Implication of NuA4 histone acetyltransferase complex in ... · L'un de ces modificateurs est NuA4,...
102
Implication of NuA4 histone acetyltransferase complex in transcription regulation and genome stability MÉMOIRE Xue Cheng Maîtrise en biologie cellulaire et moléculaire Maître ès sciences (M.Sc.) Québec, Canada ©Xue Cheng, 2014
Transcript of Implication of NuA4 histone acetyltransferase complex in ... · L'un de ces modificateurs est NuA4,...
Implication of NuA4 histone acetyltransferase complex
in transcription regulation and genome stability
MÉMOIRE
Xue Cheng
Maîtrise en biologie cellulaire et moléculaire
Maître ès sciences (M.Sc.)
Québec, Canada
©Xue Cheng, 2014
iii
RÉSUMÉ
Le génome est organisé sous forme de chromatine afin de contourner la problématique
d’espace limité dans le noyau. De plus, cette structure hautement condensé est une barrière
physique aux processus cellulaires qui nécessite l’accès à l’information génétique. Les
dernières années d'études ont dévoilé des complexes modificateurs de la chromatine comme
des acteurs clés dans plusieurs mécanismes de modulation de la chromatine. L'un de ces
modificateurs est NuA4, un complexe conservé au cours de l’évolution qui acétyle les
histones H2A, H2A.Z et H4. Dans cette thèse, en utilisant Saccharomyces cerevisiae comme
organisme modèle, nous avons identifié l'implication de NuA4 dans l'incorporation de H2A.Z
et la biosynthèse des voies purines. Dans une seconde partie, nous étudions la participation
de NuA4 dans la réponse aux dommages de l'ADN. Plus précisément, nous avons caractérisé
la phosphorylation des sous-unités NuA4 dépendante de Mec1/Tel1. L’ensemble de ces
travaux, comment NuA4 coordonne différentes activités cellulaires.
v
Abstract
Cell genome is packaged into chromatin in order to compensate the limited space within the
nucleus. However, this highly condensed structure also presents strong physical barriers for
cellular processes using DNA as templates. Recent years of studies have unveiled chromatin
modifying complexes as key players in several mechanisms of chromatin modulation. One
of these modifiers is NuA4, an evolutionary conserved large multi-subunit histone
acetyltransferase complex that acetylates histone H2A, H2A.Z and H4. In this thesis, using
Saccharomyces cerevisiae as model system, we identified the implication of NuA4 in global
histone variant H2A.Z incorporation and purine biosynthesis pathways. Moreover, we also
show previously uncharacterized involvement of NuA4 in DNA damage response pathways
through Mec1/ Tel1-dependent phosphorylation events on NuA4 subunits. Further analysis
will shed light on detailed mechanisms about how NuA4, as a multifunctional complex,
coordinates various cellular activities.
vii
Table of Contents
RÉSUMÉ ............................................................................................................................. iii Abstract .................................................................................................................................. v Table of Contents ............................................................................................................... vii List of Tables ........................................................................................................................ xi List of Figures .................................................................................................................... xiii List of Abbreviations .......................................................................................................... xv Acknowledgements ......................................................................................................... xxiii Chapter 1 Introduction ........................................................................................................ 1 1.1 Chromatin structure and function ................................................................................ 2
1.1.1 Chromatin ................................................................................................................. 2
1.1.2 Histone posttranslational modifications ................................................................. 3
1.1.2.1 Acetylation ........................................................................................................... 6
1.1.2.2 Methylation .......................................................................................................... 6
1.1.2.3 Phosphorylation .................................................................................................. 7
1.1.2.4 Other histone posttranslational modifications .................................................... 7
1.1.3 Incorporation of histone variants ........................................................................... 7
1.1.3.1 H2A.Z ................................................................................................................... 8
1.1.3.2 H2A.X .................................................................................................................. 9
1.1.3.3 Other histone variants ....................................................................................... 10
1.1.4 ATP-dependent chromatin remodeling ................................................................ 10
1.2 NuA4 histone acetyltransferase complex .................................................................... 10
1.2.1 Piccolo NuA4........................................................................................................... 11
1.2.1 TINTIN.................................................................................................................... 11
1.2.3 Eaf2-Yaf9-Arp4-Act1 sub-module ........................................................................ 11
1.2.4 Other NuA4 subunits: Eaf1 and Tra1 .................................................................. 12
1.3 NuA4 function in gene regulation................................................................................ 13
1.4 NuA4 function in genome stability .............................................................................. 15
1.5 Project Rationale ........................................................................................................... 16
Chapter 2 Eaf1 links the NuA4 histone acetyltransferase complex to Htz1 incorporation and regulation of purine biosynthesis ............................................................................... 19
2.1 Foreword ........................................................................................................................ 20 2.2 Résumé ........................................................................................................................... 20 2.3 Abstract .......................................................................................................................... 20 2.4 Introduction ................................................................................................................... 22 2.5 Material and methods ................................................................................................... 22
viii
2.5.1 Yeast strains and reagents. .................................................................................... 24
2.5.2 ChIP-on-chip. ......................................................................................................... 24
2.5.3 Northern Blot and Microarray analysis. .............................................................. 24
2.5.4 GST-pull-down, and HAT assay. .......................................................................... 25
2.5.5 Chromatin ImmunoPrecipitation (ChIP). ........................................................... 25
2.6 Results ............................................................................................................................ 27 2.6.1 Loss of Eaf1 affects genome-wide Htz1-enrichment ........................................... 27
2.6.2 NuA4 is implicated in regulation of gene network for purine biosynthesis ...... 28
2.6.3 Loss of Eaf1 cripples induction of a number of ADE genes ............................... 30
2.6.4 NuA4 interacts with Pho2 and Bas1 in vitro ........................................................ 31
2.6.5 Enrichment of Htz1 and acetylated H4 at inactive ADE promoters is dependent on NuA4 ......................................................................................................... 33
2.6.6 Loss of nucleosomes upon ADE gene induction .................................................. 34
2.6.7 Htz1 K14 acetylation at ADE gene promoter is dependent on NuA4................ 37
2.7 Discussion ...................................................................................................................... 38 Chapter 3 Implication of Mec1/Tel1-dependent phosphorylation of NuA4 histone acetyltransferase complex in DNA damage response pathways ..................................... 43 3.1 Foreword ........................................................................................................................ 44 3.2 Résumé ........................................................................................................................... 44
3.3 Abstract .......................................................................................................................... 45 3.4 Introduction ................................................................................................................... 46
3.5 Materials and Methods ................................................................................................. 48 3.5.1 Yeast Strains and Manipulation ........................................................................... 48
3.5.2 Tandem-Affinity Purification (TAP) .................................................................... 50
3.5.3 Two-dimensional gel electrophoresis .................................................................... 51
3.5.4 Western Blot ........................................................................................................... 51
3.5.5 Histone AcetylTransferase (HAT) Assay ............................................................. 52
3.5.6 Silver Stain .............................................................................................................. 52
3.5.7 Spot Assay ............................................................................................................... 52
3.5.8 Rad53 checkpoint activation/recovery assay ....................................................... 53
3.5.9 TCA Protein extraction ......................................................................................... 53
3.6 Results ............................................................................................................................ 54 3.6.1 NuA4 subunits are phosphorylated upon DNA damage .................................... 54
3.6.2 Eaf1 is phosphorylated in vivo upon DNA damage ............................................. 55
3.6.2 Eaf1 phospho-mutants do not alter complex integrity or activity ..................... 56
3.6.3 Eaf1 and Eaf3 phospho-mutants do not affect Rad53 checkpoint activation or recovery in slx4Δ background ........................................................................................ 58
ix
3.6.4 Eaf1 phospho-mutants show diverse functional links with DNA-damage response effectors ............................................................................................................ 59
3.6.5 Verification of SGA data ....................................................................................... 60
3.6.6 Involvement of phosphorylation events on other NuA4 subunits upon DNA damage ............................................................................................................................. 61
3.7 Discussion and perspectives ......................................................................................... 62 Chapter 4 Discussion and Perspectives ............................................................................. 65 References ............................................................................................................................ 71
xi
List of Tables
Table 1 - Histone Variants- Type, Function and Distribution. .............................................. 8 Table 2 - List of NuA4 Subunits .......................................................................................... 16 Table 3 - Strains Used In This Study. .................................................................................. 24 Table 4 - Primers used in ChIP-qPCR ................................................................................. 26 Table 5 - Yeast Genes Down-regulated in eaf1Δ Cells Grown in Rich Media ................... 29 Table 6 - S. cerevisiae Strains Used. .................................................................................... 49 Table 7 - Primers Used In This Study. ................................................................................ 49 Table 8 - Examples of Putative Mec1/Tel1 Target Sites in NuA4 Subunits. ...................... 54
xiii
List of Figures
Figure 1 - Cell organizational network of chromatin structure. ............................................. 2 Figure 2 - Schematic of the structure of histones in nucleosomes. ........................................ 4 Figure 3 - X-ray crystal structure of the nucleosome core particle of chromatin. ................. 5 Figure 4 - Example of recruitment of mediators through reader modules that recognize certain histone PTMs. ............................................................................................................. 5 Figure 5 - Schematic representation of NuA4 structure organization and functions of submodules. .......................................................................................................................... 13 Figure 6 - Model of NuA4 involvement in PHO5 transcription regulation. ....................... 14 Figure 7 - Model of NuA4 implication in DNA damage response. ..................................... 15 Figure 8 - NuA4 affects Htz1 incorporation independently of transcription rate. ............... 28 Figure 9 - NuA4 is important for ADE gene induction. ....................................................... 30
Figure 10 - Bas1 and Pho2 directly interact with NuA4 complex in vitro. ......................... 32 Figure 11 - The presence of H4 acetylation and Htz1 at repressed ADE17 promoter is NuA4-dependent. .................................................................................................................. 34 Figure 12 - Loss of both H4 acetylation and Htz1 variant rapidly upon induction at ADE17 promoter along with nucleosome disassembly. .................................................................... 36 Figure 13 - Htz1 is acetylated at K14 by NuA4 at ADE17 promoter. ................................. 37 Figure 14 - Model of step-wise ADE promoter architecture for gene activation. ................ 38 Figure 15 - The DNA damage response cascades and Mec1/Tel1 kinases. ........................ 47 Figure 16 - Mec1/Tel1 targeting sites mapped in Eaf1. ....................................................... 55 Figure 17 - Eaf1 is phosphorylated in vivo upon DNA damage. ......................................... 56 Figure 18 - Eaf1 SQ-mutants do not alter complex integrity or activity. ............................ 57 Figure 19 - Eaf1 and Eaf3 SQ-mutants do not alter Rad53 checkpoint activation or recovery. ............................................................................................................................... 59 Figure 20 - Eaf1 phosphorylation mutants show genetic interactions with DNA damage response effectors. ................................................................................................................ 60 Figure 21 - Mutants containing phospho-mimic Eaf1 do not show significant phenotype. 61 Figure 22 - Tra1 is phosphorylated at SQ site upon DNA damage independent of Eaf1-SQ phosphorylation status. ......................................................................................................... 62
Figure 23 - Model for the implication of NuA4 and histone modification crosstalks in DNA repair events. ............................................................................................................... 68
xv
List of Abbreviations
2D-gel Two-dimensional gel electrophoresis 53BP1 p53 binding protein 1 Act1 actin 1 ADE ADEnine requiring Akt/PKB Protein Kinase B Arp Actin-Related Protein ATM ataxia telangiectasia mutated ATP adenosine triphosphate ATR ataxia telangiectasia and Rad3 related BAF53 BRG1-associated factors 53 Bas1 BASal 1 Bdf1 bromodomain factor 1 BRCT BRCA1 C Terminus CH core histones CHD1 chromodomain helicase DNA binding 1 ChIP chromatin immunoprécipitation Chk1 CHeckpoint Kinase 1 Chk2 CHeckpoint Kinase 2 DDR DNA damage response DMAP1 DNA methyltransferase 1 associated protein 1 DNA Deoxyribonucleic acid DNA-PK DNA-dependent protein kinase Dot1 disruptor of telomeric silencing 1 DSB double strand break Eaf Esa1p-Associated Factor EPC1 enhancer of polycomb homolog 1 Epl1 Enhancer of Polycomb Like 1 Esa1 essential SAS2-related acetyltransferase 1 GAS41 Glioma-Amplified Sequence 41
Gcn5 general control nonderepressible 5 GPS Group-based Prediction System GST Glutathione S-transferase HAT histone acetyltransferase HDAC histone deacetylase HDM histone demethylase HIPK2 Homeodomain-interacting protein kinase 2
xvi
HMT histone methyltransferase HO HOmothallic switching endonuclease HR homologous recombination HSA helicase SANT associated Htz1 Histone Two A Z1 HU hydroxyurea Ies4 Ino Eighty Subunit 4 ING3 inhibitor of growth 3 INO80 INOsitol 80 complex IR ionizing radiation ISWI imitation SWI/SNF MBT Malignant Brain Tumor MDC1 Mediator of DNA damage checkpoint protein 1 Mec1 mitosis entry checkpoint 1 MMS methyl methanesulfonate Mrc1 Mediator of the Replication Checkpoint 1 MRG15 MORF4-Related Gene on chromosome 15 MRGBP MRG-binding protein MRN MRE11–RAD50–NBS1 mRNA message RNA MS mass spectrometry NFR nucleosome-free region NHEJ non-homologous end-joining NuA4 nucleosome acetyltransferase of H4 OD Optical Density ORF open reading frame PCR polymerase chain reaction PHD plant homeodomain PHO PHOsphate metabolism PI3K phosphatidylinositol-3 kinase pl point isoelectric Pol II RNA polymerase II PTM post-traductional modification qPCR quantitative polymerase chain reaction Rad RADiation sensitive RNA Ribonucleic acid S/T-Q serine or threonine followed by glutamine SAGA Spt, Ada, Gcn5 acetyltransferase SANT Swi3, Ada2, N-Cor and TFIIIB
xvii
SC synthetic complete SCD S/T-Q cluster domain SRCAP snf2-related CBP activator protein SCSM Synthetic Complete Supplement Mixture SDS3 Suppressor of Defective Silencing 3 SDS-PAGE SDS-Polyacrylamide gel electrophoresis SGA synthetic genetic array Slx4 Synthetic Lethal of unknown (X) function 4 SON short oligonucleosomes SWI/SNF mating type switching/sucrose non fermentation Swr1 Swi2/Snf2-related ATPase 1 SWR-C Swi2/Snf2-related ATPase Complex Taf1 TBP associated factor 1 TAP tandem affinity purification Tel1 telomere maintenance 1 TEV tobacco etch virus TFIID transcription factor II D Tip60 Tat interacting protein (60kDa) Tra1 yeast homolog of TRRAP1 TRRAP transformation/transactivation domain associated protein TSS Transcription Start Site UAS Upstream Activating Sequence UV Ultraviolet light WT wild type Yaf9 yeast AF-9 Yng yeast homolog of mammalian ING YPD Yeast-Peptone-Dextrose
xix
To my loving families.
xxi
Three treasures I pursue in life:
The courage to change the things I can;
The serenity to accept the things I cannot change;
And the wisdom to know the difference.
xxiii
Acknowledgements
Firstly, I would like to sincerely thank my supervisor Dr. Jacques Cote. Thank you for accepting me to your lab, giving me time to adjust and adapt to the new environment, guiding and inspiring me throughout my master study. Your excellent mentoring and admirable personalities have been nurturing me in the pursuit of science. Secondly, I want to thank all the current lab members and former lab members, especially Marie-eve, Anne-lise and Dorine. It is through the everyday discussions that I found myself constantly reflecting and learning. I truly enjoy being in this environment. “Everybody in the lab can talk science.” Thirdly, I want to thank my family for their endless love and support. Thanks to my parents for being open-minded, letting me pursuit what I want in life, even if that means their only child will not be always around. Last but not least, I want to thank my boyfriend Francois Boulanger and his family. Being far away from one’s family and familiar culture is not always easy, and it is you and your family’s care and support that warmed me all through the ups and downs in life, sentimental family-gathering festivals and harsh Quebec winters. Thanks to you all.
1
Chapter 1
Introduction
2
1.1 Chromatin structure and function
1.1.1 Chromatin
Evolution has shaped eukaryotic cells to be capable of facing and solving two vital tasks
related to its genetic information carrier, the genome. On one hand, the genome needs to be
highly condensed in order to encompass the nearly 2-meter of DNA into the nucleus
(Peterson and Laniel, 2004), the diameter of which is only ~6 μm (Bruce Alberts, 2002)
(Figure 1). On the other hand, the underlying DNA within this condensed structure needs to
be accessible at specific times and situations. Cells coordinate these two seemingly
conflicting needs through chromatin structure. By modulating the different properties of
chromatin, cells are able to adjust according to the environment and carry out different
cellular activities such as transcription, replication and DNA damage repair.
Figure 1 - Cell organizational network of chromatin structure. Modified from (Rosa and Shaw, 2013).
3
The basic unit of chromatin is the nucleosome, which consists of about 147bp of DNA
wrapping around a protein octamer with two copies of four types of histones, H2A, H2B, H3
and H4 (Kornberg, 1974). There are several mechanisms that cells have adopted to modulate
the chromatin structure in order to achieve precise temporal and spatial regulation of cellular
activities. These mechanisms include histone posttranslational modifications, incorporation
of histone variants, and ATP-dependent chromatin remodeling.
1.1.2 Histone posttranslational modifications
While DNA is wrapped around the histone core to form nucleosomes, the amino-terminal
tails of the histones extend out from the nucleosomes, providing a platform for various types
of modification including acetylation, methylation, phosphorylation and ubiquitination
(Figure 2). Different modifications, either alone or in different combinations, can regulate
chromatin structure in different manners. As the interaction between DNA and histones are
mostly based on the positive charge on histones and negative charge on DNA, some histone
modifications can directly affect this DNA-histone interaction, increasing the accessibility
for transcriptional regulatory proteins to DNA templates and thus altering chromatin
structure and gene expression (Figure 3) (Struhl, 1998). For example, multiple histone
acetylation events on H4 can attenuate the positive charge on H4 N-terminus tail, resulting
in less stable nucleosomes that are susceptible to loss and genomic regions that are more
accessible for transcriptional factors. Therefore, the presence of this modification pattern at
gene promoter regions often associates with active transcription (Steunou et al., 2014).
4
Figure 2 - Schematic of the structure of histones in nucleosomes. a) Histone N-terminus tails stretch out from nucleosomes. b) Examples of different modifications occurring on histones. A, acetyl; C, carboxyl terminus; E, glutamic acid; M, methyl; N, amino terminus; P, phosphate; S, serine; Ub, ubiquitin. Adapted from (Marks et al., 2001)
A major second mechanism is termed “effector-mediated” mechanism. In this case, the
modifications on histones can serve as docking sites for the binding of effector proteins
through specific reader domains (Figure 4). By this recruitment, the modified histone tails
can act as integrating platforms, permitting local chromatin structure to receive and interpret
information from upstream signaling cascades (Musselman et al., 2012).
5
Figure 3 - X-ray crystal structure of the nucleosome core particle of chromatin. A) Histone protein octamer is surrounded by 147 base pairs of DNA. B, C) Histones are highly positively charged at DNA contact points and histone tails. Blue color represents positive charge and red color represents negative charge. All figures were displayed by PyMol software. B, C electric potentials are generated by vacuum electrostatics (PDB: 1AOI).
Figure 4 - Example of recruitment of mediators through reader modules that recognize certain histone PTMs. Me, methylation; ac, acetylation; ph, phosphorylation. Modified from (Musselman et al., 2012)
6
1.1.2.1 Acetylation
Since first identified in 1964 as a potential regulator of RNA synthesis (Allfrey et al., 1964),
histone acetylation has been one of the histone posttranslational modifications (PTMs) that
are most characterized. The presence of acetylation is catalysed by histone acetyltransferases
(HATs) through transferring an acetyl group from acetyl-CoA to the lysine-amino groups on
the N-terminal tails of histones (Carrozza et al., 2003). On the contrary, the removal of acetyl-
group is carried out by histone deacetylases (HDACs). Disturbance of histone acetylation
homeostasis and deregulation of HATs and HDACs activities have been tightly associated
with human diseases including cancers (Avvakumov and Cote, 2007; Steunou et al., 2014).
Histone acetylation has been implicated in multiple cellular functions, such as transcription,
replication and DNA repair through both direct mechanism and effector-mediated
mechanism (Carrozza et al., 2003; Lee and Workman, 2007; Li et al., 2007; Steunou et al.,
2014; Unnikrishnan et al., 2010). As mentioned above, certain lysine acetylation events can
directly alter physical properties of histone-DNA interaction or disrupt nucleosome higher-
order associations (Shogren-Knaak et al., 2006), resulting in a more open chromatin structure.
Alternatively, histone acetylation can also recruit effectors that contain bromodomain(s)
(Figure 4), such as Gcn5, Bdf1, Taf1 and Brd4. These proteins are components of specific
chromatin remodelling complexes or transcriptional machineries (e.g. Gcn5 for SAGA, Bdf1
for SWC1-C, Taf1 for TFIID). This recruitment can indirectly interpret histone acetylation
marks into specific downstream biological responses.
1.1.2.2 Methylation
Methylation is an abundant type of histone PTM as it can occur on both lysine and arginine
residues with multiple methylation states. Lysine methylation can have three methylation
states, namely mono- (me1), di- (me2) and tri- (me3), while arginine can undergo mono- and
symmetrical or asymmetrical di-methylation (Latham and Dent, 2007). Histone methylations
are catalysed by histone methyltransferases (HMTs) from either de novo status or lower
methylation states, and removed by histone demethylases (HDMs).
Unlike acetylation, methylation does not remove the positive charge on lysines. Distinct
physicochemical properties among different states of methylation allow the specific binding
7
of diverse effectors through reader modules (Figure 4), including chromodomain, Tudor,
MBT and PHD finger domains (Musselman and Kutateladze, 2011; Musselman et al., 2012;
Taverna et al., 2007). Studies have shown that recruitment of these reader modules by
different methylation states of specific residues correspond to specialized biological
functions. For example, H3K4me3 is generally linked to active transcription sites, while
H3K9me3 has been defined as a mark for heterochromatin (Taverna et al., 2007).
1.1.2.3 Phosphorylation
Histone phosphorylation is another modification that has become a topic of vigorous
investigation. This modification is catalysed by specific kinases through addition of a
negatively charged phosphate moiety to the hydroxyl group of serine or threonine residues
which can be removed by phosphatases (Taverna et al., 2007). With sites detected on all four
core histones, histone phosphorylation events have been implicated in a variety of cellular
processes, such as transcription regulation, apoptosis, cell cycle progression, DNA repair,
and chromosome condensation (Banerjee and Chakravarti, 2011; Cheung et al., 2005; Hurd
et al., 2009; Krishnamoorthy et al., 2006; Utley et al., 2005). Again, this functions through
direct interference of DNA-histone interactions, recruitment of effector proteins, or crosstalk
with other types of modifications.
1.1.2.4 Other histone posttranslational modifications
With the recent combination of mass spectrometry, metabolic-labelling and antibody-based
detection, at least eight types of PTMs on more than 60 histone residues have been reported
in vivo (Tan et al., 2011). Future works will meet the challenges of defining the properties of
these PTMs in different contexts and translating them into specific biological outputs.
1.1.3 Incorporation of histone variants
Besides genes encoding canonical core histones, cells also possess genes that express other
histones termed as histone variants. Generally, histone variants differ from canonical histones
on primary amino acid sequence and structural level (Zlatanova et al., 2009). Moreover,
unlike canonical histones whose genes are clustered in the genome and expressed during
early-S phase of the cell cycle, histone variant genes tend to have scattered genomic
8
distribution and are constitutively expressed across the cell cycle (Rosa and Shaw, 2013;
Talbert and Henikoff, 2010).
Histone variant incorporation, similar to histone posttranslational modifications, contributes
to the regulation of diverse cellular activities, including DNA repair, meiotic recombination,
chromosome segregation, transcription initiation and termination, sex chromosome
condensation and sperm chromatin packaging etc.(Talbert and Henikoff, 2010) (Table 1).
Table 1 - Histone Variants- Type, Function and Distribution.
Family Variant Function Distribution H4 Canonical Genome packaging Universal H3 Canonical (H3.2) Genome packaging Universal H3 H3.3 Replacement Universal H2A Canonical Genome packaging Universal H2B Canonical Genome packaging Universal H2A H2A.X DNA break repair Universal H2A H2A.Z Promoter insulation Universal H3 CenH3 (CENP-A, others) Centromere identity and function Universal H2A macro H2A Gene regulation Animals H3 H3t Testis-specific Mammals H2B TH2B Testis-specific Mammals H2A H2A.Bbd Transcription and mRNA processing Mammals H2B H2BFWT Testis-specific Mammals H2A H2AL1,L2 Testis-specific Mammals H2A H2Abd DNA as break repair Bdelloids H3 H3V Transcription termination Trypanosomes H4 H4V Transcription termination Trypanosomes H2B H2BV Transcription initiation Trypanosomes
*Modified from (Talbert and Henikoff, 2010)
1.1.3.1 H2A.Z
H2A.Z is an evolutionary conserved histone variant that constitutes about 5 to 10% of the
total H2A population (West and Bonner, 1980). H2A.Z shares about 60% amino acid identity
with canonical H2A (Jackson et al., 1996) and distributes non-randomly across the genome
(Li et al., 2005; Zhang et al., 2005). Although debate remains regarding to the structure and
stability aspect of H2A.Z-containing nucleosomes, some structural features which
9
distinguish H2A.Z from H2A have been established, including a unique C-terminal tail that
specifies H2A.Z deposition and an extended surface charge patch that assist regulation of
chromatin compaction (Billon and Cote, 2013).
H2A.Z incorporation is catalyzed by ATP-dependent SWR1-complex (SWR-C) in yeast
(yeast H2A.Z is termed as Htz1) and SRCAP and p400 complexes in higher eukaryotes
through the exchange of H2A-H2B dimer with H2A.Z-H2B dimers within nucleosomes
(Altaf et al., 2009; Kobor et al., 2004; Mizuguchi et al., 2004). Genome-wide studies show
that H2A.Z localizes around nucleosome-free regions (NFRs), which correspond to the
transcription initiation sites. Enrichment of H2A.Z is found over the promoter regions of
transcriptionally inactive genes in yeast (Guillemette et al., 2005; Li et al., 2005; Zhang et
al., 2005), and this presence has been shown to be involved in presetting mechanism for
favoring nucleosomes disassembly upon gene activation (Altaf et al., 2010; Auger et al., 2008;
Zhang et al., 2005). Moreover, Htz1 is also found to be acetylated in vivo, and this acetylation
event is associated with genome-wide gene activity in yeast (Millar et al., 2006). Besides
transcription, H2A.Z incorporation has also been involved in cellular activities such as
chromosome segregation, telomere silencing and genome integrity (Billon and Cote, 2013;
Krogan et al., 2004; Lu et al., 2009).
1.1.3.2 H2A.X
H2A.X is another histone variant of H2A that constitutes about 10% of the H2A population
in mammals and about 90% in S. cerevisiae. The most striking feature of this histone variant
is that H2A.X can be phosphorylated on a large chromatin domain upon DNA damage. The
phospho-event occurs at Serine 139 in mammals and Serine 129 in yeast, and phosphorylated
H2A.X is termed as γH2A.X. During repair of DNA double strand breaks (DSBs), γH2A.X
is one of the first mark to appear at the lesions and spread rapidly to ~50kb on each side of
DSB in yeast, even up to megabases in mammalian cells.
γH2A.X is catalyzed by members of phosphatidylinositol-3 kinase-like kinase (PI3KK)
family (Mec1/Tel1 in yeast, ATR/ATM/DNA-PKcs in mammals). γH2A.X possesses a
crucial position in DNA damage response pathway by transducing and amplifying the local
damage signal through recruitment/ interaction with DNA damage repair effectors such as
the MRN complex, Mdc1 and 53BP1 (Banerjee and Chakravarti, 2011). After repairing the
10
damaged DNA, phosphorylation on S139 is removed by chromatin-associated phosphatases,
which allows cells to re-enter the cell cycle (Macurek et al., 2010).
1.1.3.3 Other histone variants
Recent years have also witnessed the characterization of new histone variants and their
functions (Montellier et al., 2013; Morillo Prado et al., 2013) (Table 1). Many newly
identified variants show tissue-specific or developmental-stage-specific expression and
incorporation, highlighting the concept of histone variant as an essential factor of chromatin
specialization within the spatial and temporal complexity of biology.
1.1.4 ATP-dependent chromatin remodeling
As the accessibility of the DNA-template is generally hampered by the presence of
nucleosomes, nucleosomes at certain genomic regions need to be moved, ejected or
restructured. This need of chromatin modulation relies on ATP-dependent chromatin
remodeling complexes (remodelers). There are four classes of remodelers, including
SWI/SNF, imitation switch (ISWI), INO80 and Mi-2/CHD groups (Erdel et al., 2011).
Current thinking suggests that each type of remodeler acts in distinct manners and carries out
unique biological functions. For example, as mentioned above, SWR-C is responsible for
histone dimer exchange with H2A.Z-H2B, an activity important for modulation of promoter
architecture (Kobor et al., 2004; Mizuguchi et al., 2004; Wu et al., 2005). Besides the
involvement in dimer exchange, ATP-dependent remodelers are also implicated in
transcriptional activation and repression, sister chromatid cohesion and DNA repair (Cairns,
2005; Morrison and Shen, 2009).
1.2 NuA4 histone acetyltransferase complex
NuA4 histone acetyltransferase is a large chromatin modifying complex that consists of 13
subunits. The main function of NuA4 is to acetylate lysines on histone H2A, H2A.Z and H4
N-terminus tails (Steunou et al., 2014). It is performed by Esa1, the only HAT essential for
viability in Saccharomyces cerevisiae (Allard et al., 1999; Utley et al., 1998). The
involvement of NuA4 in different cellular activity regulations such as transcription, DNA
11
repair, cell cycle progression, chromosome segregation and chromatin boundary
maintenance (Lu et al., 2009; Steunou et al., 2014).
The multifunctional nature of the NuA4 complex benefits from the context of its multi-
subunit assembly. Several functional sub-complexes/sub-modules have been identified with
Eaf1 as main scaffold subunit (Auger et al., 2008) (Figure 5). These sub-modules include
Piccolo NuA4 (Epl1, Yng2, Eaf6, Esa1), TINTIN (Eaf5/7/3), Eaf2-Yaf9-Arp4-Act1 sub-
module and Tra1 recruitment module.
1.2.1 Piccolo NuA4
Piccolo NuA4 is a sub-complex of NuA4 that contains Epl1, Yng2, Eaf6 and catalytic subunit
Esa1 (Auger et al., 2008; Boudreault et al., 2003). Piccolo NuA4, unlike its parental complex
NuA4, acts mainly on nucleosome substrate compared to naked histones through its Yng2
and Epl1 subunits (Ranjan et al., 2013; Selleck et al., 2005). Since Piccolo is smaller in size
yet functionally active on chromatin, it has been proposed that Piccolo NuA4 is responsible
for global histone acetylation while NuA4 carries out targeted acetylation events in a more
specific fashion through transcription activator-directed recruitment (Boudreault et al., 2003).
1.2.1 TINTIN
NuA4 subunits Eaf5, Eaf7 and Eaf3 can exist outside of NuA4 and form an independent
trimeric sub-complex referred as “TINTIN” (Trimer Independent of NuA4 involved in
Transcription Interactions with Nucleosomes) (Cheng and Cote, in press). Unlike NuA4, the
enrichment of which is mainly around promoter regions, TINTIN enriches over the coding
region of active genes (Rossetto et al., 2014). In agreement with this localization, it is found
to interact with elongating RNA polymerase II, H3K36me3 and proposed to assist the
disruption of nucleosomes, pol II progression and nucleosome refolding in its wake (Rossetto
et al., 2014).
1.2.3 Eaf2-Yaf9-Arp4-Act1 sub-module
NuA4 shares four subunits (Eaf2, Yaf9, Arp4 and Act1) with ATP-dependent chromatin
remodeler SWR-C, the main function of which is to incorporation histone variant H2A.Z. As
these two chromatin regulatory complexes also show strong genetic interactions and
functional cooperation (Altaf et al., 2010; Auger et al., 2008; Lu et al., 2009), it has been
12
proposed that the shared sub-module may play a critical role in facilitating the actions of
NuA4 and SWR-C on chromatin, such as in regulation of histone variant H2A.Z (Altaf et al.,
2009; Lu et al., 2009).
1.2.4 Other NuA4 subunits: Eaf1 and Tra1
NuA4 subunits Eaf1 and Tra1 also possess crucial functions. Eaf1 is the scaffold protein of
NuA4 and is essential for complex integrity (Figure 5). It is also the only subunit unique to
NuA4 (Auger et al., 2008), providing a valuable tool to study NuA4 without the involvement
of other chromatin complexes (e.g. INO80, SWR-C) or sub-complexes (e.g. Piccolo NuA4,
TINTIN). As NuA4 and SWR-C show genetic interactions and Eaf1 displays structural
similarities with human p400 ATPase, a subunit of NuA4 human homologous complex-
TIP60, it has been proposed that the human complex is actually a physical and functional
merge of NuA4 and SWR-C through scaffold proteins Eaf1 and Swr1 (Auger et al., 2008),
highlighting the complexity of chromatin regulation cross-talks that contribute to diverse
chromatin landscapes.
Tra1 is a large ATM-related protein that is shared by HAT complexes (Allard et al., 1999;
Grant et al., 1998). One of the functions of Tra1 is to recruit histone HAT complexes to gene
promoter regions by interacting with transcription activators (Allard et al., 1999; Brown et
al., 2001). Consistent with this, Tra1 human homolog TRRAP has been identified as an
essential cofactor for c-Myc- and E2F-mediated oncogenic transformation (McMahon et al.,
1998).
13
Figure 5 - Schematic representation of NuA4 structure organization and functions of submodules. Eaf1 acts as scaffold protein for complex assembly (Auger et al., 2008).
1.3 NuA4 function in gene regulation
It has been well documented that chromatin modifying complexes such as HATs can be
recruited to gene promoter regions by specific transcriptional factors and function as
transcription coactivators (Narlikar et al., 2002). NuA4 can be recruited by transcription
factors through its Tra1 subunit, and the activity of NuA4 has been implicated in
transcriptional regulation (e.g. ribosomal genes (Brown et al., 2001; Reid et al., 2000)).
Moreover, studies from our group demonstrated that the NuA4 complex is recruited to the
PHO5 gene promoter by the direct interaction with Pho2 DNA binding factor. This targeting
is part of a pre-setting mechanism of the PHO5 gene for rapid transcriptional activation in
response to phosphate starvation (Nourani et al., 2004). Additional studies also showed that
the crosstalk between NuA4 and ATP-dependent chromatin remodeling complex SWR-C
14
presets PHO5 promoters with enrichment of both H2A.Z and acetylated histones (Altaf et
al., 2010; Auger et al., 2008) (Figure 6).
Figure 6 - Model of NuA4 involvement in PHO5 transcription regulation. Modified from (Fuda et al., 2009). a) When phosphate (Pi) is sufficient, PHO5 gene is repressed. Transcription factor Pho2 recruits NuA4 to the upstream activating sequences (UAS). H4 acetylation and Htz1 variant preset nucleosomes prior to induction. b) Pi starvation induces translocation and recruitment of Pho4 and results in local chromatin hyperacetylation. c) Additional recruitment and contributions of chromatin remodelers assist the nucleosome eviction and gene activation.
Htz1
Htz1
Htz1
Htz1
15
1.4 NuA4 function in genome stability
Intriguing links have been made between NuA4 and genome stability. First of all, many
mutants of NuA4 subunits are sensitive to DNA-damaging agents, suggesting the
involvement of these subunits in DNA repair pathways (Table 2). In addition, NuA4 activity
near damage site is also important for DNA repair events. Local chromatin requires
modification/relaxation in order to allow DNA repair. NuA4 has been shown to be one of the
earliest factors that are recruited around DNA DSBs in vivo (Downs et al., 2004). A
functional model has been proposed for this recruitment in yeast. DNA damage activates
sensory kinases Mec1/Tel1 (ATR/ATM), which phosphorylate H2A at S129, generating
histone mark γH2A. NuA4 is recruited to DSB sites and through the interaction between
γH2A and Arp4, NuA4 is retained at the break sites and acetylates the chromatin around the
break (Altaf et al., 2009; Downs et al., 2004) (Figure 7). In agreement with this model, it has
been shown that the presence of NuA4 is directly required for non-homologous end joining
repair of DSBs, homologous recombination and replication-coupled repair (Bird et al., 2002;
Choy and Kron, 2002) (Robitaille et al, unpublished data).
Figure 7 - Model of NuA4 implication in DNA damage response. Modified from (Utley et al., 2005)
16
Table 2 - List of NuA4 Subunits
Molecular weight (kDa)
Name of the
Subunit
Deletion Phenotype
Mutant Sensitivity to
genotoxic stress
Homolog in Human
400 Tra1 lethal Yes TRRAP
125 Eaf1 slow growth Yes p400
105 Epl1 lethal Yes EPC1/2
59 Eaf2/Swc4 lethal Yes DMAP1
58 Arp4 lethal Yes BAF53
55 Esa1 lethal Yes Tip60/KAT5
49 Eaf7 viable No MRGBP
47 Eaf3 viable No MRG15/X
44 Act1 lethal N/A Actin
36/37 Yng2 slow growth Yes ING3
32 Eaf5 viable No /
32 Yaf9 viable Yes YEATS4
16 Eaf6 viable No MEAF6
1.5 Project Rationale
As described above, chromatin structure/modification modulates critical cellular activities
and the NuA4 histone acetyltransferase complex functions in multiple chromatin transactions.
Since first purified from yeast in 1999, additional data have highlighted key functions of this
large complex, yet detailed mechanisms remain to be delved. This thesis presents data on
two aspects of NuA4 functions: its role in gene activation, and its regulation during DNA
damage response.
1. The crosstalk between chromatin modifying complexes provides an additional level of
epigenetic regulation. It has been shown that NuA4 activity stimulates SWR-C exchange
activity in vitro (Altaf et al., 2010) and NuA4 affects H2A.Z deposition at PHO5 promoters
in vivo (Auger et al., 2008). Chapter 2 is the follow-up study through analyzing the genome-
wide effect of NuA4 on H2A.Z incorporation, and the effect of NuA4 on global transcription
regulation using a NuA4-specific mutant eaf1Δ.
17
2. The presence of NuA4 at DSB sites has been shown, yet a series of subsequent questions
remain unanswered, for example, does NuA4 affects the choice of repair pathways? Is NuA4
activity/substrate specificity regulated at the DNA breaks? Is NuA4 physically/functionally
cooperate with other proteins during DNA repair? Chapter 3 presents an attempt to shed light
on these questions through the analysis of posttranslational modifications on NuA4.
Using Saccharomyces cerevisiae as model system, several biochemical and genetic/genomic
techniques were adopted (such as ChIP, Tandem-Affinity-Purification (TAP), Histone
acetyltransferase (HAT) assay, synthetic genetic assay (SGA)) in order to improve our
understanding of NuA4 function in different cellular processes.
19
Chapter 2
Eaf1 links the NuA4 histone acetyltransferase complex to Htz1 incorporation
and regulation of purine biosynthesis
Xue Cheng*1, Andréanne Auger*1, Mohammed Altaf1, Simon Drouin2, Rhea T. Utley1,
François Robert2 and Jacques Côté #1
1 St-Patrick Research Group in Basic Oncology, Laval University Cancer Research Center,
Centre de Recherche du CHU de Québec-Axe Oncologie, Hôtel-Dieu de Québec, Quebec
City, Quebec G1R 2J6, Canada.
2 Chromatin and Genomic Expression research unit, Institut de recherches cliniques de
Montréal (IRCM), Montréal, Québec H2W 1R7, Canada.
* These authors contributed equally to this work.
# Corresponding author: (418) 525-4444 ext. 15545; [email protected]
Running title: NuA4 regulates Htz1 incorporation and purine biosynthesis
Key words: NuA4; Eaf1; H2A.Z; Htz1; purine biosynthesis; ADE; acetylation;
transcription.
20
2.1 Foreword
This manuscript will be submitted to the journal “Eukaryotic Cell”. I performed the ChIP and
qPCR experiment regarding to Figure 11 and 12, and the qPCR experiment in Figure 13.
Andréanne Auger performed experiment in Figure 8 and 9. Rhea T. Utley performed
experiment in Figure 10. Mohammed Altaf performed ChIP in Figure 13. Simon Drouin and
François Robert performed ChIP-on-chip labeling, hybridization, and reading. We thank Eric
Paquet for bioinformatics analysis. I wrote the manuscript.
2.2 Résumé
L'architecture de la chromatine aux promoteurs des gènes est cruciale pour leur régulation
afin d'orchestrer efficacement et avec précision les différentes fonctions cellulaires. Des
études précédentes ont identifié l'effet stimulateur du complexe acétyl-transferase d’histone
NuA4 sur l'incorporation du variant d'histone H2A.Z (Htz1) au promoteur de PHO5. Des
expériences in vitro indiquent également une interrelation intrigante entre NuA4 et le
complexe d’incorporation de H2A.Z, SWR-C. Au cours de ce travail, nous avons étudié le
rôle d’Eaf1, sous-unité d'échafaudage de NuA4, dans l'expression globale des gènes et
l'incorporation de Htz1 à l’échelle du génome entier. Nous avons constaté que la perte d’Eaf1
affecte les niveaux de Htz1 principalement aux promoteurs qui sont normalement hautement
enrichis en ce variant d'histone. L'analyse du profile d’expression des cellules mutantes pour
Eaf1 a dévoilé que la suppression d’Eaf1 paralyse l'induction de plusieurs gènes d’ADE,
suggérant une relation entre NuA4 et les gènes impliqués dans la voie de biosynthèse de la
purine. De plus, NuA4 interagit directement avec le domaine d'activation de Bas1, un facteur
de transcription clé des gènes de la voie de synthèse de l’adénine. Finalement des expériences
d'immunoprécipitation de la chromatine (ChIP) démontrent que les nucléosomes sur le
promoteur inactif d’ADE17 sont déjà acétylés par NuA4 et enrichis en Htz1. Lors de
l'induction d’ADE17, ces nucléosomes préparés pour l’activation induisent rapidement
l'expression de ce gène, dans un mécanisme similaire à celui de PHO5 et conduisant au
désassemblage des nucléosomes. Ces différents événements moléculaires représentent un cas
particulier de l’interrelation entre l’acétylation dépendante de NuA4 et l'incorporation du
variant d'histone Htz1, préparant la structure de la chromatine sur les promoteurs ADE pour
son remodelage et l’activation de la transcription subséquente.
21
2.3 Abstract
Proper modulation of promoter chromatin architecture is crucial for gene regulation in order
to precisely and efficiently orchestrate various cellular activities. Previous studies have
identified the stimulatory effect of the histone modifying complex NuA4 on the incorporation
of the histone variant H2A.Z (Htz1) at the PHO5 promoter. In vitro studies with a
reconstituted system also indicated an intriguing crosstalk between NuA4 and the H2A.Z-
loading complex, SWR-C. In this work, we investigated the role of NuA4 scaffold subunit
Eaf1 in global gene expression and genome-wide Htz1 incorporation. We found that loss of
Eaf1 affects Htz1 levels mostly at the promoters that are normally highly enriched in the
histone variant. Analysis of eaf1 mutant cells by expression array unveiled a relationship
between NuA4 and the gene network implicated in the purine biosynthesis pathway, as EAF1
deletion cripples induction of several ADE genes. NuA4 directly interacts with Bas1
activation domain, a key transcription factor of adenine genes. Chromatin
immunoprecipitation (ChIP) experiments demonstrate that nucleosomes on the inactive
ADE17 promoter are already acetylated by NuA4 and enriched in Htz1. Upon induction,
these poised nucleosomes respond rapidly in inducing conditions to activate adenine gene
expression, in a mechanism likely reminiscent of the PHO5 promoter, leading to nucleosome
disassembly. These detailed molecular events depict a specific case of crosstalk between
NuA4-dependent acetylation and incorporation of histone variant Htz1, presetting chromatin
structure over ADE promoters for subsequent chromatin remodeling and activated
transcription.
22
2.4 Introduction
Transcriptional activation is frequently accompanied by local remodeling of chromatin
structure over promoter regions. Three major mechanisms have been implicated in this
process, namely histone posttranslational modifications, ATP-dependent chromatin
remodeling and incorporation of histone variants (see review (Li et al., 2007) and references
therein). These mechanisms facilitate transcription by either sliding promoter nucleosomes
or assisting nucleosome loss, resulting in an increased accessibility of DNA to transcription
activators. Collaboration between multi-subunit complexes responsible for these activities
leads to a precise and specific control over gene expression. Studies from recent years suggest
that different sets of genes, constitutive and inducible genes for example, adopt rather distinct
strategies in utilizing these mechanisms to modulate promoter architecture (Cairns, 2009;
Tirosh and Barkai, 2008).
Recent work has shown the tight yet complex functional link between two yeast chromatin
modifying complexes, histone acetyltransferase complex NuA4 and chromatin remodeling
complex SWR-C, converging at the understanding of histone variant H2A.Z. SWR-C is a
14-subunit complex responsible for histone variant H2A.Z incorporation (Kobor et al., 2004;
Krogan et al., 2003; Mizuguchi et al., 2004). It shares 4 subunits with NuA4 (Altaf et al.,
2010; Galarneau et al., 2000; Kobor et al., 2004; Krogan et al., 2003; Le Masson et al., 2003;
Zhang et al., 2004), the main function of which is to acetylate histone H2A and H4 (Allard
et al., 1999; Utley et al., 1998). These acetylation events are important for SWR-C
recruitment and activity on chromatin, likely through its bromodomain containing subunit
Bdf1 (Altaf et al., 2010; Durant and Pugh, 2007). One of the shared subunit, Yaf9, is
implicated in helping antagonize silencing near telomeres (Zhang et al., 2004; Zhou et al.,
2010). Moreover, NuA4 is also found to acetylate H2A.Z both in vitro and in vivo (Auger et
al., 2008; Keogh et al., 2006; Millar et al., 2006). The acetylated H2A.Z is implicated in
regulation of Htz1 dynamics at promoters (Millar et al., 2006) and Htz1 function in proper
heterochromatin maintenance (Babiarz et al., 2006). Consistent with the intimate relationship
between SWR-C and NuA4, it was proposed that human TIP60 complex is a physical and
functional merge of the two complexes (Altaf et al., 2009; Auger et al., 2008; Doyon et al.,
23
2004), resulting in a single multifunctional complex that comprises all aforementioned
mechanisms of chromatin regulation.
The functional crosstalk between histone modifications by NuA4 and histone variant
incorporation by SWR-C has been carefully analyzed at PHO5. In Saccharomyces cerevisiae,
the PHO system modulates phosphate metabolism and allows cells to adapt to inorganic
phosphate environment. When phosphate is present, the PHO5 gene is maintained in a
transcriptionally repressed state by a particular chromatin structure on promoter region.
Upon gene activation in phosphate starvation conditions, the promoter nucleosome structure
undergoes a remodeling process, generating nuclease hypersensitive regions (Almer and
Horz, 1986; Almer et al., 1986). The hypersensitivity to nucleases is caused by loss of
histone-DNA contacts, leading to the removal of local nucleosomes (Boeger et al., 2003;
Brown et al., 2011; Reinke and Horz, 2003). Studies have shown that NuA4 is required in
this opening of chromatin structure through its histone acetylation activity and effect on Htz1
incorporation, presetting the promoters for proper gene induction (Auger et al., 2008; Li et
al., 2007; Nourani et al., 2004).
Although the interplay between NuA4 activity and Htz1 incorporation has been reported both
in vitro and at certain genes in vivo, the global-scale of NuA4 effect on Htz1 incorporation
remains poorly studied. To this end, in this study we investigated the effect of NuA4 on
global Htz1 variant incorporation in yeast. We show that eaf1 deletion mutant affects
genome-wide Htz1 incorporation over several hundred of promoters. Moreover, we found
that eaf1Δ also decreases the expression level of genes implicated in purine biosynthesis
pathway. Eaf1 directly interacts with ADE gene transcription factor Bas1 and Pho2, and
EAF1 deletion cripples ADE gene activation. We demonstrate that inactive adenine
promoters are enriched in Htz1 and acetylated H4 in a NuA4-dependent manner. Induction
of adenine genes results in efficient nucleosome loss, whereas the levels of Htz1 and H4
acetylation enrichment remain unchanged, suggesting a presetting mechanism for inducible
adenine gene transcription. Finally, we show that NuA4 also acetylates Htz1 at ADE
promoter, which is likely to favor nucleosome disassembly. These detailed molecular events
indicate that adenine promoters, similar to PHO5, are preset by NuA4-dependent events for
subsequent chromatin remodeling and induced transcription, highlighting the crosstalk
24
between histone modifications and histone variant incorporation in the process of
transcription modulation.
2.5 Materials and methods
2.5.1 Yeast strains and reagents.
All strains used in this study are based on S288C BY4741 background and listed in Table 1.
Wild type, htz1 deletion mutant strain was purchased from Open Biosystems. All yeast
manipulations were performed according to standard protocols unless specifically indicated.
Table 3 - Strains Used In This Study.
Strain Genotype Reference BY4741 MATa his3∆1 leu2∆0 met15∆0 ura3∆0 (Brachmann et al., 1998)
htz1∆ (1703) MATa his3∆1 leu2∆0 met15∆0 ura3∆0 htz1∆::KanMX4 Open biosystems
QY1158 MATa his3∆1 leu2∆0 met15∆0 ura3∆0 eaf1∆::KanMX4 This study
2.5.2 ChIP-on-chip.
Chromatin immunoprecipitation and genome-wide location analysis with microarrays
carrying 2–4 probes for each gene were performed as described previously (Guillemette et
al., 2005; Rossetto et al., 2014; Utley et al., 2005). Htz1 enrichment level was normalized on
H3 level for nucleosome occupancy. Genes defined as “High-Htz1-occupancy” were isolated
with a cut-off of 3 and then related to transcription frequencies using the data of (Holstege et
al., 1998).
2.5.3 Northern Blot and Microarray analysis.
Yeast cells were grown overnight in YPD, diluted to OD600 0.25 in SC+adenine or SC-
adenine media and grown to OD600 around 1.0. Cells were then washed and RNA was
isolated using the hot phenol method as described (Schmitt et al., 1990). An amount of 15 to
20 µg of RNA was analyzed by Northern blotting as described (Galarneau et al., 2000). The
used probes were ORFs from ADE1, ADE2, ADE5,7, ADE13 and ACT1 obtained by PCR
and radiolabelled by random primer (Amersham Biosciences). For microarray analysis, total
RNA was isolated using the Qiaquick RNeasy Miniprep kit (Qiagen) and mRNA was isolated
25
using PolyA tail (Promega) and analysed by Deming Xu at the Best Yeast Microarray Center
in Toronto.
2.5.4 GST-pull-down, and HAT assay.
Specific regions of Bas1 and Pho2 proteins were fused to GST (pGEX-4T3) (Fig. 10a) and
purified from Escherichia coli on glutathione sepharose following standard procedures.
Protein concentrations were normalized by coomassie staining on gels (Fig. 10b) and
equivalent amounts were used in GST pull-down assays with purified NuA4 followed by
nucleosomal HAT reactions essentially as described (Utley et al., 1998).
2.5.5 Chromatin ImmunoPrecipitation (ChIP).
ChIP experiment was performed essentially as described previously (Auger et al., 2008;
Nourani et al., 2004; Utley et al., 2005). Briefly, overnight cultures were diluted and grown
to OD600 0.5-0.8 in 200ml media. Cell cultures were cross-linked with 1% formaldehyde
for 20 min at room temperature. Crosslinking was quenched by the addition of glycine to a
final concentration of 125 mM for 5 min. Cells were centrifuged 5 min 5000 g at 4°C, washed
twice with ice cold water, once with 1 ml of TBS and resuspended in 0.5 ml of FY lysis
buffer (HEPEs 50 mM pH 7.5, NaCl 140 mM, Triton X-100 1%, EDTA 1 mM, Na
deoxycholate 0.1%, 1mM PMSF). Cell lysis was carried out using mini-BeadsBeater until
around 70% of the cells were lysed. Cells were then centrifuged and pellet was washed with
1 ml FA lysis buffer until the supernatant was clear. Pellet was resuspended in 1 ml of the
FY lysis buffer for sonication. Sonication was carried-out using the Bioruptor apparatus from
Diagenode (30 sec sonication followed by 60 sec rest, repeated 10- 12 times), which was
then centrifuged for 30 min at 4°C 20 000 g. The supernatant containing the chromatin was
placed in a new tube. For ADE induction, cells were grown in SCSM-Ade media
supplemented with adenine to OD600 0.5-1.0. For induction, cells were centrifuged, washed
in water and resuspended in SCSM-Ade media supplemented with adenine for time 0 or
resuspended in SCSM-Ade and allowed growing for the induction time period before cross-
linking.
Sonication of chromatin led to DNA fragments range between ~200-500 bp.
Immunoprecipitation was carried out using 100 µg chromatin supplemented with FA lysis
26
buffer to a final volume of 450 ul. 22.5ul of the mix was taken as input. Corresponding
antibodies were then added: 0.5 µl of anti-Htz1 (Upstate 07-718), 0.5 µl anti-hyperH4ac
(Upstate Penta), 0.5 µl anti-H3 C-terminus (Abcam Ab1791), 2ul anti-Pol II (8WG16) and
anti-AcHtz1K14 (kindly provided by Michael Grunstein). After an overnight incubation at
4°C on a wheel, 12.5 µl of protein A sepharose (GE Healthcare) was added and incubation
was continued for 4 h at 4°C on wheel. The beads were washed twice with 1 ml FA lysis
buffer, once with FA lysis buffer 500 mM NaCl, once with 1 ml Wash Buffer #2 (Tris/HCl
10 mM pH 8.0, LiCl 250 mM, NP-40 0.5%, sodium deoxycholate 0.5%, EDTA 1mM) and
once with TE. Beads were eluted with 100 µl T50E10 1% SDS for 15 min at 65°C. The eluted
material was placed in a new tube and beads were eluted once more with 150 µl TE 1% SDS.
The second elution was pooled with the first one. DNA was de-crosslinked overnight at
65°C. After de-cross-linking, 240 µl of TE and 5ug of RNase were added and incubated at
37°C for 15-minute, after which 15 mg of proteinase K and 200 µg of glycogen were added
and tubes were placed at 37°C for 2 hours. 25 µl of NaCl 5M was added before the extraction
with phenol chloroform and precipitation with ethanol. After centrifuging at 20 000 g, 4°C
for 30 min, pellets were air dried and resuspended in 100 µl NTE. PCR primers used were
analyzed for linearity range, efficiency, specificity, melting curves and products using a
LightCycler (Roche). Primer sequences are listed in Table 4.
Table 4 - Primers used in ChIP-qPCR
Gene/Primer Direction Sequence ADE17 -237bp /forward ATCATTTATAAAGAAGATCCTACCC ADE17 -122bp /reverse ATAGATCCGAACGTGATATG ADE17 +717bp/ forward TTTGTTGGATGCTCTAAATTCC ADE17 +843bp/ reverse ATCAGACAATGGGATACCCA
ADE17 +1485bp /forward CGGCCAAATTCCAACAGAAG ADE17 +1614bp/ reverse CGATGACAAAGAAACGTTGG
27
2.6 Results
2.6.1 Loss of Eaf1 affects genome-wide Htz1-enrichment
Previous studies have shown that NuA4 stimulates SWR1-dependent Htz1 incorporation and
depletion of NuA4 activity decreases Htz1 occupancy at PHO5 promoter regions (Altaf et
al., 2010; Auger et al., 2008; Nourani et al., 2004), suggesting a tight crosstalk between the
two chromatin modifying complexes. Nevertheless, as these studies have been limited to the
observations at specific loci, to what extent this crosstalk would take place globally remains
unknown. In order to further address the question of how NuA4 affects Htz1 global
incorporation, we performed chromatin immunoprecipitation assay (ChIP) of Htz1 and
histone H3 in both wild-type (WT) and eaf1Δ strains and hybridized the recovered DNA to
microarrays with 2-4 probes for each gene (ChIP-on-chip). Deletion of NuA4 subunit Eaf1
was chosen since it is the scaffold platform for NuA4 complex assembly and also the only
subunit unique to NuA4 (Auger et al., 2008; Mitchell et al., 2008). Htz1 occupancy was
measured by relative Htz1 enrichment compared to corresponding H3 signal.
In the WT strain, Htz1 is preferentially enriched at repressed/basal promoter regions
compared to gene bodies (data not shown) and do not correlate with level of transcription,
consistent with the previous reports (Li et al., 2005; Zhang et al., 2005). While Htz1 presence
does not require NuA4, this enrichment level is significantly decreased in eaf1Δ strain for a
large number of genes, in agreement with what has been observed at PHO5 promoter.
Notably, promoters which harbor a high-occupancy of Htz1 (Htz1/H3>3; p<0.05; n=429) are
most profoundly affected by EAF1 deletion (Fig.8; gene list is available upon request). These
results expand the reported observation and identify NuA4 as a crucial factor in Htz1 level
maintenance at the most enriched promoters.
28
Figure 8 - NuA4 affects Htz1 incorporation independently of transcription rate. Scatter plot of loci identified as high Htz1 occupancy loci (Ratio Htz1/H3≥ 3) by transcription rate (log2 (Transcription rate mRNA/hour)) in WT (left) and eaf1Δ strain (right). Red line shows the mean value and the black line represents the cut-off. Transcription frequencies in (Holstege et al., 1998) was used in the analysis with transcription rate.
2.6.2 NuA4 is implicated in regulation of gene network for purine biosynthesis
Both NuA4 activity and Htz1 incorporation are implicated in transcription regulation. NuA4
has been shown to acetylate promoter nucleosomes, an event considered to assist nucleosome
loss to favor transcription activation (Nourani et al., 2001; Nourani et al., 2004; Reid et al.,
2000; Utley et al., 1998). Htz1 is enriched in basal/repressed gene promoters, and involved
in activation of certain genes (Li et al., 2005; Zhang et al., 2005). As eaf1Δ mutant decreases
Htz1 occupancy of a subset of genes, whether the transcription level of these genes are also
29
disturbed by EAF1 deletion remains to be answered. To this end, we examined the expression
profile in both WT and eaf1Δ strains by microarray. The genes with the most affected Htz1
level (Figure 8) are not significantly overlapped with those most decreased expression levels
(Table 5). As expected, RP gene and PHO gene expression are affected by Eaf1/NuA4, as
reported previously (Boudreault et al., 2003; Galarneau et al., 2000; Nourani et al., 2004;
Reid et al., 2000). Surprisingly, we also found a series of genes implicated in purine
biosynthesis pathways among these most affected by EAF1 deletion (Table 5), suggesting a
role of NuA4 in regulation of purine biosynthesis.
Table 5 - Yeast Genes Down-regulated in eaf1Δ Cells Grown in Rich Media
eaf1Δ /WT Gene
0.274 RPL15B ribosomal protein0.33 ADE13 Bas1/Pho2-regulated, purine biosynthesis0.362 ADE1 Bas1/Pho2-regulated, purine biosynthesis0.391 PHO12 Pho2-regulated0.393 SHM2 purine biosynthesis, Bas1/Pho2-regulated0.423 ADE5,7 Bas1/Pho2-regulated, purine biosynthesis0.437 MTD1 purine biosynthesis, Bas1/Pho2-regulated0.444 BAT20.452 ADE2 Bas1/Pho2-regulated, purine biosynthesis0.474 GCV2 Bas1 site, purine pathway0.479 SER1(ADE9) Bas1 site, purine biosynthesis0.485 YHB10.494 PHO11 Pho2-regulated0.51 GCV1 Bas1 site, purine pathway0.519 ADE17 Bas1/Pho2-regulated, purine biosynthesis0.52 LEU10.526 YLR345w0.53 LAP40.535 BNA10.545 DDR480.547 ADE3 Bas1/Pho2-regulated, purine biosynthesis0.553 YKL100C0.556 ECM90.556 ADE12 Bas1/Pho2-regulated, purine biosynthesis0.556 YOR239w0.569 SDS3 HDAC subunit0.576 YML005w0.576 PHO5 Pho2-regulated
Microarray analys is performed on RNA isolated from eaf1 Δ cel l s compared to RNA isolated from wi ld type
(WT) cel l s . Here l i s ts the 28 genes that are the most affected by the absence of EAF1 (from 0.274 for RPL15B
to 0.576 for PHO5 , 1.0 represents wi ld type express ion level ). eaf1 Δ cel l s show a marked decrease in the
express ion of 12 genes involved in purine biosynthes is (Bald) including 7 ADE genes . PHO5 express ion
level i s a lso affected by EAF1 deletion.
Annotation
30
2.6.3 Loss of Eaf1 cripples induction of a number of ADE genes
In adenine sufficient environment, the transcription of ADE genes are basal/repressed. The
deprivation of available adenine will trigger a series of ADE gene expression in order to adapt
to the environment (Daignan-Fornier and Fink, 1992; Gedvilaite and Sasnauskas, 1994; Som
et al., 2005). To investigate further the role of Eaf1/NuA4 in ADE gene activation and purine
biosynthesis, activation of ADE genes was analysed by Northern blot. RNAs were extracted
from both WT and eaf1Δ strains and several ADE gene expression level were examined using
specific probes. In the WT strain, when adenine is present in the media, the ADE genes show
basal level of transcription (Fig. 9, left lanes), which may be due to the gradual depletion of
adenine in the media, loss of chromatin architecture or transcription noise (see discussion).
ADE starvation condition induces the ADE expression in WT cells, yet this effect is lost in
the eaf1Δ strain (Fig. 9, right lanes). Results from microarray and Northern blot analysis
demonstrate that activation of ADE expression is dependent on Eaf1/NuA4.
Figure 9 - NuA4 is important for ADE gene induction. Northern blot analysis performed with RNA isolated from wild type (WT) and eaf1Δ cells grown in the presence or absence of adenine. ADE1, ADE2, ADE5,7, ADE13 gene expression was compared to the expression level of ACT1 control.
31
2.6.4 NuA4 interacts with Pho2 and Bas1 in vitro
Two transcription factors Pho2 and Bas1 have been shown to regulate adenine gene induction
(Koehler et al., 2007; Rolfes et al., 1997; Som et al., 2005). Previous studies have shown that
Bas1 is constantly present at ADE promoters in an inactivated state. Upon induction, Bas1
undergoes a conformation change and recruits Pho2 (Som et al., 2005). Interestingly,
previous works also show that Pho2 directly interacts with NuA4 in vitro and in vivo, a step
considered crucial to preset the promoter of PHO5 gene for induction (Nourani et al., 2004).
Collectively, these bring us to the question whether NuA4 is recruited by Pho2 and/or Bas1
in the case of ADE gene regulation. To address this question, GST fusion proteins were
constructed (Fig. 10a) and purified (Fig. 10b). Equal amount of GST-fusion proteins (Fig.
10b) were used to perform pull down assay with purified NuA4 complex, where both flow-
through and beads are subject to HAT assay. NuA4 shows direct interaction with N-terminal
homeodomain of Pho2 as reported (Nourani et al., 2004), and interestingly, it also interacts
with Bas1 activation domain, with an even stronger affinity (Fig. 10c). These results indicate
that NuA4 could regulate ADE gene expression through direct recruitment by promoter-
bound transcription factors Pho2 and Bas1.
32
Figure 10 - Bas1 and Pho2 directly interact with NuA4 complex in vitro. A) Schematic representation of the GST fusion proteins used in this study. B) Indicated fusion proteins were run in 12% SDS–PAGE and coomassie stained. C) Equal amount of input, flow-though, and beads from GST-pull-down with purified NuA4 complex were assayed for histone acetyltransferase (HAT) with chromatin. HAT reactions were visualized on 18% SDS-PAGE. Pho2N serves as a positive control (Nourani et al., 2004).
33
2.6.5 Enrichment of Htz1 and acetylated H4 at inactive ADE promoters is dependent
on NuA4
The histone acetyltransferase activity provided by NuA4 is required for the presetting of
inducible PHO5 promoter during the transition from a transcriptionally inactive to an active
state in absence of phosphate (Nourani et al., 2004). Having identified the aforementioned
importance of Eaf1 subunit in regulation of ADE gene expression, we set out to investigate
the chromatin dynamics over the promoters of ADE genes, and the implication of NuA4
during this process. Using chromatin immunoprecipitation (ChIP), we first look at H4
acetylation level (a major activity of NuA4), Htz1 incorporation level at ADE17 promoter
region under repression and the effect of Eaf1 therein. ADE17 locus was chosen since its
expression is affected by EAF1 deletion in microarray and it was also shown that Htz1 is
enriched at its transcription start site (TSS) (Mizuguchi et al., 2004). Both wild-type and
eaf1Δ strains are grown in synthetic complete media, in which the adenine supplement is
sufficient. Under this repressed condition, ADE17 promoter region shows enriched H4
acetylation and Htz1 compared to control locus, and this enrichment is significantly
decreased in eaf1Δ strain (Fig. 11 a-b). These results suggest the involvement of NuA4 in
chromatin structure at basal ADE promoters.
34
Figure 11 - The presence of H4 acetylation and Htz1 at repressed ADE17 promoter is NuA4-dependent. H4ac enrichment A) and Htz1 enrichment B) at ADE17 promoter region (-237bp to -122bp) in WT and eaf1Δ is measured by chromatin immunoprecipitation (ChIP). htz1Δ serves as negative control for Htz1 IP. Potential nucleosome occupancy variation was corrected by H3 signal at the same locus. Standard deviation is shown based on two biological repeats.
2.6.6 Loss of nucleosomes upon ADE gene induction
Since uninduced ADE17 promoter shows an enrichment in both H4 acetylation and Htz1, we
wonder whether this enrichment merely represents a basal chromatin status (in this case, the
enrichment of H4 acetylation and Htz1 could be expected to increase during induction), or
35
stands for a preset mechanism to poise promoters for subsequent induction (in this case, both
levels would be expected decrease along with nucleosome loss). In order to test this, we
performed ChIP time course experiment by exposing cells to adenine starvation condition
for 0 (no starvation), 5 or 20 minutes. RNA polymerase II ChIP across the ADE17 gene
suggests short transient pol II recruitment/enrichment with an expression peak around time-
point 5-min (Fig. 12a; see discussion). This expression correlates with the rapid loss of
nucleosomes measured by the decrease of H3 signal (Fig. 12b). After confirming an efficient
induction, we then examined the H4 acetylation level and Htz1 dynamics during gene
induction. Both H4 acetylation and Htz1 levels decrease significantly within 5 minutes (Fig.
12c, e), consistent with the observed disassembly of nucleosomes (Fig. 12b), while both
levels stay unchanged on the remaining nucleosomes after correction for nucleosome signals
(Fig. 12d, f). These results suggest a mechanism that ADE17 promoter is preset by H4
acetylation and Htz1, resulting in susceptible nucleosomes to favor rapid induction.
As shown previously, eaf1Δ affects both H4 acetylation and Htz1 level at silenced ADE17
promoters (Fig. 11). If this chromatin state at ADE17 promoter indeed represents a preset
mechanism, one could expect eaf1 mutant would disrupt this poised status and alter
nucleosome stability. Indeed, eaf1 mutant shows a higher nucleosome occupancy at ADE17
promoter in repressed condition (Fig. 12g).
36
Figure 12 - Loss of both H4 acetylation and Htz1 variant rapidly upon induction at ADE17 promoter along with nucleosome disassembly. A) ADE17 expression is induced upon adenine depletion. Pol II ChIP at ADE17 promoter (-237bp to -122bp), middle (+717bp to +843bp), and 3’ (+1485 to +1614bp) of the gene. Data are presented as ratio of IP at specific ADE locus to control locus Inter V. B) Loss of nucleosomes around ADE17 promoter region upon adenine induction. Data represent ratio of H3 IP at ADE17 promoter relative to control locus Inter V. C-F) Loss of H4 acetylation and Htz1 variant along with nucleosomes upon induction. Anti-hyperacetylated H4 (H4ac)
A
C
B
D
E F
G
0.0
0.5
1.0
1.5
2.0
2.5
3.0
H3 IP
/inpu
t%
ADE17 promoter
WT ∆eaf1
0
1
2
3
4
5
6
Htz1
/H3
IP%
ratio
ADE17 promoter/control locus
t=0 t=5 t=20induction time (min(s))
0.0
0.5
1.0
1.5
2.0
2.5
3.0
3.5
Htz
1 IP
ratio
ADE17 promoter/control locus
t=0 t=5 t=20induction time (min(s))
0.0
0.1
0.2
0.3
0.4
0.5
0.6
0.7
0.8
H3 IP
/inpu
t%
ADE17 promoter/control locus
t=0 t=5 t=20induction time (min(s))
0.0
0.2
0.4
0.6
0.8
1.0
1.2
1.4
H4ac
IP ra
tio
ADE17 promoter/control locus
t=0 t=5 t=20induction time (min(s))
0.0
0.2
0.4
0.6
0.8
1.0
1.2
1.4
1.6
1.8
2.0
H4ac
/H3
IP%
ratio
ADE17 promoter/control locus
t=0 t=5 t=20induction time (min(s))
t=0 t=5 t=200
1
2
3
4
5
6
7
8
Pol I
I IP%
/con
trollo
cus
ADE17 prom.ADE17 +700bpADE17 +1.5kb
induction time (min(s))
37
IP and anti-Htz1 (C-term) IP are corrected with FMP27 (+5kb) control locus. Further correction on H3 occupancy at the same locus (D, F) indicates the shown H4ac or Htz1 decrease is due to nucleosome loss. G) EAF1 deletion results in higher nucleosome occupancy before induction. For Fig. A-D and G, standard error is present based on three biological repeats. For E-F, standard deviation is shown based on two biological repeats.
2.6.7 Htz1 K14 acetylation at ADE gene promoter is dependent on NuA4
Once deposited, the N-terminus of Htz1 can be acetylated by NuA4, an event considered to
be involved in nucleosome dynamics/removal over promoters (Keogh et al., 2006; Millar et
al., 2006). Studies have shown that Htz1 on PHO5 promoter is acetylated at K14 by NuA4
to favor nucleosome loss. While Htz1 does not correlate with transcription, Htz1K14
acetylation leads to transcription activation (Auger et al., 2008; Millar et al., 2006). Using
ChIP and antibody specifically recognizes acetylated Htz1 on lysine 14, we found that Htz1
is acetylated at ADE17 promoter, and this acetylation is decreased in eaf1Δ strain (Fig. 13).
Altogether, these results further emphasize the role of Eaf1/NuA4 in presetting ADE
promoters, favoring efficient nucleosome loss during induction through constructing a
specific promoter architecture poised for activation.
Figure 13 - Htz1 is acetylated at K14 by NuA4 at ADE17 promoter. ChIP analysis was performed with anti-AcK14 Htz1 and anti-Htz1 in WT and eaf1Δ strains. Data represent the ratio of AcHtz1 on total Htz1 occupancy and are presented as a relative change compared with wild type strain (set to 1). Error bars represent standard deviation based on two biological repeats.
38
Figure 14 - Model of step-wise ADE promoter architecture for gene activation. When Adenine is present in the media, Bas1 recruits NuA4 over ADE promoters. This recruitment leads to H4 acetylation and also stimulates Htz1 incorporation. Adenine starvation triggers the conformation changes of Bas1, which recruits Pho2. Subsequent recruitment of other transcription factors assists nucleosome eviction and ADE gene activation.
2.7 Discussion
In this work, we have provided the missing information about the NuA4 effect on Htz1
incorporation on a genome-wide scale. We found clear genome-wide alterations of Htz1
occupancy over promoters in a strain depleted in Eaf1, the only subunit unique to NuA4. This
effect is most prominent at a subset of promoters with high-Htz1-occupancy (Fig.8). These
39
genes (n= 429) are also featured by their low-transcription rate (Fig. 8; data not shown), in
agreement with previously published studies (Li et al., 2005; Zhang et al., 2005). Notably, as
the enrichment of Htz1 does not correlate with transcription rate, the disruption of Htz1 level
by eaf1Δ does not necessarily affect their transcription, as the 429 genes in Figure 8 show
little overlapping with the genes showing most significant changes in eaf1Δ expression array
(Fig.9). This, along with our results about presetting ADE promoters (Fig. 11-13), is
consistent with the notion that Htz1-occupancy status itself does not necessarily affect
transcription per se, but rather represent a ‘promoter marker’ for more susceptible
nucleosomes to facilitate rapid activation (Li et al., 2005; Santisteban et al., 2000; Zhang et
al., 2005).
We observed that ADE promoter regions are preset by NuA4-dependent H4 acetylation
before induction (Fig. 11b, Fig. 12c-d). However, we were not able to visualize a direct
recruitment of NuA4 at these promoter regions by ChIP (data not shown). This could be due
to a limited NuA4 enrichment that renders the signal below antibody detection threshold, or
alternatively, could also be explained by a transient recruitment of NuA4 activity over these
regions, after which the physical association of the complex becomes dispensable. In fact,
the latter possibility is favored by studies involving chromatin remodeling complexes SAGA
and SWI/SNF in the regulation of ADE gene induction (Koehler et al., 2007). Koehler et al.
have shown an association of SAGA and SWI/SNF with ADE promoter yet this association
is independent of ADE transcription factors, Bas1 and Pho2. Converging our observation and
the fact that both SAGA and SWI/SNF harbor a bromodomain (Syntichaki et al., 2000), one
could speculate a model that, in ADE repression condition, Bas1/Pho2 directly but transiently
recruit NuA4 to acetylated H4, an event that would further stimulate the subsequent binding
and stabilization of SAGA and/or SWI/SNF complexes for an optimal derepression prior to
and/or during induction, although NuA4-dependent acetylation may not be sufficient or
necessary for the bindings.
It has been long established that the presence of nucleosomes represses transcription and
nucleosome loss is often correlated with gene expression level (Han and Grunstein, 1988;
Lee et al., 2004). In this study, we present a case in which promoter nucleosomes are poised
in a state that is necessary but not sufficient for transcription activation. This ‘poise’
40
mechanism is highly dependent on NuA4, specifying a role of NuA4 in assisting nucleosome
disruption of occupied promoters. In fact, this facet of NuA4 is not specific to ADE or PHO5
gene promoters, as deletion of EAF1 leads to nucleosome stabilization across both intergenic
regions and gene bodies (unpublished data). Interestingly, human p400 shows structural
homology with yeast Eaf1 and Swr1, and it has been proposed that human p400 is actually a
fusion of the two yeast proteins during evolution (Auger et al., 2008). p400 was found to be
crucial for nucleosome destabilization during DNA repair (Xu et al., 2010), and whether this
function is conserved in yeast and how and to what extent Eaf1/NuA4 and Swr1/SWR-C
contribute to this process respectively remain to be answered.
During our adenine induction experiment, we noted that Pol II passage decreased at 20-
minute time point (Fig. 12a). This may be explained by the bivalent nature of poised inactive
promoters, which allows for a burst of transcription, yet requires a subsequent repression for
extensive chromatin remodeler binding, full transcription factor recruitment and/or more
robust induction of gene expression (Cairns, 2009). In fact, as more promoter chromatin
changes are experienced by repressed promoters between basal and active states relative to
constitutively expressed genes, this feature of repressed/inducible promoters could lead to
higher transcription noise (referred as the variability of gene expression in a cell population
under the same growth condition), as observed in both genome-wide studies (Tirosh and
Barkai, 2008) and individual assess of PHO5 (Raser and O'Shea, 2004) and ADE genes (Fig.
9).
An intriguing question in chromatin field is how SWR-C obtains specificity for certain loci.
Accumulative evidence evolved into a model that transcriptional factors first recruit NuA4
to gene regulatory regions. NuA4 then acetylates histone H4, which further docks SWR-C
through its Bdf1 subunit for H2A.Z incorporation. Newly deposited H2A.Z is subsequently
acetylated by NuA4, preparing the promoter for nucleosomes disruption (Altaf et al., 2009;
Altaf et al., 2010; Auger et al., 2008; Babiarz et al., 2006; Durant and Pugh, 2007; Keogh et
al., 2006; Millar et al., 2006; Raisner et al., 2005). Our data about ADE promoter architecture
is in agreement with this model (Figure 14). A recent study revealed that SWR1 preferentially
binds long nucleosome-free DNA and the adjoining nucleosome core particle, proposing a
mechanism that allows the complex discriminate gene promoters over gene bodies(Ranjan et
41
al., 2013). We found that even though in a less extent, there is still Htz1 present at promoters
in NuA4 mutants, thus it is very likely that SWR-C utilizes multiple mechanisms with
differential extent in specific chromatin context in order to precisely coordinate cellular
activities.
43
Chapter 3
Implication of Mec1/Tel1-dependent phosphorylation of NuA4
histone acetyltransferase complex in DNA damage response pathways
Xue Cheng1, Olivier Jobin-Robitaille1, Nancy Lévesque2, Jean Philippe Lambert3,
Michael Kobor2 and Jacques Côté#, 1
1 Laval University Cancer Research Center, Hôtel-Dieu de Québec (CHUQ), 9 McMahon
Street, Quebec City, QC, G1R 2J6 Canada
2 Centre for Molecular Medicine and Therapeutics, Child and Family Research Institute,
Department of Medical Genetics, University of British Columbia, BC, V5Z 4H4, Canada
3 Samuel Lunenfeld Research Institute at Mount Sinai Hospital, Toronto, ON, Canada.
# Corresponding author: (418) 525-4444 ext. 15545; [email protected]
Key words: Mec1/Tel1; NuA4; Eaf1; S/T-Q phosphorylation; DNA damage.
44
3.1 Foreword
This chapter is written in the form of a manuscript. The synthetic genetic array was performed
in collaboration with Dr. Michael Kobor. I performed the rest of experiments presented in
the figures. Yeast strains QY1650, 1651, 1653, 1097, and 1098 were constructed by Olivier
Jobin-Robitaille. Jean Philippe Lambert performed the mass spectrometry analysis
mentioned in the text. I wrote the manuscript.
3.2 Résumé
La réparation des cassures d'ADN double brin est essentielle pour le maintien de la stabilité
du génome. Chez les mammifères, les mécanismes impliqués dans la réponse cellulaire face
aux dommages à l’ADN font intervenir les kinases Mec1 / Tel1, ATR / ATM. Celles-ci jouent
un rôle central dans la réparation des cassures en phosphorylant les protéines directement
impliquées dans les voies de réparation de l'ADN, ainsi que celles impliquées dans les points
de contrôle du cycle cellulaire. Différentes études ont mis en évidence le recrutement de
remodeleur de la chromatine directement à la cassure, comme le complexe d'histone
acétyltransférase NuA4, et ont décrit leurs rôles dans la réparation des lésions de l'ADN.
Pourtant, si leurs implications ont été démontrées, les mécanismes spécifiques qui les ciblent
aux cassures ou règlementes leurs fonctions restent flous. A partir du complexe NuA4 purifié
provenant de levures traités par des agents endommageant l'ADN, nous avons montré par
spectrométrie de masse que plusieurs sous-unités de NuA4, comme la protéine de structure
Eaf1, étaient phosphorylées sur des sites conservés par la kinase Mec1/Tel1. Pourtant, la
mutation des sites phosphorylés (phospho-SQ) d’Eaf1 n'affecte pas l'intégrité du complexe
NuA4 ou son activité au niveau des réparations des dommages de l'ADN. En l’absence de
phénotypes clairs après mutation de ces sites, nous avons réalisé une analyse «Synthetic
Genetic Array (SGA)» à haut débit avec des souches de levure portant des substitutions
triples. Ces analyses montrent qu’il existe des interactions génétiques entre ces différents
sites, et suggèrent l‘existence de liens fonctionnels entre ces phospho-modifications et les
effecteurs impliqués dans la réponse cellulaire en réponse aux dommages à l’ADN. Ainsi,
une analyse systématique et approfondie du rôle spécifique de chaque modification, nous
permettra de mettre en lumière la fonction du complexe NuA4 dans les voies de réponse aux
45
dommages à l'ADN, mais de déterminer également l’implication de ces modifications post-
traductionnelles dans le ciblage et la régulation du complexe à la cassure.
3.3 Abstract
Repair of DNA double-strand break is essential for the maintenance of genome stability. The
Mec1/Tel1 kinases, ATR/ATM in mammals, play a central role in DNA damage response by
phosphorylating proteins involved in DNA repair and checkpoint pathways. Studies have
implicated the participation of chromatin regulators in the DNA-damage response and their
recruitment around DNA lesions upon DNA damage. Although several roles have been
defined, the specific mechanisms that might direct and regulate their function remain unclear.
The essential NuA4 histone acetyltransferase complex is recruited at DNA double strand
breaks to facilitate repair. Using mass spectrometry of the purified complex after treatment
of yeast cells with DNA damaging agents, we show that several subunits of NuA4 are
phosphorylated at conserved Mec1/Tel1-target sites, including the scaffold protein Eaf1.
Mutation of Eaf1 Mec1/Tel-sites does not affect NuA4 complex integrity or activity upon
DNA damage. Since these mutants have no clear phenotypes, we performed a high-
throughput Synthetic Genetic Array (SGA) analysis with yeast strains carrying triple
substitutions. Mutants showing genetic interactions suggest diverse functional links between
these phospho-modifications and other DNA damage response effectors. Further analysis of
the specific role of these modifications will shed light on the intricate function of NuA4 in
DNA damage response pathways, and establish how certain posttranslational modifications
can regulate the involvement of chromatin regulators.
46
3.4 Introduction
Cells are constantly exposed to different levels of genotoxic stress from both environmental
(e.g., chemical agents, UV radiation and ironizing radiation) and endogenous (e.g., reactive
oxygen species, endogenous alkylating agents and oxidative destruction of deoxyribose
residues) sources (Peterson and Cote, 2004). The most deleterious form of DNA damage
caused by these agents is DNA double-strand breaks (DSBs) since inefficient or failure of
such lesion repairs can lead to genome instability, chromosomal rearrangement, aneuploidy,
cell death and diseases including cancer (Jackson and Bartek, 2009; Polo and Jackson, 2011).
Elucidation of specific mechanisms involving DNA damage response (DDR) and DSB repair
is therefore of significant importance.
Eukaryotic cells have evolved two major pathways to repair DNA double-strand breaks,
namely homologous recombination (HR) and non-homologous end-joining (NHEJ). Both
pathways, although differs in the specific sets of proteins involved, share similar highly
ordered cascades of events partly overlapping in time. At early stage, DSB sites need to be
recognized by “sensors”, which can form large protein complexes that accumulate as nuclear
foci when observed under fluorescence microscope (Shiloh and Ziv, 2013). Secondly, DNA
damage detected by the sensors will activate “transducer” kinases, which further enlarge the
DNA damage signals to a wide-range of downstream “effectors”. Thirdly, effectors interpret
the DNA damage alarm into different cellular responses, activating cell survival or cell death
pathways, the balance between which is decided by the final outcome of the repair process
(Shiloh and Ziv, 2013). Lastly, if DNA repair is successful, cell cycle checkpoint will be
attenuated and finally deactivated, repair complexes will be disassembled and chromatin
structure will be restored (Figure 15).
47
Figure 15 - The DNA damage response cascades and Mec1/Tel1 kinases. Streamline of DNA damage response cascade, including the stepwise involvement of DNA damage sensors, transducers and downstream effectors. (Modified from (Shiloh and Ziv, 2013))
Two phosphatidylinositol-3 kinase-like kinase (PI3K) family proteins, Mec1 and Tel1 in
yeast, ATR and ATM in mammals, possess crucial positions during DNA damage responses
by participating in almost all steps mentioned above. Mec1 and Tel1 activate the DNA
damage response by phosphorylating many key transducers and effectors such as Chk1,
Rad53, Mrc1 and Rad9, resulting in the arrest of DNA replication and cell cycle progression
(Su, 2006). Similarly, in mammalian cells, ATR and ATM targeted proteins include p53,
48
Chk2, DNA-PK, AKT, HIPK2, and the mutations of these substrates will result in genetic
instability and cancer predisposition (Shiloh, 2003; Shiloh and Ziv, 2013).
Chromatin remodelers are among the first effectors that are recruited to the break sites to
assist the opening of chromatin structure for subsequent repair events (Allard et al., 2004).
Recent years of studies have identified that certain recruited remodelers are actually also
substrates of ATR/ATM (Mec1/Tel1), and the resulting phosphorylation events are
foundations in DNA damage response. For example, it has been shown that ATP-dependent
chromatin remodeling complex INO80 is recruited to HO endonuclease-catalysed DSBs
(Morrison and Shen, 2009). The Ies4 subunit of INO80 is phosphorylated by Mec1/Tel1
during DNA damage treatment, an event found to be implicated in DNA-damage induced
checkpoint response (Morrison et al., 2007).
Interestingly, histone acetyltransferase complex NuA4 is also recruited to DSB sites and this
recruitment is important for the efficient repair of DNA (Bird et al., 2002; Downs et al., 2004).
However, the dynamics of NuA4 after recruitment and its regulatory function besides
acetylating histones remain to be further addressed. In this study, we show that several
subunits of NuA4 are phosphorylated at conserved Mec1/Tel1-target sites. Moreover, we
find that phosphorylation events on scaffold protein Eaf1 are implicated in DNA damage
response pathways as the phospho-mutants of Eaf1 display genetic interactions with various
DNA damage response effectors. These observations lead us towards novel mechanisms
adopted by cells to allow efficient DNA repair and the maintenance of genome integrity.
3.5 Materials and Methods
3.5.1 Yeast Strains and Manipulation
All yeast manipulation followed standard procedures. PCR-based gene deletion and epitope
tagging were conducted by following Longtine system protocols (Longtine et al., 1998).
Gene deletions were verified by PCR with the criteria of both the presence of the integrated
cassette and the absence of the gene ORFs. Strain genotypes are shown in Table 6. Primers
used in this study are shown in Table 7.
49
Table 6 - S. cerevisiae Strains Used.
strain ID Genotype Reference
QY2548a his3Δ200 leu2,3-112 trpΔ1 ura3-52 ESA1 TAP-EPL1 (TRP, C-term) ∆eaf1::KANMX6 pFL36-HA-EAF1 CEN LEU2 This study
QY1097 his3Δ200 leu2,3-112 trpΔ1 ura3-52 ESA1 TAP-EPL1 (TRP, C-term) ∆eaf1::KANMX6 pFL36-HA-eaf1-AAA (S489A-S613A-S951A) CEN LEU2
This study
QY1098 his3Δ200 leu2,3-112 trpΔ1 ura3-52 ESA1 TAP-Epl1 (TRP, C-term) ∆eaf1::KANMX6 pFL36-HA-eaf1-EEE (S489E-S613E-S951E) CEN LEU2
This study
QY1650 mat a his3∆1, leu2∆0, met15∆0, ura3∆0 eaf1 WT-tADH1-NatR This study
QY1651 mat a his3∆1, leu2∆0, met15∆0, ura3∆0 eaf1 -AAA (S489A-S613A-S951A)-tADH1-NatR This study
QY1653 mat a his3∆1, leu2∆0, met15∆0, ura3∆0 eaf1 -EEE (S489E-S613E-S951E)-tADH1-NatR This study
QY2802 isogenic to QY1650 except Δmrc1::KanMX6 This study
QY2803 isogenic to QY1651 except Δmrc1::KanMX6 This study
QY2804 isogenic to QY1653 except Δmrc1::KanMX6 This study
QY2826 isogenic to QY1650 except Δrad52::KanMX6 This study
QY2827 isogenic to QY1650 except Δrad52::KanMX6 This study
QY2828 isogenic to QY1650 except Δrad52::KanMX6 This study
QY2855 isogenic to QY1650 except Δeaf3::KanMX6 Δslx4:: HisMX6 pFL36-2Flag-EAF3 WT This study
QY2856 isogenic to QY1650 except Δeaf3::KanMX6 Δslx4:: HisMX6 pFL36-2Flag-Eaf3 S50A This study
QY2857 isogenic to QY1650 except Δeaf3::KanMX6 Δslx4:: HisMX6 pFL36-2Flag-Eaf3 S50D This study
Table - 7 Primers Used In This Study.
Gene / Primer direction sequence
MRC1 deletion /forward tcgttattcgcttttgaacttatcaccaaatattttagtgcggatccccgggttaattaa
MRC1 deletion /reverse ctggagttcaatcaacttcttcggaaaagataaaaaaccagaattcgagctcgtttaaac
MRC1 promoter -224bp/forward cttactaggacaccaactctactgg
MRC1 ORF +201bp/forward agaaggcaagaaagcacccg
MRC1 ORF +696bp/reverse ggaccacgattttgaatggactga
RAD52 deletion /forward aagaactgctgaaggttctggtggctttggtgtgttgttgcggatccccgggttaattaa
RAD52 deletion /reverse aatgatgcaaattttttatttgtttcggccaggaagcgttgaattcgagctcgtttaaac
RAD52 promoter -200bp/forward tctgctcttcccgttagtga
50
RAD52 ORF +25bp/forward gagaagaagcccgttttcgg
RAD52 ORF +757bp/reverse gatcctgtttggaagcatcgag
SLX4 deletion/ forward tccataataataaccagtagttcagttggggaacttaatacggatccccgggttaattaa
SLX4 deletion/ reverse tgttttgtttttgttttgtcaaattctcaatcattcggcagaattcgagctcgtttaaac
SLX4 prom -162bp/forward aatatgcgtagttctttgtc
SLX4 ORF +301bp/ forward ggcggatcaaatatcgagga
SLX4 ORF +704bp/reverse tcacccttgttattccttgc
EAF3-S50A/forward ggtggtagtgcacaagcaactaaggaaataaagccacaaaagc
EAF3-S50A/reverse ccttagttgcttgtgcactaccacctggcttgtcattagg
EAF3-S50D/forward ggtggtagtgaccaagcaactaaggaaataaagccacaaaagc
EAF3-S50D/reverse ccttagttgcttggtcactaccacctggcttgtcattagg
subclone EAF3 pSK/forward gataagcttatatcgaattcc
subclone EAF3 pSK/reverse aaagggaacaaaagctggag
3.5.2 Tandem-Affinity Purification (TAP)
Overnight cultures of Eaf1-SQ mutants containing TAP-tagged Epl1 were diluted and grown
in 250ml of YPD to an OD600 of approximately 1.6. Cells were collected by centrifugation at
4˚C, 3000g for 3 minutes. Pellets were washed with 10ml extraction buffer (200mM HEPES,
pH 7.4, 300mM NaCl, 0.1% NP40, 2mM MgCl2, 5% glycerol) once and resuspended in 1ml
of extract buffer supplemented with 1mM DTT, 1mM PMSF, 2ug/ml leupeptin, 2ug/ml
pepstatin, 5ug/ml aprotinin, 5mM sodium butyrate, 5mM beta-glycerophosphate, 2mM
Na3VO4 and 2mM NaF, and split into 2ml-screw-cap tubes with each tube containing less
than 750ul by volume. 600ul of glass beads were added to each tube and cells were lysed at
4˚C by vortex 1-min on, 1-min off until the disruption reached ~70% as observed under
microscope. Lysates were recovered in a new tube by piercing a hole with a 25G needle.
Supernatant was collected after centrifuging the lysate at 4˚C, 14000 rpm for 30 minutes. In
parallel, 300ul of dynabeads M-270 Epoxy (Invitrogen, Cat. No. 143.01) pre-bound with IgG
were washed three times with extraction buffer supplemented with inhibitors. Beads were
resuspended in the collected supernatant and incubated on a wheel at 4˚C for 3 to 4-hour.
After incubation, beads were then washed 4 times with extraction buffer and two times with
TEV buffer (10mM Tris-HCl, pH 8, 150mM NaCl, 0.1% NP40, 0.5mM EDTA, 1mM DTT).
Beads were resuspended in 500ul of TEV buffer with addition of 13U of recombinant TEV
51
protease and placed on a wheel in 16 ˚C for 2-hour. Supernatant was recovered, beads were
washed with 500ul of TEV buffer and two elutions were polled together. Final volume 1ml
of elution was aliquoted, flash-frozen, and kept at -80 ˚C or proceeded for subsequent
analysis.
3.5.3 Two-dimensional gel electrophoresis
Two-dimensional electrophoresis (2D-gel) were performed with Immobiline DryStrip 7cm
purchased from GE healthcare (cat. No. 17-6001-94) and 1st dimentional isoelectric focusing
was run on BIO-RAD PROTEAN IEF cell kindly provided by Dr. Jacques Landry’s lab.
Briefly, Immobiline DryStrip was rehydrated in 135ul of rehydration buffer (8M Urea, 2%
CHAPS, 0.5% IPG buffer pH 6-11 (GE healthcare, 17-6001-78), 18.5mM DTT, trace
Bromophenol blue) at room temperature for 16-20 hours. 10% greater buffer than
recommended buffer volume was used to ensure a complete rehydration and seal for
subsequent cup-loading. After rehydration, the strips were placed in IEF cell, 6ul of TAP-
purified NuA4 complex was resuspended in 10ul of rehydration buffer and loaded with cap-
application at pH11 end of the gel, and run for 250V 30-min (Rapid Voltage Ramping),
4000V (Rapid Voltage Ramping) until about 16 kVh was reached. The strips were then
placed on and run for a standard 8% SDS-PAGE gel and analyzed by Western Blot.
3.5.4 Western Blot
The presence and status of specific proteins were determined by Western Bolt. 4x Loading
buffer (200mM Tris-HCl pH6.8, 0.2% bromophenol blue, 40% glycerol, 0.4M DTT, 8% SDS
and 0.4M beta-mercaptoethanol) was added to the protein to a final of 1x and boiled for 5-
min. After short spin, protein fractions were loaded to selected percentage of SDS–
polyacrylamide gel electrophoresis (PAGE) and run for certain time until the desired band
size migrated in the middle of the gel, and transferred to a nitrocellulose membrane. For
immune-blotting, membrane was first blocked with 5% non-fat milk in TBS (150mM NaCl,
20mM Tris-HCl pH7.2) -0.1% Tween 20 (TBST) for 1hr at room temperature and incubated
with specific antibody in 1% non-fat milk at 4 ˚C over-night. After incubation, membrane
was washed 3 times, 5 minutes each on a room-temperature shaker, and incubated with
secondary antibody (1:5 000 to 1:10 000 dilution) in 1% non-fat milk for 1 hour. Membrane
was washed 5 times, 5-min each with TBST, covered with ECL and exposed on films.
52
Primary antibodies used in this study: anti-Eaf1 (serum A2424, 2nd bleed, 1:3000), anti-
Rad53 (yC-19, Santa Cruz, 1:500), anti-Phospho-S/T-Q (Cell signaling, 1:500 in 5% BSA).
3.5.5 Histone AcetylTransferase (HAT) Assay
HAT assay was performed essentially as described previously (Grant et al., 1997). Briefly,
0.5 ug of core histones (CH) or short oligonucleosomes were incubated with equal amount
of TAP-purified NuA4, 0.125μl of 3H-labelled Acetyl-CoA, in HAT buffer (50mM Tris-HCl
pH 8.0, 5% glycerol, 0.1mM EDTA, 1mM DTT, 1mM PMSF) supplemented with KCl for a
final salt concentration of 50mM. Reaction was incubated at 30 ˚C for 30-min and spotted
on p81 membranes (Whatman), air-dried, and washed 3 times, 5-min each in 50 mM
carbonate buffer (50mM Na2CO3, 50Mm NaHCO3, pH 9.2). Membranes were rinsed with
acetone, air-dried and placed in vial with scintillation cocktail for 3H counting (30-min
counting per sample).
3.5.6 Silver Stain
SDS-PAGE gel was fixed in 7% acetic acid, 5% methanol for 30 minutes followed by 30-
minute incubation in 10% glutaraldehyde. Gel was transferred into a glass tank and wash
with fresh water for at least 3-hour to ensure a total exclusion of exceeded glutaraldehyde.
Gel was then incubated with 5ug/ml of DTT for 30 minutes followed by 30-minute
incubation with 0.1% w/v AgNO3. After twice quick rinse with water and developer (3g/ml
Na2CO3, 0.185ul/ml formaldehyde), gel was incubated in 160ml of developer until the
desired color was shown. Coloration was ceased with the addition of 2.3M citric acid.
3.5.7 Spot Assay
Yeast strains were grown overnight in Yeast extract-Peptone-Dextrose (YPD) medium,
diluted to an Optical Density (OD) at A600 nm of 0.1, and incubated for a further 4-5 hours.
0.5 OD cells were taken and diluted into 1ml of sterilized water. From the diluted culture,
10-fold dilutions were made, and 10ul of each dilution was spotted onto YPD+ 2% agar
plates with/without indicated amount of methyl methanesulfonate (MMS) (Sigma) or
hydroxyurea (Sigma). Spotted plates were incubated at 30°C for 2 to 3 days before the
pictures were taken.
53
3.5.8 Rad53 checkpoint activation/recovery assay
Yeast strains were grown overnight to stationary phase in SC-Leu and diluted to OD600 0.2
followed by a further 4-5 hours of incubation. 5 OD of cells were sampled, and the rest was
synchronized by adding alpha-factor to a final concentration of 12uM in 30°C for 2 hours.
Again 5 OD of cells were collected and the rest of cells were washed twice with ice-cold
sterilized water and resuspended in pre-warmed YPD containing 200mM of HU. At time
points 20min, 40min and 60min, 5 OD cells were sampled, after which the rest of the cells
were washed twice with ice-cold sterilized water and released into pre-warmed YPD. 5 OD
cells were collected after 15min, 30min, 45min and 60min release into YPD. Whole cell
extracts were obtained by TCA protein extraction and protein fractions were separated by
SDS-PAGE. Rad53 bands were detected with anti-Rad53 primary antibody (yc-19, Santa
Cruz, 1:500), donkey-anti-goat secondary antibody (1:5000, Santa Cruz).
3.5.9 TCA Protein extraction
Yeast cells were harvested and transferred into 2ml-screw-cap tubes. 200ul of 20% TCA,
200ul TCA buffer (20mM Tris-HCl pH 8.0, 50mM ammonium acetate, 2mM EDTA, 2mM
PMSF, 5mM sodium butyrate, 5mM beta-glycerophosphate, 2mM Na3VO4 and 2mM NaF)
and 400ul of glass beads were added to the tubes, and lysis step was carried out on
BeadsBeater twice with 45-second on, 2-minute off at 4 °C. Lysate was collected by piercing
a hole with 25G needle and beads were washed with 250ul of 20% TCA and 250ul of TCA
buffer, which was then pooled with the first lysate and centrifuged 10 minutes 14000 rpm at
4°C. Supernatant was discarded and the centrifuge step was repeated to eliminate remaining
TCA. The pellet was resuspended in 300ul TCA-laemmli buffer and boiled for 5 minutes.
After centrifuging 5 minutes at 14000rpm, the recovered supernatant was loaded on SDS-
PAGE and subjected to Western Blot.
54
3.6 Results
3.6.1 NuA4 subunits are phosphorylated upon DNA damage
The involvement of NuA4 in DNA damage response prompted us to further seek the specific
mechanisms underlying this process. As recruitments of both NuA4 and Mec1/Tel1 are early
steps during DNA damage response, we asked whether NuA4 subunits are DNA damage-
induced substrates of Mec1/Tel1 and, if yes, what could be the function. To this end, we
purified NuA4 complex through TAP-tagged Epl1 subunit from yeast cells treated with
DNA-damaging agent MMS. The purified complexes were subjected to mass spectrometry
in order to detect the presence of phospho-peptides.
Table 8 - Examples of Putative Mec1/Tel1 Target Sites in NuA4 Subunits.
Subunit Sequence Detected in Previous Studies Prediction
Score5 Our MS Data6
Eaf1 GLLS489QEGA yes1 3.263 no
EPSIS613QLSK yes2 5.246 yes
SSPS951QSSL yes2 8.2 yes
Tra1 DVCIS2965QLAR no 7.4 yes
Eaf3 KPGGSS50QATK yes2,3,4 9.9 no
1 Breitkreutz et al. Science, 2010. 2 Albuquerque et al. MCP, 2008. 3 Smolka MB et al. PNAS, 2007. 4 Chen SH et al., JBC, 2010. 5 Computational prediction of phosphorylation sites by Group-based Prediction System ver 2.0 (GPS 2.0), Yu Xue et al., Mol Cell Proteomics, 2008. 6 Identified phosphopeptides from mass spectrometry. Cells were treated with 0.05% MMS for 2 hours before purification.
Many phospho-sites on NuA4 subunits are identified (data not shown) and interestingly, we
found that several phosphorylation events occur at conserved Mec1/Tel1 target consensus
sequence, S/T-Q motif (Table 8, Fig. 16a). By consulting published proteomics studies, most
of our detected S/T-Q sites recur in several proteome-wide screens (Albuquerque et al., 2008;
Breitkreutz et al., 2010; Chen et al., 2010; Smolka et al., 2007). All the sites were also
confirmed by computational prediction of putative phosphorylation sites using GPS 2.0
(Group-based Prediction System, ver. 2.0) software (Xue et al., 2008) with relatively high
55
scores (score range 0 to 9.9) (Table 8). Altogether, these results implicate Mec1/Tel1 in
phosphorylating NuA4 subunits upon DNA damage.
Figure 16 - Mec1/Tel1 targeting sites mapped in Eaf1. (A) Alignment of amino acids flanking known phosphorylated S/T-Q motifs in yeast, with S/T being position 0. Evidence of phosphorylation was obtained from UniProt for reported S/T-Q Clustering Domains (SCDs) of Tel1/Mec1 targets(Cheung et al., 2012). (B) Schematic representation of full-length Eaf1, showing the HSA motif, SANT motif, and putative Mec1/Tel1 target sites. The sequences of the mutated sites in the study are indicated. (C) Schematic representation of Eaf1 as a scaffold protein for the assembly of other NuA4 subunits/ sub-modules.
3.6.2 Eaf1 is phosphorylated in vivo upon DNA damage
To investigate the functions of the potential Mec1/Tel1-dependent phosphorylation events
on NuA4, we started with the Eaf1 subunit as it is the only subunit unique to NuA4 (Auger
et al., 2008). Eaf1 is the scaffold subunit of NuA4 and the platform for the assembly of other
functional sub-modules into the complex (Fig.16 C) (Auger et al., 2008; Boudreault et al.,
2003; Lu et al., 2009; Mitchell et al., 2008; Rossetto et al., 2014; Selleck et al., 2005). Eaf1
carries a SANT domain, a HSA domain and contains a C-terminal glutamine-rich region (Fig.
16 B) (Auger et al., 2008). None of our candidate Eaf1 phospho-SQ sites fall into these
domains.
In order to confirm that Eaf1 is indeed phosphorylated upon DNA damage in vivo, we
performed two-dimensional gel electrophoresis (2D-gel) analysis with NuA4 complex
Eaf1-WT
Eaf1-WT
MMS
+
-
α-Eaf1
Eaf1(pI 9.5)
pH 11 MpH6
P-Eaf1
57
purifications which further confirmed the silver stain results (data not shown). Thus, we
conclude that Eaf1 phospho-mutants do not affect NuA4 complex integrity.
We then tested whether Eaf1 phospho-mutants would affect NuA4 histone acetyltransferase
activity. Equal amounts of purified NuA4 complexes used in Figure 18A were first
normalized by acetyltransferase activity on free core histones. Histone acetyltransferase
assays on chromatin substrates were performed using equal amount of NuA4 complexes on,
short oligonucleosomes (SON). As NuA4 complex integrity is required for targeting
chromatin, the activity on SON reflects NuA4 activity (Berndsen et al., 2007; Boudreault et
al., 2003). NuA4 histone acetyltransferase activity does not change among Eaf1 mutants after
DNA damage (Figure 18B). Taken together, these results show that both NuA4 complex
integrity and activity are independent of Eaf1 phosphorylation status.
Figure 18 - Eaf1 SQ-mutants do not alter complex integrity or activity. (A) NuA4 complex was purified with TAP-tag from WT, null or phospho-mimic mutants treated with or without MMS and subject to silver stain. Subunits were identified (left) based on molecular weight (right). (B) In vitro Histone AcetylTransferase (HAT) activity assay on nucleosomes using TAP-purified NuA4 from Eaf1 SQ-mutants treated with MMS. Error bars represent standard deviation from two technical repeats.
58
3.6.3 Eaf1 and Eaf3 phospho-mutants do not affect Rad53 checkpoint activation or
recovery in slx4Δ background
Previous work has indicated that the role of NuA4 in DNA damage response is functionally
linked to DNA-damage checkpoint regulation. During DNA damage, adaptor protein Rad9
(yeast paralog of mammalian 53BP1) can bind γH2A through its BRCT domain and bind
Dot1-dependent di-methylated H3K79 through its Tudor domain around the break and
activate checkpoint kinase Rad53 (yeast paralog of mammalian Chk2) (Hammet et al., 2007;
Javaheri et al., 2006; Nnakwe et al., 2009; Wysocki et al., 2005). As NuA4 can also interact
with γH2A through its Arp4 subunit, it has been proposed that the binding of NuA4 and its
activity may disrupt Rad9-binding, thus attenuate Rad53 checkpoint signal (Javaheri et al.,
2006).
Besides the antagonizing relationship between Rad9 and NuA4, other proteins can also
regulate Rad9-dependent Rad53 activation. Slx4 is a DNA repair scaffolding protein that
functions as an endonuclease to process DNA at damage sites. It counteracts Rad9-Rad53
dependent pathway, preventing excessive Rad9-dependent Rad53 activation (Ohouo et al.,
2013). Consequently, slx4 deletion strain shows Rad53 hyperactivation during DNA damage
response (Ohouo et al., 2013). Interestingly, a genome-wide quantitative study identified
phospho-Eaf3 at serine 50, a potential Mec1/Tel1 target, as one of the most affected
phosphorylation site in slx4 deletion strain (Ohouo et al., 2013). This strongly support the
involvement of Mec1/Tel1-dependent phosphorylation of NuA4 in DNA damage checkpoint
activation.
In order to elucidate the intriguing relationship between NuA4, Slx4 and Rad53 checkpoint
response, we constructed strains carrying both slx4 deletion and Eaf1+Eaf3 SQ point
mutations and examined whether these S/T-Q sites affect Rad53 checkpoint activation or
recovery level. Cells were first synchronized in G1 by alpha-factor, then released in 200mM
of HU to activate checkpoint kinase Rad53 autophosphorylation. After sampling at 20-min,
40-min, and 60-min, cells were washed and released into YPD in order to monitor checkpoint
recovery. HU treatment and YPD recovery efficiently activated and recovered Rad53
checkpoint, yet it shows no significant difference among the mutants (Figure 19). Based on
59
these results, we conclude that Eaf1 and Eaf3 phospho-status do not affect elevated Rad53
activation or recovery in slx4 deletion background.
Figure 19 - Eaf1 and Eaf3 SQ-mutants do not alter Rad53 checkpoint activation or recovery. Indicated mutant cells were grown to early-log phase and synchronized with α-factor in G1 and released into YPD supplemented with 200mM of HU. Cells were sampled at indicated time points and subject to TCA protein extraction and SDS-PAGE WB. Rad53 mobility shift caused by autophosphorylation (P-Rad53) was monitored. Rad53 was detected with anti-Rad53 antibody (yC-19, Santa Cruz).
3.6.4 Eaf1 phospho-mutants show diverse functional links with DNA-damage response
effectors
To identify potential genetic interactions with Eaf1-SQ-mutants, we used synthetic genetic
array (SGA) technology (Tong et al., 2004). Briefly, either wild type cells or mutant cells are
crossed with a collection of viable yeast deletions and the resulting spores which combine
both mutations through meiotic recombination are measured by growth and given relative
fitness scores. Higher scores indicates better growth, and vice versa. Eaf1 WT and SQ
mutants exhibit similar genetic profiling for most of the genes. However, some genes
involved in DNA damage response pathways/ DNA repair show opposite genetic interactions
between AAA and EEE mutants (Fig. 20 B). These functional interactions suggest that
phosphorylated Eaf1 is a novel player in DNA damage response.
60
Figure 20 - Eaf1 phosphorylation mutants show genetic interactions with DNA damage response effectors. (A) Synthetic genetic array (SGA) methodology (Boone et al., 2007). The results scored are calculated based on double mutant colony sizes. (B) Scatter plot results of SGA analysis. Each spot represents a double mutant containing a gene deletion and either Eaf1 AAA mutant or EEE mutant. Scores were given by the viability of the generated double mutant spores, with the positive score representing synthetic rescue while negative representing synthetic sick (or lethal). Genes which are less affected by Eaf1 phosphorylation mutants appear closer along the diagonal line (x=y). Some genes are highlighted in red dot.
3.6.5 Verification of SGA data
To verify the SGA data, we created double mutants and spotted on media containing DNA-
damaging agents. Genes of interest were selected by both higher scores in SGA and relevance
to DNA damage response. For example, Mrc1 is S-phase checkpoint protein and shows
synthetic sickness with Eaf1-AAA mutant; Rad52 stimulates strand exchange during
homologues recombination pathway of DSB repair, and shows synthetic fitness with Eaf1-
AAA mutant. As seen in Figure 21 A, Eaf1-SQ mutants themselves are not sensitive to drugs.
When Eaf1-SQ mutants were combined with several deletions screened out from the SGA
data, the growth defects seen in SGA screen could not be reproduced by PCR-based gene
disruption in haploid Eaf1-SQ mutant background (Figure 21 B, C, data not shown).
61
Figure 21 - Mutants containing phospho-mimic Eaf1 do not show significant phenotype. (A) Tenfold serial dilution of yeast mutant cultures were plated on either YPD media (no treatment), media containing 0.02% MMS or 150mM HU. Eaf1 phosphorylation mutants were generated with serine to alanine or glutamic acid substitutions of amino acid 489,613, and 951 (designated as eaf1 AAA or EEE). (B, C) Tenfold serial dilution of RAD52 (B) or MRC1 (C) deletion strains with the eaf1 phosphorylation mutants. Strains were plated on YPD, SC media or media containing indicated concentration of MMS or HU.
3.6.6 Involvement of phosphorylation events on other NuA4 subunits upon DNA
damage
Phosphorylation events on other subunits of NuA4 during DNA damage were also taken into
consideration when experiments were performed on Eaf1-SQ mutants. For example, one
attempt trying to detect phosphorylation on Eaf1 by western blot with an anti-phospho-S/T-
Q antibody, while failing to detect Eaf1 signal upon DNA damage, revealed a light yet
specific appearance of Tra1 signal upon DNA damage (Figure 22). This is consistent with
62
our MS results (Table 8), but further studies are needed in order to address the function and
importance of phosphorylation events on other NuA4 subunits (see Discussion and
Perspective).
Figure 22 - Tra1 is phosphorylated at SQ site upon DNA damage independent of Eaf1-SQ phosphorylation status. TAP-purification of NuA4 from Eaf1 WT and SQ-mutants treated with or without 0.05% of MMS for 2-hour. Western blot was performed with phospho-SQ antibody and Eaf1 antibody. Eaf1 signal is presented as loading control.
3.7 Discussion and perspectives
Chromatin modifying complexes have been long suggested to be involved in DNA damage
response pathways. Nevertheless, the detailed mechanisms remain obscure. For examples,
studies have shown that NuA4 can be recruited by γH2A around DNA damage sites to assist
the opening of chromatin structure, but the pending questions are: does NuA4 merely
function through acetylating histones? If not, what are the other functions or the other
substrates? As NuA4 counteracts Rad9, what is the role of NuA4 in checkpoint release?
Does NuA4 cooperates with other chromatin modifiers to favor specific repair pathways and
how? This work presents an attempt to address some of these questions. We identified several
subunits of NuA4 as being phosphorylated at conserved Mec1/Tel1 targeting motif in vivo.
The phosphorylation events on scaffold protein Eaf1 seems not to function through affecting
NuA4 itself, as phospho-mutants of Eaf1 do not affect NuA4 integrity/activity (Figure 18)
and the mutants do not alter NuA4 auto-acetylation or recruitment at DSB either(data not
shown). SGA analysis supports instead a function through other DNA damage effectors
(Figure 20). It is possible that these phosphorylation events physically recruit specific
MMS
— Tra1
α-Eaf1 – — Eaf1
α-P-SQ –
- - - + + +
63
effectors or function through inhibiting certain interactions. Our first attempt to screen
specific physical interactors by AP/MS failed to pinpoint candidates of interest, yet we do
not rule out the possibilities of technical limitations (e.g. too stringent washes) or that the
nature of interactions is too transient to be detected by our approach.
Besides the potential of being physically involved in phosphorylation-dependent interactions,
NuA4 phosphorylation events may participate in specific pathways which can be detected by
genetic interaction screen approaches, such as SGA. Our strategy to verify data obtained from
SGA remains unfruitful up to date, which prompt us to consider other means/approaches to
validate. While SGA generates double mutants by crossing two single mutants, a step which
involves meiosis, our PCR-based gene disruption approach operates only in haploid cells,
which only undergo mitosis. This could mask potential effects of the double mutants. In other
words, the defects observed in SGA may reflect genetic interactions during meiosis
sporulation or germination process. As NuA4 is also implicated in meiosis, it would be
essential to verify this possibility through assays that measure sporulation/germination
efficiencies. In fact, one of the highest scored genetic interaction is between Eaf1-AAA
mutant and REC114 gene, While REC114 itself or in combination with Eaf1-SQ mutants
created by our haploid strains do not exhibit defects on drugs, REC114 is actually a protein
that is highly involved in early stages of meiotic recombination. Interestingly, a recent study
also identified Rec114 as substrate of Mec1/Tel1, and the resulting phosphorylation is
implicated in meiotic DSB-homeostasis (Carballo et al., 2013). It will be of great interest to
test whether this process is related to Eaf1/NuA4 phosphorylation, which can further define
the function of NuA4 in meiotic DSB regulation/repair. Moreover, as the potential genetic
interactions are expected to be stronger in the presence of DNA damaging agents, performing
SGA on media containing MMS or HU would give clearer hints on genetic interaction
networks (experiments in preparation).
Besides the study of Eaf1/Eaf3-SQ phosphorylation, future works will also include the
functional definition of phosphorylation events on other NuA4 subunits, such as Tra1 (Table
8). It has been reported that Tra1 is involved in the recruitment of NuA4 by transcription
factors during transcription activation (Allard et al., 1999; Brown et al., 2001; Knutson and
Hahn, 2011). Our detected S/T-Q site in Tra1 falls into the FAT domain of Tra1, which is
64
conserved in Tra1 mammalian homolog TRRAP. Strain carrying partial truncation of the
protein (a.a. 2904 to a.a. 3001, which contains the S/T-Q site (a.a. 2965)) is viable, but
displays severe heat-sensitivity, drug sensitivity and transcriptional deficiency (Knutson and
Hahn, 2011). Interestingly, this partial truncation of Tra1 shows normal complex recruitment
to NuA4 targeted promoters, but exhibits defects in NuA4 HAT activity (Knutson and Hahn,
2011). It is thus tempting to speculate that our detected Tra1 S/T-Q site is implicated in these
observed phenotypes and it may represent an intriguing “switch” for NuA4 HAT activity at
damage sites in response to different signals. By constructing point mutants of Tra1 S/T-Q
sites, further study will test this possibility.
Altogether, this study identifies new potential targets in Mec1/Tel1 DNA damage response
pathways, presenting an additional layer of regulation through modification of a chromatin
modifier. Our results and future works will improve the understanding on how certain
posttranslational modifications can regulate the involvement of chromatin regulators in
different cellular pathways.
65
Chapter 4
Discussion and Perspectives
66
With the combination of biochemistry, genetic and genome-wide approaches, this thesis
investigated the role of the conserved NuA4 histone acetyltransferase complex in gene
regulation and genome stability. It provides original findings, part of which form a
manuscript soon to be submitted (chapter 2), while the other part requires additional work
(chapter 3). Future work will involve both deepening the understanding of specific
mechanisms in each process (e.g. transcription- chapter 2; DNA repair- chapter 3) and
widening the viewing angles by connecting the related observations into possible functional
outputs.
Intriguing connections could be made between NuA4 function and other histone
modifications during transcription. For example, phosphorylation of histone H4 serine 1
(H4S1ph) is linked to transcription and enriched in coding regions of active genes (Utley et
al., 2005) (Rossetto et al. unpublished). It has also been shown that this phosphorylation
event inhibits NuA4-mediated chromatin acetylation (Utley et al., 2005). It would be
interesting to investigate the detailed mechanism and function of this crosstalk. One possible
mechanism is that as H4S1ph (catalysed by CK2) antagonizes NuA4 activity in vivo, the
enrichment of H4S1ph over gene bodies restricts H4ac to promoter regions. This can stabilize
nucleosomes over gene bodies to maintain accurate transcription, suppressing the onset of
undesired cryptic transcription initiation. In fact, H4S1A phosphor-null mutant does not
show defects in cryptic transcription suppression compared to wild type (Rossetto et al.
unpublished), suggesting the antagonizing role of H4S1ph might be necessary but not
sufficient for the regional restriction of H4ac.
As H4-ac-containing nucleosomes are less stable, H4S1ph-containing nucleosomes may thus
be more stable, exhibiting longer half-life of retention on chromatin during transcription.
This could be tested by ChIP experiments for histone H3 or H4 in H4S1 WT and H4S1A
mutant at highly transcribed loci to measure nucleosome occupancy. Alternatively, a system
that can efficiently differentiate newly incorporated and parental histones (Rufiange et al.,
2007) could be used to measure replication-independent chromatin dynamics and it relative
to NuA4 activity on H4S1ph.
67
It will be also interesting to delve deeper into NuA4 functions during DNA damage response.
As mentioned earlier, NuA4 is recruited to DSB through the interaction between Arp4
subunit and γH2A (Downs et al., 2004). The burning question is whether other interaction(s)
is (are) required for this recruitment. Preliminary results from our lab show that NuA4
recruitment to DSB depends on an interaction with MRX (Mre11-Rad50-Xrs2), a
heterotrimeric complex that recognizes DNA lesions. This recruitment depends on a
phospho-dependent interaction between NuA4 and Xrs2 (O.Jobin-Robitaille, et al.
unpublished). It is thus very interesting to see whether this dependency on NuA4-
phosphorylation is rooted from the Mec1/Tel1-phosphorylation-sites detected in our mass
spectrometry analysis (Table 8). There are several possible approaches to test this hypothesis.
One is to detect in vitro interactions by incubating recombinant components of MRX (Mre11,
Rad50 and Xrs2) with either wild type or phospho-mutated subunits of native NuA4 purified
through TAP-tag with/without DNA damage (GST pull-down). Another experiment would
be to ChIP NuA4 components (e.g. Eaf1) in wild type and NuA4-phospho-mutants around
DSB site to see whether the recruitment is affected.
Intriguingly, the crosstalk between H4S1ph and NuA4-mediated H4ac is also involved in
DSB repair pathways (Utley et al., 2005). H4S1ph is enriched around DSB sites in vivo, but
its appearance is much later compared to γH2A. Interestingly, the appearance of H4S1ph is
concurrent with the decrease of H4ac, in agreement with the anti-correlation between the two
histone marks (Utley et al., 2005). It is thus proposed that H4S1ph functions through blocking
reacetylation of local H4 tails after chromatin restoration once the damage is repaired (Figure
23). Experiments such as measuring H4ac around DSB sites in WT and H4S1A mutant cells
could provide support to this model.
68
Figure 23 - Model for the implication of NuA4 and histone modification crosstalks in DNA repair events. Upon DSB, DNA damage sensor kinases Mec1 and Tel1 phosphorylate H2A at S129, and also phosphorylate NuA4 subunits. NuA4 is then recruited to DSB sites through two interactions: Arp4 and γH2A; phosphorylated-subunit (e.g. Tra1) and MRX. NuA4, either by its physical presence or its activity, modulate DSB repair process and after repair, chromatin structure is restored and CK2 catalyses H4S1ph to block local reacetylation of chromatin by NuA4. Modified from (Utley et al., 2005).
69
On the top of more than 15 years of studies on NuA4, this thesis underlines the wide range
of functions that have been merged into one single protein complex. This allows the cell to
perform precise regulatory mechanisms to orchestrate the appropriate activities and
responses to environmental stimuli. Given the fact that NuA4 homologous complex in human
is frequently implicated in human diseases such as cancers (Avvakumov and Cote, 2007),
further work is still needed to elucidate the detailed mechanisms about how NuA4 functions
in specific cellular processes. It will also be important to understand how the multiple
functions of NuA4 are coordinated and how NuA4 cooperates with other chromatin modifiers
to facilitate cellular responses to different signals.
71
References Albuquerque, C.P., Smolka, M.B., Payne, S.H., Bafna, V., Eng, J., and Zhou, H. (2008). A multidimensional chromatography technology for in-depth phosphoproteome analysis. Molecular & cellular proteomics : MCP 7, 1389-1396. Allard, S., Masson, J.Y., and Cote, J. (2004). Chromatin remodeling and the maintenance of genome integrity. Biochimica et biophysica acta 1677, 158-164. Allard, S., Utley, R.T., Savard, J., Clarke, A., Grant, P., Brandl, C.J., Pillus, L., Workman, J.L., and Cote, J. (1999). NuA4, an essential transcription adaptor/histone H4 acetyltransferase complex containing Esa1p and the ATM-related cofactor Tra1p. The EMBO journal 18, 5108-5119. Allfrey, V.G., Faulkner, R., and Mirsky, A.E. (1964). ACETYLATION AND METHYLATION OF HISTONES AND THEIR POSSIBLE ROLE IN THE REGULATION OF RNA SYNTHESIS. Proceedings of the National Academy of Sciences of the United States of America 51, 786-794. Almer, A., and Horz, W. (1986). Nuclease hypersensitive regions with adjacent positioned nucleosomes mark the gene boundaries of the PHO5/PHO3 locus in yeast. The EMBO journal 5, 2681-2687. Almer, A., Rudolph, H., Hinnen, A., and Horz, W. (1986). Removal of positioned nucleosomes from the yeast PHO5 promoter upon PHO5 induction releases additional upstream activating DNA elements. The EMBO journal 5, 2689-2696. Altaf, M., Auger, A., Covic, M., and Cote, J. (2009). Connection between histone H2A variants and chromatin remodeling complexes. Biochemistry and cell biology = Biochimie et biologie cellulaire 87, 35-50. Altaf, M., Auger, A., Monnet-Saksouk, J., Brodeur, J., Piquet, S., Cramet, M., Bouchard, N., Lacoste, N., Utley, R.T., Gaudreau, L., et al. (2010). NuA4-dependent Acetylation of Nucleosomal Histones H4 and H2A Directly Stimulates Incorporation of H2A.Z by the SWR1 Complex. Journal of Biological Chemistry 285, 15966-15977. Auger, A., Galarneau, L., Altaf, M., Nourani, A., Doyon, Y., Utley, R.T., Cronier, D., Allard, S., and Cote, J. (2008). Eaf1 is the platform for NuA4 molecular assembly that evolutionarily links chromatin acetylation to ATP-dependent exchange of histone H2A variants. Molecular and cellular biology 28, 2257-2270. Avvakumov, N., and Cote, J. (2007). The MYST family of histone acetyltransferases and their intimate links to cancer. Oncogene 26, 5395-5407. Babiarz, J.E., Halley, J.E., and Rine, J. (2006). Telomeric heterochromatin boundaries require NuA4-dependent acetylation of histone variant H2A.Z in Saccharomyces cerevisiae. Genes & development 20, 700-710. Banerjee, T., and Chakravarti, D. (2011). A peek into the complex realm of histone phosphorylation. Mol Cell Biol 31, 4858-4873. Berndsen, C.E., Selleck, W., McBryant, S.J., Hansen, J.C., Tan, S., and Denu, J.M. (2007). Nucleosome recognition by the Piccolo NuA4 histone acetyltransferase complex. Biochemistry 46, 2091-2099. Billon, P., and Cote, J. (2013). Precise deposition of histone H2A.Z in chromatin for genome expression and maintenance. Biochimica et biophysica acta 1819, 290-302.
72
Bird, A.W., Yu, D.Y., Pray-Grant, M.G., Qiu, Q., Harmon, K.E., Megee, P.C., Grant, P.A., Smith, M.M., and Christman, M.F. (2002). Acetylation of histone H4 by Esa1 is required for DNA double-strand break repair. Nature 419, 411-415. Boeger, H., Griesenbeck, J., Strattan, J.S., and Kornberg, R.D. (2003). Nucleosomes unfold completely at a transcriptionally active promoter. Molecular cell 11, 1587-1598. Boone, C., Bussey, H., and Andrews, B.J. (2007). Exploring genetic interactions and networks with yeast. Nature reviews Genetics 8, 437-449. Boudreault, A.A., Cronier, D., Selleck, W., Lacoste, N., Utley, R.T., Allard, S., Savard, J., Lane, W.S., Tan, S., and Côté, J. (2003). Yeast Enhancer of Polycomb defines global Esa1-dependent acetylation of chromatin. Genes & development 17, 1415-1428. Breitkreutz, A., Choi, H., Sharom, J.R., Boucher, L., Neduva, V., Larsen, B., Lin, Z.Y., Breitkreutz, B.J., Stark, C., Liu, G., et al. (2010). A global protein kinase and phosphatase interaction network in yeast. Science (New York, NY) 328, 1043-1046. Brown, C.E., Howe, L., Sousa, K., Alley, S.C., Carrozza, M.J., Tan, S., and Workman, J.L. (2001). Recruitment of HAT complexes by direct activator interactions with the ATM-related Tra1 subunit. Science (New York, NY) 292, 2333-2337. Brown, C.R., Mao, C., Falkovskaia, E., Law, J.K., and Boeger, H. (2011). In vivo role for the chromatin-remodeling enzyme SWI/SNF in the removal of promoter nucleosomes by disassembly rather than sliding. The Journal of biological chemistry 286, 40556-40565. Bruce Alberts, A.J., Julian Lewis, Martin Raff, Keith Roberts, Peter Walter, ed. (2002). DNA and Chromosomes. In Molecular Biology of the Cell (Garland Science), pp. 191–234 Cairns, B.R. (2005). Chromatin remodeling complexes: strength in diversity, precision through specialization. Current opinion in genetics & development 15, 185-190. Cairns, B.R. (2009). The logic of chromatin architecture and remodelling at promoters. Nature 461, 193-198. Carballo, J.A., Panizza, S., Serrentino, M.E., Johnson, A.L., Geymonat, M., Borde, V., Klein, F., and Cha, R.S. (2013). Budding yeast ATM/ATR control meiotic double-strand break (DSB) levels by down-regulating Rec114, an essential component of the DSB-machinery. PLoS genetics 9, e1003545. Carrozza, M.J., Utley, R.T., Workman, J.L., and Cote, J. (2003). The diverse functions of histone acetyltransferase complexes. Trends in genetics : TIG 19, 321-329. Chen, S.H., Albuquerque, C.P., Liang, J., Suhandynata, R.T., and Zhou, H. (2010). A proteome-wide analysis of kinase-substrate network in the DNA damage response. The Journal of biological chemistry 285, 12803-12812. Cheung, H.C., San Lucas, F.A., Hicks, S., Chang, K., Bertuch, A.A., and Ribes-Zamora, A. (2012). An S/T-Q cluster domain census unveils new putative targets under Tel1/Mec1 control. BMC genomics 13, 664. Cheung, W.L., Turner, F.B., Krishnamoorthy, T., Wolner, B., Ahn, S.H., Foley, M., Dorsey, J.A., Peterson, C.L., Berger, S.L., and Allis, C.D. (2005). Phosphorylation of histone H4 serine 1 during DNA damage requires casein kinase II in S. cerevisiae. Current biology : CB 15, 656-660. Choy, J.S., and Kron, S.J. (2002). NuA4 subunit Yng2 function in intra-S-phase DNA damage response. Mol Cell Biol 22, 8215-8225. Daignan-Fornier, B., and Fink, G.R. (1992). Coregulation of purine and histidine biosynthesis by the transcriptional activators BAS1 and BAS2. Proceedings of the National Academy of Sciences of the United States of America 89, 6746-6750.
73
Downs, J.A., Allard, S., Jobin-Robitaille, O., Javaheri, A., Auger, A., Bouchard, N., Kron, S.J., Jackson, S.P., and Cote, J. (2004). Binding of chromatin-modifying activities to phosphorylated histone H2A at DNA damage sites. Mol Cell 16, 979-990. Doyon, Y., Selleck, W., Lane, W.S., Tan, S., and Cote, J. (2004). Structural and functional conservation of the NuA4 histone acetyltransferase complex from yeast to humans. Molecular and cellular biology 24, 1884-1896. Durant, M., and Pugh, B.F. (2007). NuA4-directed chromatin transactions throughout the Saccharomyces cerevisiae genome. Molecular and cellular biology 27, 5327-5335. Erdel, F., Krug, J., Langst, G., and Rippe, K. (2011). Targeting chromatin remodelers: signals and search mechanisms. Biochimica et biophysica acta 1809, 497-508. Fuda, N.J., Ardehali, M.B., and Lis, J.T. (2009). Defining mechanisms that regulate RNA polymerase II transcription in vivo. Nature 461, 186-192. Galarneau, L., Nourani, A., Boudreault, A.A., Zhang, Y., Heliot, L., Allard, S., Savard, J., Lane, W.S., Stillman, D.J., and Cote, J. (2000). Multiple links between the NuA4 histone acetyltransferase complex and epigenetic control of transcription. Molecular cell 5, 927-937. Gedvilaite, A., and Sasnauskas, K. (1994). Control of the expression of the ADE2 gene of the yeast Saccharomyces cerevisiae. Current genetics 25, 475-479. Grant, P.A., Duggan, L., Cote, J., Roberts, S.M., Brownell, J.E., Candau, R., Ohba, R., Owen-Hughes, T., Allis, C.D., Winston, F., et al. (1997). Yeast Gcn5 functions in two multisubunit complexes to acetylate nucleosomal histones: characterization of an Ada complex and the SAGA (Spt/Ada) complex. Genes Dev 11, 1640-1650. Grant, P.A., Schieltz, D., Pray-Grant, M.G., Yates, J.R., 3rd, and Workman, J.L. (1998). The ATM-related cofactor Tra1 is a component of the purified SAGA complex. Mol Cell 2, 863-867. Guillemette, B., Bataille, A.R., Gevry, N., Adam, M., Blanchette, M., Robert, F., and Gaudreau, L. (2005). Variant histone H2A.Z is globally localized to the promoters of inactive yeast genes and regulates nucleosome positioning. PLoS biology 3, e384. Hammet, A., Magill, C., Heierhorst, J., and Jackson, S.P. (2007). Rad9 BRCT domain interaction with phosphorylated H2AX regulates the G1 checkpoint in budding yeast. EMBO reports 8, 851-857. Han, M., and Grunstein, M. (1988). Nucleosome loss activates yeast downstream promoters in vivo. Cell 55, 1137-1145. Holstege, F.C., Jennings, E.G., Wyrick, J.J., Lee, T.I., Hengartner, C.J., Green, M.R., Golub, T.R., Lander, E.S., and Young, R.A. (1998). Dissecting the regulatory circuitry of a eukaryotic genome. Cell 95, 717-728. Hurd, P.J., Bannister, A.J., Halls, K., Dawson, M.A., Vermeulen, M., Olsen, J.V., Ismail, H., Somers, J., Mann, M., Owen-Hughes, T., et al. (2009). Phosphorylation of histone H3 Thr-45 is linked to apoptosis. The Journal of biological chemistry 284, 16575-16583. Jackson, J.D., Falciano, V.T., and Gorovsky, M.A. (1996). A likely histone H2A.F/Z variant in Saccharomyces cerevisiae. Trends in biochemical sciences 21, 466-467. Jackson, S.P., and Bartek, J. (2009). The DNA-damage response in human biology and disease. Nature 461, 1071-1078. Javaheri, A., Wysocki, R., Jobin-Robitaille, O., Altaf, M., Cote, J., and Kron, S.J. (2006). Yeast G1 DNA damage checkpoint regulation by H2A phosphorylation is independent of chromatin remodeling. Proceedings of the National Academy of Sciences of the United States of America 103, 13771-13776.
74
Keogh, M.C., Mennella, T.A., Sawa, C., Berthelet, S., Krogan, N.J., Wolek, A., Podolny, V., Carpenter, L.R., Greenblatt, J.F., Baetz, K., et al. (2006). The Saccharomyces cerevisiae histone H2A variant Htz1 is acetylated by NuA4. Genes & development 20, 660-665. Knutson, B.A., and Hahn, S. (2011). Domains of Tra1 important for activator recruitment and transcription coactivator functions of SAGA and NuA4 complexes. Mol Cell Biol 31, 818-831. Kobor, M.S., Venkatasubrahmanyam, S., Meneghini, M.D., Gin, J.W., Jennings, J.L., Link, A.J., Madhani, H.D., and Rine, J. (2004). A protein complex containing the conserved Swi2/Snf2-related ATPase Swr1p deposits histone variant H2A.Z into euchromatin. PLoS biology 2, E131. Koehler, R.N., Rachfall, N., and Rolfes, R.J. (2007). Activation of the ADE genes requires the chromatin remodeling complexes SAGA and SWI/SNF. Eukaryotic cell 6, 1474-1485. Kornberg, R.D. (1974). Chromatin structure: a repeating unit of histones and DNA. Science (New York, NY) 184, 868-871. Krishnamoorthy, T., Chen, X., Govin, J., Cheung, W.L., Dorsey, J., Schindler, K., Winter, E., Allis, C.D., Guacci, V., Khochbin, S., et al. (2006). Phosphorylation of histone H4 Ser1 regulates sporulation in yeast and is conserved in fly and mouse spermatogenesis. Genes & Development 20, 2580-2592. Krogan, N.J., Baetz, K., Keogh, M.C., Datta, N., Sawa, C., Kwok, T.C., Thompson, N.J., Davey, M.G., Pootoolal, J., Hughes, T.R., et al. (2004). Regulation of chromosome stability by the histone H2A variant Htz1, the Swr1 chromatin remodeling complex, and the histone acetyltransferase NuA4. Proceedings of the National Academy of Sciences of the United States of America 101, 13513-13518. Krogan, N.J., Keogh, M.C., Datta, N., Sawa, C., Ryan, O.W., Ding, H., Haw, R.A., Pootoolal, J., Tong, A., Canadien, V., et al. (2003). A Snf2 family ATPase complex required for recruitment of the histone H2A variant Htz1. Molecular cell 12, 1565-1576. Latham, J.A., and Dent, S.Y. (2007). Cross-regulation of histone modifications. Nature structural & molecular biology 14, 1017-1024. Le Masson, I., Yu, D.Y., Jensen, K., Chevalier, A., Courbeyrette, R., Boulard, Y., Smith, M.M., and Mann, C. (2003). Yaf9, a novel NuA4 histone acetyltransferase subunit, is required for the cellular response to spindle stress in yeast. Molecular and cellular biology 23, 6086-6102. Lee, C.K., Shibata, Y., Rao, B., Strahl, B.D., and Lieb, J.D. (2004). Evidence for nucleosome depletion at active regulatory regions genome-wide. Nature genetics 36, 900-905. Lee, K.K., and Workman, J.L. (2007). Histone acetyltransferase complexes: one size doesn't fit all. Nature reviews Molecular cell biology 8, 284-295. Li, B., Carey, M., and Workman, J.L. (2007). The role of chromatin during transcription. Cell 128, 707-719. Li, B., Pattenden, S.G., Lee, D., Gutierrez, J., Chen, J., Seidel, C., Gerton, J., and Workman, J.L. (2005). Preferential occupancy of histone variant H2AZ at inactive promoters influences local histone modifications and chromatin remodeling. Proceedings of the National Academy of Sciences of the United States of America 102, 18385-18390. Longtine, M.S., McKenzie, A., 3rd, Demarini, D.J., Shah, N.G., Wach, A., Brachat, A., Philippsen, P., and Pringle, J.R. (1998). Additional modules for versatile and economical PCR-based gene deletion and modification in Saccharomyces cerevisiae. Yeast (Chichester, England) 14, 953-961.
75
Lu, P.Y., Levesque, N., and Kobor, M.S. (2009). NuA4 and SWR1-C: two chromatin-modifying complexes with overlapping functions and components. Biochemistry and cell biology = Biochimie et biologie cellulaire 87, 799-815. Macurek, L., Lindqvist, A., Voets, O., Kool, J., Vos, H.R., and Medema, R.H. (2010). Wip1 phosphatase is associated with chromatin and dephosphorylates gammaH2AX to promote checkpoint inhibition. Oncogene 29, 2281-2291. Marks, P., Rifkind, R.A., Richon, V.M., Breslow, R., Miller, T., and Kelly, W.K. (2001). Histone deacetylases and cancer: causes and therapies. Nature reviews Cancer 1, 194-202. McMahon, S.B., Van Buskirk, H.A., Dugan, K.A., Copeland, T.D., and Cole, M.D. (1998). The novel ATM-related protein TRRAP is an essential cofactor for the c-Myc and E2F oncoproteins. Cell 94, 363-374. Millar, C.B., Xu, F., Zhang, K., and Grunstein, M. (2006). Acetylation of H2AZ Lys 14 is associated with genome-wide gene activity in yeast. Genes & development 20, 711-722. Mitchell, L., Lambert, J.P., Gerdes, M., Al-Madhoun, A.S., Skerjanc, I.S., Figeys, D., and Baetz, K. (2008). Functional dissection of the NuA4 histone acetyltransferase reveals its role as a genetic hub and that Eaf1 is essential for complex integrity. Molecular and cellular biology 28, 2244-2256. Mizuguchi, G., Shen, X., Landry, J., Wu, W.H., Sen, S., and Wu, C. (2004). ATP-driven exchange of histone H2AZ variant catalyzed by SWR1 chromatin remodeling complex. Science (New York, NY) 303, 343-348. Montellier, E., Boussouar, F., Rousseaux, S., Zhang, K., Buchou, T., Fenaille, F., Shiota, H., Debernardi, A., Hery, P., Curtet, S., et al. (2013). Chromatin-to-nucleoprotamine transition is controlled by the histone H2B variant TH2B. Genes Dev 27, 1680-1692. Morillo Prado, J.R., Srinivasan, S., and Fuller, M.T. (2013). The histone variant His2Av is required for adult stem cell maintenance in the Drosophila testis. PLoS genetics 9, e1003903. Morrison, A.J., Kim, J.A., Person, M.D., Highland, J., Xiao, J., Wehr, T.S., Hensley, S., Bao, Y., Shen, J., Collins, S.R., et al. (2007). Mec1/Tel1 phosphorylation of the INO80 chromatin remodeling complex influences DNA damage checkpoint responses. Cell 130, 499-511. Morrison, A.J., and Shen, X. (2009). Chromatin remodelling beyond transcription: the INO80 and SWR1 complexes. Nature reviews Molecular cell biology 10, 373-384. Musselman, C.A., and Kutateladze, T.G. (2011). Handpicking epigenetic marks with PHD fingers. Nucleic Acids Research. Musselman, C.A., Lalonde, M.E., Cote, J., and Kutateladze, T.G. (2012). Perceiving the epigenetic landscape through histone readers. Nature structural & molecular biology 19, 1218-1227. Narlikar, G.J., Fan, H.Y., and Kingston, R.E. (2002). Cooperation between complexes that regulate chromatin structure and transcription. Cell 108, 475-487. Nnakwe, C.C., Altaf, M., Cote, J., and Kron, S.J. (2009). Dissection of Rad9 BRCT domain function in the mitotic checkpoint response to telomere uncapping. DNA repair 8, 1452-1461. Nourani, A., Doyon, Y., Utley, R.T., Allard, S., Lane, W.S., and Cote, J. (2001). Role of an ING1 growth regulator in transcriptional activation and targeted histone acetylation by the NuA4 complex. Molecular and cellular biology 21, 7629-7640.
76
Nourani, A., Utley, R.T., Allard, S., and Cote, J. (2004). Recruitment of the NuA4 complex poises the PHO5 promoter for chromatin remodeling and activation. The EMBO journal 23, 2597-2607. Ohouo, P.Y., Bastos de Oliveira, F.M., Liu, Y., Ma, C.J., and Smolka, M.B. (2013). DNA-repair scaffolds dampen checkpoint signalling by counteracting the adaptor Rad9. Nature 493, 120-124. Peterson, C.L., and Cote, J. (2004). Cellular machineries for chromosomal DNA repair. Genes Dev 18, 602-616. Peterson, C.L., and Laniel, M.-A. (2004). Histones and histone modifications. Current Biology 14, R546-R551. Polo, S.E., and Jackson, S.P. (2011). Dynamics of DNA damage response proteins at DNA breaks: a focus on protein modifications. Genes Dev 25, 409-433. Raisner, R.M., Hartley, P.D., Meneghini, M.D., Bao, M.Z., Liu, C.L., Schreiber, S.L., Rando, O.J., and Madhani, H.D. (2005). Histone variant H2A.Z marks the 5' ends of both active and inactive genes in euchromatin. Cell 123, 233-248. Ranjan, A., Mizuguchi, G., FitzGerald, Peter C., Wei, D., Wang, F., Huang, Y., Luk, E., Woodcock, Christopher L., and Wu, C. (2013). Nucleosome-free Region Dominates Histone Acetylation in Targeting SWR1 to Promoters for H2A.Z Replacement. Cell 154, 1232-1245. Raser, J.M., and O'Shea, E.K. (2004). Control of stochasticity in eukaryotic gene expression. Science (New York, NY) 304, 1811-1814. Reid, J.L., Iyer, V.R., Brown, P.O., and Struhl, K. (2000). Coordinate regulation of yeast ribosomal protein genes is associated with targeted recruitment of Esa1 histone acetylase. Molecular cell 6, 1297-1307. Reinke, H., and Horz, W. (2003). Histones are first hyperacetylated and then lose contact with the activated PHO5 promoter. Molecular cell 11, 1599-1607. Rolfes, R.J., Zhang, F., and Hinnebusch, A.G. (1997). The transcriptional activators BAS1, BAS2, and ABF1 bind positive regulatory sites as the critical elements for adenine regulation of ADE5,7. The Journal of biological chemistry 272, 13343-13354. Rosa, S., and Shaw, P. (2013). Insights into chromatin structure and dynamics in plants. Biology 2, 1378-1410. Rossetto, D., Cramet, M., Wang, A.Y., Steunou, A.L., Lacoste, N., Schulze, J.M., Cote, V., Monnet-Saksouk, J., Piquet, S., Nourani, A., et al. (2014). Eaf5/7/3 form a functionally independent NuA4 submodule linked to RNA polymerase II-coupled nucleosome recycling. The EMBO journal 33, 1397-1415. Rufiange, A., Jacques, P.E., Bhat, W., Robert, F., and Nourani, A. (2007). Genome-wide replication-independent histone H3 exchange occurs predominantly at promoters and implicates H3 K56 acetylation and Asf1. Mol Cell 27, 393-405. Santisteban, M.S., Kalashnikova, T., and Smith, M.M. (2000). Histone H2A.Z regulats transcription and is partially redundant with nucleosome remodeling complexes. Cell 103, 411-422. Schmitt, M.E., Brown, T.A., and Trumpower, B.L. (1990). A rapid and simple method for preparation of RNA from Saccharomyces cerevisiae. Nucleic acids research 18, 3091-3092. Selleck, W., Fortin, I., Sermwittayawong, D., Cote, J., and Tan, S. (2005). The Saccharomyces cerevisiae Piccolo NuA4 histone acetyltransferase complex requires the Enhancer of Polycomb A domain and chromodomain to acetylate nucleosomes. Mol Cell Biol 25, 5535-5542.
77
Shiloh, Y. (2003). ATM and related protein kinases: safeguarding genome integrity. Nature reviews Cancer 3, 155-168. Shiloh, Y., and Ziv, Y. (2013). The ATM protein kinase: regulating the cellular response to genotoxic stress, and more. Nature reviews Molecular cell biology 14, 197-210. Shogren-Knaak, M., Ishii, H., Sun, J.M., Pazin, M.J., Davie, J.R., and Peterson, C.L. (2006). Histone H4-K16 acetylation controls chromatin structure and protein interactions. Science (New York, NY) 311, 844-847. Smolka, M.B., Albuquerque, C.P., Chen, S.H., and Zhou, H. (2007). Proteome-wide identification of in vivo targets of DNA damage checkpoint kinases. Proceedings of the National Academy of Sciences of the United States of America 104, 10364-10369. Som, I., Mitsch, R.N., Urbanowski, J.L., and Rolfes, R.J. (2005). DNA-bound Bas1 recruits Pho2 to activate ADE genes in Saccharomyces cerevisiae. Eukaryotic cell 4, 1725-1735. Steunou, A.-L., Rossetto, D., and Côté, J. (2014). Regulating Chromatin by Histone Acetylation. In Fundamentals of Chromatin, J.L. Workman, and S.M. Abmayr, eds. (Springer New York), pp. 147-212. Struhl, K. (1998). Histone acetylation and transcriptional regulatory mechanisms. Genes Dev 12, 599-606. Su, T.T. (2006). Cellular responses to DNA damage: one signal, multiple choices. Annual review of genetics 40, 187-208. Syntichaki, P., Topalidou, I., and Thireos, G. (2000). The Gcn5 bromodomain co-ordinates nucleosome remodelling. Nature 404, 414-417. Talbert, P.B., and Henikoff, S. (2010). Histone variants--ancient wrap artists of the epigenome. Nature reviews Molecular cell biology 11, 264-275. Tan, M., Luo, H., Lee, S., Jin, F., Yang, J.S., Montellier, E., Buchou, T., Cheng, Z., Rousseaux, S., Rajagopal, N., et al. (2011). Identification of 67 histone marks and histone lysine crotonylation as a new type of histone modification. Cell 146, 1016-1028. Taverna, S.D., Li, H., Ruthenburg, A.J., Allis, C.D., and Patel, D.J. (2007). How chromatin-binding modules interpret histone modifications: lessons from professional pocket pickers. Nature structural & molecular biology 14, 1025-1040. Tirosh, I., and Barkai, N. (2008). Two strategies for gene regulation by promoter nucleosomes. Genome research 18, 1084-1091. Tong, A.H., Lesage, G., Bader, G.D., Ding, H., Xu, H., Xin, X., Young, J., Berriz, G.F., Brost, R.L., Chang, M., et al. (2004). Global mapping of the yeast genetic interaction network. Science (New York, NY) 303, 808-813. Unnikrishnan, A., Gafken, P.R., and Tsukiyama, T. (2010). Dynamic changes in histone acetylation regulate origins of DNA replication. Nature structural & molecular biology 17, 430-437. Utley, R.T., Ikeda, K., Grant, P.A., Cote, J., Steger, D.J., Eberharter, A., John, S., and Workman, J.L. (1998). Transcriptional activators direct histone acetyltransferase complexes to nucleosomes. Nature 394, 498-502. Utley, R.T., Lacoste, N., Jobin-Robitaille, O., Allard, S., and Côté, J. (2005). Regulation of NuA4 Histone Acetyltransferase Activity in Transcription and DNA Repair by Phosphorylation of Histone H4. Molecular and cellular biology 25, 8179-8190. West, M.H., and Bonner, W.M. (1980). Histone 2A, a heteromorphous family of eight protein species. Biochemistry 19, 3238-3245.
78
Wu, W.H., Alami, S., Luk, E., Wu, C.H., Sen, S., Mizuguchi, G., Wei, D., and Wu, C. (2005). Swc2 is a widely conserved H2AZ-binding module essential for ATP-dependent histone exchange. Nature structural & molecular biology 12, 1064-1071. Wysocki, R., Javaheri, A., Allard, S., Sha, F., Cote, J., and Kron, S.J. (2005). Role of Dot1-dependent histone H3 methylation in G1 and S phase DNA damage checkpoint functions of Rad9. Mol Cell Biol 25, 8430-8443. Xu, Y., Sun, Y., Jiang, X., Ayrapetov, M.K., Moskwa, P., Yang, S., Weinstock, D.M., and Price, B.D. (2010). The p400 ATPase regulates nucleosome stability and chromatin ubiquitination during DNA repair. The Journal of cell biology 191, 31-43. Xue, Y., Ren, J., Gao, X., Jin, C., Wen, L., and Yao, X. (2008). GPS 2.0, a tool to predict kinase-specific phosphorylation sites in hierarchy. Molecular & cellular proteomics : MCP 7, 1598-1608. Zhang, H., Richardson, D.O., Roberts, D.N., Utley, R., Erdjument-Bromage, H., Tempst, P., Cote, J., and Cairns, B.R. (2004). The Yaf9 component of the SWR1 and NuA4 complexes is required for proper gene expression, histone H4 acetylation, and Htz1 replacement near telomeres. Molecular and cellular biology 24, 9424-9436. Zhang, H., Roberts, D.N., and Cairns, B.R. (2005). Genome-wide dynamics of Htz1, a histone H2A variant that poises repressed/basal promoters for activation through histone loss. Cell 123, 219-231. Zhou, B.O., Wang, S.S., Xu, L.X., Meng, F.L., Xuan, Y.J., Duan, Y.M., Wang, J.Y., Hu, H., Dong, X., Ding, J., et al. (2010). SWR1 complex poises heterochromatin boundaries for antisilencing activity propagation. Molecular and cellular biology 30, 2391-2400. Zlatanova, J., Bishop, T.C., Victor, J.M., Jackson, V., and van Holde, K. (2009). The nucleosome family: dynamic and growing. Structure 17, 160-171.
