Sousa et al BMC Genomics 2013 14:838 http:wwwbiomedcentralcom1471-216414838 RESEARCH ARTICLE Open Access Genome-wide identification of genes involved in the positive and…
PowerPoint [email protected] [email protected] The Delphic Boat Biology is a science of relationships between objects rather than of objects: from sun together,
The genome and transcriptome of Phalaenopsis yield insights into floral organ development and flowering regulation Jian-Zhi Huang1,*, Chih-Peng Lin2,4,*, Ting-Chi Cheng1,…
Genome annotation Erwin Datema 2011 Sandra Smit 2012, 2013 Genome annotation AGACAAAGATCCGCTAAATTAAATCTGGACTTCACATATTGAAGTGATATCACACGTTTCTCTAAT AATCTCCTCACAATATTATGTTTGGGATGAACTTGTCGTGATTTGCCATTGTAGCAATCACTTGAA…
Genome-Wide Association Scan Shows Genetic Variants in the FTO Gene Are Associated with Obesity-Related Traits Angelo Scuteri 12 Serena Sanna 34 Wei-Min Chen 3 Manuela Uda…
Page 1 UE Spécifique ANALYSE ET METHODES D ETUDE DU GENOME Page 2 I- STRUCTURE DU GENOME Organisation Composition Les différentes séquences Le gène Page 3 INTRODUCTION…
Genome-wide gene expression patterns in dikaryon of the basidiomycete fungus Pleurotus ostreatusb r a z i l i a n j o u r n a l o f m i c r o b i o l o g y 4 8 (2 0 1 7)
Sensory Peripheral Neuropathy in CALGB 40101 *R. Michael Baldwin1, *Kouros Owzar2,3, Hitoshi Zembutsu4, Aparna Chhibber1, Michiaki Kubo4, Chen Jiang3, Dorothy Watson3, Rachel
Genome-wide association study of oral cavity and pharyngeal cancer 1 Corina Lesseur1, Brenda Diergaarde2, Andrew F Olshan3, Victor Wünsch-Filho4, Andrew 2 R Ness5, Geoffrey
1 Transcription coordinates histone amounts and genome content 1 Kora-Lee Claude 1 , Daniela Bureik 1 , Petia Adarska 1 , Abhyudai Singh 2 , Kurt M. Schmoller 1* 2 1 Institute…
1 Genome-wide association study identifies 30 Loci Associated with Bipolar Disorder Eli A Stahl 1,2,3†&, Gerome Breen 4,5†, Andreas J Forstner 6,7,8,9,10†, Andrew McQuillin
RESEARCH ARTICLE Open Access A genome-wide association study identifies candidate loci associated to syringomyelia secondary to Chiari-like malformation in Cavalier King…
Draft genome of the globally widespread and invasive Argentine ant Linepithema humile Christopher D. Smitha,1, Aleksey Ziminb, Carson Holtc, Ehab Abouheifd, Richard Bentone,…
1 Whole-genome and RNA sequencing reveal variation and transcriptomic coordination in the developing human prefrontal cortex Donna M. Werling1,*, Sirisha Pochareddy2,*, Jinmyung…
Copyright � 2011 by the Genetics Society of America DOI: 10.1534genetics.110.124057 Genome-Wide Association Study Identifies Two Major Loci Affecting Calving Ease and Growth-Related…
Action Genome: Actions as Compositions of Spatio-temporal Scene Graphs Jingwei Ji Ranjay Krishna Li Fei-Fei Juan Carlos Niebles Stanford University {jingweij, ranjaykrishna,…
RESEARCH ARTICLE Genome-wide identification and expression profile analysis of nuclear factor Y family genes in Sorghum bicolor L. Moench P. Maheshwari1, Divya Kummari2,…
MOUSE GENETIC RESOURCES Genome-Wide Association Mapping of Quantitative Traits in Outbred Mice Weidong Zhang*1 Ron Korstanje*1 Jill Thaisz† Frank Staedtler‡ Nicole Harttman‡…
Toxoplasma gondii Superinfection and Virulence during Secondary Infection Correlate with the Exact ROP5ROP18 Allelic Combination Kirk D. C. Jensen,a* Ana Camejo,a Mariane…
First near complete haplotype phased genome assembly of River buffalo Bubalus bubalis Sudhakar Ananthasayanam1*, Harish Kothandaraman2, Nilesh Nayee1, Sujit Saha1, Dushyant…