggestions pour de nouvelles avenues de

recherche sur ces environnements fascinants du nord de l’Île d’Ellesmere.

13

Chapitre 2 – Coupled landscape-lake evolution in the coastal high Arctic

2.1 Résumé

Cinq lacs couverts de glace et deux fjords on été profilés sur l’Île d’Ellesmere, à la limite nord de

l’arctique canadien afin d’examiner leurs caractéristiques environnementales et d’évaluer les

conséquences limnologiques à long temre (Holocène) de l’évolution du paysage. Tous ces sites

ont des patrons de stratification thermale et chimique forts, avec des maximums de température

allant de 0,75 °C à 12,15 °C et des conductivités allant jusqu’à 98,1 mS cm-1 (deux fois celle de

l’eau de mer) dans certaines eaux profondes. Les lacs possèdent tous une zone anoxique avec de

hautes concentrations de phosphore réactif dissous (jusqu’à 4,0 mg L-1), d’azote (jusqu’à 25,8 mg

L-1) et de carbone organique dissous (jusqu’à 6,5 mg L-1). Leur composition géochimique indique

une influence terrestre superposée à des propriétés dérivées de l’environement marin, avec des

proportions ioniques semblables à l’eau de mer sous l’halocline, des déviations de ces proportions

dans les eaux de surface, et des concentrations extrêmes de Fe total (jusqu’à 71 mg L-1) et de Mn

total (jusqu’à 11 mg L-1) dans les zones anoxiques. Les eaux oxygénés de surface contenaient des

communautées phytoplanctoniques diluées (Chl a de l’ordre de 0.3 à 1.3 µg L-1), et les courbes

d’absorption spectrales indiquaient la présence de bactéries photosynthétiques dans la couche

anoxique de certains lacs. Ces écosystèmes forment une chronoséquence qui reflète les

différentes étapes de l’évolution du paysage, ce qui incluent des baies marines ouvertes à la mer,

des fjords bloquées par de la glace de mer épaisse (Disraeli, Fjord, Taconite Inlet), des lac salins

couverts de glace de façon permanente isolés de la mer par le relèvement isostatique (Lacs A, C1

et C2), et des lacs isolés qui perdent leur couvert de glace durant l’été. Ces derniers sont soumis à

l’entraînement d’eaux salines dans leur colonne d’eau supérieure par le brassage induit par le vent

(Lake Romulus, Lake A in 2000), ou au lessivage complet de leur bassin par l’eau de fonte diluée

dans le cas de lac avec des basins versants plus grands (Lac C3 et le Lac Char, qui se trouve à 650

km au sud de la région des lac d’Ellesmere). Cette chronoséqence fournit une illustration

frappante des contrôles qu’exerce le paysage sur les propriétés des lacs côtiers de haute latitude.

14

2.2 Abstract

Five ice-covered lakes and two ice-covered fjords were profiled on Ellesmere Island at the

northern limit of high Arctic Canada to examine their environmental characteristics, and to

evaluate the long-term (Holocene) limnological consequences of landscape evolution. All of the

ecosystems showed strong patterns of thermal and chemical stratification with subsurface

temperature maxima from 0.75 °C to 12.15 °C and conductivities up to 98.1 mS cm-1 (twice that

of seawater) in some bottom waters. The saline lakes were all anoxic at depth, and these

lowermost strata contained high concentrations of total phosphorus (up to 4.0 mg L-1), total

nitrogen (up to 25.8 mg L-1) and dissolved organic carbon (up to 6.5 mg L-1). Their geochemical

composition indicated a terrestrial influence superimposed on marine-derived properties, with

seawater ratios of major ions beneath the halocline, deviations from this ratio in the upper water

column, and extreme concentrations of total Fe (up to 71 mg L-1) and total Mn (up to 11 mg L-1)

in the anoxic zone. The oxygenated surface waters contained dilute phytoplankton communities

(Chl a in the range 0.3-1.3 µg L-1), and spectral absorption curves were indicative of

photosynthetic green sulfur bacteria in the upper anoxic layer of some lakes. These ecosystems

form a chronosequence that reflects different steps of landscape evolution including marine

embayments open to the sea, inlets blocked by thick sea ice (Disraeli Fjord, Taconite Inlet),

perennially ice-capped, saline lakes isolated from the sea by isostatic uplift (Lakes A, C1, C2),

and isolated lakes that lose their ice cover in summer. The latter are subject to entrainment of

saline water into their upper water column by wind-induced mixing (Lake Romulus; Lake A in

2000), or complete flushing of their basins by dilute snowmelt in lakes with a larger catchment to

lake area ratio (Lake C3, and Char Lake which lies 650 km to the south of the Ellesmere lakes

region). This chronosequence provides a striking illustration of landscape controls on the

limnological properties of coastal, high latitude lakes.

15

2.3 Introduction

Lake ecosystems are strongly coupled to features of their surrounding landscapes such as

geomorphology, lithology, vegetation and hydrological characteristics (Wetzel 2001). Many

temperate lakes owe their origin to glacial action in the past that shaped their lake basin and

surrounding landscape, and that distributed glaciogenic deposits of different sources and mineral

composition across their catchments. In the Polar Regions, glacial and periglacial processes

continue today. High latitude lakes, wetlands and rivers are likely to show ongoing responses to

recent deglaciation, variations in ice-cover and, for coastal waters, recent or current changes in

their linkages with the sea.

The high arctic landscape has been greatly influenced by the last glaciation. In these northernmost

parts of the North American continent, the landscape is still evolving today in response to those

glacial influences, mainly by isostatic adjustment of landmasses after glacial retreat. At the last

glacial maximum (18 ka BP), the thick Innuitian Ice Sheet covered the Canadian High Arctic and

extended to the Greenland Ice Sheet, closing Nares Strait and the Kane Basin (England 1999;

England et al. 2004; Tushingham 1991). Paleo-studies have shown that, after the glacial retreat

and the opening of Nares Strait ca. 9.5 ka BP, there was regional warming at northern Ellesmere

from around 8 ka BP to around 3-4 ka BP. This was followed by a period of cooling (Bradley

1990; Smith 2002), that brought about the formation of an extensive ice shelf (Ellesmere Ice

Shelf) along the northern coast of Ellesmere Island (Jeffries 2003; Vincent et al. 2001). The most

recent period of warming appears to have begun in the mid 19th century at the end of the Little

Ice Age (Douglas et al. 1994) and resulted in major loss of the Ellesmere ice shelves over the

course of the 20th century (Vincent et al. 2001; Jeffries 2003). An accelerated warming trend has

been observed in this region from the 1980s to the present (Mueller et al. 2003; Antoniades et al.

2005).

Isostatic rebound and sea-level adjustments over the last few thousand years have caused an uplift

of land relative to sea-level by 80 to 150 m, resulting in gradual isolation of seawater containing

basins from the coastal marine environment (England 1997; Lemmen 1989). This has produced a

series of saline lakes and fjords with freshwater overlying seawater. Although comparatively well

described and common in coastal antarctic regions (Gibson 1999), saline lakes are relatively rare

16

in arctic environments, and in the Canadian Arctic, only 12 have been reported in the literature to

date: Lakes A, B, C1, C2, C3, Tuborg and Romulus on Ellesmere Island, Lake Sophia

(Cornwallis Island), Garrow Lake (Little Cornwallis Island) and Ogac, Qasigialiminiq and

Tariujarusiq Lakes (Baffin Island) These lakes are covered through most of the year, and on some

lakes and years throughout all seasons, by a thick layer of ice.

The objectives of the present study were to characterize the limnological properties of marine-

derived ecosystems on Ellesmere Island at the northern limit of Canada, and to evaluate their

water column characteristics in relation to known changes in landscapes over the course of the

Holocene. We profiled 5 lakes and 2 fjords, with further measurements at Char Lake, a well-

known high arctic lake further to south in the Canadian Arctic Archipelago. From this ensemble

of measurements, we aimed to define the consequences of long-term climate change and

landscape evolution on the limnology of this remote, high arctic lake district.

2.4 Materials and Methods

2.4.1 Sampling sites

Two stratified fjords (Taconite Inlet and Disraeli Fjord) and four meromictic lakes (Lakes A, C1,

C2, C3) were sampled on the northern coast of Ellesmere Island. Additional measurements were

obtained at meromictic Romulus Lake further to the south on Ellesmere Island near Eureka, and

at Char Lake, a freshwater lake near Resolute Bay on Cornwallis Island. The mean annual air

temperatures at these sites are -19.4 ºC at Alert on the northern coast of Ellesmere, -19.7 ºC at

Eureka station and -16.4 ºC at Resolute Bay (Meteorological Service of Canada, www.ec.gc.ca).

Precipitation is much lower at Eureka (64 mm) than at Alert (154 mm) or Resolute (135 mm).

Lake A is a deep meromictic lake within a rocky, unglacierized catchment that rises to 600 m

(Fig. 2.1). The lake was cut off from the sea 2500-4000 years BP by the isostatic uplift of the

northern Ellesmere coast. It has been visited several times over the last forty years (Hattersley-

Smith et al. 1970; Jeffries et al. 1984; Retelle 1986; Ludlam 1996a; Van Hove et al. 2001) and

has shown a remarkable stability in its stratification throughout this period. It was visited twice

over the course of the present study, on 3-8 June 1999 and on 1-4 August 2001.

17

Lakes C1, C2 and C3 are situated only a few kilometres apart on the edge of Taconite Inlet (Fig.

2.1), on rocky, mountainous terrain that rises to 1200 m and contains glaciers. Radiocarbon

dating of the bottom waters of Lake C1 (Ludlam 1996a) and Lake A (Lyons and Mielke 1973)

indicate a similar time of isolation from the sea, within the period 2500-4000 years BP. All three

C-series lakes are situated near sea level (4, 1.5 and 10 m asl, respectively), also suggesting a

common isolation period. They have similar areas and basin depths, but differ substantially in the

size of their catchments (Table 2.1). These lakes were extensively studied in a 1990-1992

paleolimnological research program centered on understanding sedimentary processes in Lake C2

(Bradley et al. 1996). Within the present study, they were visited on 20-28 July, 2001.

Romulus Lake is a hypersaline meromictic lake similar in shape, area and basin size to Lake A,

but in rolling lowland terrain on the Fosheim Peninusula of Ellesmere Island, 300 km to the south

of the northern Ellesmere Island sites. This lake has the lowest water inputs per unit area of all the

systems given its small catchment-to-lake area ratio plus its low precipitation regime (Table 2.1).

It lies 8 m above sea-level and 14C-dating of marine shells retrieved from 70 cm in sediment cores

indicate that prior to 3600 BP Romulus Lake was connected to the sea via an extension of nearby

Slidre Fjord (Davidge 1994). It was first surveyed in 1989 (Eggington and Hodgson, 1990) and

was described in more detail by Davidge (1994) and Jackson et al. (2004). During the course of

this study, Romulus Lake was visited before the melt season on 20-25 May 2000.

Disraeli Fjord (Fig. 2.1B) is a deep, narrow, marine embayment that at the time of sampling on 9

June 1999 had a surface layer of freshwater dammed by the Ward Hunt Ice Shelf. At that time,

this “epishelf” lake was one of the few known examples of such systems in the northern

hemisphere. The freshwater surface layer subsequently drained following partial breakup event

on the Ward Hunt Ice Shelf (Mueller et al. 2003) and our measurements therefore provide a

record of this system prior to major change.

Taconite Inlet (Fig. 2.1C) is an arm of M’Clintock Inlet in which freshwater has built up behind

the multi-year sea ice at its seaward end, giving rise to stratified conditions. The Taconite River

and all three C lakes drain into this fjord. The inlet is separated in two basins by a shallow sill and

18

the inner basin is known to have a stratified water column with an anoxic bottom layer (Ludlam

1996b). Sampling in the present study was in the outer basin near Lake C1.

Table 2.1 : Location, date of visit, average ice thickness (± 1 SD), maximum depth (Zmax), and lake

area of the ice-covered lakes and fjords. Lake A (1999), Disraeli Fjord and Taconite Inlet had multi-

year ice cover while annual ice cover prevailed at the other sites. Water load was estimated as the

product of the catchment area and annual precipitation divided by the lake area. Chl a values are

given as an index of trophic status, and are the maximum concentrations observed in the water

column.

Site Latitude Longitude Date

of visit

Ice thickness (m)

Zmax (m)

Lake area (km2)

Catch-ment area (km2)

Ratio Basin: Lake

Water load (m)

Chl a (µg L-1)

Lake A

83º00'N 75º30'W Jun 1999

1.97±0.01 128 5 37 7.4 1.1 0.53

Aug. 2001

1.00±0.09 0.32

Lake C1

82º51'N 78º12'W July 2001

1.05±0.07 65 1.1 3.3 3 0.5 0.79

Lake C2

82º50'N 78º05'W July 2001

1.27±0.02 84 1.8 23.5 13 2.0 0.67

Lake C3

82º48'N 78º05'W July 2001

1.05 51 1.7 180* 106 16.3 1.02

Lake Romulus

79º50'N 85º00'W May 2000

2.51±0.01 60 4.4 28 6.4 0.4 0.47

Char Lake

74º42'N 94º50'W June 1999

2.27 28 0.56 8 14.0 1.9 0.22

Disraeli Fjord

82º50'N 73º40'W June 1999

2.60 >400 143 2100 14.7 2.3 0.27

Taconite Inlet

82º50'N 78º15'W July 2001

1.5 >80 10 307 30.7 4.4 1.32

*This assumes some input from the Taconite River; Bradley et al. (1996) note that very little of this river currently enters the lake and their estimates of the drainage basin area are 10.8 km2

(Taconite River excluded, input mostly from the east of the lake) and 260 km2 (including the full drainage basin of the Taconite River).

Char Lake is well known as a result of the International Biological Program study at this site in

the late 1960s and 70s (Schindler et al. 1974). It is a 28 m-deep, freshwater, high arctic lake that

is used as a drinking water supply for the hamlet of Resolute Bay. It is smaller than the C-series

lakes and has an intermediate catchment-to-lake ratio (Table 2.1). It currently lies 34 m asl, and is

19

thought to have emerged from the sea about 6000 years ago (Schindler et al. 1974, and references

therein). Sampling was in June before a moat formed around the ice.

2.4.2 Physico-chemical and biological characteristics

All the aquatic environments were covered by a thick layer of ice (1.0-2.6 m) at the time of our

visits. Sampling was conducted from a mid-lake site through a 22 cm-diameter hole bored

through the ice with a battery-powered drill (Strikemaster). Ice thickness data for the lakes

sampled in June 1999 and May 2000 are representative of the annual maximum. The thinner ice

measured in late July and early August 2001 was representative of the ice remnant at the end of

the melt season of that year.

Profiles for temperature, conductivity, pH and dissolved oxygen were measured with a Surveyor

3 profiler (Hydrolab Corporation) that was lowered through the water column. Profiles of the

beam attenuation coefficient at 660 nm (beam c(660)) were measured using a Sea Tech

transmissometer (Wet Labs, Inc.) measuring transmission of a collimated light beam over a 10-

cm path length. Sampling depths were selected from the profile data and water samples for the

different analyses were obtained from these depths with an opaque 2 L Kemmerer sampling

bottle.

Water for chemical analysis was filtered through 0.45 µm Millipore membranes and subsequently

analyzed for dissolved organic carbon (DOC), dissolved inorganic carbon (DIC), nitrate and

nitrite (NO3-+ NO2

-), reactive Si (SiO2), soluble reactive phosphorus (SRP), and major ions (Na+,

K+, Mg2+, Ca2+, Ba2+, Cl- and SO4

2-). Additional samples were stored cold and unfiltered, and

subsequently analyzed for total nitrogen (TN), phosphorus (TP), iron (Fe) and manganese (Mn).

Chemical analysis of these samples was conducted by the National Laboratory for Environmental

Testing (Burlington, Ontario, Canada) according to their standard protocols as described in

Gibson et al. (2002).

To determine chlorophyll a concentrations (Chl a), samples from the oxic waters were filtered

onto 25 mm diameter Amersham GF/F equivalent filters and stored frozen prior to analysis.

Pigments were extracted using 8 ml of boiling ethanol (Nusch 1980). Fluorescence was measured

in a Sequoia-Turner model 450 fluorometer before and after acidification with HCl, and

20

concentrations of Chl a were calculated using the equations of Jeffrey and Welschmeyer (1997).

Ethanol extracts of pigments from the anoxic waters of Lake A (June 1999) were analyzed by

spectrophotometry and the absorption spectra were converted to bacteriochlorophyll e

concentrations using the molar absorption of Borrego et al. (1999).

Water samples from selected depths in Lake C1 and Lake A (2001) were vacuum-filtered in

duplicate through 25-mm GF/F filters and stored at -20°C until measurement (3 weeks after

collection) of spectral absorption by particles (ap, m-1) The absorbance of particles concentrated

onto the filters was measured over the spectral range 390–800 nm according to Roesler (1998)

using a Hewlett-Packard 8452A diode array spectrophotometer equipped with an integrating

sphere (Labsphere RSA-HP-84; Hewlett- Packard Corp.). Absorbance values were then

converted to ap using the algorithm of Roesler (1998).

2.4.3 Statistical analysis

In order to discriminate and ordinate these high arctic environments as a function of their

environmental properties we applied principal component analysis (PCA) to a set of limnological

descriptors: maximum temperature, depth of thermal maximum, ratio of catchment to lake area,

and maximum values for the water column of conductivity, dissolved organic carbon, total

phosphorus and Chl a concentrations. This analysis was carried out using CANOCO 4.5 (ter

Braak and Smilauer 1998).

2.5 Results

2.5.1 Physical properties

Temperature and conductivity profiles underscored the diversity of physical stratification regimes

in the high Arctic (Fig 2.2). A mid-water-column temperature maximum can be seen in all the

lakes. Maximum temperatures ranged from 0.38 ºC in hypersaline Romulus Lake to 12.15 ºC in

Lake C1. Conductivities ranged from 0.18 mS.cm-1 in the freshwater Lake C3 to 98 mS.cm-1 at

the bottom of Romulus Lake. The steepness of the halocline varied between lakes, from gradual

in Lakes A and C1 which have shallow mixed layers to the very steep gradient found in Romulus

21

lake. This likely reflects wind-induced mixing during the longer period of ice-free conditions that

characterizes this latter lake. In a 1992 study of Romulus Lake, Davidge (1994) observed

complete ice-out by July 28 and open water likely persisted for at least 4 weeks. The 1999 profile

in Lake A closely resembled those obtained by earlier investigations (Ludlam 1996a). However,

in the subsequent year, a change in the surface profile was observed, indicating a mixing event

where freshwater mixed into the top of the salinity gradient, evening out the salt concentration in

a layer from 3.5 to 10 m. In 1999 conductivity in this zone ranged from 0.27 mS cm-1 to 2.08

mSm-1, while in 2001 this zone was isohaline with a conductivity of 0.96 mS cm-1. This is

examined in detail in chapter 3.

Differences in the stratification patterns in Lakes C1, C2 and C3 can be seen, with evidence of

mixing down to 7 m in Lake C1, 20m in C2 and to 35 m in Lake C3 (Fig. 2.2). Lake C3 is

essentially a freshwater lake, with a dilute solute content and less than twofold difference in

conductivity between the surface and bottom waters compared to the many orders-of-magnitude

difference between the surface and deep waters of other meromictic lakes. This marked

difference relative to adjacent Lakes C1 and C2 is most likely due to the much greater catchment

to lake ratio and hence water loading (Table 2.1), and the impact of the Taconite River that

partially runs through the lake and contributes to water column mixing.

Disraeli Fjord and Taconite Inlet showed stratification patterns caused by the thick ice dams near

their seaward ends. Disraeli Fjord had a steep halocline at 33m, the depth where seawater came in

from under the thick ice shelf that blocked the outflow of the surface water (Vincent et al. 2001;

Mueller et al 2003). Taconite Inlet stratification was similar to that of Disraeli Fjord but with a

shallower halocline (5.5 m) reflecting the thinner multi-year sea ice at its mouth.

Our measurements at Char Lake illustrate the strong limnological contrast between northern

Ellesmere aquatic ecosystems and this classic high arctic lake. Char Lake (Fig. 2.3) had a well-

mixed 28 m-deep water column, with low conductivity, cold temperatures, high oxygen

concentrations, and ultra-oligotrophic nutrient and chl a concentrations. Temperature,

conductivity, pH and dissolved oxygen varied little through most of the water column, implying

regular mixing during open water conditions each year. Some variation was recorded

22

immediately under the ice, with lower conductivity and higher DOC and DIC than the rest of the

water column, probably as a result of the early season inflow of meltwaters from the surrounding

catchment.

2.5.2 Geochemical properties

All of the Ellesmere Island lakes showed the typical meromictic profile with anoxic bottom

waters. The oxycline was located at depths ranging from 13 m in Lake A to 47 m in Lake C3

(Fig. 2.4). The surface waters were well oxygenated and, in some cases, supersaturated. In Lake

C1, >200% oxygen saturation over the depth interval 7-14 m persisted for during two weeks in

mid-July, most likely as the combined result of intense photosynthesis and stable stratification.

The Mn-rich layer in Lake A (up to 9.7 and 8.2 mg L-1 in 1999 and 2001 respectively) extending

from 10 m to 29m has been previously described (Gibson et al. 2002), and occurred in a region

that was devoid of both O2 and H2S. Our profiles show that similar Mn-rich layers occurred in

Lakes C1 (3.4 mg L-1), C2 (11.4 mg L-1) and Romulus Lake (6.7 mg L-1). Extremely high

concentrations of Fe occurred in anoxic water below the Mn maximum, at 50 m depth in Lake C2

(12. 1 mg L-1) and as a sharp peak at 30 m depth in both years of sampling at Lake A (up to 2.0

mg L-1). In Lake Romulus, Mn peaked at the top of the anoxic monimolimnion, while Fe

continued to rise to a plateau with maximum concentrations of 71 mg L-1 towards the bottom of

the water column. The two fjord sites had oxygenated deep waters reflecting tidal exchange with

the offshore marine environment, and low values of Mn (< 0.005 mg L-1) and Fe (< 0.001 mg L-1)

typical of oxic waters.

Dissolved organic and inorganic carbon concentrations as well as pH were similarly characterized

by strong vertical gradients (Fig. 2.5). In general, both DOC and DIC concentrations increased

with depth. Unusually high DIC concentrations occurred in the hypolimnion of the saline lakes

and ranged from 160 mg L-1 in Lake A to 364 mg L-1 in Lake C1. Lower DIC occurred in the

freshwaters (22 mg L-1 in Lake C3) and in oxic fjords (typical seawater values of 25 mg L-1 in

Taconite Inlet and Disraeli Fjord). DOC concentrations in the surface waters of the meromictic

lakes varied over an order-of-magnitude, from 0.2 mg L-1 in Lake A in 2001 to 2.5 mg L-1 in

Romulus Lake. DOC concentrations increased with depth in all lakes (except the weakly

23

stratified Lake C3), and reached concentrations up to 6.5 mg L-1 in the hypersaline bottom waters

of Romulus Lake. DOC concentrations in Taconite and Disraeli showed less vertical variation,

with values in the range 0.3-0.8 mg L-1. There was a decrease in the DOC concentrations in the

anoxic zone measured in Lake A in 1999 relative to 2001. This may be due to seasonal or inter-

annual variations, but could also result from contamination or filtration artefacts.

Nutrients also varied markedly among environments and with depth (Table 2.2). Nutrient

concentrations were low in the surface freshwater of the meromictic lakes, although higher than

in ultra-oligotrophic Char Lake. Total nitrogen ranged from 0.029 mg L-1 at the bottom of Lake

C3 to 25.4 mg L-1 at the bottom of Lake C1, with generally higher values in anoxic water likely

reflecting high concentrations of ammonium. Total phosphorus ranged from the ultraoligotrophic

level of 0.004 mg L-1 in the surface of Disraeli Fjord up to a hypertrophic maximum of 4.02 mg

L-1 in the bottom of Lake C1, again with markedly higher concentrations in the anoxic bottom

waters.

Table 2.2 : Concentrations of reactive nutrients in the high arctic aquatic

environments. Total nitrogen (TN), total phosphorus (TP), TN:TP ratio, silicate

(SiO2), Nitrate (NO3-N) and soluble reactive phosphorus (SRP).

(n/r : not recorded ).

Lake Depth TN TP TN:TP SiO2 NO3 SRP m mg/l mg/l mg/l mg/l Lake A (1999) Surface 2 0.096 0.005 19.2 0.64 0.022 0.009 Deep 100 10.1 1.32 7.6 12.6 0.036 1.44 Disraeli Fjord Surface 2.5 0.097 0.004 24.2 0.88 0.023 0.008 Deep 40 0.226 0.041 5.5 0.51 0.014 0.036 Lake C1 Surface 3 0.135 0.0056 24.1 1.46 0.056 0.0025 Deep 50 25.8 4.02 6.4 8.34 0.021 n/r Lake C2 Surface 3 0.077 0.01 7.7 0.86 < 0.010 0.0056 Deep 50 24.2 0.78 31.0 11.8 0.02 n/r Lake C3 Surface 5 0.029 0.0054 5.4 1.57 0.025 n/r Deep 50 0.048 0.0102 4.7 4.08 0.214 0.0032 Taconite Inlet Surface 3 0.054 0.0176 3.1 0.91 0.032 0.0027 (inner basin) Deep 75 2.54 < 0.1 > 25.4 2.54 0.19 n/r Taconite Inlet Surface 3 0.062 0.0126 4.9 0.97 0.023 0.001 (outer basin) Deep 50 0.087 0.0393 2.2 0.49 0.025 n/r Romulus Lake Surface 2.5 0.249 0.0108 23.0 0.45 0.04 0.0109 Deep 49 17.2 0.0449 383.0 3.29 < 0.010 0.066 Char Lake Surface 2.5 0.285 n/r n/r < 0.010 <0.002 Deep 20 0.061 n/r n/r < 0.010 <0.002

24

The TN:TP ratio greatly varied from site to site, with extreme values ranging from 2.21 (by

weight) in the bottom waters of the outer basin of Taconite Inlet, marine depletion of N relative to

P, and up to 383 in the deep waters of Romulus Lake, likely influenced by the high ammonium

concentrations at depth. Silica ranged from 0.45 mg L-1 in the surface waters of Romulus Lake to

12.6 mg L-1 in the bottom waters of Lake A. Nitrate-N concentrations ranged from 0.014 mg L-1

in the marine waters of Disraeli Fjord to 0.214 mg L-1 in the bottom waters of Lake C3,

suggestive of strong or prolonged nitrification in the latter. Soluble reactive phosphorus

concentrations ranged from 0.001 mg L-1 in the Taconite Inlet to 1.44 mg L-1 in the anoxic bottom

waters of Lake A. The latter was slightly above the TP value, likely reflecting analytical error in

the two separate analyses but indicating that the phosphorus pool in the bottom waters of Lake A

(and in anoxic waters of the other meromictic lakes) was dominated by dissolved reactive

phosphorus.

The ionic composition of water samples from the different environments was compared with

standard seawater in order to provide an index of the relative contribution of marine- and land-

influenced processes (Table 2.3). The different enrichment ratios were calculated using the

following equation:

Ex = ([x]s/[Cl-]s)/([x]sw/[Cl-]sw)

where [x] is the concentration of the ion of interest in the sample (s) and standard seawater (sw),

and [Cl-] is the concentration of chloride ions in the sample and in standard seawater, where it is

the dominant ion. There were large differences in the enrichment ratio of the different ions, but

many of the values for the deep waters were near 1.0 for the fjords, as expected given their

connections with the sea, and also for Lakes A, C1, C2 and Romulus, indicating their marine

origins. Lake C3 was a notable exception, with enrichment of all ions relative to chloride,

reflecting the strong terrestrial rather than marine influence on this lake and its present-day

flushed, freshwater conditions. The surface waters at most sites were enriched in calcium and

barium indicating the terrigenous influence (Gibson et al. 2002), and there was a major decrease

(> 70%) in these enrichment ratios in Lake A between 1999 and 2003, consistent with an

entrainment of deeper, marine-derived water into the upper water column. Sulfate enrichment

25

ratios were below 1.0 in all the deep samples, with evidence of substantial depletion, probably by

sulfate reducing bacteria, in Lake C1. The Fe and Mn enrichments were generally high at all

depths, likely influenced by the inclusion of particulate forms in these analyses and indicative of

a long term terrigenous influence superimposed on the marine properties of the waters.

Table 2.3 : Enrichment ratios of major ions and indicator constituents (Ba, total Mn and total

Fe) compared to seawater in surface and sub-halocline waters ( n/r : not recorded ).

Na+ K+ Mg2+ Ca2+ SO4

2- Ba2+ Mn Fe Environment Surface Ratios Taconite Inlet 1.06 1.28 1.21 5.84 1.53 8.77 1974 2787 Outer basin 1.04 1.27 1.17 7.022 1.17 9.74 2254 2938 Lake C1 0.98 1.09 1.41 7.32 1.16 21.64 71.32 125.86Lake C2 1.01 1.08 2.12 23.48 2.17 66.52 6100 25658 Lake C3 2.71 19.73 61.41 644.92 156.63 1910 209618 217597Disraeli Fjord 0.98 1.15 1.06 2.29 1 n/r n/r n/r Lake A (1999) 1.07 1.45 2.48 24.55 1.87 112.9 837.8 n/r Lake A (2001) 0.98 1.25 1.39 5.01 1.07 42.8 217.49 235 Romulus Lake 1.02 0.96 0.97 1.59 0.9 1.36 5.76 5.55

Sub-Halocline Ratios

Taconite Inlet 0.94 0.95 0.92 0.93 0.77 0.06 3.92 3.3 Outer basin 0.96 0.98 0.95 0.94 0.08 0.07 10.72 3.6 Lake C1 1.04 0.93 1.05 0.59 0.25 1.12 1396 5.81 Lake C2 0.99 0.89 1.02 1.03 0.87 1.66 18755 4369 Lake C3 1.43 4.92 14.89 240.41 28.75 695.57 3131102 39437 Disraeli Fjord 0.97 1.08 0.98 0.98 0.92 n/r n/r n/r Lake A (1999) 0.98 1 0.97 0.9 0.7 0.62 2677 2.25 Lake A (2001) 0.99 0.95 0.98 0.93 0.8 0.68 2787 12.79 Romulus Lake 0.9 0.79 0.95 0.92 0.85 0.33 1570 8739

26

2.5.3 Biological properties

Maximum chlorophyll a concentrations ranged from 0.27 to 1.3 µg L-1 and were generally

observed in the upper part of the oxygenated water column, close to the ice where light

availability for photosynthesis was maximal. These values are typical of ultra-oligotrophic to

oligotrophic systems. In the anoxic waters of meromictic Lake A, Lake C1 and Romulus Lake a

community of H2S-dependent photosynthetic bacteria was observed. The sulfur particles

associated with these bacteria caused a turbid yellow coloration of the water and likely

contributed to the marked peaks in beam attenuation (Fig. 2.6A and 2.6B; see also Belzile et al.

2001). The turbidity peak in Lake A also corresponded to the maximum in total Fe, suggesting

that microbial production of precipitated iron compounds might additionally contribute to

particulates at this depth. Particle absorption spectra of samples from the upper anoxic zones of

Lakes A and C1 showed a peak at 715 nm indicative of bacteriochlorophyll e, a photosynthetic

pigment that is characteristic of green sulfur bacteria (Fig. 2.6C and 2.6D). The presence of these

green sulfur bacteria represents a striking difference with the autotrophic community of Char

Lake and other Arctic freshwater lakes. Analysis of samples from Lake A (June 1999) gave

Bacteriochlorophyll e concentrations up to 4.7 mg L-1 (at 30 m), nearly one order of magnitude

higher than the Chl a concentrations in the oxic surface waters. A similar magnitude for

Bacteriochlorophyll e concentration in Lake C1 and Lake A (August 2001) relative to Chl a

concentration in the oxic waters is suggested by the particle absorption curves (Fig. 2.6C and

2.6D).

2.5.4 Statistical Analysis

PCA analysis illustrated the great diversity of the environments (Fig. 2.7), with an absence of

clusters and wide separation of all sites. The strongest discriminating component was the ratio

of catchment area to the area of the water body (score of 0.923 on the first axis) indicating the

important landscape control on flushing rates. The strongest discriminating components on the

second axis were maximum temperature (0.884) and maximum total phosphorus (0.807).

27

2.6 Discussion

The limnological observations reported here underscore the striking diversity of physicochemical

conditions to be found in high arctic lakes and fjords. Conditions ranged from freshwater to

hypersaline, and from continuously warm to near-freezing temperatures that persist even in

summer. Despite their fundamental differences, however, the environments sampled in the

present study share a number of common features. They all contain low Chl a concentrations,

placing them in the oligotrophic to ultra-oligotrophic range. Their high latitude position means

that they are all covered by a thick layer of ice for most of the year and experience the strong

seasonal light-dark contrast of polar environments. The four meromictic systems are

characterized by anoxic and sulphidic bottom waters that have major ion ratios indicative of a

seawater origin, and that contain high concentrations of phosphorus (mostly SRP), nitrogen

(likely to be mostly ammonium), Fe and Mn. The meromictic lakes also all contain

photosynthetic green sulfur bacteria in their upper anoxic zones.

The mid-depth thermal maxima in the meromictic lakes show similarities in position and

magnitude to those in Antarctic meromictic lakes (Spigel and Priscu 1996; Gibson 1999). The

diversity of thermal regimes of the high arctic lakes is similar to the high variability in Antarctica,

for example in the McMurdo Dry Valleys where water column maxima range from 2 to 25 °C.

Energy balance calculations show that these unusual temperatures result from solar energy that

penetrates the ice and water column. The heat is gradually accumulated over hundreds of years to

millennia in the lower water columns of the lakes that are stabilized by salt gradients (Spigel and

Priscu 1996). The observed divergence in thermal characteristics between individual lakes is

likely to arise from differences in snow and ice cover (which affect the transmission of solar

radiation), attenuation properties of the water column (which affect depths of maximum

absorption of solar radiation; Spigel and Priscu 1996), the surrounding topography (which may

reduce solar input through shading), and water column history (Gibson 1999).

The chemical characteristics of the Ellesmere Island lakes also find parallel in Antarctica.

Hypersaline bottom waters are found in both Polar Regions, for example up to three times that of

seawater in Lake Vanda in the McMurdo Dry Valleys. However, the Dry Valley lakes have a

more complex biogeochemical history (Lyons et al. 1997), and ionic ratios deviate substantially

28

from seawater. Total Fe and Mn concentrations are also high in Dry Valley lakes (up to 3.4 mg

Mn L-1 and to 1.1 mg Fe L-1 in Lake Vanda; Green et al. 1989) although below the extreme

values recorded here in Ellesmere lakes, likely reflecting differences in catchment geochemistry.

Sediment laden underflows are known for Lake C2 (Retelle and Child 1996), and may contribute

to the deep delivery of Mn- and Fe-rich particles.

The ice-dependent ecosystems of northern Ellesmere Island are likely to be highly responsive to

small shifts in climate once their ice-covers warm to near 0oC. Some evidence of this sensitivity

can be seen by comparing Lake A, which has a more persistent ice cover, and Romulus Lake,

situated three degrees of latitude to its south, where the ice cover is lost for several weeks each

year. Despite its more northerly location, Lake A exhibits a far higher maximum water column

temperature (8.78 oC) than Lake Romulus (0.36 oC). Lakes C1, C2 and C3 are adjacent lakes at

the same latitude, yet have strikingly different thermal maxima (12.15, 2.45, 3.59 oC), reflecting

the importance of not only persistent ice-cover, but also the strength and position down the water

column of salinity gradients that promote stable stratification and that allow the long-term

trapping and storage of heat.

The marine-derived lakes of Arctic Canada can be placed within an evolutionary sequence of

landscape change, with individual lakes representing different steps in the transition from marine

to freshwater or hypersaline ecosystems (Fig. 2.8). All lakes were originally marine basins with

complete tidal connection to the open ocean. As sea level fell at the end of the last ice age

because of reduced ice loading on the land (isostatic rebound), pockets of seawater would have

been progressively cut-off, eventually resulting in seasonal and then complete isolation of the

lakes. Three such lakes which still receive occasional marine input are known in Arctic Canada:

Ogac (fed by spring tides; McLaren 1967), Qasigialiminiq and Tariujarusiq, lakes, all on Baffin

Island (Hardie 2004). Further examples have been recorded in Scandinavia (Ström and Klaveness

2003) and Antarctica (Gibson 1999). These lakes (lagoons) are typically stratified, with sea water

at the bottom of the water column and fresh water at the surface. Eventually such lakes become

completely isolated from the ocean to form saline lakes, such as Lake Romulus (present study

and Davidge 1994), Sophia Lake (Ouellet et al., 1987) and Garrow Lake (Ouellet et al. 1989;

Markager et al. 1998).

29

A specialized route for lake formation is illustrated by Disraeli Fjord and Taconite Inlet, at the

highest latitudes of the Canadian Arctic. Build-up of thick, landfast ice at the mouths of the long

fjords of northern Ellesmere Island results in dams that trap the inflowing meltwaters behind

them, with the depth of the freshwater layer constrained by the thickness of the ice shelf (Vincent

et al. 2001). The less dense freshwater floats on the denser seawater, and these epishelf lakes are

tidal. The salinity profile of Taconite Inlet, with its 6 m-thick freshwater layer, indicates that the

minimum thickness of the ice sheet damming the lake is only ca. 6 m. In 1999 Disraeli Fjord

presented a more mature system, with depth of the freshwater layer over 30 m. Epishelf lakes also

occur in Antarctica (Mueller et al. 2003 and references therein), where the freshwater can be up

to 100 meters thick. This ecosystem type is entirely dependent on the integrity of the ice dam, as

illustrated by Disraeli Fjord in 2002, when a major crack formed across the Ward Hunt Ice Shelf

and resulted in almost complete drainage of the surface freshwaters (Mueller et al. 2003). The

epishelf lake structure was completely lost at this time and the basin reverted to a marine inlet

that is at present fully connected to the Arctic Ocean. The epishelf systems contrast with Lake

Tuborg, also an ice dammed saline lake in the High Arctic, but formed by a glacial surge that

trapped seawater at the landward end of a marine embayment. The glacier holding back Lake

Tuborg is grounded throughout, and therefore the lake is not tidal. It is meromictic, with a layer

of freshwater overlying marine-derived saltwater (Smith et al. 2004).

With ongoing uplift and decreasing sea level, the tidal waters of epishelf lakes can be cut off to

form meromictic lakes. Lake A was isolated from a coastal arm of Disraeli Fjord epishelf lake

2500-4000 years ago. Gibson et al. (2002) provided geochemical evidence that significant

dilution of seawater in the lake basin occurred when the lake was still tidal prior to final

separation. Lakes C1, C2 and C3 may have had a similar origin, being isolated from an earlier

epishelf lake in Taconite Inlet.

The diversity of waters sampled in this study show that once isolated from the ocean, a saline

lake can follow divergent pathways (Fig 2.8). If significant freshwater flow occurs through the

lake, all salt can be flushed out resulting in a freshwater lake. Examples of such lakes in the

Arctic are Char Lake (based on the local emergence curve) and Lake C3. In these cases it would

be expected that the lakes would have a large drainage basin to lake area ratio and water loading.

30

Table 2.2 shows this to be the case, particularly for Lake C3, which has a theoretical annual water

loading that amounts to 25 % of the maximum depth of the lake. Flushing of salt from wind-

mixed water columns will be more rapid in areas of higher precipitation or if there is extensive

ice or snowfields in the drainage basin that provide a regular source of water. The transition from

saline to freshwater conditions is also known from coastal lakes at other latitudes, for example

lakes along the edge of Hudson Bay in subarctic Québec (Saulnier-Talbot et al. 2003).

An alternative development route occurs in basins with negative water balance; i.e., in which the

input through precipitation and inflow is less than the loss due to evaporation and outflow. In

these cases the initially marine lakes will become hypersaline (Fig. 8). Lake Romulus in our data

set provides a compelling example. If the process continues long enough a balance may be

reached between evaporation (which decreases with increasing salinity) and input, such as that

found for Deep Lake in Antarctica (Ferris and Burton, 1988). Freeze-concentration processes

both in the catchment (Ouellet et al. 1987) and within the lake (Davidge 1994) are also likely to

play a role in the development of hypersaline conditions. Under changing hydrologic conditions,

a hypersaline lake could lose its salt though flushing and evolve into a freshwater lake, although

no such examples are known from the Arctic.

Lakes that are neither fresh nor hypersaline can exist in a complex field in which changes in

climate can have significant affects on the lake. For example, Lake A retains near sea-water

salinity in its monimolimnion underneath a ca 10 m layer of fresher water. The ice on Lake A

appears to be going through a climate-induced transition from perennial to seasonal ice cover.

The permanent ice cover precluded wind mixing in the lake and lessened the intensity of ice

formation. We predict that the occurrence of a period of open water every year will lead to an

increase in salinity in the surface water due to entrainment of deeper, more saline water through

wind mixing, and that the annual ice formation will result in the production of more saline bottom

water through the production of brines at the lake margins (Ferris et al., 1991; Davidge 1994).

Therefore the bottom waters of the lake may become hypersaline, as in Romulus Lake (Davidge

1994). A similar fate may await Lakes C1 and C2, and it possible that Lakes Sophia and Garrow

may have already moved some way down this path. These latter lakes lose their ice cover for

several weeks each summer but contain hypersaline water at depth that may be due in part to

31

surface ice formation, but also to the freeze-out of salt from a saline aquifer (talik) under the lake

(Ouellet et al. 1987, 1989).

The Canadian High Arctic contains a set of present-day aquatic ecosystems that represent each

step of the coupled landscape-lake chronosequence. An analogous set of landscape evolutionary

processes leading to different lake types has been described to some extent in Antarctica,

specifically for an Antarctic fjord situated in the Vestfold Hills, an unglacierized coastal area near

the Australian Davis Station (Gallagher et al. 1989). Ellis Fjord contains a stratified basin, with a

hypersaline layer at its bottom. Gallagher et al. (1989) examined the physico-chemical processes

and concluded that the formation of the hypersaline layer depended on salt freeze-out during the

formation of ice cover. Paleolimnological studies in the Vestfold Hills area have provided a

detailed record of environmental change in Antarctic meromictic lakes, and similar studies are

required for the Ellesmere Island lakes and fjords, building on the studies at Taconite Inlet

(Bradley et al. 1996) and Tuborg Lake (Smith et al. 2004). The Canadian High Arctic is currently

experiencing changes in climate that seem to be unprecedented relative to the last few millennia

(Douglas et al. 1994), and these have begun to have a major impact on the aquatic ecosystems of

Ellesmere Island (Mueller et al. 2003; Antoniades et al. 2005). The predicted continuation and

amplification of these effects (ACIA 2004) are likely to cause major limnological shifts in the

high arctic systems described here, and to accelerate their evolution towards the end points as

shown in Fig. 8. Lake C3 is likely to continue to freshen given its large water load and minimal

stratification. Lakes A, C1 and C2 have relatively small catchments and deep water columns and

are more likely to move towards conditions seen in Romulus Lake, with increased open water

conditions favoring entrainment of saline waters into the surface layer and the production of

hypersaline brines by freeze-up. The evolution of all these lakes will also depend on the effect of

climate change on precipitation. Break-up of the Ward Hunt Ice Shelf has already led to the

draining of the Disraeli Fjord epishelf lake, and it has reverted to a marine embayment. A similar

fate probably awaits the incipient epishelf lake in Taconite Inlet. Finally, isostatic rebound is

likely to continue independent of modern climate change, leading to the eventual isolation of the

Baffin Island lagoons that are tenuously connected to the ocean, and perhaps initiating the

coupled landscape-lake evolutionary process in other marine bays.

32

Figure 2.1 : Map of the sampling sites. Pane A shows the whole Canadian Arctic Archipelago

(map from http://maps.grida.no/arctic/). Pane B shows the main study area on the northwestern

shore of Ellesmere Island. Pane C shows the Taconite Inlet area, with the catchment areas for

lakes C1, C2 and C3 outlined.

33

Figure 2.2 : Physical limnology of the different studied environments. Conductivity profiles in

mS.cm-1 are indicated by open triangles (note the different scales for Lakes C3 and Romulus).

Temperature profiles are indicated by black circles (note the different scales for all of the

environments).

34

Figure. 2.3. Water column profiles at Char Lake, June 1999. A, conductivity (black circles) and

temperature (open triangles); B, dissolved oxygen (black circles) and pH (open diamonds); C,

dissolved organic carbon (DOC; open diamonds) and dissolved inorganic carbon (DIC; open

triangles).

35

Figure 2.4 : Profiles of the oxydoreduction indicators. Dissolved oxygen profiles are shown by

black circles, the profiles extend down to anoxic layer or end of cable. In Lake C1, the dissolved

oxygen concentration exceeded the sensitivity of our sensor (>200% of saturation).

Concentrations of total manganese (open diamonds) and total iron (open triangles) are also

plotted. Note different scales for each site.

36

Figure 2.5 : Profiles for pH (black circles), dissolved organic carbon (DOC) (open diamonds) and

dissolved inorganic carbon (DIC) (open triangles). pH values are given on the same scale for all

environments except Disraeli Fjord. DIC and DOC scales are different for all the sites.

37

Figure 2.6 : Beam attenuation coefficient profiles (c660) and particle absorption (ap) spectra at

selected depths in Lake C1 on 19 June 2001 (panels A and C), and Lake A on 3 August 2001

(panels B and D). The numbers in panels C and D refer to the sample depths in metres. The

dashed line marks the depth limit of the oxic zone.

38

Figure 2.7 : Principal Component Analysis (PCA) of limnological descriptors for the 8 lakes and

fiords. Eigenvalues for the two first axes were 0.412 and 0.282. CLratio = ratio of catchment area

to lake area; DOC = maximum dissolved organic carbon concentrations measured in the water

column; maxCond = maximum conductivity; Max T= maximum temperature; TP max =

maximum total phosphorus concentrations; ZTmax = depth of the maximum temperature.

39

Figure 2.8 : Postulated evolutionary sequence for coastal, high latitude landscapes, embayments

and lakes.

40

Chapitre 3- Threshold effects of climate warming on stratified lakes and fjords of northern

Ellesmere Island, Canada.

3.1 Résumé

La côte nord de l’Île d’Ellesmere est une région de milieux aquatiques variés dans lesquels la

glace épaisse persistante joue un rôle majeur, contrôlant leurs caractéristiques physiques,

chimiques et biologiques. Dans cette étude, nous documentons une série de changements

dramatiques qui se sont produits dans la structure verticale de ces écosystèmes suite à une

tendance au réchauffement ainsi qu’à une fonte et un bris de glace. Nos séries temporelles

d’images RADARSAT couvrant la période 1998-2003 (inclusivement) montrent que les lacs A,

B, C1, C2 et C3 ont perdu leur couvert de glace de façon substantielle durant certaines années. En

1998, les lacs de la série C étaient complètement libres de glace, alors que les lacs A et B ont

gardé leur couvert de glace. En 2000 et 2003, les lacs C ainsi que les lacs A et B ont subi des bris

importants de leur couvert de glace. La période 2000-2003 a aussi été une période de rupture de

la plate-forme de glace de Ward Hunt qui ferme l’entrée du Fjord Disraeli et qui a été

accompagné par la disparition complète du lac épi-plate-forme du Fjord Disraeli. Des profils

provenant d’autres fjords de la région confirment la survie d’un autre lac épi-plate-forme dans le

Fjord de Milne. Des profils CTD (Conductivity-Temperature-Depth) des lacs méromictiques ont

confirmé le début du mélange après une longue période de stabilité. Par contre, suite à la

disparition complète du couvert de glace du Lac A à l’été 2000, les profils de colonne d’eau de

l’été 2001 montrent une nouvelle couche de mélange d’une profondeur de 10 m. Les profils des

lacs de la série C en 2001 montrent aussi des indices de mélange récent, ce qui correspond avec

les observations RADARSAT de conditions d’eau libre. Les profils des lacs A et B de 2003 et

2004 indiquent des changements subséquents à leur structure physique. Une analyse des données

météorologiques des stations de Alert, la station la plus nordique du réseau d’Environnement

Canada, située à 175 km à l’est de notre site d’étude et de la station d’Eureka, 300 km plus au

sud, montrent une tendance au réchauffement depuis les premières observations des lacs en 1967,

avec une augmentation de température anuelle moyenne de 0,47°C et de 0,59°C par décennie

respectivement. Les valeurs les plus élevées en degree-jour de fonte pour les 54 années

d’enregistrement à Alert datent de 2002 et en 2003.

41

3.2 Abstract

The northern coast of Ellesmere Island is a region with diverse aquatic ecosystems in which

persistent thick ice plays a major role in their physical, chemical and biological characteristics. A

series of permanently stratified and stable meromictic lakes are found in this region. In this study,

we document a series of dramatic changes that have taken place in the vertical structure of these

ecosystems as a result of warming trends, ice melting and break-up. Our time series of

RADARSAT images over the period 1998-2003 (inclusive) shows that Lakes A, B, C1, C2 and

C3 lost their ice cover in certain years. The C-series lakes were completely ice-free in 1998,

while Lakes A and B retained their ice cover. However, in 2000 and 2003, the C lakes as well as

Lakes A and B experienced substantial ice break up. A breakup event also occurred between

2000-2003 on the Ward Hunt Ice Shelf which was accompanied by the complete loss of a

freshwater (or “epishelf”) lake in Disraeli Fjord. Profiles from other fjords from this region

confirmed the continued existence of other epishelf lakes located at Milne Fjord. CTD

(Conductivity-Temperature-Depth) profiling of the meromictic lakes showed that mixing

occured, after a period of long-term stability. Subsequent to the ice cover break-up on Lake A in

2000, the 2001 water column profiles showed a new 10 m mixed layer. Profiles from the Lake C

series in 2001 also showed evidence of recent mixing, consistent with the RADARSAT

observations of open water conditions in 1998 and 2000. Profiles of Lakes A and B from 2003

and 2004 indicated further changes in the physical structure of these ecosystems. An analysis of

meteorological data from Alert, which is 175 km to the east of our study sites, and from Eureka,

which is 300 km to the south, shows a warming trend since the first water column profile was

taken in 1967, with an average yearly temperature increase of 0.47oC and 0.59°C per 10 years,

respectively. Highest values of melting degree-days for the 54-year record at Alert occured in

2002 and 2003.

42

3.3 Introduction

There is a broad consensus that the world is entering a period of accelerated climate change

(IPCC 2001). We appear to be crossing a long-term threshold of natural variability and stepping

into climate conditions that have not been experienced since the last Interglacial. Anthropogenic

emissions of greenhouse gases and the resultant increase in net radiative forcing are now widely

accepted as the cause of this rapidly changing climate regime (Hansen 2004; Karl and Trenberth

2003). We are now faced with the problem of evaluating the extent and pace of this change, and

its effect on the biosphere. Simulation models (e.g., Dai et al. 2004) as well as direct observations

(Serreze et al. 2000) indicate that the highest amplitude and most rapid climate changes are

occurring in the Arctic.

In the north American continental Arctic, climate records from the last two decades indicate a

strong warming of 1.06 °C/decade for annual average temperatures (Comiso 2003), however

there is also considerable variability among regions. The thinning and decrease in extent of the

sea-ice cover (Laxon et al. 2003; Rothrock et al. 1999) could lead to even more dramatic changes

through a positive albedo-driven feedback that would cause Arctic Ocean warming and further

decrease in sea-ice extent, further amplifying warming at high latitudes.

There have been observations at many locations showing significant climate changes in the Arctic

since the beginning of the short record period for this region (Serreze et al. 2000), and the most

recent observations now indicate a consistent warming trend throughout much of the Arctic

(Overland et al. 2004). A notable exception to this trend is the relative climate stability of the

northern Québec and Labrador region (R. Pienitz et al., cited in ACIA 2004). Long-term trends,

however, have been difficult to resolve in the Arctic, in part because of the significant interannual

variability in climate. This high latitude climate regime is also affected by cyclical processes,

specifically the Arctic Oscillation (AO) and the North Atlantic Oscillation (NAO), which can

obscure underlying trends, particularly over short time-scales.

An alternative approach towards evaluating climate change is to identify critical thresholds in

ecosystems where further change results in abrupt, discontinuous shifts in environmental and

ecological properties. Some of these thresholds for aquatic ecosystems have been identified in

43

the recent Arctic Climate Impact Assessment (ACIA 2004) and include changes in ice cover

thickness and duration, snow cover, stratification regime (e.g., from cold-monomictic to

dimictic), dissolved organic carbon loading associated with treeline migration, and abrupt

changes in connections with the sea associated with isostatic uplift or sea-level variations. Such

threshold effects can provide more compelling evidence of climate impacts than long-term

continuous records of continual changes that are obscured by natural scales of variability.

The northern coast of Ellesmere Island lies at the northern limit of the Canadian High Arctic, and

at the northern limit of landmasses on our planet. It lies within the region likely to experience the

strongest impacts of climate change. It contains many types of aquatic ecosystems including

meltwater lakes on the surface of ice shelves, deep, ice-dammed fjords and perennially ice-

covered meromictic lakes. These ecosystems are attracting increasing attention as climate change

indicators because of their strong dependence on the presence of ice, in the form of ice shelves,

multi-year sea-ice or a permanent ice-cover (Mueller et al. 2003).

The phase change of water from solid to liquid has a single temperature threshold, and that

change can potentially have dramatic effects on both the long-term structure of stratified

environments, as well as on runoff from snow and ice-melt, thereby amplifying the effects of

small temperature changes. Signs of these changes appear as the freezing balance threshold is

being crossed, either through a decrease of ice formation during the winter, or through increased

melt over the summer period. An ice shelf that was present along the entire northern coast of

Ellesmere Island at the beginning of the last century has been receding since that time (Vincent et

al. 2001). The last remnants of this ice shelf are continuing to dwindle, endangering rare and

delicate ecosystems such as epishelf lakes (Mueller et al. 2003; Vincent et al. 2001).

Climate impacts are beginning to be discerned throughout the Arctic region, including effects on

lakes and ponds from the treeline (Rühland et al. 2003) up to the polar desert (Perren et al. 2003).

However, long-term climate data for the region are sparse, making it difficult to place these

impacts in the context of global change. One set of invaluable climate records does exist and it

comes from the weather stations set up at military bases in the 1950s in the Canadian Arctic

44

Archipelago. This network, though not extensive, provides continuous data from 1951 to this date

at two locations on Ellesmere Island, at Eureka and Alert.

In this paper, we present a synthesis of our recent observations on lakes and fjords of Northern

Ellesmere Island (Fig. 3.1). We first evaluate a time series of RADARSAT images of ice-cover.

Secondly, we present in situ water column profiling data to characterize the stratification regime

of these environments, the extent of change, and the presence of threshold effects. Finally, we

examine the current records of climate from the long-term monitoring stations of Alert and

Eureka to interpret the limnological impacts relative to the current magnitude of atmospheric

change. We surmised that these northern-most lake ecosystems would be highly sensitive to any

warming trend in the region.

3.4 Materials and methods

3.4.1 Description of study sites

Lake A (83°00’N, 75°05’W) is a 120 m-deep stratified meromictic lake that was first described in

1970 (Hattersley-Smith et al. 1970). It has a deep thermal maximum (see Chapter 2), a feature

that is typical of solar heated meromictic lakes (Shirtcliffe and Benseman 1964). It has been

visited afterwards by three other research teams, including our own (Belzile et al. 2001; Gibson et

al. 2002; Jeffries and Krouse 1985; Jeffries et al. 1984; Ludlam 1996a; Van Hove et al. 2001). It

harbors the northernmost lake population of Arctic Char (Babilook, pers comm.). Lake B is a

smaller lake located in the same valley as Lake A and has been much less frequently sampled. It

also is a deep meromictic lake that appears to be perennially ice-capped.

Lakes C1, C2 and C3 near Taconite Inlet are meromictic to differing extents. All three lakes have

similar depths and areas, but differ mainly by the size of their catchments. This characteristic has

been used to evaluate the effect of an increase in runoff caused by climate change (see Chapter

2).

Disraeli Fjord is a stratified fjord dammed by the Ward Hunt Ice Shelf that blocks its entrance to

the Arctic Ocean. It is fed by meltwaters from Disraeli Glacier, an outlet glacier of the northern

45

Ellesmere Ice Cap, as well as other glaciers, streams and rivers. This type of environment, with

an extensive layer of freshwater in direct tidal contact with the sea trapped behind an ice shelf

was first described in Antarctica and is called an epishelf lake (Gibson and Andersen 2002;

Laybourn-Parry et al. 2001). This feature is extremely rare in the Northern Polar region: the

largest and best known example was Disraeli Fjord. Other fjords in the northern Ellesmere region

have ice shelves blocking the flow of freshwater from their drainage basins, including Milne and

Alfred Ernest ice shelves, and their limnology had little been investigated, but they are known to

have stratified water columns (Jeffries, 2002).

3.4.2 RADARSAT

Synthetic aperture radar images were obtained from the satellite RADARSAT for the end of each

melt season from 1998 onwards, and were spatially and radiometrically corrected. The satellite

instrument was operated in standard beam mode 5 (12.5 m resolution) or fine beam mode 1 (6.5

m resolution). The images were provided through the Canadian Centre for Remote Sensing

(1998, 1999) or through the Alaska Satellite Facility (all other dates). They represent the

condition of the ice cover towards the end of the melting season. The 1998 image was acquired

after the onset of freezing, but the reflectance difference between the newly formed black ice and

the second year white ice can be clearly seen.

3.4.3 Profiling

The temperature and conductivity profiles from 1967, 1984 and 1992 were obtained from

previous studies and the methods are described in the earlier papers (Hattersley-Smith et al. 1970;

Jeffries and Krouse 1985; Jeffries et al. 1984; Ludlam 1996a).

The temperature and conductivity profiles for Lake A and Disraeli Fjord in 1999 and for lakes A,

C1, C2, C3 and Taconite Inlet in 2001 were obtained with a Hydrolab Surveyor 3 profiler by

lowering the profiler through the ice cover by a hole drilled into the ice cove with an electric

auger and manually logging the data at 0.5m intervals.

46

The temperature and conductivity profiles for Lake A and Disraeli Fjord in 2003 and for lakes A,

B and Milne, Alfred Ernest and Markham fjords in 2004 were logged at 1 second intervals using

a Brancker XR-420 CTD, that was slowly lowered through drilled holes or natural openings in

the ice.

3.4.4 Climate data

The weather data from Alert and Eureka, were obtained through the Environment Canada

website. Melting-Degree-Day data (MDD) for each station were calculated by summing the daily

average temperature for all days in the year where the average temperature was above the

freezing point. Mean July, January and yearly temperature were calculated by averaging daily

mean temperatures. Daily maximum and daily minimum temperatures were also averaged to

assess the long-term changes in temperature variation. Trends were plotted for the period of

instrumental record of the lake structures, from 1967 to 2004.

3.5 Results

3.5.1 Ice cover

Our RADARSAT data, coupled to the field observation from research teams, showed that the

Lake A ice cover has been relatively stable over the observation period, with at most a relatively

wide moat forming around the edge of the ice pan at the end of the melting season. There are no

long-term ice cover observations for Ellesmere Island, but all the evidence pointed to a multi-year

ice cover over Lakes A and B up until the late 1990s. Even in 1998, which is well known to have

been an exceptionally warm year in the Arctic (Vincent et al. 2001), the RADARSAT data

indicated complete ice cover on Lakes A and B (Fig. 3.2). Our observations from the beginning

of the summer of the next year before the onset of melt (early June 1999) showed that the Lake A

ice cover contained a top layer of refrozen candled-ice from the previous year, and a bottom layer

of first year accretion black ice, pointing to a multiyear ice cover. In contrast, during the summer

of 2000, the ice cover of Lakes A and B melted completely by the end of August (Fig. 3.2). In

2003, also a very warm year, the ice substantially melted and broke up on both lakes, but there

was no complete ice-out.

47

Lakes C1, C2 and C3 appeared to be more sensitive to warming and their ice cover was lost

completely more often than in Lakes A and B (Fig. 3.2). The warm year in 1998 melted their ice-

cover almost entirely, with only a small residual ice-pan left on Lake C2. A complete ice-out was

observed in 2000 for all three lakes. In 2002, only Lake C3 became ice-free by the end of the

summer, perhaps linked to its larger catchment area and subsequent mixing by inflowing water.

In 2003, there was some ice melt on all three lakes, with this time only Lake C1 becoming ice-

free.

Disraeli Fjord is usually almost entirely covered by thick freshwater-type ice cover throughout

summer, as seen in Fig. 3.3 from the August 2000 image. However, this ice has recently changed

its radar reflectivity properties, suggesting a shift from freshwater to saline ice (M. Jeffries,

unpublished data). In 2003, large portions of the fjord were ice-free (Fig. 3.3), probably linked to

the major changes in the water column of the fjord.

3.5.2 Water column structure

The 1967 profiles from Lakes A and B show a very gradual increase in temperature at the surface

of all three lakes suggesting a long period of stability, while the most recent years show

developement of a surface mixed layer. The temperature and salinity profiles from Lake A were

relatively stable over the last 35 years (Fig. 3.4a and b), but some changes can be seen over the

years, mainly a general increase of the mid-water column maximum, as outlined in Table 3.1.

There is some evidence of limited surface mixing in the second sampling, in 1982, where there

seems to be a surface mixed layer. The profiles showed a dramatic change between 1999 and

2001. In Lake A in the past, the surface conductivity gradually increased from low, dilute

meltwater values immediately under the ice to the conductivity maximum at 28 m. In 2001,

however, the same, slightly brackish salinity of 0.5 ppt was found throughout the surface 10 m. In

2003, there was a second constant salinity layer that had formed, and this secondary halocline

was accompanied by a secondary thermal maximum, leading to a very unusual temperature

profile with two sub-surface thermal maxima. In 2004, the thermal and salinity profiles developed

further, with the secondary thermal maximum displaced down in the water column.

48

The Lake B water column, sampled in 2004, also seems to show an impact of recent melt (Fig.

3.5). The less detailed time series for Lake B does not show the change to be as dramatic as in

Lake A. Lake B is sheltered by steep cliffs towards the head of the valley, and the shorter fetch,

more protected aspect of this lake may have lessened the impacts of wind-induced mixing relative

to Lake A. The increase in mid-water column temperature maximum is larger in Lake B than in

Lake A, as seen in Table 3.1.

Table 3.1 : The depth and magnitude of thermal

maxima in the meromictic lakes of northern Ellesmere

Island for all reported dates of sampling, 1967-2004.

Lake Year Tmax (°C) Z-Tmax (m) Lake A 1967 7.6 17 1982 8.28 15 1992 8.91 16 1999 8.51 17 2001 8.78 17 2003 8.66 19 2004 8.59 18.3 Lake B 1967 8.65 17 1982 9.79 15 2004 10.27 17.1 Lake C1 1967 10.1 15.8 1985 10.65 15 1992 11.44 16.2 2001 12.15 15.7 Lake C2 1985 3.73 10 1992 3.82 19.1 2001 3.37 24.5 Lake C3 1992 4.07 30 2001 3.59 44

Lake C1 (Fig. 3.6) is the third lake that was sampled in 1967 and at the time showed a surface

mixed layer based on the temperature profile. The more exposed location of this lake relative to

49

Lakes A and B may have favoured these earlier periods of mixing, perhaps during the warm

period of the early 1960s that led to a major break-up of the Ward Hunt Ice Shelf (Vincent et al.

2001). There was also a marked increase in its mid-water column temperature maximum (Table

3.1). Lake C2 showed a dramatic shift in its surface temperature stratification between 1992 and

2001, with a deep mixed layer in 2001 subsequent to the two ice-out events observed in 1998 and

2000. Lake C3, had a weaker stratification than the other lakes and was found to be, and was

probably subject to complete water column mixing in the ice-out years.

Disraeli Fjord has experienced dramatic changes over the last few years in its water column

stratification. The first measurements from 1967 showed a deep freshwater layer at 45 m (Fig.

3.7). At each subsequent visit over the next 33 years, the freshwater layer lying over sea water

was found to have gradually thinned but was still 33 m thick up until 1999 (Vincent et al. 2001).

However, this freshwater layer completely drained away between 1999 and 2002 due to the

formation of the large north-south fissure in the Ward Hunt Ice Shelf (Mueller et al. 2003).

Our most recent profiling of northern Ellesmere fjords have confirmed the complete loss of the

epishelf lake structure in Disraeli Fjord in 2003 and 2004, and variable profiles in other fjords

(Fig. 3.7). Taconite Inlet has been sampled only in 1990 after the break-up of M’Clintock Ice

Shelf, which broke up in the early 1960s, and showed no evidence of true epishelf lake structure

at that time. A sharp halocline was found at a 5 m depth, suggesting an intermediary state where

freshwater is trapped behind multi-year sea-ice instead of behind a fully formed ice-shelf. Alfred

Ernest Fjord also has very similar structure, even though it still contains fragments of the great ice

shelf that spanned the entire northern coast of Ellesmere Island at the beginning of the century.

The waters behind Markham Ice Shelf show a structure very similar to Disraeli fjord, suggesting

a more direct contact to the sea. It is very likely that prior to the Ellesmere Ice Shelf break-up, all

of those fjords had a surface structure that resembled Disraeli Fjord before the break-up and

collapse of Ward Hunt Ice Shelf. Profiling at Milne Fjord in 2004 showed that it still contains a

17.5 m-thick surface layer of freshwater resembling the earlier epishelf state of Disraeli Fjord

(Fig. 3.7), and as such is the last known real epishelf lake in Northern Canada.

50

3.5.3 Climate data

All the plotted variables show a tendency towards warming over the course of the last 37 years,

corresponding to the period of measurements of the stratified lakes of northern Ellesmere Island

(Fig. 3.8). Melting degree-days at Alert were at the highest level recorded in 50 years in 2002 and

2003, higher than the warm years at the beginning of the 1960s that resulted in major calving

events in the Ward Hunt Ice Shelf. The same upwards temperature trend is found in the mean

July, January and Yearly temperatures at Alert Station. Table 3.2 shows the details of the trends,

showing that only the yearly mean temperature trends are statistically significant.

The data record over the same period further to the south on Ellesmere Island, at Eureka, shows

similar trends but at lower amplitudes (Fig. 3.8). It is interesting to note that, just as it has been

already pointed out by other researchers (Mueller et al. 2003), the most important changes over

the year occurred during the spring and fall periods, which explains why the yearly warming

trends are steeper than the January or July warming trends.

Table 3.2 : Trend statistics for the climate data from Alert and

Eureka presented in Fig 3.8, for the period 1967-present

Trend Slope R2 P (dy-1 or oCy-1) Alert MDD 1.42 0.075 0.0953 Yearly Temperature 0.047 0.31 <0.0001 January Temperature -6.58E-04 9.70E-06 0.9852 July Temperature 0.022 0.0569 0.1491 Eureka MDD 1.87 0.1 0.0526 Yearly Temperature 0.059 0.272 0.0009 January Temperature 0.017 0.0171 0.7528 July Temperature 0.024 0.0694 0.1099

51

3.6 Discussion

The compilation of RADARSAT images presented here shows that the northern Ellesmere Island

region is currently undergoing major changes. The melting and break-up of the Ward Hunt Ice

Shelf brought the complete drainage of the Disraeli epishelf lake. The summer melting of the ice

cover on lakes that were previously assumed to be perennially ice-covered is also of major

significance since the ice cover dictates the exchanges between the water and the atmosphere, and

a loss of ice cover exposes the water column to wind-driven mixing. These changes are consistent

with major changes elsewhere in the Arctic cryosphere, in permafrost, sea-ice and glaciers

(Serreze et al. 2000).

The extent of recent changes in Disraeli Fjord is underscored by a comparison of RADARSAT

images over several years. In 1998, the warmest year on record for much of the Arctic up to that

time, the ice remained full in place over all of the fjord with the exception of a narrow moat

around its periphery. Similarly in 2000, the ice remained intact (Fig. 3.3). However in late

summer 2003 the ice substantially broke up, and large, several-km wide areas of open water were

observed from helicopter overflights and from the RADARSAT imagery (Fig. 3.3). This may be

a direct response to the increased temperatures and melting degree days in the 2003 season (see

below). However it might also have been exacerbated by the change of ice type from freshwater

to saltwater following the disintegration of the Ward Hunt Ice Shelf and draining of the thick

surface-layer of freshwater from the Disraeli Fjord epishelf lake (Mueller et al. 2003).

The water column profiling provides further evidence of major change. The surface stratification

pattern of Lake A saw major modifications brought about by the melting of the ice cover that

allowed for the wind mixing of the first 10 m of the water column, and an increase of salinity in

its surface waters. The formation of a secondary halocline and thermocline could mean a change

in the oxygen content of the intermediate layer and an important loss of habitat for plankton and

fish. Surface mixing can increase the salinity of the surface layer by mixing up salts from the

halocline. When the surface waters increase in salinity over a critical threshold, ice formation can

52

bring salt exclusion and the possible formation of brine plumes that would over time make the

bottom part of the lake hypersaline, as found for example in Romulus Lake (see Chapter 2).

The stability of the stratification pattern in Lake A and mainly its stability from 1990 to 1999

including the warm 1998 summer, suggests that temperature alone cannot explain the

disappearance of the ice cover and subsequent mixing of the top 10 m of the water column on

Lake A in 2000. In fact, 2003 seems to have been even warmer than 1998 and the ice cover does

not seem to have melted completely during that summer either. It should be noted, however, that

the climate data are from stations at Alert and Eureka, not the Lake A basin itself, and that local

microclimatological variations may be of importance.

Once the ice covers are weakened by substantial melt, changes in wind direction, duration and

intensity are likely to play major roles in the subsequent break-up of the ice. This is probably a

factor contributing to the year-to-year variations in ice over Lakes A and B, particularly given the

sheltered nature of the valley in which they are located. Wind has been given very little attention

in the climate change literature, yet it is likely to have wide-ranging effects. For example, Vincent

and Belzile (Vincent and Belzile 2003) and Vincent et al. (Vincent et al. 2005) note that, by

redistributing snow on lake and sea ice, wind can have a greater effect on underwater biological

UV exposure than moderate stratospheric ozone depletion.

A notable observation from our profiling survey of the Ellesmere Island coast in 2004 is that

another epishelf lake is still in existence, in Milne Fjord (Fig. 3.7). This epishelf lake had already

been detected by Jeffries (2002). This fjord is still completely closed by a remnant of the

Ellesmere Ice Shelf, and currently has a thick freshwater layer overlying seawater. This will be a

fascinating location for ecological and paleolimnological studies of a remaining epishelf lake

ecosystem, and an especially important site for future monitoring of climate impacts.

The climate record from Alert and Eureka shows evidence of a warming trend over the period

dating from the discovery of the meromictic lakes of Northern Ellesmere Island and the first

limnological profiles of the Disraeli Fjord epishelf lake completed in 1967. Of great significance

for these ice-dependant systems is the striking increase of melting degree days per year at Alert in

53

recent years could explain abrupt, threshold type changes seen in the ice conditions of the ice-

shelf, fjords and lakes.

The remarkable ice-dependent environments of Northern Ellesmere Island are currently in a

phase of rapid transition, from permanently ice-covered to annually melting ice-cover. Their

biological and chemical properties are likely to be undergoing similarly abrupt changes, and will

require careful evaluation. These ecosystems appear to be extremely sensitive to the threshold

effects of small changes in the temperature regime, and are therefore invaluable long-term

monitoring sites for global change.

54

Figure 3.1 : Map of the Northern Ellesmere region. A : the Canadian Arctic Archipelago. B : the

study region around the Marvin Peninsula

55

Figu

re 3

.2 :

RA

DA

RSA

T im

ages

of L

ake

A a

nd B

in th

e to

p pa

nes

and

of L

akes

C1,

C2

and

C3

in th

e lo

wer

pan

es.

The

RA

DA

RSA

T da

ta a

re ©

Can

adia

n Sp

ace

Age

ncy/

Age

nce

spat

iale

can

adie

nne.

56

Figure. 3.3. Fine Beam RADARSAT-1 images of the northern end of Quttinirpaaq National Park,

Nunavut, Canada. Note the recent ice break-up in Disraeli Fjord in 2003 and in Lake A and B in

2000 (black = recent open water). The RADARSAT data are © Canadian Space Agency/Agence

spatiale canadienne 2003.

57

Figure 3.4a : Lake A temperature profiles for the different years of sampling. The temperature

data from 1967 are given as a dashed line in each plot for reference.

58

Figure 3.4b : Lake A salinity profiles for the different years of sampling. The salinity data from

1967 are given as a dashed line in each plot for reference. The arrows in 2003 and 2004 profiles

point to a density feature that has moved down the water column between the years. Note the

different depth scale than Fig. 3.4a.

59

Figure 3.5 : Temperature profiles from Lake B from three different years of sampling. The insert

shows the salinity profiles.

60

Figure 3.6 : Temperature profiles from Lakes C1, C2 and C3, salinity profiles from Lake C1 and

Lake C2 and conductivity profiles from Lake C3.

61

Figure 3.7 : Salinity profiles from five High Arctic Fjords. The left panel shows the evolution of

Disraeli Fjord from 1967 to 2004. Note different depth scale for both panels, dashed line in left

panel indicates the depth of the right pane. Right panel shows the stratification of four other

fjords. 2001 for Taconite, and 2004 for the other three.

62

Figure 3.8 : Temperature data from Alert and Eureka Station. Trendlines are given with 95% confidence limits and are plotted for the period of limnological observation of the region, from 1967 to 2004 inclusive.

63

Chapitre 4 - Genetic diversity and distribution of picocyanobacteria in high Arctic lakes

and fjords: microbial generalists in diverse habitats.

4.1 Résumé

Les lacs méromictiques, les fjords stratifiés et les lacs d’eau douce du haut Arctique canadien

démontraient une grande diversité de conditions physico-chimiques, avec des conductivités allant

de l’eau douce (0.1 mS.cm-1) à plus du double de l’eau de mer (100 mS.cm-1) et des températures

allant de -0,75 à +12 ºC. Les comptages par microscopie à fluorescence classique ont montré la

prédominance des picocyanobactéries, qui se retrouvent en grand nombre (103 à 2.5 x 104

cellules.ml-1) dans les zones oxiques et anoxiques de ces eaux. De plus, une grande diversité de

protistes a été observée : des chlorophytes, des cryptophytes, des dinoflagellés et des ciliés. Un

cilié marin, Mesodinium rubrum, a été retrouvé dans un des lacs arctiques alors qu’il avait été

aussi décrit dans les environnements lacustres antarctiques. Une analyse moléculaire utilisant le

gène 16S rARN par élèctrophorèse sur gel par gradient de denaturant (DGGE) et les librairies de

clones faits à partir d’échantillons provenant de 8 lacs et fjords différents, a montré une faible

variété de phylotypes colonisant une grande variété d’environnements. Au total, 133 séquences

partielles de bandes, de clones et de souches on été obtenues. Parmi celles-ci, 83% des séquences

(111) se regroupaient principalement en deux groupes apparentés, et les autres séquences se

regroupaient dans 7 autres phylotypes dont un seul ne contenait exclusivement des séquences

arctiques de cette étude. Ces résultats suggèrent que des souches généralistes de

picocyanobactéries dominent plusieurs types d’habitats malgré la grande variété de niches

écologiques potentielles dans ces fjords et ces lacs fortement stratifiés.

64

4.2 Abstract

Meromictic lakes, stratified fjords and freshwater lakes in the Canadian High Arctic showed a

great diversity of physico-chemical conditions, with conductivities ranging from freshwater (0.1

mS.cm-1) to more than twice seawater (100 mS.cm-1) and temperatures ranging from -0.75 to 12

ºC. Classical fluorescence micrcscopy cell counts showed that picocyanobacteria occurred in high

concentrations (103 to 2.5 x 104 cells.ml-1) in the oxic and suboxic zones of all of these waters. In

addition, a great diversity of protists was observed: chlorophytes, cryptophytes, dinoflagellates

and ciliates, including Mesodinium rubrum, a marine ciliate that is also found in Antarctic lakes.

Molecular analysis of 16S rRNA genes using denaturating gradient gel electrophoresis (DGGE)

and clone libraries of samples from 8 different lakes and fjords showed a low diversity of

phylotypes colonizing a wide variety of environments. In total 133 partial sequences from DGGE

bands, clones and strains were obtained. 83% of the sequences (111) clustered mainly in two

closely related groups, and remaining sequences were also found in 7 other phylotypes of which

one contained exclusively arctic sequences from this study. These results suggest that generalist

strains of picocyanobacteria dominate many types of habitat despite a high diversity of potential

ecological niches in these highly stratified lakes and fjords.

65

4.3 Introduction

The classical ecological view of extreme environments is that they are often dominated by

extremophiles, highly adapted organisms with special requirements and unusual, often narrow

environmental tolerances. This has deep implications for the understanding of endemism (the

restriction of species to a particular geographical region) and biodiversity which are closely

linked concepts and are a critical part of our understanding of the Earth’s present biosphere and

the impact of human activities. The concept of microbial endemism has been difficult to assess

and is still highly controversial (Finlay and Esteban 2004; Hedlund and Staley 2004), in part

because the concept of microbial species is in itself difficult to define (Castenholz 1992;

Franzmann 1996). The widely accepted and used definition is now based strictly on genetic level

similarity (Cohan 2002), and with the rise of molecular ecology (Pace 1997), it is now possible to

quantify the genetic differences among strains and communities and to map the geographic

distributions of genotypes.

Because there are many possible ways for microorganisms to travel freely from one region of the

globe to the other even between the polar regions (Vincent 2000b), the opportunities for

microbial endemism are limited. Many examples show that microorganisms from very distant

locations can bear a very close kinship when the environmental conditions are similar (Zwart et

al. 2002). The most likely systems favouring genetic separation would be in similar environments

at greatly distant locations separated by an environmental barrier that is very difficult to cross.

One such situation can be found in the ice-covered lakes of Antarctica and the High Arctic. Those

extreme environments are separated by tens of thousands of kilometres as well as by the warm

tropical and equatorial zones, limiting the movement of cold-acclimated species from one polar

zone to the other. On the other hand, studies of polar cyanobacteria have shown that many are in

fact psychrotrophs, with optimal growth temperatures well above the temperature found in their

natural environments (Tang et al. 1997) and tolerance of warm as well as cold extremes that

could contribute to their survival in transport from one pole to the other.

There have been limited bipolar comparisons to date, but there is some evidence of gene flow

between the polar regions, for example, some strains of sea ice bacteria (Staley and Gosink 1999)

and foraminifers (Darling et al. 2000). The dinoflagellate Polarella glacialis was initially thought

66

to be endemic to the Southern Ocean, but more recent molecular studies have also shown the

presence of an almost identical taxon in the Arctic (Montresor et al. 2003).

For cyanobacteria, some morphological studies have suggested that some cyanobacterial taxa are

restricted to Antarctica (Komarek and Anagnostidis 1999; Vincent 2000b), but the relative lack of

similar studies in the Arctic and the lack of molecular analyses might be the reason for this

apparent distinctiveness. At the molecular level, a study of Synechococcus strains from Arctic and

Antarctic lakes has shown a close relationship between strains from both polar regions (Vincent

et al. 2000a).

A recent study of the 16S gene from Antarctic microbial mats (Taton et al. 2003) has shown the

presence of a great phylogenetic diversity of filamentous and unicellular cyanobacteria, with 9

lineages that were exclusively Antarctic, and 2 that were novel and contained no known cultured

strains. Here again the lack of similar molecular studies in the Arctic could be responsible for the

apparent limitation of genotypes to one polar region.

Many previous studies have drawn attention to the importance of cyanobacteria as primary

producers in the polar environment (Vincent 2000a) although their genetic characteristics have

been little explored. While mat-forming species of cyanobacteria commonly occur in shallow

lakes, meltwater ponds, streams and cryoconite holes (Christner et al. 2003; Nadeau et al. 2001),

the ecology of picoplankton in high latitude lakes is not well known. Our objectives in the present

study were firstly to determine whether picocyanobacteria were present in the pelagic zone of

deeper lakes in the High Arctic, and to quantify their abundance and distribution. We focused this

work on a series of diverse, ice-covered and highly stratified waters at the northern limit of

Nunavut in the Canadian High Arctic that encompass a broad range of environmental conditions.

Our second objective was to assess the genetic diversity and distinctiveness of these populations

relative to their habitat distribution and relative to populations of cyanobacteria elsewhere,

including Antarctica. Environmental stability is commonly thought to be an important factor for

the development of sympatric communities with highly specialized environmental niches,

whereas generalist species have a selective advantage in a changing environment. We therefore

hypothesized that these stable high Arctic waters would yield a high level of diversity, as well as

67

provide a compelling test of endemism or divergence when compared to equivalent habitats in the

south polar region. These two aspects were addressed by the genetic characterization of

environmental DNA samples from 8 of our lake and fjord sampling sites in the Canadian High

Arctic. We also linked these results to our associated observations on the limnology and

microbial ecology of each site.

4.4 Methods

4.4.1 Sampling sites

Sampling was made primarily at sites in the northern sector of Ellesmere Island, at the northern

limit of landmasses in North America, with some additional sites near Resolute Bay, Cornwallis

Island, about 8 degrees of latitude further to the south (Figure 4.1). On Ellesmere Island, our main

study site was Lake A (83º00’N,75º05’W). This meromictic lake was first visited by a sledging

expedition at the end of the 1960s (Hattersley-Smith et al. 1970), and has been resampled on

several occasions since then (Belzile et al. 2001; Gibson et al. 2002; Hattersley-Smith et al. 1970;

Jeffries et al. 1984; Ludlam 1996a; Van Hove et al. 2001). These observations have shown the

highly stratified nature of its water column and the high degree of stability in this pattern over 30

years. Lake A has an area of 4.9 km2 and a maximum depth of ca. 120 m. It drains a catchment

containing no glaciers and is covered by a 2 m thick layer of ice during winter that melts to

around 1 m thick during most summers. For the present study, Lake A was visited twice, in June

of 1999 and August of 2001.

About 40 km west of Lake A lies Taconite Inlet and three lakes that are all similar in size and

depth (from 1.1 to 1.8 km2 and 51 to 84 m, respectively) (82º50’N, 78ºW). They differ mainly by

the size of their catchment and the amount of glacial influence they are subjected to. Lake C1 has

a strong stratification, a small catchment and has no glacial influence. Lake C2 has a larger

catchment containing small glaciers. Lake C3 has a large catchment and a strong glacial influence

from the Taconite River, an arm of which flows through the lake before draining into Taconite

Inlet. The inner basin of the inlet is partially isolated by a sill from its outer basin and is thought

to be at least 80 m deep. The outer basin is in direct contact with nearby M’Clintock Inlet. This

series of lakes can be taken as representing the gradual isolation and evolution of a marine basin

68

by isostatic uplift following deglaciation or eustatic variation of sea-level (see Chapter 2). All

these systems have winter ice-covers of around 2 m and we now have evidence from

RADARSAT imagery that this ice cover can be lost completely during some summers (see

Chapter 3). This sampling area was visited in the present study in July of 2001.

Table 4.1 : Environmental conditions at sampled sites (sampling dates are given in Chapter 2).

Depth Temperature Conductivity DO pH Fe Mn DOC DIC (m) (°C) (mS.cm-1) (mg/L) (mg/L) (mg/L) (mg/L) (mg/L)Lake A 2 4.7 0.45 12.32 7.26 0.009 0.0012 0.7 10.9 6.5 3.31 0.96 14.35 7.81 0.004 0.0011 1 14.6 12 6.21 7.26 3.71 7.19 0.008 0.109 0.6 20 15 8.5 17.5 0.13 7.25 0.006 4.81 0.5 41 Lake C1 5 2.8 1.79 16.1 8.43 0.009 0.0006 1.4 41.6 12 11.36 13.7 >20 7.4 <0 0.0011 1.2 136 15 12.14 18.4 12.55 7.29 Lake C2 3 2.43 0.216 13.95 8 0.184 0.0045 0.6 10 15 2.33 0.216 13.66 7.96 0.102 0.0029 0.5 10.1 Lake C3 5 3.22 0.18 12.59 7.97 0.045 0.0051 0.6 15.6 Romulus Lake 2.5 -0.75 15.8 14.6 7.89 <0 <0 3.1 63 16 0.24 16.3 11.68 7.73 0.013 0.0037 2.4 56 Disraeli Fjord 2.5 -0.25 1.25 19.7 8.18 0.001 <0.001 0.5 12.7 Taconite Inlet 3 2.93 1.29 13.99 8.27 0.485 0.0202 0.3 11.8 10 -1.77 47.4 12.49 7.86 0.096 0.0038 <0.1 24.26 Lake Meretta 2.5 0.03 5.8 7.09

Disraeli Fjord, a few kilometers east of Lake A, is a stratified fjord dammed by an ice shelf. It is a

deep (more than 400 m) system that has a very strong marine influence, as demonstrated by the

zooplankton species found in the deeper waters (Van Hove et al. 2001). Its surface waters form

an epishelf lake that was 33 m deep when we visited it in June of 1999 but which seems to be

undergoing dramatic change with the thinning of the Ward Hunt Ice Shelf (Mueller et al. 2003;

Vincent et al. 2001) and was covered by a 2.5 m-thick layer of ice.

The final site on Ellesmere Island was Romulus Lake (79º50’N, 85º00’W), a meromictic lake 20

km from Eureka and a little more than 300 km south of Lake A. It is similar in size and catchment

area to Lake A, but because of its more southerly and continental location, in summer it is a

warmer location and in consequence it loses its 2.5 m–thick ice cover annually. It is currently in a

69

hypersaline state (Davidge 1994; Egginton and Hudgson 1990), most probably from solute

concentration during the annual freeze-up of the ice cover.

Samples were also collected from Char and Meretta Lakes near Resolute Bay (74°42’N,

94°50’W) on Cornwallis Island. These lakes were intensively studied as the sites of an IBP

project in 1968-1972 and have been the subject of paleolimnological studies (Douglas and Smol

2000). These lakes are covered by a winter ice cover of over 2 m and they are both cold

monomictic lakes. They are used here both as reference points and representative of the final

freshwater step of limnological evolution. These lakes were isostatically uplifted and separated

from the sea about 6000 years ago (Barr 1971).

4.4.2 Sampling methods

Water was collected at different depths with a Kemmerer sampling bottle and filtered in the field

laboratory as soon as possible. For environmental DNA (Pace 1997), 1 to 2 liters were filtered on

Gelman Supor-200 0.2 µm porosity filters and put in lysis buffer before freezing. Extraction of

DNA from cultures and filters was performed using a modified warm phenol-chloroform

extraction protocol (Giovannoni et al. 1990; Wilmotte et al. 2002).

Environmental data were obtained using a Hydrolab Surveyor 3 profiler that was lowered through

holes drilled through the ice cover at each site. Water chemistry analyses were conducted by the

National Laboratory for Environmental Testing (Burlington, Ontario, Canada). Further details on

methods and complete data for water chemistry of Lake A have been published elsewhere

(Gibson et al. 2002).

Chl a concentrations were determined by ethanol extraction from a 25 mm GF/F-equivalent glass

fiber filter. Fluorescence determination was carried out using a Sequoia-Turner Fluorometer

(Nusch 1980) and calibrated using an Anacystis Chl a standard that was analyzed

spectrophotometrically.

Picocyanobacteria concentrations were determined by filtering 50 ml of samples on Anodisc 0.2

µm filters (Whatman) and mounting the filters on microscopic slides using Aqua-Polymount

70

(Polysciences). Slides were prepared in the field immediately after sampling and then were stored

frozen. The cells were subsequently counted by epifluorescence microscopy with a Zeiss

Axioskop inverted microscope fitted with blue and green excitation filters to detect the

autofluorescence of the photosynthetic pigments.

4.4.3 Molecular studies

Using cyano-specific primers for a semi-nested PCR reaction (polymerase chain reaction), a

portion of the 16S rRNA gene was amplified using 359F (Nübel et al. 1997) and 23S30R (Taton

et al. 2003) for the first amplification and 359F and 781RGC (a or b) (a:

cgcccgccgcgccccgcgcccgtcccgccgcccccgccgactactggggtatctaatcccatt (5' – 3'), b:

cgcccgccgcgccccgcgcccgtcccgccgcccccgccgactacaggggtatctaatcccttt (5' – 3') (Boutte et al. In

prep.) for the second, where a high CG-content section was added to the DNA fragments,

forming the GC-clamp. For the first PCR, we used 30 cycles of 45 seconds at 94 ºC, 45 seconds

at 54 ºC, and 2 minutes at 68 ºC. For the second PCR, we used 35 cycles of 1 minute at 94 ºC, 1

minute at 60 ºC, and 1 minute at 68 ºC.

After the GC-clamp PCR, samples were run on a denaturating gradient gel (DGGE) using a

DCode gene system (Bio-Rad) and performed as described by Muyzer (Muyzer 1999) with the

following modifications. The PCR products from reactions using the 781RGC (a) and (b) primers

were run separately on a 6% acrylamide gel. The gel contained a linear denaturation gradient of

45 to 55% denaturant (the 100% denaturating solution was 7 M urea and 20% formamide).

Electrophoresis was conducted for 16h at 45 V and 60ºC. The gel was stained with GelStar

(Molecular Probes) stain and imaged using a Bio-Rad phosphorimager. Bands on the gel were cut

out using a surgical scalpel, the DNA allowed to diffuse out of the gel in TE-4 buffer at room

temperature for 1h and a PCR was run to confirm the identity of the fragments using 359F and

781R without the GC clamp first, and then with the GC clamp included in the primers. The

products of this second PCR were put again on a DGGE gel and the position of the bands was

confirmed before sequencing using the 781R primer. Sequencing was carried out by Genome

Express (France) on a ABI PRISM system 377 (PE Applied Biosystems).

71

4.4.4 Cloning

Cloning was done using the TOPO TA cloning kit following the manufacturer’s instructions

(Invitrogen BV, the Netherlands). Single adenine bases were added to the extremities of the

359F-23S30R products obtained by PCR of three environmental samples : Lake C3, 5 m (2001),

Lake A, 15 m (2001) and Lake A, 2 m (1999). PCR products from three PCR amplifications from

the same sample were pooled and fragments were ligated into the plasmid. White transformants

were purified using standard agar plate streaking methods. Plasmid DNAs were extracted and a

partial sequence of approximately 400 base pairs (bp) was obtained using the 359F and 781R

cyano-specific primers that were used for PCR reactions. Sequencing was carried out by Genome

Express (France) on a ABI PRISM system 377 (PE Applied Biosystems).

4.4.5 Phylogenetic analysis

Sequences were analysed using BLASTn on NCBI’s website and the two most similar sequences

were selected. When the sequences having the highest similarity scores were uncultured, the

closest cultured sequence was retrieved. Sequences were corrected by visual inspection and

edited using the BioEdit software package (Hall 1999). Alignments were made using Clustal W

algorithm included in the same package and a corrected alignment containing 318 positions was

obtained. The phylogenetic tree was constructed using the TREECON software package (Van De

Peer and De Wachter 1994), using Jukes and Cantor (Jukes and Cantor 1969) distance

calculations without taking indels (insertions and deletions) into account. The neighbour-joining

method was then used to build the phylogenetic tree. Bootstrap analysis was performed, using

1000 resampled trees. Sequences included in the tree were all those determined in this study, the

Antarctic and Arctic picocyanobacterial sequences as well as the closest related sequences

available in the GenBank database. When identical sequences were obtained, only one

representative was selected for further analysis and the number of identical clones indicated

between brackets besides the sequence name in the tree (Fig. 4.4). In addition, representatives of

major picocyanobacterial clusters from freshwater environments that have been identified in

previous studies (Crosbie et al. 2003; Ernst et al. 2003) have also been added, to provide a

context for our sequences.

72

4.4.6 Statistical analysis

In order to detect if some environmental variables were influencing the distribution of the main

cyanobacterial clusters found in the genetic analyses, we used canonical correspondence analyses,

relating the different environmental values to the presence/absence data of different clusters.

Variables included in this analysis were : depth, temperature, conductivity, dissolved oxygen, pH,

Chl a concentration, picocyanobacterial cell counts, DOC, DIC, total phosphorus, and

concentrations of various ions (Cl-, Na+, K+, Mg2+, Ca2+, total dissolved Fe and Mn, SO42-). The

sites were defined as single depths of sampling, since all the environments showed strong

stratification. Canonical correspondence analysis (CCA) was carried out using CANOCO for

Windows 4.5 (ter Braak and Smilauer 2002). Simple transformations (1/n or ln n) were applied to

normalize the environmental data. The significance of the solution was determined using 99

unrestricted Monte Carlo permutations.

4.5 Results

4.5.1 Limnological conditions

The sampled environments spanned a broad range of limnological conditions (Table 4.1). A

complete physicochemical description of those lakes can be found in chapter 2. Two illustrative

profiles are presented in Figure 4.2 : Lake C3 was almost completely freshwater, as can be seen

from the very low conductivities (from 0.1 under the ice to 0.26 mS.cm-1 at the bottom) and Lake

A was a classic solar heated meromictic lake. It showed conductivities ranging from 0.2 mS.cm-1

at the surface to 49 mS.cm-1 in the lower part of the water column and a mid-water column

maximum of 8.15 ºC at 16 m that was stabilized by the density gradient created by the salinity

increase.

73

4.5.2 Biological communities

Chl a concentrations were relatively low in the surface waters of all the studied sites, ranging

from 0.2 to 1.0 µg.l-1 indicating the oligotrophic to ultra-oligotrophic nature of these

environments (Fig. 4.3).

Picocyanobacteria were found in great abundance in all of the environments, with cell counts up

to 25 000 cells/ml in the oxic zones (Fig. 4.3). Yet higher counts were found under the oxycline

of Lake A at a depth of 20 m (up to 60 000 cells/ml), in association with redox conditions that

allowed anoxia without the presence of H2S. The protist communities were highly stratified in all

environments, with large differences in taxonomic composition between sites, and in Lake A,

between sampling years.

4.5.3 Molecular analyses

Amplification and sequencing of a 400 bp–length fragment of the 16S rRNA gene from

environmental samples with cyano-specific primers and further analyses of diversity by both

DGGE and cloning showed a relatively low diversity of cyanobacteria in a wide range of

lacustrine habitats from the Canadian High Arctic (Table 4.2). From three clone libraries, 73

clones were obtained and partial sequences of the 16S rRNA gene from those clones were

obtained. A first clone library from a surface water sample of Lake A produced only three

sequences as preliminary data. The other two clone libraries, from Lake C3 at 5 m and Lake A at

15 m, had coverage indexes of 97 and 100% respectively, reflecting the fact that one phylotype

was dominant at each site. From DGGE analyses, 52 bands were re-amplified and sequenced.

Eight sequences from cultivated strains were also obtained. In total, 133 partial 16S rRNA

sequences were obtained. The distance tree was divided into eight sequence clusters, with two

main clusters containing 85% of sequences obtained from cloning and DGGE (Fig. 4.4).

Nine sequence clusters were defined in the tree based on sequence similarity. The first four

clusters fell within the Cyanobium group as defined by Ernst et al. (Ernst et al. 2003) that

includes all freshwater Synechococcus strains. Cluster V was composed of sequences obtained

from polar environments, and clusters VI to IX contained sequences outside of the

74

Synechococcus radiation. Interestingly, no sequences were found that were related to marine

Synechococcus and Prochlorococcus strains.

Table 4.2 : Distribution of phylotypes among sampled sites.

Site Depth Conductivity Cluster (m) (mS.cm-1) I II III IV V VI VIIVIII Lake A 2 0.45 5 3 1 6.5 0.96 2 12 7.26 5 15 17.5 36 1 Lake C1 5 1.79 1 1 12 13.7 4 4 15 18.4 3 1 Lake C2 3 0.216 7 15 0.216 5 Lake C3 5 0.18 32 4 Romulus Lake 2.5 15.8 1 16 16.3 1 1 Disraeli 2.5 1.25 3 Taconite Inlet 3 1.29 3 1 10 47.4 2 Char 2 0.26 3 20 0.26 1 1 Lake Meretta 2.5 0.2 4

The first group, Cluster I, with an internal similarity of 98.9% contained 48 sequences : 13 DGGE

bands and 35 clones. The DGGE bands originated from samples from a broad range of

environments whereas 29 identical clone sequences came from Lake A at a depth of 15 m.

Cluster I sequences are closely related to Synechococcus strains from temperate regions. Cluster

II had an internal similarity of 98.6% and was composed of 68 sequences from DGGE bands and

clones from the 5 m sample layer of Lake C3. Again, this group showed close similarity (>98%)

to strains of temperate origin, mainly PE-rich isolates from a sub-alpine lake in Austria (Crosbie

et al. 2003). It was closely related to the sequences in Cluster I, with a similarity of 96-97%

between sequences in the two groups. Taton et al. (Taton et al. 2003) used the highly variable

region corresponding to Escherichia coli positions 463 to 468 as a signature for different clusters.

Noteworthy, all sequences in Cluster I had the nucleotides ATC and all sequences in Cluster II

had AAC at the same signature positions. Those signature sequences are indicated with the

75

cluster names on the distance tree (Fig. 4.4). Cluster III contains two sequences from our study,

one picocyanobacterial strain isolated from Taconite Inlet and one DGGE band from Lake A. It

corresponds to Ernst et al.’s (Ernst et al. 2003) Cyanobium gracile cluster and is closely related to

a strain already isolated from a thermokast melt pond on Bylot Island in the Canadian Arctic

(P212; (Vincent et al. 2000a). Cluster IV contained 2 DGGE band sequences and 5 sequences

from cultured strains and had an internal similarity of 98.6%. It is closely related (more than 98%

similarity) to Synechococcus sp. strain NIVA-CYA 328 from Norway. Cluster V contained two

of our sequences, one DGGE band and one strain and was closely related to an arctic strain

(P211) as well as picocyanobacterial strains from Antarctic meromictic lake ecosystems (Ace,

Pendant, Abraxas) that closely resemble the Northern Ellesmere lakes in the north polar region.

The other clusters contained various cyanobacterial and plastid lineages. Cluster VI contained a

plastid sequence that was closely related to Chrysochromulina polylepis, consistent with the

presence of Chrysochromulina cells found in microscopic counts of the protistan community in

Lake A. Cluster VII contained sequences of filamentous cyanobacteria from a planktonic sample

in Meretta Lake (25a) that was closely related to Nostoc. Lake Meretta is a shallow nutrient-

enriched lake that has extensive microbial Nostoc mats in its benthos and surrounding catchment,

and the planktonic sample probably contained material from these sources. Cluster VIII is a novel

phylotype that contained sequences that were not closely related to any known cultured strains,

but was loosely (around 92%) similar to filamentous Leptolyngbya, also common in arctic

microbial mats in the benthos of lake catchments. The final group, Cluster IX contained

sequences from a strain isolated from Limnopolar Lake on Byers Island in Antarctica (see Fig.

1.1, Chapter 1) and a sequence obtained from Lake C3. This cluster is related to Limnothrix and

Pseudanabaena strains as well as a sequence obtained from a microbial mat in Lake Fryxell in

the McMurdo Dry Valleys in Antarctica.

76

4.6 Discussion

4.6.1 Cyanobacteria in polar lakes

Our results show the widespread distribution of picocyanobacteria in Ellesmere Island lakes and

are consistent with previous studies in the High Arctic and Antarctica (Vézina and Vincent 1997).

However, they show for the first time that picocyanobacteria are also abundant in a wide range of

deep, marine-derived Arctic environments, and under a broad range of physical and chemical

conditions. The concentrations observed here fall at the lower end of the range of lake

observations and reflect the oligotrophic nature of these environments. Much higher

concentrations have been observed in some nutrient-rich meromictic lakes of Antarctica, for

example up to 107 cells per ml in Ace Lake, Antarctica (Rankin et al. 1997).

These observations in marine-derived environments contrast markedly with those in northern seas

and the Arctic Ocean where very low concentrations of picocyanobacteria are encountered

(Gradinger and Lens 1995). Studies of bacterioplankon diversity in the Arctic Ocean have even

reported a complete absence of cyanobacteria by molecular methods (Bano and Hollibaugh

2002). The same striking absence has also been found in studies of sea-ice communities that

contribute substantially to the total productivity of polar oceans (Brown and Bowman 2001;

Melnikov et al. 2002). This contrast is particularly striking given that the environments sampled

in the present study are either derived from the sea (and many still contain saline water) or are in

direct contact with it. These observations imply that the controls on cyanobacterial populations

are determined by offshore factors, for example large grazer populations or advective losses,

rather than by temperature or salinity.

The current polar aquatic system comparisons are mainly concerned with the polar oceans (Bano

and Hollibaugh 2002; Wilmotte et al. 2002), but the Arctic and Southern Oceans have very

different structures. The former is an ocean surrounded by land that is strongly influenced by

great rivers coming in from the Canadian and Siberian regions, while the latter is an ocean

surrounded land with a very limited terrestrial influence. The comparison must take these

contrasting factors into account, and the marine polar environments are not easily directly

comparable. When looking at polar lakes, on the other hand, and at meromictic lakes in

77

particular, the terrestrial influence they are subjected to is limited by their usually small

catchment area and allows for closer comparisons than between the polar oceans.

Studies of picocyanobacteria from the Southern Ocean (Wilmotte et al. 2002) have revealed a low

abundance of those organisms and a molecular diversity study showed that the strains found in

the Southern Ocean were closely related to strains found in both the tropical and northern regions.

The strains that we found in the present study were not closely related to this marine group,

illustrating a fundamental difference between the marine and lacustrine environments and

communities.

While studies of filamentous cyanobacteria from polar ecosystems can rely on both

morphological and molecular techniques even when accounting for the cyanobacterial

morphological plasticity (Nadeau et al. 2001; Taton et al. 2003), studies of picocyanobacteria are

limited to molecular ecology, given the limited morphological diversity, yet high genetic

diversity of the Synechococcus genus. The resolving power of 16S rRNA can be limited, when

looking at closely related strains, but unicellular cyanobacteria are well characterized and the

database of sequences is extensive (Scalan and West 2002). It is possible, however, that the 16S

rDNA analysis has insufficient genetic resolution to discriminate some strains that differ in their

physiological tolerances and acclimation abilities.

4.6.2 Microbial endemism and climate change Our results show that there are two main groups of picocyanobacteria present in the High Arctic

aquatic environments studied here. One group clusters with the clones from the Lake A deep

sample (15 m), and mainly consists of sequences from around or under the oxycline of the

different lakes, probably representing a single microaerophilic and halotolerant strain. The second

group clusters with the Lake C3 surface clones (3 m), and seems to be a more “freshwater” strain.

Both those strains are found in a wide array of environments, illustrating their wide

environmental tolerances. This attribute has been previously noted for filamentous cyanobacteria

in high latitude lakes, ponds and rivers (Tang et al. 1997). In the present study, both groups of

Synechococcus strains shared strong genetic affinities with other freshwater strains. There were

also DGGE bands that clustered around Antarctic lake cyanobacteria, suggesting a close

78

relationship between Arctic and Antarctic ecosystems despite the great distance and major

climatic and geographic barriers between the north and south polar regions.

Principal component determination by canonical correspondence analysis showed that there is no

single apparent environmental variable that drives the distribution of picocyanobacterial

genotypes that we observed here, and that all are found in a wide range of conditions. Polar

aquatic ecosystems of the type studied here seem to favour generalist strains of cyanobacteria, in

contrast with the common perception of highly specialized communities in extreme

environments.

The results obtained here contrast with the view of microorganisms as highly specialised taxa.

The recent publication of three picocyanobacterial genomes provides some interesting insight into

this aspect. The motile Synechococcus WH8102 seems to be more of a generalist (Palenik et al.

2003) than the two highly specialised and light-level adapted Prochlorococcus that are closely

related when using rRNA sequences but have highly divergent genomes (Rocap et al. 2003). The

genomes were also found to be greatly influenced by lateral gene transfer mediated by

cyanophages that were found in great number and diversity in the marine environment (Sullivan

et al. 2003). The environments we investigated in the present study contained high concentrations

of viral particles (105-106 ml-1). These may include cyanophages that could influence the genomic

structure of picocyanobacteria, and by doing so, contribute to the wide environmental tolerances

found within the same rRNA- constructed cluster.

Our limnological observations confirm the habitat diversity of the High Arctic meromictic lake

environments, both between lakes and through highly stratified environments. However, the

molecular analyses show that these features do not translate into a broad genetic diversity of

cyanobacterial groups. Contrary to our hypothesis, the results are not consistent with a high

diversity of cyanobacterial genotypes and niche-differentiation among limnologically diverse

lakes, or across the strong vertical gradients in physical and chemical conditions within each lake.

The results instead imply that a limited number of genotypes has achieved success in these high

Arctic environments by way of a survival strategy based on broad environmental tolerances.

Similarly, the Arctic genotypes observed here do not show evidence of microbial endemism. The

79

divergence from the few picocyanobacterial strains already characterized from the polar regions

is not strong enough to show clear separation between Arctic and Antarctic groups.

80

Figure 4.1 : The geographical location of sampling sites and the sources of cyanobacterial strains

and clones analyzed in the present study. Pane A: the Canadian Arctic Archipelago, pane B: area

surrounding the Marvin Peninsula.

81

Figure 4.2 : Profiles of temperature (black circles) and conductivity (open triangles) in two lakes

where the clones were obtained.

82

Figure 4.3 : Profiles of Chl a concentration (open triangles) and picocyanobacterial cell counts

(black circles) in seven sampled environments from which samples for cloning and DGGE were

obtained. Note two different years for Lake A.

83

Figure 4.4 : Phylogenetic tree of

cyanobacterial strains from 16S

rRNA sequences constructed using

Jukes and Cantor parameters (1969)

by the neighbor joining method,

using TREECON software package.

The sequences from this study are

given in bold; S indicates sequences

from cultured isolates, and others

are from environmental samples.

Each cluster is identified with its

signature sequence. The distribution

of clusters among environments is

given in Table 4.2.

Distance

84

Chapitre 5 - Farthest north lake and fjord populations of calanoid copepods Limnocalanus

macrurus and Drepanopus bungei in the Canadian high Arctic

5.1 Résumé

Les assemblages zooplanctoniques du lac A et du fjord Disraeli, au nord de l’Île d’Ellesmere,

(83°N, 75°W), ont été étudiés au début de l’été 1999. Dans le lac A, au couvert de glace

permanent, deux espèces de copépodes reliques glaciaires (Limnocalanus macrurus et

Drepanopus bungei) ont été trouvés dans les eaux de surface (jusqu’à 30 m). Tous les stades de

développement de D. bungei, plus abondant, ont été trouvés, alors que seulement des adultes de

L. macrurus ont été observés. Une analyse de contenu stomacal a montré que L. macrurus était

prédateur de l’espèce plus petite. Un échantillon tiré d’un trait de filet dans le fjord Disraeli était

principalement composé de D. bungei et de L. macrurus, avec en plus deux espèces de copépodes

cyclopoïdes marins (Oncaea borealis et Oithona similis). Ces deux communautées

zooplanctoniques se retrouvent dans des habitats inhabituels qui sont fortement influencés par la

glace et la neige persistantes. Ils seront le site de transformations majeures d’habitat si les

tendances présentes de réchauffement de climat continuent dans la région polaire nordique.

85

5.2 Abstract

The zooplankton assemblages of Lake A and Disraeli Fjord, northern Ellesmere Island (83ºN,

75ºW), were surveyed in early summer of 1999. In permanently ice-covered Lake A, two glacial

relict calanoid copepod species (Drepanopus bungei and Limnocalanus macrurus) were found in

the top 30 m. All developmental stages of the more abundant D. bungei were present, whereas

only adults of L. macrurus were found. Analysis of gut contents showed that L. macrurus preyed

upon the smaller species. A net tow sample of zooplankton from Disraeli Fjord was mainly

composed of D. bungei and L. macrurus, along with two marine cyclopoid copepods (Oncaea

borealis and Oithona similis). These two zooplankton communities occur within unusual habitats

that are strongly influenced by perennial ice and snow. They will be subject to major habitat

disruption should the current warming trends continue in the north polar region.

86

5.3 Introduction

The distribution of copepods in the Arctic Ocean and arctic coastal waters is well documented

(summarized in Mauchline 1998; Thibault et al. 1999), however information concerning lake and

fjord populations at extreme latitudes in the circumpolar Arctic is still limited. In the present

study we examined the zooplankton assemblages at the northern limit of these habitat types :

perennial ice-covered Lake A and ice-dammed Disraeli Fjord. Both sites are located at latitude

83ºN in the Canadian High Arctic.

Lake A was first investigated in 1967 (Hattersley-Smith et al. 1970), and there have been

occasional visits since that time (Jeffries et al. 1984; Ludlam 1996a; Retelle 1986). Little

attention, however, has been given to the biological limnology of this lake. Nearby Disraeli Fjord

has been sampled sporadically since 1967, and previous collections of zooplankton have revealed

the presence of Drepanopus bungei (Bowmann and Long 1968). Given their extreme location at

the northern limit of North America, the species composition at these sites is of special interest

for biogeographical analyses. In addition to the zooplankton collections we also undertook a

limnological description of these sites to provide background information on habitat

characteristics.

5.4 Materials and methods

Lake A (83º00’N, 75º30'W; Fig. 5.1), and Disraeli Fjord (82º50’N, 73º40’W; Fig. 5.1) are located

on the northern coast of Ellesmere Island. Lake A is meromictic (permanently stratified) and has

a maximum depth of > 115 m, a surface area of 4.9 km2, an apparently perennial ice cover up to 2

m in thickness (but see new information in Chapter 3 of this thesis obtained subsequent to the

1999 sampling reported here) and a catchment area of 37 km2 containing no glaciers. It was

formed after the last ice age when isostatic uplift of northern Ellesmere Island trapped pockets of

seawater in a pre-existing depression (Lyons and Mielke 1973). Disraeli Fjord is a stratified, 45

km long fjord dammed at its northern end by the Ward Hunt Ice Shelf. At the time of sampling,

the ice cover on the fjord was 2.4 m.

87

Water column measurements were made in Lake A during the first week of June 1999 and

Disraeli Fjord was profiled on 9 June 1999. Temperature, salinity and dissolved oxygen were

measured using a Hydrolab Surveyor 3 profiler. Estimates of phytoplankton biomass were made

by measuring chlorophyll a (Chl a) concentration. Water was sampled at 1 m intervals in the oxic

zone in Lake A and at 1-10 m intervals in Disraeli Fjord. Sampling was made with a 2 L

Kemmerer bottle and 250 mL subsamples were filtered through GF/F glass fibre filters. Filters

were kept frozen and pigments were extracted within less than a month using boiling ethanol

according to Nusch (Nusch 1980). Fluorescence was measured with a Sequoia-Turner Model 450

fluorometer, with correction for phaeopigments using the equations of Jeffrey and Welschmeyer

(Jeffrey and Welschmeyer 1997).

Zooplankton was sampled from Lake A on 8 June 1999 and Disraeli Fjord on 9 June 1999. At

Lake A, a hole was cut through the ice and was kept open for three days before zooplankton

sampling. A 1 m long conical plankton net (mesh size: 100 µm; mouth diameter: 20 cm) was used

to sample the zooplankton. Duplicate net tows were made sequentially at the following depths:

2.5, 5, 7.5, 10, 12.5, 15, 17.5, 20, 25 and 30 m. The net was towed by hand vertically at

approximately 1 m/s from a given depth to the surface. In Disraeli Fjord, logistical constraints

allowed us only a single tow from the brackish water layer, from 30 m to the surface. All samples

were preserved with final concentrations of 0.2% glutaraldehyde and 0.02% formaldehyde, a

preservative used for phytoplankton studies which gave very good preservation of zooplankton.

The specimens were identified and enumerated using a binocular microscope (32X

magnification). For each species, copepodite stages were counted separately, but nauplii stages

were pooled. The volume filtered by the plankton net was determined by multiplying the mouth

area by the depth of sampling. To calculate zooplankton densities, a filtration efficiency of 100%

was assumed (Tranter and Smith 1968), and the differences between numbers in each tow were

used to calculate the stratum density. The stomach contents of several adults of L. macrurus and

D. bungei were determined by dissecting and mounting their intestines on a glass microscope

slide and examining them at 400X magnification.

88

5.5 Results and Discussion

Disraeli Fjord and Lake A were both highly stratified (Figs. 5.2 and 5.3). Lake A had temperature

and salinity profiles similar to other polar meromictic lakes (cf. Gibson 1999), with a temperature

maximum below the surface and a gradual halocline. The oxygenated zone was limited to a 13 m

supersaturated low conductivity layer (0.26 mS/cm, 0.13 0/00) at the surface in which Chl a

concentrations ranged from 0.2 to 0.5 µg Chl a.l-1. These values are similar to Chl a

concentrations in other lakes in the High Arctic (Lake Char : 0.46-0.78 µg.l-1, Lake Garrow :

0.04-0.40 µg.l–1; Markager et al. 1999) and in oligotrophic lakes in the McMurdo Dry Valleys in

Antarctica (Vincent 1987).

Disraeli Fjord had a sharp halocline at 32 m that likely reflected the depth of the nearby ice shelf

at the mouth of the fjord (Vincent et al. 2001). The surface waters were relatively fresh (0.68

mS/cm, 0.67 0/00), while salinity and other conditions below 32 m were similar to the Arctic

Ocean. This type of ecosystem of freshwater floating on seawater is known as an epishelf lake,

and is a phenomenon mostly restricted to Antarctica (see Hodgson et al. 2004). The water column

sampled was well oxygenated with temperatures close to 0ºC. Chl a concentrations were very

low, with maximum values of only 0.3 µg L-1, comparable to the lower limit of the values

measured in the Arctic Ocean (Wheeler et al. 1996).

Two species of calanoid copepods, Limnocalanus macrurus and Drepanopus bungei, were the

only metazoans present in the samples collected from Lake A. They have a well documented

distribution over the Siberian arctic shelf, particularly in the brackish surface waters influenced

by riverine input (Holmquist 1970; Zenkevitch 1963). These species have also been found in

some marine localities in the Canadian Arctic Archipelago (Bowmann and Long 1968; Evans and

Grainger 1980; Holmquist 1970). Table 5.1 shows the abundance of each stage for both species,

whereas the density for every 5 m layer is shown in Fig. 5.4. The two net tows made for each

depth were not significantly different (paired t-test, t = 0.58, p = 0.57). Only the adult stages of L.

macrurus were present in our collections, whereas D. bungei was represented by adults,

copepodites and nauplii. Of the copepodid stages, CIII was the most abundant.

89

Previous studies have shown that L. macrurus and D. bungei both have a one year life-cycle, and

that the adults overwinter (Evans and Grainger 1980; Roff 1971). The absence of the earlier

stages of L. macrurus in the present study suggests that the population was composed only of the

overwintering adults. The developmental stages of D. bungei that were found in Lake A, along

with the record of spermatophores attached to some females, indicate that the population of this

species was in its reproductive phase. The large number of nauplii of this species is probably

derived from reproduction by the overwintering adults.

The enumeration data show that a high proportion of the Lake A zooplankton population resided

in the 5 to 10 m stratum, close to the oxic-anoxic interface, with a second density maximum in

the 15 to 20 m stratum, well into the anoxic but not sulfidic zone. This lower peak may indicate a

deep accumulation layer of food particles and an area of refuge from predation. The presence of

fish in this lake (Arctic Char) has been confirmed by Parks Canada (V. Sahahatien, pers. com.),

and there are similar observations of fish from other saline lakes in the High Arctic (Lake C3,

R.S. Bradley, pers. com.; Lake Garrow; Dickman 1995; Warren 1985). It is possible that the

observed distribution of copepods was influenced by the sampling hole being open for three days

before the sampling occurred given the extremely low irradiances that these biota normally

experience beneath the snow and ice (< 1% of surface incident irradiance, unpublished results).

Table 5.1 Number of individuals of each species and life-cycle stage of zooplankton found in net tows in Lake A,and sizes for these stages. For the number of individuals per tow, each value is the mean of two net hauls(range in parentheses )

Depth of Limnocalanus macrurus Drepanopus bungei Both spp.tow (m) Total

Female Male Female Male Copepodites NaupliiAdults Adults Adults Adults

C I-II C III C IV-V

2.5 0.5 (0.5) 0 (0) 0 (0) 0 (0) 0.5 (0.5) 0 (0) 0 (0) 0.5 (0.5) 1.5 (0.5)5 1.5 (0.5) 1 (0) 0.5 (0.5) 0 (0) 0 (0) 0 (0) 0 (0) 5 (0) 8 (1)7.5 2.5 (0.5) 0.5 (0.5) 0 (0) 0 (0) 0 (0) 4 (2) 0 (0) 43.5 (5.5) 50.5 (8.5)10 2.5 (0.5) 3 (2) 1 (1) 0 (0) 2 (1) 14 (5) 1.5 (1.5) 82 (10) 106 (21)12.5 2.5 (0.5) 3 (3) 1.5 (1.5) 0.5 (0.5) 0.5 (0.5) 11.5 (3.5) 0 (0) 64.5 (1.5) 84 (1)15 12 (1) 3.5 (3.5) 6 (4) 0 (0) 1.5 (0.5) 6.5 (2.5) 0.5 (0.5) 65.5 (12.5) 95.5 (18.5)17.5 9 (4) 4 (3) 8.5 (0.5) 2 (1) 2 (0) 12 (2) 2 (1) 87 (6) 126.5 (17.5)20 7.5 (3.5) 3 (0) 7.5 (1.5) 1.5 (0.5) 0.5 (0.5) 19 (1) 0 (0) 93.5 (9.5) 132.5 (13.5)25 18 (1) 3.5 (1.5) 8 (2) 2 (2) 0.5 (0.5) 22.5 (7.5) 0.5 (0.5) 95 (10) 150 (25)30 11.5 (3.5) 3.5 (0.5) 8 (3) 1.5 (0.5) 0 (0) 20 (4) 0.5 (0.5) 96.5 (14.5) 141.5 (13.5)Size (mm)Mean 2.24 2.11 0.99 0.70 0.69 0.19SD 0.14 0.20 0.08 0.08 0.05 0.02n 76 24 40 6 87 79

90

The gut contents of six male and four female L. macrurus were examined from the Lake A

samples. Fragments of crustacean legs were found in several of the guts, and one entire nauplius

of D. bungei was present in the gut of an adult male. This is evidence of predatory behaviour by

L. macrurus, consistent with previous studies (Warren 1985) and suggests that L. macrurus could

be a major controlling factor on the Drepanopus population. The gut contents of five female adult

D. bungei were also examined but no recognisable matter was found.

The plankton sample collected from Disraeli Fjord was dominated by copepodites and adults of

D. bungei (78 %) (Table 5.2). Adult male and female L. macrurus were also present, but in very

low numbers (1%). Other organisms present in the plankton tow included the early copepodite

stages of two species of cyclopoid copepods, Oithona similis (3%), Oncaea borealis (4%), and

copepod nauplii (14%).

Table 5.2 : Number of each species and life-cycle stage of

zooplankton in Disraeli Fjord from a 20 m tow (0.63 m3

filtered assuming a 100 % efficiency )

Species Stage Number Limnocalanus macrurus Female Adult 2 Drepanopus bungei Female Adult 14 Male Adult 2 Copepodite 61 Nauplius 394 Oithona similis All 20 Oncaea borealis All 25 Unidentified Nauplii 87

The zooplankton species of Lake A are not found in the coastal waters of northern Ellesmere

Island, nor elsewhere in the central Arctic Ocean (Grainger 1964). The marine copepod

assemblages in nearby Nansen Sound (between Ellesmere and Axel Heiberg Islands) are

dominated by Calanus spp. (Cairns 1967), which in general dominates zooplankton assemblages

of the Arctic Ocean (Grainger 1964; Thibault et al. 1999). Although large bodied zooplankton

91

such as Calanus can be under-represented in net hauls of the type obtained here, their complete

absence from all tows suggests that they did not occur neither in Lake A nor the surface waters of

Disraeli Fjord. O. borealis and O. similis, found in Disraeli Fjord, are common constituents of the

Arctic Ocean zooplankton, reflecting the direct contact of Disraeli Fjord with the open sea.

However, the presence of L. macrurus and D. bungei in Disraeli Fjord sets it apart from the

Arctic Ocean, and provides an intermediate situation between the Lake A and marine

assemblages.

The environmental conditions of Lake A and Disraeli Fjord are highly dependent on the presence

of ice, which limits the amount of light, wind-induced mixing and, in the case of Disraeli Fjord,

acts as a dam that maintains the presence of a low salinity surface layer. Climate change can

greatly influence ice conditions, and current monitoring data shows that the Arctic is undergoing

considerable warming and ice melt at present (Hartmann et al. 2000; Vincent et al. 2001). Our

most recent data from Disraeli Fjord and Lake A (see chapter 3) show that both of these

ecosystems experienced major, climate-related perturbations subsequent to this 1999 study.

Ongoing measurements are required to assess the impacts of these changes on the zooplankton

communities relative to the baseline conditions described here.

92

Figure 5.1 : Location of Lake A and Disraeli Fjord on northern Ellesmere Island, Canadian High

Arctic.

93

Figure 5.2 : Water column properties of Lake A (8 June 1999).

94

Figure 5.3 : Water column properties of Disraeli Fjord (9 June 1999).

95

Figure 5.4 : Stratum density of copepods in Lake A, northern Ellesmere Island, calculated from

differences between concentrations in tows from adjacent depths.

96

Chapitre 6 – Conclusion générale Le territoire Arctique Canadien demeure encore aujourd’hui une région peu explorée et qui

regorge encore de beaucoup de trésors limnologiques et microbiologiques à découvrir à l'avenir.

Les observations présentées ici montrent que la région de la partie nord de l'Île d’Ellemere

renferme une diversité remarquable d’environnements aquatiques qui sont riches en

communautés planctoniques allant des virus jusqu’au zooplancton. Cependant, nos résultats

montrent aussi que ces écosystèmes ont une longue histoire de changement environnemental et

qu'ils sont très sensibles aux variations climatiques amenées par l’effet de serre en ce moment sur

notre planète.

Dans la première partie de cette étude (chapitre 2), nous avons vu l’évolution à l’échelle holocène

des environnements, inférée à partir de la diversité impressionnante des milieux aquatiques

contemporains. Nos résultats montrent que ces écosystèmes forment une chronoséquence

limnologique. Les grandes transformations dans le régime de brassage lors de l’isolement d’un

bassin marin laisse des traces non seulement pour les paléolimnologistes qui cherchent les indices

dans les sédiments mais aussi, si la stratification est forte, dans la composition ionique des eaux.

Ceci permet de recréer l’histoire des différentes couches d’eau, d’une façon similaire à

l’utilisation de traceurs chimiques pour déterminer l’origine de masses d’eau océaniques. Cette

« archive vivante » de l’évolution du paysage et des lacs durant l’Holocène sera très importante

pour les études futures des processus physiques, chimiques et biologiques dans les

environnements polaires.

Dans la seconde partie de l’étude (chapitre 3), nous nous sommes attardés sur les effets des

changements climatiques actuels sur les cryo-écosystèmes, c’est-à-dire les environnements

« vivants » qui sont fortement influencés par la glace. Nous avons identifié une grande

perturbation des lacs A et B causée par la disparition en 2000 de leur couvert de glace. Le

profilage du lac C2 indique une grande perturbation des eaux de surface entre 1992 et 2001

causée par au moins deux années d’eau libre en 1998 et 2000. Ces perturbations, si les mêmes

conditions de brassage se présentent sur plusieurs années consécutives, peuvent amener une

transformation fondamentale du lac et le pousser dans son évolution vers une disparition de sa

stratification unique ou vers les conditions limnologiques qui sont observées aujourd'hui au lac

97

Romulus. Notre compilation de données RADARSAT montre comment la glace dans les

environnements nordiques est très sensible à de petites variations du climat, spécifiquement le

couvert de glace des fjords et des lacs, ainsi que des plate-formes de glace épaisse flottant sur la

mer le long de la côte nord d’Ellesmere. Les observations présentées ici montrent que la région

nord de l’Île d’Ellesmere est déjà le site de perturbations majeures et que les écosystèmes

dépendant de la glace sont des sites d’importance en tant que sentinelles des changements

climatiques.

La troisième partie de cette étude (chapitre 4) définit la communauté picocyanobactérienne qui

habite les milieux aquatiques arctiques. Ces milieux extrêmes et isolés étaient au départ des

candidats intéressants pour détecter des cyanobactéries endémiques aux milieux lacustres

arctiques, puisque les milieux océaniques dont ils sont issus sont pauveres en cyanobactéries, en

contraste par rapport aux concentrations importantes de cyanobactéries détectés dans tous les

environnements qui nous intéressent ici. Les résultats des études génétiques montrent que les

cyanobactéries présentes dans ces lacs du haut arctique sont très proches parentes avec les

picocyanobactéries qui sont retrouvées dans des lacs partout autour du globe, ce qui témoigne de

la grande adaptabilité de ces organismes. Ces résultats sont en accord avec les études sur

l'influence de la température sur les cyanobactéries polaires. Presque toutes les souches de

cyanobactéries isolées jusqu'à présent de l'Antarctique et de l'Arctique sont des espèces

psychrotolérantes (optimum de croissance ≥ 15 oC), et non pas psychrophiles (Tang et al. 1997).

Ces organismes semblent être des généralistes aux tolérances très larges aux extrêmes des

environnements polaires, plutôt que des spécialistes adaptés à une croissance rapide dans les

environnements marins et lacustres polaires.

La dernière partie de mon étude (chapitre 5) présente la description la plus nordique de

zooplancton des lacs et fjords. Cette étude a un dénouement qui a changé depuis la rédaction et la

publication de cet article : le fjord Disraeli, qui avait une couche d’eau douce en surface d’une

épaisseur de 33 m, et qui renfermait une communauté zooplanctonique unique d’espèces d’eau

saumâtre et d’espèces d’eau salée, a été le site d’un événement majeur. Il s’est formé une grande

faille dans la plate-forme de Glace de Ward Hunt, qui retenait les eaux de surface du fjord. Cette

faille a laissé échapper des milliards de mètres cubes d’eau douce dans l’océan, faisant disparaître

98

ce lac épi-plate-forme unique, le seul en fait qui avait été décrit dans l’hémisphère nord (Mueller

et al. 2003). Les données présentées au chapitre 5 présentent donc une description unique des

conditions prévalant avant cette grande perturbation.

L’objectif principal de cette thèse était d’évaluer la diversité limnologique et biologique des lacs

côtiers du Nord de l’Île d’Ellesmere et de comprendre leur réponse aux changements

environnementaux et climatiques à l’échelle de l’Holocène et à l’échelle des changements

climatiques présents. Nous avons placé une emphase particulière sur les variables d’état de ces

environnements, tel que les conditions chimiques ou les abondances des organismes. Beaucoup

de travail reste à faire à l’avenir pour mesurer les variables de taux comme les dynamiques de

productions primaires et secondaires, et de comprendre les processus limnologiques qui

contrôlent ces dynamiques biologiques dans les lacs et fjords de cette région. Nos études

moléculaires des cyanobactéries illustrent la puissance de cette approche pour adresser des

questions fondamentales sur la biodiversité et les adaptations génétiques, et ces travaux doivent

maintenant être étendus aux autres groupes de microorganismes présents dans les eaux, comme

les virus, les bactéries hétérotrophes et les protistes.

À cause de contraintes logistiques inhérentes à la localisation extrêmement éloignée de cette

partie du Canada, nos travaux au nord de l’Île d’Ellesmere ont été restreints à la période

printemps-été. Même si c’est la période du maximum d’apport en énergie solaire, et par

conséquent probablement la période du maximum d’activité biologique dans ces écosystèmes,

une extension des observations sur un cycle annuel complet serait très utile dans l’avenir afin de

comprendre les variations intersaisonnières. La perte du couvert de glace dans les lacs a le

potentiel de transformer radicalement l’amplitude et la période des variations saisonnières dans

les processus biologiques.

Il est d’une importance capitale que des travaux se poursuivent dans ces sites uniques au nord de

l’île d’Ellesmere. La grande sensibilité des cryo-écosystèmes aux changements climatiques,

principalement dans leur transformation au point de congélation, en fait des sentinelles

inestimables des changements climatiques, et un monitoring à long terme doit être fait. Ce site

d’étude est dans la région de la planète où les modèles de circulation générale prévoient les plus

grandes augmentations de température durant le siècle présent (ACIA 2004). Nos analyses de

99

données RADARSAT démontrent que la télédétection satellitaire peut apporter une contribution

très importante dans le suivi de ces écosystèmes nordiques. Par contre, nos données de CTD et les

données biologiques et chimiques qui leur sont associées dans la colonne d’eau montrent que les

mesures de surface ne donnent qu’un indice des transformations majeures qui se passent plus

profondément dans ces environnements très structurés verticalement. Le monitoring des ces

environnements sentinelles à l’avenir sera grandement facilité par les technologies satellitaires

existantes et futures, mais doit être accompagné d’observations in-situ.

100

Références bibliographiques

ACIA. 2004. Effects of Climate change on Arctic freshwater ecosystems. Arctic Impact Assessment final report. Geophysical Institute.

ANTONIADES, D., M.S.V. DOUGLAS, et J.P. SMOL. 2005. Quantitative estimates of recent environmental changes in the Canadian High Arctic inferred from lake and pond sediments. Journal of Paleolimnology, 33: 349-360.

ANTONIADES, D., M. S. V. DOUGLAS, et J. P. SMOL. 2003. The physical and chemical limnology of 24 ponds and one lake from Isachsen, Ellef Ringnes Island, Canadian High Arctic. International Review of Hydrobiology 88: 519-538.

ARMITAGE, K. B., et H. B. HOUSE. 1962. A limnological reconnaissance in the area of McMurdo Sound, Antarctica. Limnology and Oceanography 7: 36-41.

BANO, N., et J. T. HOLLIBAUGH. 2002. Phylogenetic composition of bacterioplankton assemblages from the Arctic Ocean. Applied and Environmental Microbiology 68: 505-518.

BARR, W. 1971. Postglacial isostatic movement in northeastern Devon Island: a reappraisal. Arctic 24: 249-268.

BELZILE, C., W. F. VINCENT, J. A. E. GIBSON, et P. VAN HOVE. 2001. Bio-optical characteristics of the snow, ice and water column of a perenially ice-covered lake : sensitivity to global change in the High Arctic. Canadian Journal of Fisheries and Aquatic Sciences 58: 2405-2418.

BORREGO, C.M., J.B. ARELLANO, C.A. ABELLA, T. GILLBRO, et J. GARCIA-GIL. 1999. The molar extinction coefficient of bacteriochlorophyll e and the pigment stoichiometry in Chlorobium phaeobacteroides. Photosynthesis Research, 60: 257–264.

BOUTTE, C., S. GRUBISIC, P. BALTHASART, et A. WILMOTTE. In prep. Parameter testing of the DGGE technique for the study of cyanobacterial molecular ecology.

BOWMANN, T. E., et A. LONG. 1968. Relict populations of Drepanopus bungei and Limnocalanus macrurus grimaldii (Copepoda: Calanoida) from Ellesmere Island, N.W.T. Arctic 21: 172-180.

BRADLEY, R. S. 1990. Holocene paleoclimatology of the Queen Elizabeth Islands, Canadian High Arctic. Quaternary Science Reviews 9: 365-384.

BRADLEY, R. S., M. J. RETELLE, S. D. LUDLAM, D. R. HARDY, B. ZOLITSCHKA, S. F. LAMOUREUX, et M. S. V. DOUGLAS. 1996. The Taconite Inlet lakes project : a systems approach to paleoclimatic reconstruction. Journal of Paleolimnology 16: 97-110.

BROWN, M. V., et J. P. BOWMAN. 2001. A molecular phylogenetic survey of sea-ice microbial communities (SIMCO). FEMS Microbiol. Ecol. 35: 267-275.

BULL, A. T. 2004. Microbial Biodiversity and Bioprospecting. American Society of Microbiology Press.

BURKE, C. M., et H. R. BURTON. 1988. Photosynthetic bacteria in meromictic lakes and stratified fjords of the Vestfold Hills, Antarctica. Hydrobiologia 165: 13-23.

BURTON, H. R. 1981. Chemistry, physics and evolution of Antarctic saline lakes. Hydrobiologia 82: 339-362.

CAIRNS, A. A. 1967. The zooplankton of Tanquary Fjord, Ellesmere Island, with special reference to calanoid copepods. Journal of the Fisheries Research Board of Canada 24: 555-568.

CANFIELD, D. E., JR, R. W. BACHMANN, et M. V. HOYER. 1983. Freeze-out of salts in hard-water lakes. Limnology and Oceanography 28: 970-977.

101

CASTENHOLZ, R. W. 1992. Species usage, concept, and evolution in the cyanobacteria (blue-green algae). Journal of Phycology 28: 737-745.

CHRISTNER, B., B. KVITKO, et J. REEVE. 2003. Molecular identification of Bacteria and Eukarya inhabiting an Antarctic cryoconite hole. Extremophiles 7: 177-183.

COHAN, F. M. 2002. What are Bacterial Species ? Annual Review of Microbiology 56: 457-487. COMISO, J. C. 2003. Warming trends in the Arctic from clear sky satellite observations. Journal of

Climate 16: 3498-3510. CROSBIE, N. D., M. PÖCKL, et T. WEISSE. 2003. Dispersal and phylogenetic diversity of

nonmarine picocyanobacteria, inferred from 16S rRNA gene and cpcBA-intergenic spacer sequence analyses. Applied and Environmental Microbiology 69: 5716-5721.

DAI, A., W. M. WASHINGTON, G. A. MEEHL, T. W. BETTGE, et W. G. STRAND. 2004. The ACPI climate change simulations. Climatic Change 62: 29-43.

DARLING, K. F., C. M. WADE, I. A. STEWART, D. KROON, R. DINGLE, et A. J. L. BROWN. 2000. Molecular evidence for genetic mixing of Arctic and Antarctic subpolar populations of planktonic foraminifers. Nature 405: 43-47.

DAVIDGE, G. D. 1994. Physical limnology and sedimentology of Romulus Lake : a meromictic lake in the canadian High Arctic. Mémoire de Maîtrise, Geography Department. Queen's University.

DICKMAN, M. 1995. An isolated population of fourhorn sculpins (Myxocephalus quadricornis, familiy Cottidae) in a hypersaline high arctic Canadian lake. Hydrobiologia 312: 27-35.

DORAN, P. T., C. P. MCKAY, W. P. ADAMS, M. C. ENGLISH, R. A. WHARTON, et M. A. MEYER. 1996. Climate forcing and thermal feedback of residual lake-ice covers in the high Arctic. Limnology and oceanography 41: 839-848.

DOUGLAS, M. S. V., et J. P. SMOL. 2000. Eutrophication and recovery in the High Arctic : Meretta Lake (Cornwallis Island, Nunavut, Canada) revisited. Hydrobiologia 431: 193-204.

DOUGLAS, M. S. V., J. P. SMOL, et W. BLAKE JR. 1994. Marked post-18th century environmental change in high-arctic ecosystems. Science 266: 416-419.

EGGINTON, P. A., et D. A. HUDGSON. 1990. Preliminary assessment of selected drainage basins in western Fosheim Peninsula, Ellesmere Island, as sites for global change studies. Current Research, Part D, Geological Survey of Canada Paper 90-1D: 71-77.

ENGLAND, J.H. 1997. Unusual rates and patterns of Holocene emergence, Ellesmere Island, Arctic Canada. Journal of the Geological Society, London 154: 781-792.

---. 1999. Coalescent Greenland and Innuitan ice during the Last Glacial Maximum : revising the Quaternary of the Canadian High Arctic. Quaternary Science Reviews 19: 421-456.

ENGLAND, J.H., N. ATKINSON, A.S. DYKE, D.J.A EVANS, et M. ZREDA. 2004. Late Wisconsinan buildup and wastage of the Innuitian Ice Sheet across southern Ellesmere Island, Nunavut. Canadian Journal of Earth Sciences, 41: 39-61.

ERNST, A., S. BECKER, U. I. A. WOLLENZIEN, et C. POSTIUS. 2003. Ecosystem-dependent adaptative radiations of picocyanobacteria inferred from 16S rRNA and ITS-1 sequence analysis. Microbiology-SGM 149: 217-228.

EVANS, M. S., et E. H. GRAINGER. 1980. Zooplankton in a Canadian Arctic estuary, p. 199-210. In V. S. Kennedy [ed.], Estuarine Research. Academic Press.

FERRIS, J. M., et H. R. BURTON. 1988. The annual cycle of heat content and mechanical stability of hypersaline Deep Lake, Vestfold Hills, Antarctica. Hydrobiologia 165: 115-128.

FERRIS, J. M., J. A. E. GIBSON, et H. R. BURTON. 1991. Evidence of density currents with the potential to promote meromixis in ice-covered saline lakes. Palaeogeography, Palaeoclimatology, Palaeoecology 84: 99-107.

102

FINLAY, B. J., et G. F. ESTEBAN. 2004. Ubiquitous Dispersal of Free-Living Microorganisms, p. 216-224. In A. T. Bull [ed.], Microbial Diversity and Bioprospecting. ASM Press.

FRANZMANN, P. D. 1996. Examination of Antarctic prokaryotic diversity through molecular comparisons. Biodiversity and Conservation 5: 1295-1305.

GALLAGHER, J. B., H. R. BURTON, et G. E. CALF. 1989. Meromixis in an antarctic fjord : a precursor to a meromictic lake on an isostatically rising coastline. Hydrobiologia 172: 235-254.

GIBSON, J. A. E. 1999. The meromictic lakes and stratified marine basins of the Vestfold Hills, East Antarctica. Antarctic Science 11: 175-192.

GIBSON, J. A. E., et D. T. ANDERSEN. 2002. Physical structure of epishelf lakes of the southern Bunger Hills, East Antarctica. Antarctic Science 14: 253-261.

GIBSON, J. A. E., W. F. VINCENT, P. VAN HOVE, C. BELZILE, X. WANG, et D. MUIR. 2002. Geochemistry of ice-covered, meromictic Lake A in the Canadian High Arctic. Aquatic Geochemistry 8: 97-119.

GIOVANNONI, S. J., E. F. DELONG, T. M. SCHMIDT, et N. R. PACE. 1990. Tangential flow filtration and preliminary phylogenetic analysis of marine picoplankton. Applied and Environmental Microbiology 56: 2572-2575.

GOLDMAN, C. R., et A. J. HORNE. 1983. Limnology. McGraw-Hill. GRADINGER, R., et J. LENS. 1995. Seasonal occurrence of picocyanobacteria in the Greenland Sea

and central Arctic Ocean. Polar Biology 14: 447-452. GRAINGER, E. H. 1964. Zooplankton from the Arctic Ocean and adjacent Canadian waters.

Journal of the Fisheries Research Board of Canada 22: 543-564. GREEN, W.J., T.G. FERDELMAN, et D.E. CANFIELD. 1989. Metal dynamics in Lake Vanda (Wright

Valley, Antarctica). Chemical Geology 76 : 85-94. HALL, T. A. 1999. BioEdit : a user-friendly biological sequence alignment editor and analysis

program for Windows 95/98/NT. Nucl. Acids Symp. Ser. 41: 95-98. HAMILTON, P. B., K. GAJEWSKI, D. E. ATKINSON, et D. R. S. LEAN. 2001. Physical and chemical

limnology of 204 lakes from the Canadian Arctic Archipelago. Hydrobiologia 457: 133-148.

HANSEN, J. E. 2004. Diffusing the global warming time bomb ? Scientific American March: 68-77.

HARDIE, D.C. 2004. Population genetics, life history, and ecology of Arctic marine fishes. Arctic 57: 444-448.

HARTMANN, D. L., J. M. WALLACE, V. LIMPASUVAN, D. W. J. THOMPSON, et J. R. HOLTON. 2000. Can ozone depletion and global warming interact to produce rapid climate change? Proceedings of the National Academy of Sciences 97: 1412-1417.

HATTERSLEY-SMITH, G., J. E. KEYS, H. SERSON, et J. E. MIELKE. 1970. Density stratified lakes in Northern Ellesmere Island. Nature 225: 55-56.

HATTERSLEY-SMITH, G., et H. SERSON. 1964. Stratified water of a glacial lake in northern Ellesmere Island. Arctic 17: 108-111.

HEDLUND, B. P., et J. T. STALEY. 2004. Microbial Endemism and Biogeography, p. 225-231. In A. T. Bull [ed.], Microbial Diversity and Bioprospecting. ASM Press.

HODGSON, D. A., P. T. DORAN, D. ROBERTS, et A. MCMINN. 2004. Paleolimnological studies from the Antarctic and subantarctic islands, p. 419-474. In R. Pienitz, M. S. V. Douglas and J. P. Smol [eds.], Long-Term Environmental Change in Arctic and Antarctic Lakes. Springer.

103

HOLMQUIST, C. 1970. The genus Limnocalanus (Crustacea, Copepoda). Zeitschrift Zool Syst Evolutionforschung 8: 273-296.

IPCC. 2001. Climate Change 2001 : The Scientific Basis. Contribution of Working Group I to the Third Assessment Report of the International Panel on Climate Change. Cambridge University Press.

JACKSON, T. A., D. C. G. MUIR, et W. F. VINCENT. 2004. Historical variations in the stable isotope composition of mercury in Arctic lake sediments. Environmental Science and Technology 38: 2813-2821.

JEFFREY, S. W., et N. A. WELSCHMEYER. 1997. Spectrophotometric and fluorimetric equations in common use in oceanography, p. 597-615. In S. W. Jeffrey, R. F. C. Mantoura and S. W. Wright [eds.], Phytoplankton pigments in oceanography : guidelines to modern methods. UNESCO.

JEFFRIES, M. O. 1992. Arctic ice shelves and ice islands : origin, growth and disintegration, physical characteristics, structural-stratigraphic variability, and dynamics. Reviews of Geophysics 30: 245-267.

JEFFRIES, M. O., et H. R. KROUSE. 1985. Isotopic and chemical investigation of two stratified lakes in the Canadian Arctic. Zeitschrift für Gletscherkunde und Glazialgeologie 21: 71-78.

JEFFRIES, M. O., H. R. KROUSE, M. A. SHAKUR, et S. A. HARRIS. 1984. Isotope geochemistry of stratified Lake "A", Ellesmere Island, NWT., Canada. Canadian Journal of Earth Sciences 21: 1008-1017.

JUKES, T. H., et C. R. CANTOR. 1969. Evolution of Protein Molecules, p. 21-132. In H. N. Munro [ed.], Mammalian Protein Metabolism. Academic Press.

KALFF, J., et H. E. WELCH. 1974. Phytoplankton production in Char Lake, a natural polar lake, and in Meretta Lake, a polluted polar lake, Cornwallis Island, Northwest Territories. Journal of the Fisheries Research Board of Canada 31: 621-636.

KARL, T. R., et K. E. TRENBERTH. 2003. Modern global climate change. Science 203: 1719. KOMAREK, J., et K. ANAGNOSTIDIS. 1999. Cyanoprokaryota, 1. Teil Chroococcales. Gustav

Fischer. LAXON, S., N. PEACOCK, et D. SMITH. 2003. High interannual variability of sea ice thickness in

the Arctic region. Nature 425: 947-950. LAYBOURN-PARRY, J., et H. J. MARCHANT. 1992. The microbial plankton of the freshwater lakes

in the Vestfold Hills, Princess Elizabeth Land, Antarctica. Polar Biology 12: 405-410. LAYBOURN-PARRY, J., et W. A. MARSHALL. 2003. Photosynthesis, mixotrophy and microbial

plankton dynamics in two high Arctic lakes during summer. Polar Biology 26: 517-524. LAYBOURN-PARRY, J., W. C. QUAYLE, T. HENSHAW, A. RUDDELL, et H. J. MARCHANTS. 2001.

Life on the edge : the plankton and chemistry of Beaver lake, an ultra-oligotrophic epishelf lake, Antarctica. Freshwater Biology 46: 1205-1217.

LEE, P. A., J. C. PRISCU, G. R. DITRULLIO, S. F. RISEMAN, N. TURSICH, et S. J. DE MORA. 2004. Elevated levels of dimethylated-sulfur compounds in Lake Bonney, a poorly ventilated Antarctic lake. Limnology and Oceanography 49: 1044-1055.

LEMMEN, D. S. 1989. The last glaciation of Marvin Peninsula, northern Ellesmere Island, High Arctic, Canada. Canadian Journal of Earth Sciences 26: 2578-2590.

LIM, D. S. S., M. S. V. DOUGLAS, J. P. SMOL, et D. R. S. LEAN. 201. Physical and chemical limnological characteristics of 38 lakes and ponds on Bathurst Island, Nunavut, Canadian High Arctic. International Review of Hydrobiology 86: 1-22.

104

LIZOTTE, M. P., T. R. SHARP, et J. C. PRISCU. 1996. Phytoplankton dynamics in the stratified water column of Lake Bonney, Antarctica. Polar Biology 16: 155-162.

LOVEJOY, C., E. C. CARMACK, L. LEGENDRE, et N. M. PRICE. 2002. Water column interleaving : a new physical mechanism determinig protist communities and bacterial states. Limnology and Oceanography 47: 1819-1831.

LOVEJOY, C., W. F. VINCENT, J.-J. FRENETTE, et J. J. DODSON. 1993. Microbial gradients in a turbid estuary : application of a new method for protozoan community analysis. Limnology and Oceanography 38: 1295-1303.

LUDLAM, S. D. 1996a. The comparative limnology of high arctic, coastal, meromictic lakes. Journal of Paleolimnology 16: 111-131.

---. 1996b. Stratification patterns in Taconite Inlet, Ellesmere Island, N.W.T. Journal of Paleolimnology 16: 205-215.

LYONS, J. B., et J. E. MIELKE. 1973. Holocene history of a portion of northernmost Ellesmere Island. Arctic 16: 314-323.

LYONS, W.B., L.R. BARTEK, P.A. MAYEWSKI, et P.T. DORAN. 1997. Climate history of the McMurdo Dry Valleys since the last glacial maximum: A synthesis. In Ecosystem processes in Antarctic ice-free landscapes. Edited by W.B. Lyons, C. Howard-Williams, and I. Hawes. Balkema, Rotterdam, pp.15-22.

MCLAREN, I.A.1967 Physical and chemical characteristics of Ogac Lake, a landlocked fiord on Baffin Island. Journal of the Fisheries Research Board of Canada, 24: 981-1015.

MARGALEF, R. 1968. Perspectives in Ecological Theory. University of Chicago Press. MARKAGER, S., W. F. VINCENT, et E. P. Y. TANG. 1999. Carbon fixation by phytoplankton in high

Arctic lakes : Implications of low temperature for photosynthesis. Limnology and Oceanography 44: 597-607.

MAUCHLINE, J. 1998. The Biology of Calanoid Copepods. Academic Press. MELNIKOV, I. A., E. G. KOLOSOVA, H. E. WELCH, et L. S. ZHITINA. 2002. Sea ice biological

communities and nutrient dynamics in the Canada Basin of the Arctic Ocean. Deep-Sea Research I 49: 1623-1649.

MICHELUTTI, N., M. S. V. DOUGLAS, D. R. S. LEAN, et J. P. SMOL. 2002a. Physical and chemical limnology of 34 ultra-oligotrophic lakes and ponds near Wynniatt Bay, Victoria Island, Arctic Canada. Hydrobiologia 482: 1-13.

MICHELUTTI, N., M. S. V. DOUGLAS, D. C. G. MUIR, X. WANG, et J. P. SMOL. 2002b. Limnological characteristics of 38 lakes and ponds on Axel Heiberg Island, High Arctic Canada. International Review of Hydrobiology 87: 385-399.

MICHELUTTI, N., M. S. V. DOUGLAS, et J. P. SMOL. 2003. Diatom response to recent climatic change in a high arctic lake (Char Lake, Cornwallis Island, Nunavut). Global and Planetary Change 38: 257-271.

MONTRESOR, M., C. LOVEJOY, L. ORSINI, G. PROCACCINI, et S. ROY. 2003. Bipolar distribution of the cyst-forming dinoflagellate Polarella glacialis. Polar Biology 16: 186-194.

MUELLER, D. R., W. F. VINCENT, et M. O. JEFFRIES. 2003. Break-up of the largest Arctic ice shelf and associated loss of an epishelf lake. Geophysical Research Letters. 30: 2031

MUYZER, G. 1999. DGGE/TGGE : a method for identifying genes from natural ecosystems. Current Opinion in Microbiology 2: 317-422.

NADEAU, T. L., E. C. MILBRANDT, et R. W. CASTENHOLZ. 2001. Evolutionary relationships of cultivated antarctic oscillatorians (cyanobacteria). Journal of Phycology 37: 650-654.

NÜBEL, U., F. GARCIA-PICHEL, et G. MUYZER. 1997. PCR primers to amplify 16S rRNA genes from cyanobacteria. Applied and Environmental Microbiology 63: 3327-3332.

105

NUSCH, E. A. 1980. Comparison of different methods for chlorophyll and phaeopigment determination. Archiv Hydrobiologie Beihefte Ergebnisse Limnologie 14: 14-36.

OUELLET, M., M. BISSON, P. PAGÉ, et M. DICKMAN. 1987. Physicochemical limnology of meromictic saline Lake Sophia, Canadian Arctic Archipelago. Arctic and Alpine Research 19: 305-312.

OUELLET, M., M. DICKMAN, M. BISSON, et P. PAGÉ. 1989. Physico-chemical characteristics and origin of hypersaline Lake Garrow in the Canadian High Arctic. Hydrobiologia 172: 215-234.

OVERLAND, J. E., M. C. SPILLANE, et N. N. SOREIDE. 2004. Integrated analysis of physical and biological pan-arctic change. Climatic Change 63: 291-322.

PACE, N. R. 1997. A molecular view of microbial diversity and the biosphere. Science 276: 734-740.

PALENIK, B., B. BRAHAMSHA, F. W. LARIMER, M. LAND, L. HAUSER, P. CHAIN, J. LAMERDIN, W. REGALA, E. E. ALLEN, J. MCCARREN, I. PAULSEN, A. DUFRESNE, F. PARTENSKY, E. A. WEBB, et J. WATERBURY. 2003. The genome of a motile marine Synechococcus. Nature 424: 1037-1042.

PEARY, R. E. 1907. Nearest the Pole. Hutchinson & Co. PELTIER, W. R. 2002. On eustatic sea level history : Last Glacial Maximum to Holocene.

Quaternary Science Reviews 21: 377-396. PERREN, B. B., R. S. BRADLEY, et P. FRANCUS. 2003. Rapid lacustrine response to recent High

Arctic warming : a diatom record from Sawtooth Lake, Ellesmere Island, Nunavut. Arctic, Antarctic and Alpine Research 35: 271-278.

PERRISS, S. J., et J. LAYBOURN-PARRY. 1997. Microbial communities in the saline lakes of the Vestfold Hills (Eastern Antarctica). Polar Biology 18: 135-144.

PERRISS, S. J., J. LAYBOURN-PARRY, et H. J. MARCHANT. 1995. The widespread occurrence of the autotrophic ciliate Mesodinium rubrum (Ciliophora : Haptorida) in the saline and brackish lakes of the Vestfold Hills, Eastern Antarctica. Polar Biology 15: 423-428.

PIENITZ, R., et W. F. VINCENT. 2000. Effect of climate change relative to ozone depletion on UV exposure in subarctic lakes. Nature 404: 484-487.

PRISCU, J. C. 1998. Ecosystem Dynamics in a Polar Desert : The McMurdo Dry Valleys, Antarctica. American Geophysical Union.

QUAYLE, W. C., L. S. PECK, H. PEAT, J. C. ELLIS-EVANS, et P. R. HARRIGAN. 2003. Extreme responses to climate change in antarctic lakes. Science 295: 645.

RANKIN, L. M., P. D. FRANZMANN, T. A. MCMEEKIN, et H. R. BURTON. 1997. Seasonal distribution of picocyanobacteria in Ace Lake, a marine derived Antarctic lake, p. 178-184. In B. Battaglia, J. Valencia and D. W. H. Walton [eds.], Antarctic communities : Species, Structure and Survival. Cambridge University Press.

RETELLE, M. J. 1986. Stratigraphy and sedimentology of coastal lacustrine basins, Northeastern Ellesmere Island, N.W.T. Géographie Physique et Quaternaire XL: 117-128.

RETELLE, M., et J.K. CHILD. 1996. Suspended sediment transport and deposition in a High Arctic meromictic lake, northern Ellesmere Island, Canada. Journal of Paleolimnology, 16: 151-167.

RIGLER, F. H. 1978. Limnology in the High Arctic: a case study of Char Lake. Internationale Vereinigung für Theoretische und Angewandte Limnologie : Verhandlungen 20: 127-140.

ROCAP, G., F. W. LARIMER, J. LAMERDIN, S. MALFATTI, P. CHAIN, N. A. AHLGREN, A. ARELLANO, M. COLEMAN, L. HAUSER, W. R. HESS, Z. I. JOHNSON, M. LAND, D. LINDELL, A. F. POST, W. REGALA, M. SHAH, S. L. SHAW, C. STEGLICH, M. B. SULLIVAN, C. S. TING,

106

A. TOLONEN, E. A. WEBB, E. R. ZINSER, et S. W. CHISHOLM. 2003. Genome divergence in two Prochlorococcus ecotypes reflects oceanic niche differentiation. Nature 424: 1042-1047.

ROESLER, C. S. 1998. Theoretical and experimental approaches to improve the accuracy of particulate absorption coefficients derived from the quantitative filter technique. Limnology and Oceanography, 43: 1649-1660.

ROFF, J. C. 1971. Aspects of the reproductive biology of the planktonic copepod Limnocalanus macrurus Sars, 1863. Crustaceana 22: 155-160.

ROTHROCK, D. A., Y. YU, et G. A. MAYKUT. 1999. Thinning of the Arctic sea-ice cover. Geophysical Research Letters 26: 3469-3472.

RUBLEE, P. A. 1992. Community structure and bottom-up regulation of heterotrophic microplankton in arctic LTER lakes. Hydrobiologia 240: 133-141.

RÜHLAND, K., A. PRIESNITZ, et J. P. SMOL. 2003. Paleolimnological evidence from diatoms for recent environmental changes in 50 lakes across Canadian arctic treeline. Arctic, Antarctic and Alpine Research 35: 110-123.

RYSGAARD, S., T. VANG, M. STJERNHOLM, B. RASMUSSEN, A. WINDELIN, et S. KILSHOLM. 2003. Physical conditions, carbon transport, and climate change impacts in a Northeast Greenland Fjord. Arctic, Antarctic and Alpine Research 35: 301-312.

SAULNIER-TALBOT, E., R. PIENITZ, et W. F. VINCENT. 2003. Holocene lake succession and palaeo-optics of a subarctic lake, northern Québec, Canada. Holocene 13: 517-526.

SCALAN, D. J., et N. J. WEST. 2002. Molecular ecology of the marine cyanobacterial genera Prochlococcus and Synechococcus. FEMS Microbiology Ecology 40: 1-12.

SCHINDLER, D. W., H. E. WELCH, J. KALFF, G. J. BRUNSKILL, et N. KRITSCH. 1974. Physical and chemical limnology of Char Lake (75° N lat.). Journal of the Fisheries Research Board of Canada 31: 585-607.

SERREZE, M. C., J. E. WALSH, F. S. CHAPIN, T. OSTERKAMP, M. DYURGEROV, V. ROMANOVSKY, W. C. OECHEL, J. MORISON, T. ZHANG, et R. G. BARRY. 2000. Observational evidence of recent change in the northern high-latitude environment. Climatic Change 46: 159-207.

SHIRTCLIFFE, T. G. L., et R. F. BENSEMAN. 1964. A sun-heated Antarctic lake. Journal of Geophysical Research 69: 3355-3359.

SMITH, I. R. 2002. Diatom-based Holocene paleoenvironmental records from continental sites on northeastern Ellesmere Island, high Arctic, Canada. Journal of Paleolimnology 27: 9-28.

SMITH, S.V., R.S. BRADLEY, et M.B. ABBOTT. 2004. A 300 year record of environmental change from Lake Tuborg, Ellesmere Island, Nunavut, Canada. Journal of Paleolimnology, 32 : 137-148.

SPAULDING, S.A., D.M. MCKNIGHT, R.L. SMITH et R. DUFFORD. 1994. Phytoplankton population dynamics in perenially ice covered Lake Fryxell. Journal of Plankton Research. 16: 527-541

SPIGEL, R.H., et PRISCU, J.C. 1998. Physical limnology of McMurdo Dry Valley lakes. In : Ecosystem Dynamics in a Polar Desert: The McMurdo Dry Valleys. Edited by J.C. Priscu. Antarctic Research Series, 72: 153-187.

STALEY, J. T., et J. J. GOSINK. 1999. Poles apart : biodiversity and biogeography of sea-ice bacteria. Annual Review of Microbiology 53: 189-215.

STEWART, K. M., et R. F. PLATFORD. 1986. Hypersaline gradients in two Canadian High Arctic lakes. Canadian Journal of Fisheries and Aquatic Sciences 43: 1795-1803.

STRØM, K. 1957. A lake with trapped seawater ? Nature 180: 982-983.

107

STRÖM, T.-E., et D. KLAVENESS. 2003. Hunnebotn: a seawater basin transformed by natural and anthropogenic processes. Estuarine, Coastal and Shelf Science, 56: 1177-1185.

SULLIVAN, M. B., J. B. WATERBURY, et S. W. CHISHOLM. 2003. Cyanophages infecting the oceanic cyanobacterium Prochlorococcus. Nature 424: 1047-1051.

SWADLING, K. M., J. A. E. GIBSON, R. PIENITZ, et W. F. VINCENT. 2001. Biogeography of copepods in subarctic Québec Canada. Hydrobiologia 453/454: 341-350.

TABOR, H. 1963. Large area solar collectors for power production. Solar Energy 7: 189-194. TANG, E. P. Y., R. TREMBLAY, et W. F. VINCENT. 1997. Cyanobacterial dominance of polar

freshwater ecosystems : are high-latitude mat-formers adapted to low temperature? Journal of Phycology 33: 171-181.

TATON, A., S. GRUBISIC, E. BRAMBILLA, R. DE WIT, et A. WILMOTTE. 2003. Cyanobacterial diversity in natural and artificial microbial mats of Lake Fryxell (McMurdo Dry Valleys, Antarctica): a morphological and molecular approach. Applied and Environmental Microbiology 69: 5157-5169.

TER BRAAK, C. J. F., et P. SMILAUER. 2002. CANOCO Reference Manual and CanoDraw for Windows User's Guide: Software for Canonical Community Ordination (version 4.5). Microcomputer Power.

THIBAULT, D., E. J. H. HEAD, et P. A. WHEELER. 1999. Mesozooplankton in the Arctic Ocean in summer. Deep-Sea Research Part I : Oceanographic Research Papers 46: 1391-1415.

TOMINAGA, H., et F. FUKUI. 1981. Saline lakes at Syowa Oasis, Antarctica. Hydrobiologia 82: 375-389.

TRANTER, D. J., et P. E. SMITH. 1968. Filtration performance, p. 27-56. In D. J. Tranter and J. H. Fraser [eds.], Zooplankton Sampling. Monographs on Oceanographic Methodology 2. UNESCO press.

TUSHINGHAM, A. M. 1991. On the extent and thickness of the Innuitian Ice Sheet : a postglacial-adjustment approach. Canadian Journal of Earth Sciences 28: 231-239.

VAN DE PEER, Y., et R. DE WACHTER. 1994. TREECON for Windows: a software package for the construction and drawing of evolutionary trees for the Microsoft Windows environment. Computer Applications in the Biosciences 10: 569-570.

VAN HOVE, P., K. M. SWADLING, J. A. E. GIBSON, C. BELZILE, et W. F. VINCENT. 2001. Farthest north lake and fjord populations of calanoid copepods Limnocalanus macrurus and Drepanopus bungei in the Canadian high Arctic. Polar Biology 24: 303-307.

VÉZINA, S., et W. F. VINCENT. 1997. Arctic cyanobacteria and limnological properties of their environment : Bylot Island, Northwest Territories, Canada (73°N, 80°W). Polar Biology 17: 523-534.

VILLENEUVE, V., W. F. VINCENT, et J. KOMAREK. 2001. Community structure and microhabitat characteristics of cyanobacterial mats in an extreme high Arctic environment : Ward Hunt Lake, p. 199-224. In J. Elster, J. Seckbach, W. F. Vincent and O. Lhotsky [eds.], Algae and Extreme Environments. Nova Hedwigia Beihefte.

VINCENT, W. F. 1987. Antarctic Limnology, p. 379-412. In A. B. Viner [ed.], Inland Waters of New Zealand. DSIR Science Information Publishing Service.

---. 2000a. Cyanobacterial Dominance in the Polar Regions, p. 321-340. In B. A. Whitton and M. Potts [eds.], The Ecology of Cyanobacteria. Kluwer Academic Publishers.

---. 2000b. Evolutionary origins of Antarctic microbiota : invasion, selection and endemism. Antarctic Science 12: 374-385.

108

VINCENT, W. F., et C. BELZILE. 2003. Biological UV exposure in the polar oceans : Arctic-Antarctic comparisons, p. 176-181. In A. H. I. Huiskes et al. [eds.], Antarctic Biology in a Global Context. Backhuys Publishers.

VINCENT, W. F., J. P. BOWMAN, L. M. RANKIN, et T. A. MCMEEKIN. 2000a. Phylogenetic Diversity of Picocyanobacteria in Arctic and Antarctic ecosystems., p. 317-322. In C. R. Bell, Brylinsky and Johnson-Green [eds.], Microbial Biosystems : New Frontiers. Atlantic Canada for Microbial Ecology.

VINCENT, W. F., M. T. DOWNES, et C. L. VINCENT. 1981. Nitrous oxide cycling in Lake Vanda, Antarctica. Nature 292: 618-620.

VINCENT, W. F., J. A. E. GIBSON, et M. O. JEFFRIES. 2001. Ice shelf collapse, climate change and habitat loss in the Canadian high Arctic. Polar Record 37: 133-142.

VINCENT, W. F., J. A. E. GIBSON, R. PIENITZ, V. VILLENEUVE, P. A. BROADY, P. B. HAMILTON, et C. HOWARD-WILLIAMS. 2000b. Ice shelf microbial ecosystems in the high Arctic and implications for life on snowball earth. Naturwissenschaften 87: 137-141.

VINCENT, W. F., et J. E. HOBBIE. 2000. Ecology of Arctic lakes and rivers, p. 197-231. In M. Nuttal and T. V. Callaghan [eds.], The Arctic : Environment, People, Policies. Harwood Academic Publishers.

VINCENT, W. F., I. LAURION, et R. PIENITZ. 1998. Arctic and Antarctic lakes as optical indicators of global changes, p. 691-696. In W. F. Budd [ed.], Antarctica and Global Change. Annals of Glaciology.

VINCENT, W. F., M. RAUTIO, et R. PIENITZ. 2005. Climate control of underwater UV exposure in polar and alpine aquatic ecosystems. In J. B. Orback [ed.], Arctic Environmental Change. Springer (in press).

WARREN, G. J. 1985. Predaceous feeding habits of Limnocalanus macrurus. Journal of Plankton Research 7: 537-552.

WELCH, H. E., et J. KALFF. 1974. Benthic photosynthesis and respiration in Char Lake. Journal of the Fisheries Research Board of Canada 31: 609-620.

WETZEL, R.G. 2001. Limnology: Lake and River Ecosystems. Third Edition. Academic Press. WHEELER, P. A., M. GOSSELIN, E. SHERR, D. THIBAULT, D. L. KIRCHMAN, R. BENNER, et T. E.

WHITLEDGE. 1996. Active cycling of organic carbon in the central Arctic Ocean. Nature 380: 697-699.

WILMOTTE, A., C. DEMONCEAU, A. GOFFART, J.-H. HECQ, V. DEMOULIN, et A. C. CROSSLEY. 2002. Molecular and pigment studies of the picophytoplankton in a region of the Southern Ocean (42-54°S, 141-144°E) in march 1998. Deep-Sea Research II 49: 3351-3363.

WILSON, A. T., et H. W. WELLMAN. 1962. Lake Vanda : an Antarctic lake. Nature 196: 1171-1173.

ZENKEVITCH, L. 1963. Biology of the Seas of the U.S.S.R. Interscience Publishers. ZWART, G., B. C. CRUMP, M. P. K. AGTERVELD, F. HAGEN, et S.-K. HAN. 2002. Typical

freshwater bacteria : an analysis of available 16S rRNA gene sequences from plankton of lakes and rivers. Aquatic Microbial Ecology 28: 141-155.

109

Annexe 1 Données chimiques des lacs et fjords de l’Île d’Ellesmere. Chemical data from lakes and fjords of Ellesmere Island. Key: Sus Int = below the limits of detection; nd = no data; over measurement = above the calibration range. Table 1. DOC, DIC, silica, nitrogen and phosphorus data. Table 2. Mn, oxygen and Fe data. Table 3. Major ion data.

110

Table 1. DOC, DIC, silica, nitrogen and phosphorus data. Depth SiO2 DOC DIC SRP-P-F NO2-N-F NO3+NO2-F NH3-N-F TKN-N-F TP-P-UF TP-P-F m mg/L mg/L mg/L mg/L mg/L mg/L mg/L mg/L mg/L mg/L Lake Romulus 2.5 0.45 3.1 63 0.0109 0.04 0.05 0.249 0.0108 nd 6 0.45 2.5 60 0.0106 0.084 0.046 0.3 0.0062 nd 10 0.45 2.6 55.2 0.0106 0.02 0.053 0.247 0.0104 nd 12 0.45 2.5 65.6 0.0103 0.029 0.064 0.259 0.0094 nd 14 0.47 2.5 56.8 0.0106 0.033 0.055 0.234 0.0113 nd 16 0.51 2.4 56.9 0.0109 0.075 0.044 0.277 0.0113 nd 18 3.49 3.1 109 0.022 1.89 Sus Int 2.51 0.0262 nd 20 3.59 4.4 168 0.0845 < 0.010 9.26 0.934 0.0611 nd 22.5 3.19 5.9 179 0.0783 < 0.010 12.7 13.1 0.0728 nd 25 2.93 6 193 0.0906 < 0.010 14.8 14.8 0.0668 nd 35 3.48 6.6 216 0.0783 < 0.010 17.8 17.2 Sus Int nd 49 3.29 6.6 224 0.066 < 0.010 18.3 17.2 0.0449 nd Lake C1 1 1.35 1.1 21.9 0.004 0.003 0.035 < 0.005 0.167 0.0064 0.0028 3 1.46 1.3 42.4 0.0013 0.004 0.056 < 0.005 0.135 0.0056 0.0028 5 1.54 1.4 41.6 0.0013 0.004 0.053 < 0.005 0.167 0.0053 0.0032 7.5 2.09 1.2 49.7 0.0109 0.005 0.084 < 0.005 0.153 0.0098 0.0035 10 5.67 1.2 111 Sus Int 0.017 0.487 Sus Int 0.164 0.0047 0.0071 12 7.82 1.2 136 Sus Int 0.007 0.444 Sus Int 0.217 0.0056 0.0098 15 10.1 1 144 Sus Int 0.003 0.226 Sus Int 0.19 0.0072 0.0137 20 10.2 1.1 121 Sus Int 0.001 0.024 Sus Int 0.181 0.0098 0.0135 30 6.76 1.8 181 Sus Int 0.002 0.019 Sus Int 4.87 0.0297 0.0718 50 8.34 4.9 364 Sus Int 0.003 0.021 Sus Int 25.8 4.02 4.33 Lake C2 1 0.52 1.1 10.4 0.0056 0.002 < 0.010 Sus Int 0.063 0.018 0.0054 3 0.86 0.6 10 0.0025 0.002 < 0.010 Sus Int 0.077 0.01 0.0048 5 0.86 0.5 10 0.0018 0.002 < 0.010 Sus Int 0.052 0.0098 0.0027 10 0.86 0.5 10.2 0.0015 0.002 0.013 Sus Int 0.04 0.0067 0.002 15 0.87 0.5 10.1 0.0016 0.003 0.011 Sus Int 0.056 0.0065 0.0021 20 0.96 0.5 10.6 0.0022 0.005 0.034 Sus Int 0.041 0.0048 0.0019 30 9.03 1.5 152 Sus Int 0.002 0.015 Sus Int 10 0.0329 0.0259 50 11.8 2.8 248 Sus Int 0.002 0.02 Sus Int 24.2 0.78 0.0293

111

Table 1. DOC, DIC, silica, nitrogen and phosphorus data (cont.) Depth SiO2 DOC DIC SRP-P-F NO2-N-F NO3+NO2-F NH3-N-F TKN-N-F TP-P-UF TP-P-F m mg/L mg/L mg/L mg/L mg/L mg/L mg/L mg/L mg/L mg/L Lake C3 1 0.97 0.7 4.9 Sus Int 0.002 0.02 Sus Int 0.83 0.0112 0.0104 5 1.57 0.6 15.6 0.004 0.004 0.025 Sus Int 0.029 0.0054 0.002 40 2.38 0.6 17.6 0.0021 0.003 0.076 Sus Int 0.077 0.0112 0.0044 50 4.08 0.6 22.3 0.0032 0.005 0.214 Sus Int 0.048 0.0102 0.0065 Taconite Inlet Station1 1 0.66 0.5 6.5 0.0027 0.002 0.022 Sus Int 0.136 0.0071 0.0029 3 0.91 0.4 10.9 0.0008 0.007 0.032 Sus Int 0.054 0.0176 0.0025 5 0.83 0.4 10.6 0.002 0.003 0.024 Sus Int 0.052 0.0202 0.0048 10 0.38 0.4 25.1 Sus Int 0.002 0.028 Sus Int 0.045 0.0383 0.0394 30 0.44 < 0.1 25.5 Sus Int 0.003 0.034 Sus Int 0.07 0.0385 0.0438 50 2.14 < 0.1 27.5 Sus Int 0.004 0.183 Sus Int 0.074 0.0525 0.0651 75 2.54 < 0.1 27.9 Sus Int 0.003 0.19 Sus Int 0.072 0.0438 0.0552 Taconite Inlet Station 2 1 0.57 0.2 4.6 0.001 0.002 0.023 Sus Int 0.046 0.0076 0.0034 3 0.97 0.3 11.8 0.0016 0.002 0.025 Sus Int 0.062 0.0126 0.0042 5 0.85 0.3 11.6 0.0037 0.003 0.03 Sus Int 0.064 0.0112 0.0025 10 0.39 < 0.1 24.4 Sus Int 0.003 0.022 Sus Int 0.089 0.0366 0.0412 30 0.39 < 0.1 24.6 Sus Int 0.003 0.022 Sus Int 0.064 0.0369 0.0409 50 0.49 < 0.1 25 Sus Int 0.003 0.036 Sus Int 0.087 0.0393 0.0485

112

Table 1. DOC, DIC, silica, nitrogen and phosphorus data (cont.) Depth SiO2 DOC DIC SRP-P-F NO2-N-F NO3+NO2-F NH3-N-F TKN-N-F TP-P-UF TP-P-F m mg/L mg/L mg/L mg/L mg/L mg/L mg/L mg/L mg/L mg/L Lake A (2001) 1 0.54 0.3 7 0.0021 0.004 0.023 Sus Int 0.08 0.0067 0.0035 2 0.64 0.7 10.9 0.0009 0.004 0.022 Sus Int 0.096 0.005 0.0034 3 0.76 0.7 13.5 0.0007 0.002 0.016 Sus Int 0.08 0.0049 0.0041 4 0.79 0.7 14.7 0.0007 0.002 0.015 Sus Int 0.111 0.0087 0.003 5 0.81 0.6 14.7 0.0008 0.003 0.015 Sus Int 0.075 0.0043 0.0025 6 0.79 1 14.6 0.0007 0.003 0.015 Sus Int 0.094 0.0081 0.0019 8 0.8 0.7 14.7 0.0011 0.002 0.015 Sus Int 0.082 0.0041 0.0021 10 0.81 0.7 15.2 0.0009 0.003 0.015 Sus Int 0.102 0.0069 0.0039 15 4.99 0.5 41 Sus Int 0.006 0.016 Sus Int 0.061 0.0188 0.0145 20 9.61 0.6 87.9 Sus Int 0.004 0.015 Sus Int 0.121 0.0236 0.0309 25 11.5 0.9 113 Sus Int 0.004 0.015 Sus Int 1.21 0.0256 0.0262 29 14.4 1.5 123 Sus Int 0.006 < 0.010 Sus Int 3.81 0.0292 0.0366 30 14.7 1.5 122 Sus Int 0.003 < 0.010 Sus Int 4.74 0.0721 0.0387 35* 1.38 0.8 15.3 0.0089 0.003 < 0.010 Sus Int 0.193 0.0061 0.0146 40 12.8 1.4 135 0.756 0.003 < 0.010 Sus Int 7.87 0.854 0.728 50 10.8 1.5 148 1.03 0.002 < 0.010 Sus Int 9.91 1.09 1.05 75 12.6 1.6 162 Sus Int 0.007 < 0.010 Sus Int 10.6 1.3 1.3 100 12.6 1.8 136 1.44 0.003 0.036 Sus Int 10.1 1.32 1.21

*Data from this depth seems inaccurate, probably due to the sampling bottle closing too early.

113

Table 2. Mn, oxygen and Fe data Depth Mn Fe D.O. Depth Mn Fe D.O. Depth Mn Fe D.O. m mg/L mg/L mg/L m mg/L mg/L mg/L m mg/L mg/L mg/L Lake Romulus 2.5 14.6 Lake C3 Lake A (2001) 6 < 0.0005 0.005 15.08 1 0.0038 0.044 11.65 1 0.0012 0.006 11.08 10 < 0.0005 0.004 15.38 5 0.0051 0.045 12.59 2 0.0012 0.009 12.32 12 0.0006 0.013 14.85 40 0.0114 0.154 5.69 3 0.0013 0.008 14.16 14 0.0005 0.011 14.21 50 0.439 0.047 0.25 4 0.0013 0.004 14.36 16 0.0037 0.013 11.68 Taconite Inlet Station1 5 0.001 0.004 14.35 18 6.66 3.53 0.28 1 0.0037 0.041 12.15 6 0.0011 0.004 14.37 20 4.05 40.5 0.25 3 0.0202 0.458 13.99 8 0.0012 0.004 14.3 22.5 2.49 59.8 0.14 5 0.0218 0.469 18.33 10 0.0018 0.008 14.22 25 1.89 66.8 0.14 10 0.0038 0.096 12.49 15 1.87 0.006 0.13 35 1.51 70.9 0.14 30 0.0005 0.017 12.96 20 6.99 0.003 0.1 49 1.48 70 0.11 50 0.0042 0.012 11.36 25 8.21 0.002 0.1 Lake C1 75 0.0015 0.01 29 7.73 0.053 0.09 1 0.0017 0.029 11.8 Taconite Inlet Station 2 30 6.82 1.99 0.09 3 0.0005 0.005 16.08 1 0.003 0.036 12.88 35 0.0137 0.007 0.09 5 0.0006 0.009 16.06 3 0.0145 0.277 14.03 40 2.57 0.506 0.09 7.5 0.001 0.017 over measurement 5 0.0134 0.268 16.76 50 0.972 0.183 0.09 10 0.0015 < 0.001 over measurement 10 0.0015 0.04 7.45 75 0.984 0.035 0.09 12 0.0015 < 0.001 over measurement 30 0.0007 0.021 7.26 100 1 0.039 0.09 15 0.0011 < 0.001 12.55 50 0.0014 0.01 4.65 20 0.751 < 0.001 0.22 30 3.43 0.009 0.12 50 0.452 0.016 0.1 Lake C2 1 0.0045 0.173 13.88 3 0.0046 0.184 13.95 5 0.004 0.143 14 10 0.0039 0.142 13.85 15 0.0029 0.102 13.66 20 0.0048 0.117 4.5 30 11.4 0.206 0.12 50 6.11 12.1 0.11

114

Table 3. Major ion data. Depth Cl- Na+ K+ Mg2+ Ca2+ SO4

2- Ba m mg/L mg/L mg/L mg/L mg/L mg/L mg/L Lake Romulus 2.5 5110 2920 102 332 174 645 6 5140 2940 103 332 172 666 0.0752 10 5140 2930 100 332 174 651 0.0757 12 5050 2880 99 328 172 626 0.0754 14 5110 2890 102 331 173 627 0.0776 16 5230 2910 101 334 172 619 0.0753 18 14800 8150 240 1160 408 2380 0.197 20 34300 16200 483 2320 735 4650 0.24 22.5 40200 19800 635 2690 840 5330 0.217 25 47200 22300 715 2850 880 5650 0.194 35 85800 23900 755 2900 890 5380 0.172 49 45700 23000 753 2900 898 5450 0.164 Lake C1 1 292 172 7.07 29.9 50.3 55.6 0.0638 3 393 222 9.17 36.9 61.6 64.4 0.097 5 408 224 9.25 38.5 63.6 66.4 0.0956 7.5 760 423 15.9 61.6 77 103 0.116 10 2350 1380 47.5 202 153 311 0.166 12 3530 2030 65 300 192 517 0.151 15 5470 3200 102 451 243 755 0.123 20 7250 4190 134 595 230 1070 0.114 30 11800 6650 212 900 251 1190 0.112 50 15700 9100 302 1100 200 551 0.191 Lake C2 1 24.6 13.7 0.55 3.4 12.1 5.9 0.0196 3 31.8 17.5 0.68 4.44 15.7 8.7 0.0216 5 31.8 17.8 0.71 4.5 15.9 9.7 0.0229 10 31.9 17.9 0.7 4.5 16.3 9.2 0.0207 15 33.4 18.4 0.71 4.57 16 10.2 0.0203 20 76.8 45.6 1.66 7.94 18.2 13.5 0.0293 30 10000 5650 170 805 271 1350 0.257 50 15800 8750 293 1070 348 1940 0.285

115

Table 3. Major ion data.(Cont.) Depth Cl- Na+ K+ Mg2+ Ca2+ SO4

2- Ba m mg/L mg/L mg/L mg/L mg/L mg/L mg/L Lake C3 1 3.1 2.15 0.16 1.07 4.85 5 0.0063 5 1.18 1.78 0.48 4.83 16.2 25.9 0.0244 40 2.83 2.95 0.51 5.55 29.7 26.4 0.0322 50 6.8 5.43 0.69 6.75 34.8 27.4 0.0512 Taconite Inlet Station1 1 79.6 47.3 2.09 6.4 11.9 13.1 0.0084 3 242 137 5.99 17.2 21.9 35.7 0.0265 5 649 339 15 39.8 29.6 88.3 0.0322 10 16900 9100 343 1090 352 196 0.0114 30 19600 9600 358 1120 355 195 0.011 50 19000 9970 374 1170 381 223 0.0157 75 17600 9980 366 1210 382 183 0.0248 Taconite Inlet Station 2 1 73.7 42.5 1.96 5.76 9.17 15.9 0.007 3 261 153 6.72 18.5 23.6 43.6 0.029 5 73.7 278 12.5 31.3 27.2 69.5 0.032 10 17100 9150 344 1120 358 2220 0.0111 30 17200 9430 356 1110 355 1960 0.0112 50 17300 9300 352 1100 346 1870 0.0117

116

Table 3. Major ion data.(Cont.) Depth Cl- Na+ K+ Mg2+ Ca2+ SO4

2- Ba m mg/L mg/L mg/L mg/L mg/L mg/L mg/L Lake A (2001) 1 45 25.5 1.33 5.42 12.3 9 0.0226 2 81.4 44.8 2.11 7.58 14.3 14.1 0.0377 3 194 111 4.25 15.6 20.7 29.1 0.0512 4 221 124 4.86 17.1 21.2 27.5 0.0561 5 223 130 4.95 18 23.1 32.9 0.0569 6 232 130 5.1 18.3 21.5 33.6 0.0577 8 235 114 5.27 18.3 22.4 33.6 0.0575 10 215 132 5.15 18.5 22.4 33.9 0.0572 15 4720 2600 81 408 158 797 0.101 20 9610 5270 163 770 254 1710 0.113 25 13100 6930 228 970 304 2010 0.149 29 14900 8140 271 1050 324 2130 0.189 30 15300 8310 279 1060 325 2110 0.207 35 213 125 4.75 17.9 20.5 55.6 0.051 40 17000 9400 333 1150 342 1710 0.183 50 17200 9650 353 1150 337 1990 0.114 75 17700 9650 350 1120 333 1990 0.129 100 17400 9650 343 1140 346 2000 0.129

117

Annexe 2 Alignement des séquences d’ADN des picocyanobactéries provenant des lacs et fjords du nord d’Ellesmere, et de quelques sites comparatifs. DNA sequences for picocyanobacteria from northern Ellesmere lakes and fjords, and from some comparative sites.

A 2m 1999 cA2B1 1 CAACGCCGCGTGAGGGATGAAGGCCTCTGGGCTGTAAACCTCTTTTATCAAGGAAGAAG- 59 Lake A 15m C5A5 1 CAACGCCGCGTGAGGGATGAAGGCCTCTGGGCTGTAAACCTCTTTTATCAAGGAAGAAG- 59 Lake A 15m C5C9 2 1 CAACGCCGCGTGAGGGATGAAGGCCTCTGGGCTGTAAACCTCTTTTATCAAGGAAGAAG- 59 Lake A 15m C5A8 1 CAACGCCGCGTGAGGGATGAAGGCCTCTGGGCTGTAAACCTCTTTTATCAAGGAAGAAG- 59 Lake A 15m C5B13 1 CAACGCCGCGTGAGGGATGTAGGCCTCTGGGCTGTAAACCTCTTTTATCAAGGAAGAAG- 59 Lake A 15m C5B20 1 CAACGCCGCGTGAGGGATGAAGGCCTCTGGGCTGTAAACCTCTTTTATCAAGGAAGAAG- 59 Lake A 15m C5B4 25 1 CAACGCCGCGTGAGGGATGAAGGCCTCTGGGCTGTAAACCTCTTTTATCAAGGAAGAAG- 59 Lake A 15m C5C10 1 CAACGCCGCGTGAGGGATGAAGGCCTCTGGGCTGTAAACCTCTTTTATCAAGGAAGAAG- 59 Lake A 15m C5C11 1 CAACGCCGCGTGAGGGATGAAGGCCTCTGGGCTGTAAACCTCTTTTATCAAGGAAGAAG- 59 Lake C3 5m C6B3 3 1 CAATACCGCGTGTGGGAGGAAGGCCCTTGGGTTGTAAACCACTTTTATCAGGGAAGAAG- 59 Lake C3 5m C6B1 1 CAATACCGCGTGTGGGAGGAAGGCCCTTGGGTTGTAAACCwCTTTTATCAGGGAAGAAG- 59 Lake C3 5m C6B5 29 1 CAACGCCGCGTGAGGGATGAAGGCCTCTGGGCTGTAAACCTCTTTTATCAAGGAAGAAG- 59 Lake C3 5m C6C8 2 1 CAACGCCGCGTGAGGGATGAAGGCCTCTGGGCTGTAAACCTCTTTTATCAAGGAAGAAG- 59 Lake C1 15m D01b 1 CAACGCCGCGTGAGGGACGAAGGCCTCTGGGCTGTAAACCTCTTTTCTCAAGGAAGAAG- 59 Lake C1 15m D02b 1 CAACGCCGCGTGAGGGACGAAGGCCTCTGGGCTGTAAACCTCTTTTCTCAAGGAAGAAG- 59 Taconite Inlet 10m D 1 CAACGCCGCGTGAGGGATGAAGGCCTCTGGGCTGTAAACCTCTTTTATCAAGGAAGAAG- 59 Lake C1 15m D04b 1 CAACGCCGCGTGAGGGATGAAGGCCTCTGGGCTGTAAACCTCTTTTCTCAAGGAAGAAG- 59 Lake C2 15m D08b 5 1 CAACGCCGCGTGAGGGATGAAGGCCTCTGGGCTGTAAACCTCTTTTATCAAGGAAGAAG- 59 Lake A 2m D10b 1 CAACGCCGCGTGAGGGATGAAGGCCTCTGGGCTGTAAACCTCTTTTCTCAAGGAAGAAG- 59 Lake C1 12m Da09a 1 CAACCCCGCGT-AGGGATGAAGGCCTCTGGGCTGTAAACCTCTTTTATCAAGGAAGAAG- 58 Lake Meretta 2.5m Da 1 CAATACCGCGTGAGGGAGGAAGGCTCTTGGGTCGTAAACCTCTTTTCTCAGGGAAGAAAA 60 Taconite Inlet 3m Db 1 CAACGCCGCGTGAGGGATGAAGGCCTCTGGgCTGTAAACCTCTTTTATCAAGGAAGAAG- 59 Lake C2 3m Db319b 1 CAACGCCGCGTGAGGGATGAAGGCCTCTGGGCTGTAAACCTCTTTTATCAAGGAAGAAG- 59 Lake C1 12m Db323b 1 CAACGCCGCGTGAGGGATGAAGGCCTCTGGGCTGTAAACCTCTTTTATCAAGGAAGAAG- 59 Lake A 2m Db328b 1 CAACNCCGCGTGAGGGATGAAGGCCTCTGGGCTGTAAACCTCTTTTATCAAGGAAGAAG- 59 Lake C1 5m Db329b 1 CAATACCGCGTGAGGGATGAAGGATyTTGGTCTGTAAACCTCTTTTCTCAAGAAAGAAG- 59 Taconite Inlet 30m S 1 CAACGCCGCGTGAGGGATGAAGGCCTCTGGGCTGTAAACCTCTTTTCTCAAGGAAGAAG- 59 Char 20m S (gex) 1 AAACGCCGCGTGAGGGACGAAGGCCTCTGGGCTGTAAACCTCTTTTCTCAAGGAAGAAG- 59 Lake C1 12m S (gex) 1 GCACGCCGCGTGAGGGACGAAGGCCTCTGGGCTGTAAACCTCTTTTCTCAAGGAAGAAG- 59 Lake C1 12m Sb411a 1 CAACGCCGCGTGAGGGACGAAGGCCTCTGGGCTGTAAACCTCTTTTCTCAAGGAAGAAG- 59 Lake C1 15m Sb424b 1 CAACGCCGCGTGAGGGACGAAGGCCTCTGGGCTGTAAACCTCTTTTCTCAAGGAAGAAG- 59 Lake C1 12m Sb425b 2 1 CAACGCCGCGTGAGGGACGAAGGCCTCTGGGCTGTAAACCTCTTTTCTCAAGGAAGAAG- 59 Lake C3 5m Db430b 1 CAATACCGCGTGAGGGACGAAGGCCTGTGGGTTGTACwCCTCTTTTGTTAGGGAAGA--- 57 Lake Limnopolar Sb42 1 CAATACCGCGTGAGGGACGAAGGTCTGTGGATTGTAAACCTCTTTTGTTGGGGAAGA--- 57 Lake A 2m 1999 cA2B1 60 AACTGACGGTACTTGATGAATAAGCCACGGCTAATTCCGTGCCAGCAGCCGCGGTAATAC 119 Lake A 15m C5A5 60 ATCTGACGGTACTTGATGAATAAGCCACGGCTAATTCCGTGCCAGCGGCCGCGGTAATAC 119 Lake A 15m C5C9 2 60 ATCTGACGGTACTTGATGAATAAGCCACGGCTAATTCCGTGCCAGCAGCCGCGGTAATAC 119 Lake A 15m C5A8 60 ATCTGACGGTACTTGATGAATAAGCCACGGCTAATTCCGTGCCAGCAGCCGCGGTAATAC 119 Lake A 15m C5B13 60 ATCTGACGGTACTTGATGAATAAGCCACGGCTAATTCCGTGCCAGCAGCCGCGGTAATAC 119 Lake A 15m C5B20 60 ATCTGACGGTACTTGATGAATAAGCCACGGCTGATTCCGTGCCAGCAGCCGCAGTAATAC 119 Lake A 15m C5B4 25 60 ATCTGACGGTACTTGATGAATAAGCCACGGCTAATTCCGTGCCAGCAGCCGCGGTAATAC 119 Lake A 15m C5C10 60 ATCTGACGGTACTTGATGAATAAGCCACGGCTAATTCCGTGCCAGCAGCCGCGGTAATAC 119 Lake A 15m C5C11 60 ATCTGACGGTACTTGATGAATAAGCCACGGCTAATTCCGTGCCAGCAGCCGCGGTAATAC 119 Lake C3 5m C6B3 3 60 CTCTGACGGTACCTGATGAATAAGCATCGGCTAACTCCGTGCCAGCAGCCGCGGTAATAC 119 Lake C3 5m C6B1 60 CTCTGACGGTACCTGATGAATAAGCATCGGCTAACTCCGTGCCAGCAGCCGCGGTAATAC 119 Lake C3 5m C6B5 29 60 AACTGACGGTACTTGATGAATAAGCCACGGCTAATTCCGTGCCAGCAGCCGCGGTAATAC 119 Lake C3 5m C6C8 2 60 AACTGACGGTACTTGATGAATAAGCCACGGCTAATTCCGTGCCAGCAGCCGCGGTAATAC 119 Lake C1 15m D01b 60 ACATGACGGTACTTGAGGAATAAGCCACGGCTAATTCCGTGCCAGCAGCCGCGGTAATAC 119 Lake C1 15m D02b 60 ACATGACGGTACTTGAGGAATAAGCCACGGCTAATTCCGTGCCAGCAGCCGCGGTAATAC 119 Taconite Inlet 10m D 60 AACTGACGGTACTTGATGAATAAGCCACGGCTAATTCCGTGCCAGCAGCCGCGGTAATAC 119 Lake C1 15m D04b 60 ACATGACGGTACTTGANGAATAAGCCACGGCTAATTCCGTGCCAGCAGCCGCGGTAATAC 119 Lake C2 15m D08b 5 60 AACTGACGGTACTTGATGAATAAGCCACGGCTAATTCCGTGCCAGCAGCCGCGGTAATAC 119 Lake A 2m D10b 60 AACTGACGGTACTTGAGGAATAAGCCACGGCTAATTCCGTGCCAGCAGCCGCGGTAATAC 119

118

Lake C1 12m Da09a 59 ATCTGACGGTACTTGATGAATAAGCCACGGCTAATTCCGTGCCAGCAGCCGCGGTAATAC 118 Lake Meretta 2.5m Da 61 AAATGACGGTACCTGAGGAATAAGCATCGGCTAACTCCGTGCCAGCAGCCGCGGTAATAC 120 Taconite Inlet 3m Db 60 AACTGACGGTACTTGATGAATAAGCCACGGCTAATTCCGTGCCAGCAGCCGCGGTAATAC 119 Lake C2 3m Db319b 60 AACTGACGGTACTTGATGAATAAGCCACGGCTAATTCCGTGCCAGCAGCCGCGGTAATAC 119 Lake C1 12m Db323b 60 ATmTGACGGTACTTGATGAATAAGCCACGGCTAATTCCGTGCCAGCAGCCGCGGTAATAC 119 Lake A 2m Db328b 60 AACTGACGGTACTTGATGAATAAGCCwCGGCTAATTCCGTGCCAGCAGCCGCGGTAATAC 119 Lake C1 5m Db329b 60 TTCTGACGGTACTTGAGGAATAAGCATCGGCTAACTCCGTGCCAGCAGCCGCGGTAATAC 119 Taconite Inlet 30m S 60 ACATGACGGTACTTGAGGAATAAGCCACGGCTAATTCCGTGCCAGCAGCCGCGGTAATAC 119 Char 20m S (gex) 60 ACATGACGGTACTTGAGGAATAAGCCACGGCTAATTCCGTGCCAGCAGCCGCGGTAATAC 119 Lake C1 12m S (gex) 60 ACATGACGGTACTTGAGGAATAAGCCACGGCTAATTCCGTGCCAGCAGCCGCGGTAATAC 119 Lake C1 12m Sb411a 60 ACATGACGGTACTTGAGGAATAAGCCACGGCTAATTCCGTGCCAGCAGCCGCGGTAATAC 119 Lake C1 15m Sb424b 60 ACATGACGGTACTTGAGGAATAAGCCACGGCTAATTCCGTGCCAGCAGCCGCGGTAATAC 119 Lake C1 12m Sb425b 2 60 ACATGACGGTACTTGAGGAATAAGCCACGGCTAATTCCGTGCCAGCAGCCGCGGTAATAC 119 Lake C3 5m Db430b 58 TAATGACGGTACCTAACGAATAAGCATCGGCTAACTCCGTGCCAGCAGCCGCGGTAAGAC 117 Lake Limnopolar Sb42 58 TAATGACGGTACCCAACGAATAAGCATCGGCTAACTCCGTGCCAGCAGCCGCGGTAAGAC 117 Lake A 2m 1999 cA2B1 120 GGGAGTGGCAAGCGTTATCCGGAATTATTGGGCGTAAAG-CGTCCG-CAGGC-GGTTTTA 176 Lake A 15m C5A5 120 GGGAGTGGCAAGCGTTATCCGGAATTATTGGGCGTAAAG-CGTCCG-CAGGC-GGTCTTG 176 Lake A 15m C5C9 2 120 GGGAGTGGCAAGCGTTATCCGGAATTATTGGGCGTAAAG-CGACCG-CAGGC-GGTCTTG 176 Lake A 15m C5A8 120 GGGAGTGGCAAGCGTTATCCGGAATTATTGGGCGTAAAG-CGTCCG-CAGGC-GGTCCTG 176 Lake A 15m C5B13 120 GGGAGTGGCAAGCGTTATCCGGAATTATTGGGCGTAAAG-CGTCCG-CAGGC-GGTCTTG 176 Lake A 15m C5B20 120 GGGAGTGGCAAGCGTTATCCGGAATTATTGGGCGTAAAG-CGTCCG-CAGGC-GGTCTTG 176 Lake A 15m C5B4 25 120 GGGAGTGGCAAGCGTTATCCGGAATTATTGGGCGTAAAG-CGTCCG-CAGGC-GGTCTTG 176 Lake A 15m C5C10 120 GGGAGTGGCAAGCGTTATCCGGAATTATTGGGCGTAAAG-CGTCCG-CAGGC-GGTCTTG 176 Lake A 15m C5C11 120 GGGAGTGGCAAGCGTTATCCGGAATTATTGGGCGTAAAG-CGTCCG-CAGGC-GGTCTTG 176 Lake C3 5m C6B3 3 120 GGAGGATGCAAGCGTTATCCGGAATCATTGGGCGTAAAG-CGTCCG-TAGG-TGGTTTGT 176 Lake C3 5m C6B1 120 GGAGGATGCAAGCGTTATCCGGAATCATTGGGCGTAAAG-CGTCCG-TAGG-TGGTTTGT 176 Lake C3 5m C6B5 29 120 GGGAGTGGCAAGCGTTATCCGGAATTATTGGGCGTAAAG-CGTCCG-CAGGC-GGTTTTA 176 Lake C3 5m C6C8 2 120 GGGAGTGGCAAGCGTTATCCGGAATTATTGGGCGTAAAA-CGTCCG-CAGGC-GGTTTTA 176 Lake C1 15m D01b 120 GGGAGTGGCAAGCGTTATCCGGAATTATTGGGCGTAAAG-CGTCCG-CAGGC-GGCCCAG 176 Lake C1 15m D02b 120 GGGAGTGGCAAGCGTTATCCGGAATTATTGGGCGTAAAG-CGTCCG-CAGGC-GGCCTTG 176 Taconite Inlet 10m D 120 GGGAGTGGCAAGCGTTATCCGGAATTATTGGGCGTAAAG-CGTCCG-CAGGC-GGTTTTG 176 Lake C1 15m D04b 120 GGGAGTGGCAAGCGTTATCCGGAATTATTGGGCGTAAAG-CGTCCG-CAGGC-GGCCTTG 176 Lake C2 15m D08b 5 120 GGGAGTGGCAAGCGTTATCCGGAATTATTGGGCGTAAAG-CGTCCG-CAGGC-GGTTTTA 176 Lake A 2m D10b 120 GGGAGTGGCAAGCGTTATCCGGAATTATTGGGCGTAAAG-CGTCCG-CAGGC-GGCCTTG 176 Lake C1 12m Da09a 119 GGGAGTGGCAAGCGTTATCCGGAATTATTGGGCGTAAAG-CGTCCG-CAGGC-GGTCTTG 175 Lake Meretta 2.5m Da 121 GGAGGATGCAAGCGTTATCCGGAATGATTGGGCGTAAAG-CGTCCG-CAGG-TGGCTGTG 177 Taconite Inlet 3m Db 120 GGGAGTGGCAAGCGTTATCCGGAATTATTGGGCGTAAAG-CGTCCG-CAGGC-GGTTTTA 176 Lake C2 3m Db319b 120 GGGAGTGGCAAGCGTTATCCGGAATTATTGGGCGTAAAGCGGTCCG-CAGGC-GGTTTTA 177 Lake C1 12m Db323b 120 GGGAGTGGCAAGCGTTATCCGGAATTATTGGGCGTAAAG-CGTCCG-CAGGC-GGTCTTG 176 Lake A 2m Db328b 120 GGGAGwGGCAAGCGTTATCCGGAATTATTGGGCGTAAAG-CGTCCG-CAGGC-GGTTTTA 176 Lake C1 5m Db329b 120 GGGGGATGCAAGCGTTATCCGGAATCATTGGGCGTAAAG-CGCCTG-TAGG-TTGTTTAA 176 Taconite Inlet 30m S 120 GGGAGTGGCAAGCGTTATCCGGAATTATTGGGCGTAAAG-CGTCCG-CAGGC-GGCCTTG 176 Char 20m S (gex) 120 GGGAGTGGCAAGCGTTATCCGGAATTATTGGGCGTAAAG-CGTCCG-CAGGC-GGCTCAG 176 Lake C1 12m S (gex) 120 GGGAGTGGCAAGCGTTATCCGGAATTATTGGGCGTAAAG-CGTCCG-CAGGC-GGCCTTG 176 Lake C1 12m Sb411a 120 GGGAGTGGCAAGCGTTATCCGGAATTATTGGGCGTAAAG-CGTCCG-CAGGGCGGCCTTG 177 Lake C1 15m Sb424b 120 GGGAGTGGCAAGCGTTAtcCGGAATTATTGGGCGTAAAG-CGTCCG-CAGGC-GGCCTTG 176 Lake C1 12m Sb425b 2 120 GGGAGTGGCAAGCGTTAtCCGGAATTATTGGGCGTAAAG-CGTCCG-CAGGc-GGCCTTG 176 Lake C3 5m Db430b 118 GGAGGATGCAAGCGTTATCCGGAATTATTGGGCGTAAAAGCGTACTGTAGGCTGGCTAAT 177 Lake Limnopolar Sb42 118 GGAGGATGCAAGCGTTATCCGGAATTATTGGGCGTAAAG-CGTACG-TAGGCTGTTTCAT 175 Lake A 2m 1999 cA2B1 177 CAAGTCTGTCGTTAAAG-CGTGGAGCTCAACTCCAT-TTCAGCGGTGGAAACTGTAAGAC 234 Lake A 15m C5A5 177 AAAGTCTGTTGTTAAAG-CGTGGAGCTCAACTCCAT-TTCAGCAATGGAAACTAGAAGAC 234 Lake A 15m C5C9 2 177 AAAGTCTGTTGTTAAGG-CGTGGAGCTCAACTCCAT-TTCAGCAATGGAAACTAGAAGAC 234 Lake A 15m C5A8 177 AAAGTCTGTTGTTAAAG-CGTGGAGCTCAACTCCAT-TTCAGCAATGGAAACTAmAAGAC 234 Lake A 15m C5B13 177 AAAGTCTGTTGTTAAAG-CGTGGAGCTCAACTCCAT-TTCAGCAATGGAAACTAGAAGAC 234 Lake A 15m C5B20 177 AAAGTCTGTTGTTAAAG-CGTGGAGCTCAACTCCAT-TTCAGCAATGGAAACTAGAAGAC 234 Lake A 15m C5B4 25 177 AAAGTCTGTTGTTAAAG-CGTGGAGCTCAACTCCAT-TTCAGCAATGGAAACTAGAAGAC 234 Lake A 15m C5C10 177 AAAGTCTGTTGTTAAAG-CGTGGAGCTCAACTCCAT-TTCAGCAATGGGAACTAGAAGAC 234 Lake A 15m C5C11 177 AAAGTCTGTTGTTAAAG-CGTGGAGCTCAACTCCAT-TTCAGCAATGGAAACTAGAAGAC 234 Lake C3 5m C6B3 3 177 CAAGTCTGTCGTCAAAG-AATGGAGCTTAACTCCAT-AAAGGCGGTGGAAACTGAGGGAC 234 Lake C3 5m C6B1 177 CAAGTCTGTCGTCAAAG-AATGGAGCTTAACTCCAT-AAAGGCGGTGGAAACTGAGAGAC 234 Lake C3 5m C6B5 29 177 CAAGTCTGTCGTTAAAG-CGTGGAGCTCAACTCCAT-TTCAGCGATGGAAACTGTAAGAC 234

119

Lake C3 5m C6C8 2 177 CAAGTCTGTCGTTAAAG-CGTGGAGCTCAACTCCAT-TTCAGCGATGGAAACTGTAAGAC 234 Lake C1 15m D01b 177 AAAGTCTGTTGTTAAAA-AGTGGAGCTCAACTCCAT-CCAGGCAATGGAAACTACTGGGC 234 Lake C1 15m D02b 177 AAAGTCTGTTGTTAAAG-AGTGGAGCTCAACTCCAT-TyCaGCAATGGAAACTACAAGGC 234 Taconite Inlet 10m D 177 CAAGTCTGTyGTTAAAG-CGTGGAGCTCAACTCCAT-TTCAGCGATGGAAACTGTAAGAC 234 Lake C1 15m D04b 177 AAAGTCTGTTGTTAAAG-mGTGGAGCTCAACTCCAT-TTCAGCAATGGAAACTACAAGGC 234 Lake C2 15m D08b 5 177 CAAGTCTGTCGTTAAAG-CGTGGAGCTCAACTCCAT-TTCAGCGATGGAAACTGTAAGAC 234 Lake A 2m D10b 177 AAAGTCTGTCGTTAAAG-CGTGGAGCTTAACTCCAT-TTCGGCGGTGGAAACTACAAGGC 234 Lake C1 12m Da09a 176 AAAGTCTGTTGTTAAAG-CTTGGAGCTCAACTCCAT-TTCAGCAATGGAAACTAGAAGAC 233 Lake Meretta 2.5m Da 178 TAAGTCTGCTGTTAAAG-AGTCTAGCTCAACTAGAT-AAAAGCAGTGGAAACTACACGGC 235 Taconite Inlet 3m Db 177 CAAGTCTGTCGTTAAAGCTGTGGAGCTCAACTCCAT-TTCAGCGATGGAAACTGTAAGAC 235 Lake C2 3m Db319b 178 CAAGTCTGTCGTTAAAG-CGTGGAGCTCAACTCCAT-TTCAGCGATGGAAACTGTAAGAC 235 Lake C1 12m Db323b 177 AAAGTCTGTTGTTAAAG-CGTGGAGCTCAACTCCAT-TTCAGCAATGGAAACTACAAGrC 234 Lake A 2m Db328b 177 CAAGTCTGTCGTTAAAG-CGTGGAGCTCAACTCCAT-TTCAGCGATGGAAACTGTAAGAC 234 Lake C1 5m Db329b 177 TAAGTCTGTTGTTAAAG-CCTAGGGCTTAACCCTAG-AAAAGCAATGGAAACTACTAGAC 234 Taconite Inlet 30m S 177 TAAGTCTGTCGTTAAAA-CGTGGAGCTCAACTCCAT-TTCAGCGATGGAAACTACAAGGC 234 Char 20m S (gex) 177 AAAGTCTGTTGTTAAAA-AGTGGAGCTCAACTCCAT-CCAGGCAATGGAAACTACTGGGC 234 Lake C1 12m S (gex) 177 AAAGTCTGTTGTTAAAG-CGTGGAGCTCAACTCCAT-TTCAGCAATGGAAACTACAAGGC 234 Lake C1 12m Sb411a 178 AAAGTCTGTTGTTAAAG-CGTGGAGCTCAACTCCAT-TTCAGCAATGGAAACTACAAGGC 235 Lake C1 15m Sb424b 177 AAAGTCTGTTGTTAAAG-CGTGGAGCTCAACTCCAT-TTCAGCAATGGAAACTACAAGGC 234 Lake C1 12m Sb425b 2 177 AAAGTCTGTTGTTAAAG-CGTGGAGCTCAACTCCAT-TTCAGCAATGGAAACTACAAGGC 234 Lake C3 5m Db430b 178 TAAGTCTGTTGTCAAAGCCCTGAGGCTCAACCTTGGATCAGGCAATGGAAACTGAATAGC 237 Lake Limnopolar Sb42 175 -AAGTCTGTTGTCAAAGCGC-GAGGCTCAACCTTGT-AAAGGCAATGGAAACTGCGAGAC 232 Lake A 2m 1999 cA2B1 235 TCGAGTGTGGTAGGGGCAGAGGGAATTCCCGGTGTAGCGGTGAAATGCGTAGATAT 290 Lake A 15m C5A5 235 TAGAGTGTGGTAGGGGCAGAGGGAATTCCCGGTGTAGCGGTGAAATGCGTAGATAT 290 Lake A 15m C5C9 2 235 TAGAGTGTGGTAGGGGCAGAGGGAATTCCCGGTGTAGCGGTGAAATGCGCAGATAT 290 Lake A 15m C5A8 235 TAGAGTGTGGTAGGGGCAGAGGGAATTCCCGGTGTAGCGGTGAAATGCGTAGATAT 290 Lake A 15m C5B13 235 TAGAGTGTGGTAGGGGCAGAGGGAATTCCCGGTGTAGCGGTGAAATGCGTAGATAT 290 Lake A 15m C5B20 235 TAGAGTGTGGTAGGGGCAGAGGGAATTCCCGGTGTAGCGGTGAAATGCGTAGATAT 290 Lake A 15m C5B4 25 235 TAGAGTGTGGTAGGGGCAGAGGGAATTCCCGGTGTAGCGGTGAAATGCGTAGATAT 290 Lake A 15m C5C10 235 TAGAGTGTGGTAGGGGCAGAGGGAATTCCCGGTGTAGCGGTGAAATGCGTAGATAT 290 Lake A 15m C5C11 235 TAGAGTGTGGTAGGGGCTGAGGGAATTCCCGGTGTAGCGGTGAAATGCGTAGATAT 290 Lake C3 5m C6B3 3 235 TAGAGTTCGGTAGGGGTAGCGGGAATTCCCAGTGTAGCGGTGAAATGCGTAGATAT 290 Lake C3 5m C6B1 235 TAGAGTTCGGTAGGGGTAGCGGGAATTCCCAGTGTAGCGGTGAAATGCGTAGATAT 290 Lake C3 5m C6B5 29 235 TCGAGTGTGGTAGGGGCAGAGGGAATTCCCGGTGTAGCGGTGAAATGCGTAGATAT 290 Lake C3 5m C6C8 2 235 TCGAGTGTGGTAGGGGCAGAGGGAATTCCCGGTGTAGCGGTGAAATGCGTAGATAT 290 Lake C1 15m D01b 235 TAGAGTGTGGTAGGGGCAGAGGGAATTCCCGGTGTAGCGGTGAAATGCGTAGATAT 290 Lake C1 15m D02b 235 TAGAGTGTGGTAGGGGCAGAGGGAATTCCCGGTGTAGCGGTGAAATGCGTAGATAT 290 Taconite Inlet 10m D 235 TCGAGTGTGGTAGGGGCAGAGGGAATTCCCGGTGTAGCGGTGAAATGCGTAGATAT 290 Lake C1 15m D04b 235 TAGAGTGTGGTAGGGGCAGAGGGAATTCCCGGTGTAGCGGTGAAATGCGTAGATAT 290 Lake C2 15m D08b 5 235 TCGAGTGTGGTAGGGGCAGAGGGAATTCCCGGTGTAGCGGTGAAATGCGTAGATAT 290 Lake A 2m D10b 235 TTGAGTGTGGTAGGGGCAGAGGGAATTCCCGGTGTAGCGGTGAAATGCGTAGATAT 290 Lake C1 12m Da09a 234 TAGAGTGTGGTAGGGGCAGAGGGAATTCCCGGTGTAGCGGTGAAATGCGTAGATAT 289 Lake Meretta 2.5m Da 236 TAGAGTGCGTTCGGGGCAGAGGGAATTCCTGGTGTAGCGGTGAAATGCGTAGAGAT 291 Taconite Inlet 3m Db 236 TNGAGTGTGGTAGGGGCAGAGGGAATTCCCGGTGTAGCGGTGAAATGCGTAGATAT 291 Lake C2 3m Db319b 236 TCGAGTGTGGTAGGGGCAGAGGGAATTCCCGGTGTAGCGGTGAAATGCGTAGATAT 291 Lake C1 12m Db323b 235 TAGAGTGTGGTAGGGGCAGAGGGAATTCCCGGTGTAGCGGTGAAATGCGTAGATAT 290 Lake A 2m Db328b 235 TmGAGTGTGGTAGGGGCAGAGGGAATTCCCGGTGTAGCGGTGAAATGCGTAGATAT 290 Lake C1 5m Db329b 235 TwGAGTATGGCAGGGGTAGAGGGAATTTCTAGTGTAGCGGTGAAATGCGTAGATAT 290 Taconite Inlet 30m S 235 TTGAGTGTGGTAGGGGCAGAGGGAATTCCCGGTGTAGCGGTGAAATGCGTAGATAT 290 Char 20m S (gex) 235 TAGAGTGTGGTAGGGGCAGAGGGAATTCCCGGTGTAGCGGTGAAATGCGTAGATAT 290 Lake C1 12m S (gex) 235 TAGAGTGTGGTAGGGGCAGAGGGAATTCCCGGTGTAGCGGTGAAATGCGTAGATAT 290 Lake C1 12m Sb411a 236 TAGAGTGTGGTAGGGGCAGAGGGAATTCCCGGTGTAGCGGTGAAATGCGTAGATAT 291 Lake C1 15m Sb424b 235 TAGAGTGTGGTAGGGGCAGAGGGAATTCCCGGTGTANCGGTGAAATGCGTAGATAT 290 Lake C1 12m Sb425b 2 235 TAGAGTGTGGTAGGGGCAGAGGGAATTCCCGGTGTAGCGGTGAAATGCGTAGATAT 290 Lake C3 5m Db430b 238 TAGAGAGAGATAGGGGCAGrAGGAATTCCmGGTGTAGCGGTGAAATGCGTAGATAT 293 Lake Limnopolar Sb42 233 TAGAGAGAGATAGGGGCAGGAGGAATTCCAGGTGTAGCGGTGAAATGCGTAGATAT 288