T H E C R O P J O U R N A L 1 ( 2 0 1 3 ) 2 – 1 4

Ava i l ab l e on l i ne a t www.sc i enced i r ec t . com

ScienceDirect

Identification and finemapping of two blast resistance genes inrice cultivar 93-11

Cailin Leia,1, Kun Haoa,1, Yilong Yanga, Jian Maa, Shuai Wanga, Jiulin Wanga,Zhijun Chenga, Shasha Zhaoa, Xin Zhanga, Xiuping Guoa,Chunming Wangb, Jianmin Wana,b,⁎aInstitute of Crop Science, Chinese Academy of Agricultural Sciences,The National Key Facility for Crop Gene Resources and Genetic Improvement, Beijing 100081, ChinabKey Laboratory of Crop Genetics and Germplasm Enhancement, Jiangsu Provincial Center of Plant Gene Engineering,Nanjing Agricultural University, Nanjing, Jiangsu 210095, China

A R T I C L E I N F O

⁎ Corresponding author at: Institute of CropResources and Genetic Improvement, Beijin

E-mail address: wanjm@njau.edu.cn (J. W1 Contributed equally to this work.

Peer review under the responsibility of Crop

2214-5141/$ – see front matter © 2013 ProducCrop Science, CAAS.http://dx.doi.org/10.1016/j.cj.2013.07.007

A B S T R A C T

Article history:Received 28 March 2013Received in revised form 15May 2013Accepted 14 June 2013Available online 10 July 2013

Rice blast, caused by Magnaporthe oryzae, is a major disease of rice almost worldwide. TheChinese indica cultivar 93-11 is resistant to numerous isolates of the blast fungus in China, andcan be used as broad-spectrum resistance resource, particularly in japonica rice breedingprograms. In this study, we identified and mapped two blast resistance genes, Pi60(t) andPi61(t), in cv. 93-11 using F2 and F3 populations derived from a cross between the susceptiblecv. Lijiangxintuanheigu (LTH) and resistant cv. 93-11 and inoculated with M. oryzae isolatesfrom different geographic origins. Pi60(t) was delimited to a 274 kb region on the short arm ofchromosome 11, flanked by InDel markers K1-4 and E12 and cosegregatedwith InDel markersB1 and Y10. Pi61(t) was mapped to a 200 kb region on the short arm (near the centromere) ofchromosome 12, flanked by InDel markers M2 and S29 and cosegregating with InDel markerM9. In the 274 kb region of Pi60(t), 93-11 contains six NBS-LRR genes including the two Pia/PiCO39 alleles (BGIOSGA034263 and BGIOSGA035032) which are quite close to the two Pia/PiCO39 alleles (SasRGA4 and SasRGA5) in Sasanishiki and CO39, with only nine amino acidsdiffering in the protein sequences of BGIOSGA035032 and SasRGA5. In the 200 kb region ofPi61(t), 93-11 contains four NBS-LRR genes, all of which show high identities in proteinsequencewith their correspondingNBS-LRR alleles in susceptible cv. Nipponbare. Comparisonof the response spectra and physical positions between the target genes and other R genes inthe same chromosome regions indicated that Pi60(t) could be Pia/PiCO39 or its allele, whereas

Keywords:Oryza sativaRice blastMagnaporthe oryzaeResistance geneGene mapping

Science, Chinese Academy of Agricultural Sciences, The National Key Facility for Crop Geneg 100081, China.an).

Science Society of China and Institute of Crop Science, CAAS.China Agricultural University.

tion and hosting by Elsevier B.V. on behalf of Crop Science Society of China and Institute of

Table 1 – Rice genotypes evaluated for b

ID Designation

1 93-11

2 LTH

3 IRBLa-A4 IRBLa-C5 Aichi Asahi6 CO397 IR64 a

8 IRBLta-K19 IRBLta-CT210 IRBLta-CP111 IRBL12-M12 IRBL19-A13 IRBL20-IR2414 IRBLta2-Pi15 IRBLta2-Re16 F-128-1

a Broad-spectrum blast resistant cultivar, harbPi27(t), Pi29(t), Pi30(t), Pi31(t) and Pi32(t) [59].

3T H E C R O P J O U R N A L 1 ( 2 0 1 3 ) 2 – 1 4

Pi61(t) appears to be different from Pita, Pita-2, Pi19(t), Pi39(t) and Pi42(t) in the same R genecluster. DNA markers tightly linked to Pi60(t) and Pi61(t) will enable marker-assisted breedingand map-based cloning.© 2013 Production and hosting by Elsevier B.V. on behalf of Crop Science Society of China

and Institute of Crop Science, CAAS.

1. Introduction

Rice blast, caused by the fungus Magnaporthe oryzae, is animportant disease in most rice production regions of the worldbecause of its devastating effects on yield. In this pathosystem,pathotype- or race-specific resistance follows the gene-for-generelationship [1].M. oryzae is highly variable, and loss of resistancein varieties is quite common [2,3], especially when resistance isbased on a single resistance (R) gene [4–6]. Nevertheless, theutilization of R genes is still considered to be the most effectiveand economical method to control the disease. A major strategyto develop more durable resistance is to combine multipleR genes that confer overlapping resistance spectra to multipleisolates/races of M. oryzae in a single variety [7]. In this regard,continued identification of new R genes in genetic resourcematerials is essential.

Genetic studies on blast resistance began as early as the 1960sandwere intensifiedwith the availability of genomesequences ofthe two subspecies of cultivated rice, Oryza sativa (ssp. japonicacultivar (cv.) Nipponbare and spp. indica cv. 93-11) and abundantgenetic markers [8–10]. To date, more than 70 R genes and somequantitative trait loci (QTL) have been identified and mapped onrice chromosomes [11–13]. These R genes are largely clustered onchromosomes 6, 11 and 12, and involve different specificities[11–15]. Development of DNA markers closely linked to the Rgenes not only sets the stage formarker-assisted selection (MAS)in rice breeding programs, but also facilitatesmap-based cloning.Some blast R genes have been finely mapped [11,12,15–21], andamong them Pib [22], Pita [23], Pi9 [24], Piz-t and Pi2 [25], Pid2 [26],Pi36 [27], Pi37 [28], Pikm [29], Pi5 [30], Pid3/Pi25 [31,32], Pit [33], Pish[34], pi21 [35], Pb1 [36], Pia/PiCO39 [37,38], Pi-kh/Pi54 [39], Pik [40],

last resistance.

R gene

Pi41(t), ?

None

Pia/PiCO39Pia/PiCO39Pia/PiCO39, Pi19(t)Pia/PiCO39Pi30(t)PitaPitaPitaPi12(t)Pi19(t)Pi20(t)Pita-2Pita-2Pita-2

oring six R genes, viz. Pi20(t)

Pik-p [41] and Pi1 [21] have been isolated.Markers tightly linked tothe R genes, and more recently, markers derived from cloned Rgenes should greatly facilitate pyramiding of the R genes intocultivars by MAS; for example, markers developed from Pita[42,43] and Pib [18].

The sequenced indica cv. 93-11 is a widely grown blastresistant cultivar and hybrid rice restorer in China [9,44–47]. It isresistant to M. oryzae races ZA49, ZE3 and ZG1 from Jiangsu,China [44], and to 80% of 45 M. oryzae isolates (22 from japonicaand 23 from indica) from other provinces in China [48]. Althoughblast R gene Pi41 was previously reported in cv. 93-11 [47],additional R genes must also be present [26,31,49–53]. Theobjectives of the present studywere to evaluate blast resistancein cv. 93-11 using awide range of ChineseM. oryzae isolates, andto identify and map R genes additional to Pi41.

2. Materials and methods

2.1. Rice genotypes and culture

Five rice cultivars, one near-isogenic line (NIL) and ten mono-genic lines (MLs)were used in this study (Table 1). Indica cv. 93-11(resistant, male parent) and japonica cv. Lijiangxintuanheigu(LTH, susceptible, female parent) were evaluated for reaction toM. oryzae isolates, and crossed to develop F2 and F3 populationsfor genetic analysis and gene mapping. Cultivars CO39, AichiAsahi and IR64 togetherwith 11 NILs/MLs, each carrying a singleR gene (Table 1), were used as reference lines to differentiate thegenesmapped in 93-11 from previously reported R genes. 93-11,LTH, Aichi Asahi, IR64 and F-128-1 are maintained at the

Remark Reference

Chinese elite indica cultivar,R gene donor

[47]

Lijiangxintuanheigu, japonicacultivar with no blast R genes

[54,55]

LTH monogenic line [38,56]LTH monogenic line [38,56]Japonica variety [38,56,57]Indica cultivar [38,56]Indica cultivar [58,59]LTH monogenic line [56]LTH monogenic line [56]LTH monogenic line [56]LTH monogenic line [56]LTH monogenic line [56]LTH monogenic line [56]LTH monogenic line [56]LTH monogenic line [56]LTH near-isogenic line [54,55]

, Pita, Pib, Pik-s, Piz-t, and one unknown gene [58], or six R genes, Pi25(t),

4 T H E C R O P J O U R N A L 1 ( 2 0 1 3 ) 2 – 1 4

Institute of Crop Science, Chinese Academy of AgriculturalSciences (CAAS), Beijing, China. CO39 and the other 10MLswerekindly provided by Dr. Yoshimichi Fukuta, International RiceResearch Institute (IRRI), Los Baños, The Philippines.

Seedlings were grown in 60 cm × 30 cm × 5 cm plastic seed-ling trays in a greenhouse. Pre-soaked seeds of test materialswere sown in rows together with the parents. For geneticanalysis and gene mapping, 300 seeds of the F2 population and15 seeds of each parent were sown per tray. For differentiating Rgenes, 15 seeds of each of the two parents and 11 reference lines(Table 1) were sown in each tray with two replications.

2.2. M. oryzae isolates and conidial inoculation

A total of 495 M. oryzae isolates from different rice growingregions were used to evaluate the reaction of cv. 93-11. Amongthem, five isolates — three indica-derived isolates, 001-99-1(pathotype 241.6, from Jiangsu of China), RB17 (pathotype423.2, from Hunan of China), and GZ26 (pathotype 541.0, fromGuizhou of China), and two japonica-derived isolates, 99-26-2

Table 2 – Primer sequences of InDel markers used for mapping

Marker Primer sequence (5′–3′) P

11-2 F: TGATGAGCTCTCACTTGTTGAAAR: CGTACATTGGCTTATGTGATCTG

B3 F: GACGAAGAGAGTAAACGGCTTCTTCR: CGGACCTTCCGTTATACTCCTTCGGTTT

K4-1 F: AACAGCGTGCTTCTCTGACTGCACR: CGGCTACGAGCCAATGCACGT

K2-1 F: TGTGAGCGTGAAACCCGGTGR: ACCTCCGGTGAACTTATTCCTCGT

K1-4 F: TGGCCATTTCGGTTGGTTACACR: ACGCAGGTAGTACAAAGTACCGAT

B1 F: TTGCTATTGAAAGTGTCAGTCGCACR: GCTCGGCGAATTGCTCCGCAGGCTTGAC

Y10 F: CCGTTCCCGTGAAATATTGGGCAATR: GCAAAGACCTGGCTGAGCAACTGAAGAA

E12 F: CTGCCCCGATTTAGACGGR: GACGCGACACGGCGTTGGTCGC

H6 F: GGGTGATGTTGAACAGGR: GGATCGCCACATTCAAGCAAC

H4 F: GATCTATCTCTTACAGTTAGAAGGR: GCAAAGAAAGCTACAAC

B14 F: GATCTTGCTGTTATAAATCAGCCR: AAAGCCGTGATTCTTTAGATCGTCGTTT

C13 F: GGTGCTATTTGGTAGCCCTACR: GCGAGAAGTAGAAGTTG

C7 F: GGCATTGAAGGATCGAGACCTGGGR: ACCGTCGGCCCCGTTAAGGT

C6 F: TCGATGACAACTAGCATGATTAGGACTR: TCGGCTACCATGTTCCTTCTTCA

A4 F: AGAATCACGGGCGTAACAAAGATACR: GGAACTACACAGGACCTACG

11-4 F: TGAGATGTGGCCATTAAGGAR: TGGCAAAAGATCTTATATTTACTTCG

11-7 R TGATAAATCCCATACTAAGGATCTG 1F GCTTAGTCCGAGGCCTTCA 1

S11-6-2 R ACGTTGCCTGACGAAGAGTT 1F CGCAGCAGAATAGTCCACAA 1

a Genomic position based on Nipponbare sequence by BLAST analysis in

(pathotype 437.1, from Beijing of China) and P-2b (pathotype303.0, from Japan) — provided clear resistant or susceptiblereactions on the two parents and 11 reference lines (Table 1)and were chosen for further studies.

All isolates are stored at the Institute of Crop Science, CAAS,Beijing, China. Inoculum preparation and seedling inoculationfollowed the procedure described by Chen et al. [60]. Diseasereactionswere evaluated6–7days after inoculationonanumericalscale ranging from 0–3 (resistant) to 4–5 (susceptible) as describedbyMackill andBonman [4]. Observed reactionswere verified in thefield following injection-inoculation as described by Lei et al. [61].

2.3. Development of markers and construction of a linkagemap

Genomic DNA was extracted from seedling leaves using theCTAB method [62]. Two sets of DNA bulks, each containing aresistant pool and a susceptible pool, were prepared followingthe methods described by Yang et al. [47]. The first set (set 1,for Pi60(t)) was assembled with equimolar amounts of DNA

gene Pi60(t).

hysical position (bp) a Expectedsize (bp)

Annealingtemperature (°C)

Start End

3,345,901 3,345,923 133 573,346,011 3,346,0335,915,215 5,815,239 173 575,915,360 5,915,3876,062,943 6,062,966 257 576,063,180 6,063,2006,291,389 6,291,408 264 576,291,630 6,291,6536,374,031 6,374,052 116 576,374,124 6,374,1476,540,523 6,540,547 225 576,540,721 6,540,7486,628,112 6,628,136 248 576,628,332 6,628,3596,648,601 6,648,618 176 576,648,755 6,648,7766,701,912 6,701,928 132 536,702,023 6,702,0436,955,998 6,956,021 139 556,856,120 6,956,1367,003,526 7,003,548 172 577,003,670 7,003,6977,053,861 7,053,881 176 577,054,020 7,054,0367,406,821 7,406,844 203 577,407,004 7,407,0237,505,090 7,505,116 209 577,505,276 7,505,2987,817,732 7,817,756 178 577,817,890 7,817,9098,375,365 8,375,384 155 578,375,494 8,375,5196,002,655 16,002,679 152 576,002,788 16,002,8066,047,300 16,047,319 213 576,047,493 16,047,512

the Gramene database.

5T H E C R O P J O U R N A L 1 ( 2 0 1 3 ) 2 – 1 4

from 15 isolate 001-99-1-resistant or 15 susceptible F2 individ-uals, and the second set (set 2, for Pi61(t)) from 15 isolate99-26-2-resistant or susceptible F2 individuals.

Two hundred and ninety simple sequence repeats (SSR) and212 insertion–deletion (InDel)markers distributed evenly acrossthe genome were screened for polymorphisms between therespective parents. Polymorphic markers were then subjectedto bulked segregant analysis (BSA) combined with recessiveclass analysis (RCA) [63,64]. Candidate markers linked withresistant phenotypes were further confirmed using the F2individuals comprising the resistant and susceptible pools. Tofinely map the R genes, two populations were developed. Thefirst consisted of 1629 F2 individuals that were extremely

Table 3 – Primer sequences of InDel and SSR markers used for

Marker Primer sequence (5′–3′) P

G3 F: AGTAATATTTGTGATACCAAAT 3R: TCTACTAATACCTTCGTTTCAT 3

G2 F: CAGACCATTGAGATCAGTC 6R: CGACTACTGACAGGATTTAAC 6

G7 F: GGTGCCGTGAGGACGCAGC 8R: GTCGCCCCTGAGGTGGGAGCG 8

RM101 b F: ACACAACATGTTCCCTCCCATGC 8R: GTGAATGGTCAAGTGACTTAGGTGGC 8

E4 F: GAATTCGACGAAGTGTCTCTCCG 8R: ACGTACCTTATAAACTCTTCCGTA 8

T7 F: TCTAAACTCTGCATCAGATAATTAC 9R: TGGTCATAGGGACATTCTCGTC 9

S13 F: GAGAGAAAGAGGGCGGAGTC 9R: ACATCCAACGCTCCAAAGAG 9

M1 F: CGCTCCTTTCCCGGCGTCTC 9R: TCCCCACGAGCCTCTCCACC 9

S1 F: CGGAATCATCCCTAGACAGG 9R: GCACCTCCACCTTTGTGTCT 9

S9 F: GAAAAGGGATGACGAATTGC 9R: GAATCGTTCGTATCGCGTCT 9

M2 F: GGCAGAGCGAGTGCTTGTCGAG 9R: TGCCCAGACAGTTGGATTGGACA 9

M9 F CGATTTTCCTTCTCACCTGGGGG 9R TGGCCTATGGCTGCTGGAAGT 9

S29 F: CATCTCCCCCTAGTCGCTCT 10R: AGCAACAGGAACCAAACACC 10

G8 F: CACGTATTCACGTCGGTC 10R: GTGTGAATTGACCCTTG 10

12-5 F: TGGGCAACTGAATCTAACCA 10R: GGAGATGATGATGCGGTGAT 10

P1 F ACTTCAATCTTCTTTTTATATG 10R ACTGCCACTATTGAGATCGAGTAC 10

RRS63 b F CACCTGGCTCCTCATCAAGT 11R ATCATGTCCGATTCCTTTGG 11

RM27990 b F: ACTTACACACTTGATCCGTTCG 12R: CCAGGATTTATTCGACAAGC 12

12-6 F: CAACTAAAACCAACACAAAATCCA 13R: TGTCTAGTTGCATGTCTGAGTGTC 13

12-7 R: GTGGCTGTTTAGGAGCGTTT 15F: CAACCAAACAGCAATGCAAC 15

C4-3 F ACCTTGCAGCGCTATTTCGG 16R ACGCTGTCCAAAGGCATCCA 16

RM519 b F: AGAGAGCCCCTAAATTTCCG 19R: AGGTACGCTCACCTGTGGAC 19

a Genomic position of markers based on the Nipponbare sequence by BLb SSR marker.

susceptible to isolate 001-99-1 and 725 that were extremelyresistant. The second consisted of 1911 F2 individuals extremelysusceptible to isolate 99-26-2. Additional sets of SSR and InDelmarkers in the target R gene regions identified by the initiallinkage analysis were used for alignment within the criticalregion of the genomic sequences of 93-11 andNipponbare usingthe software Premier 3 (http://www.premierbiosoft.com/).

The PCR amplifications were performed in 25 μL volumescontaining 50 ng template, 0.2 μmol L−1 of each primer,1.5 mmol L−1 MgCl2, 0.02 μmol L−1 dNTP and 1 U Taq polymer-ase. The PCR cycling profile consisted of initial denaturation at94 °C for 5 min, followed by 35 cycles of 94 °C for 60 s, 55–58 °Cfor 30 s, and 72 °C for 60 s, with a final extension at 72 °C for

mapping gene Pi61(t).

hysical position (bp) a Expectedsize (bp)

Annealingtemperature (°C)

Start End

,228,265 3,228,286 154 57,228,397 3,228,418,953,805 6,953,825 175 57,953,961 6,953,979,237,561 8,237,579 133 57,237,693 8,237,673,826,555 8,826,577 300 55,826,829 8,826,854,886,134 8,886,156 125 57,886,238 8,886,259,257,162 9,257,186 285 57,257,425 9,257,446,439,535 9,439,554 163 60,439,670 9,439,689,783,990 9,784,009 689 58,783,320 9,783,339,841,854 9,841,873 237 59,842,072 9,842,091,903,377 9,903,396 176 60,903,525 9,903,544,925,293 9,925,314 662 58,924,653 9,924,675,985,472 9,985,494 880 58,984,625 9,984,645,124,186 10,124,205 234 60,124,400 10,124,419,274,859 10,274,876 134 55,274,976 10,274,992,472,908 10,472,927 176 57,473,064 10,473,083,627,961 10,627,982 161 57,628,099 10,628,122,222,006 11,222,025 234 55,222,220 11,222,239,855,086 12,855,107 130 57,855,196 12,855,215,047,393 13,047,416 123 57,047,492 13,047,515,569,682 15,569,701 206 57,569,868 15,569,887,680,925 16,680,944 94 57,680,999 16,681,018,973,101 19,973,120 122 57,973,222 19,973,203

ASTN analysis in the Gramene database.

Table 5 – Resistance spectra of cv. 93-11 to 495 M. oryzaeisolates from different rice-growing regions in China andfrom Japan.

Origin ofisolate

Number ofisolates

Number ofavirulentisolates

Frequencyof avirulentisolates (%)

Japonica rice-growingregion

215 186 86.51

Beijing, China 11 11 100.00Tianjin, China 9 9 100.00Liaoning, China 30 30 100.00Jilin, China 28 28 100.00Hebei, China 37 35 94.59Heilongjiang, China 41 31 75.61Ningxia, China 51 34 66.31Japan 8 8 100.00Indica rice-growingregion

280 188 67.14

Jiangsu, China 27 25 92.59Yunnan, China 4 3 75.00Guangdong, China 37 27 72.97Zhejiang, China 13 9 69.23Sichuan, China 39 32 82.05Hunan, China 66 50 75.76Fujian, China 68 32 47.05Guizhou, China 3 1 33.33Guangxi, China 14 2 14.29Jiangxi, China 9 7 77.78

6 T H E C R O P J O U R N A L 1 ( 2 0 1 3 ) 2 – 1 4

7 min. PCR products were separated on 8% non-denaturingpolyacrylamide gels and visualized using the silver stainingmethod described by Sanguinetti et al. [65]. InDel and SSRprimers linked to the R genes in cv. 93-11 are listed in Tables 2and 3. Genetic distances between adjacent loci were estimatedas Nr/2NT (Nr being the number of recombinants, and NT theoverall population size) [47,66].

2.4. Construction of physical maps and identification ofcandidate R genes

The physical map of the target locus was constructed basedon Nipponbare contigs (http://www.gramene.org/). The 93-11contigs were also anchored to this framework using thelinked markers. Candidate genes within the target region werepredicted and annotated using the Gramene database (http://www.gramene.org/). Each candidate NBS-LRR (nucleotidebinding site-leucine rich repeat) gene in cv. 93-11was amplifiedusing specific primers (Table 4) designed from the Nipponbaresequence in the Gramene database, and then sequenced byBeijing Biomed Co. Ltd., Beijing. DNA and protein sequenceswere predicted using the softberry program (http://linux1.softberry.com/), and then alignedwithNipponbare homologuesusing the Gramene and EBI needle programs (http://www.ebi.ac.uk/).

Total 495 374 75.56

3. Results

3.1. Blast resistance spectrum of cv. 93-11

A total of 495 M. oryzae isolates were evaluated (Table 5).Cultivar 93-11 was resistant to 86.5% (186/215) of japonica-derived isolates collected from northern China (Beijing, Tianjin,Liaoning, Jilin, Hebei, Heilongjiang and Ningxia) and Japan, and67.1% (188/280) of indica-derived isolates collected fromsouthernChina (Jiangsu, Yunnan, Guangdong, Zhejiang, Sichuan, Hunan,Fujian, Guizhou and Guangxi), an average of 75.6% (374/495).

In a more local context, 93-11 was resistant to 92%–100% of150 isolates from Beijing, Tianjin, Liaoning, Jilin, Hebei, Jiangsuof China and Japan (Table 5). This indicated that 93-11 could beused as a resistance resource in most japonica growing regionsand in some indica regions, such as Jiangsu.

3.2. Genetic analysis of blast resistance in cv. 93-11

TheF2 population derived from the cross LTH × 93-11 segregated3R:1S when challenged with the indica-derived isolate 001-99-1

Table 4 – Primers used for PCR amplification of entire genomic

Locus Forward primer

SasRGA4 GTACCTATGGTCAACAATGG CGSasRGA5 CGCAAGCTTGCGCTGTCCATCTTAAATGTGCAC CGOs12g17410 TCCCAGTTCACACCTCGTAACTTGAAGA GCOs12g17420 CCAGAGACAAAAGACCAATGGGAGC TGOs12g17430 CGCGCGCGTGATCAACAATAGG ACOs12g17480 GCGGCGCCTGAGGTGAATATGT GCOs12g17490 ACCCCTCAACTACCAGCTGCCC GC

and japonica-derived isolate 99-26-2 (Table 6), suggesting that theresistance of 93-11 to each of the two isolates was controlled byone dominant R gene.

To determine whether the same genes were involved, 153001-99-1-susceptible F2 individuals were planted and injection-inoculated with isolate 99-26-2. A 3R:1S segregation ratio wasobserved, indicating that the genesweredifferent andgeneticallyindependent. We tentatively named them Pi60(t) and Pi61(t),effective against isolates 001-99-1 and 99-26-2, respectively.

3.3. Genetic mapping of Pi60(t) and Pi61(t)

Two hundred and twelve InDel and 290 SSR markers werescreened for polymorphisms between parents 93-11 and LTH,and between the two sets of DNA bulks. Six InDelmarkers, viz.11-2, B3, C6, 11-4, 11-7 and S11-6-2 (Table 2), on chromosome11 were polymorphic between both parents and DNA bulks forgene Pi60(t) (set 1); and InDel markers 12-1 and 12-6, and SSRmarkers RM101 and RM519, (Table 3) on chromosome 12,showed distinct polymorphisms between both parents and

fragments of related candidate NBS-LRR genes in cv. 93-11.

Reverse primer Expectedsize (bp)

CGGATCCGCGCCACGTGAAGATTCTAGATCCTTGTC 6332CGGATCCGCGCCAGATAATATCGTGGGGTAC 7064TCATTGACAGTCAGGCTACCCACA 4792GATCCTGATGCTGAACCTCCTCC 4040AGCAAAGGAAAAAGGGACCTCAACA 2018TCAGGCATTGCTCCCTGCAT 4921AACTCACGCGCCTTGACTCT 4753

Table 6 – Segregation of blast resistance to two isolates inF2 population of LTH × 93-11.

Isolate a No ofindividuals

R:S χ23:1 P-value

001-99-1 (241.6) 373 257:116 0.010 0.75–0.9599-26-2 (437.1) 632 482:150 0.530 0.30–0.50

153b 114:39 0.002 >0.95

a The number in the parenthesis after the M. oryzae isolate is thepathotype code of each isolate based on avirulence or virulence on12 Kiyosawa et al. differential varieties [67].b These 153 individuals were susceptible to isolate 001-99-1 afterspray inoculation.

7T H E C R O P J O U R N A L 1 ( 2 0 1 3 ) 2 – 1 4

DNA bulks for gene Pi61(t) (set 2). These polymorphic markerswere validated by genotyping individuals in the respectivepopulations. For rough mapping of the Pi60(t) and Pi61(t)loci, 160 001-99-1-susceptible F2 individuals and 124 99-26-2-

Fig. 1 – Genetic and physical map of the Pi60(t) region. a: Rough gnumber above the bold horizontal line: genetic distance (cM); CENsusceptible F2 plants. In parentheses, numbers of recombinants;recombinants identified from 745 resistant F2 plants; d: PhysicalThe colored horizontal block: BAC/PAC clone; vertical red dashedgene; e: Physical map of the Pi60(t) region based on the 93-11 sequin 93-11 sequence; vertical red dashed line: marker positions; re

susceptible F2 individuals were further subjected to linkageanalysis with the above respective polymorphic markers forthe two R genes. Pi60(t) was delimited to a 8.8 cM interval onthe short arm of chromosome 11 by flanking markers B3(2.5 cM) and A4 (5.3 cM) (Fig. 1-a); and Pi61(t) was delimited toa 24.4 cM interval near the centromere of chromosome 12 byflanking markers G2 (12.4 cM) and 12-6 (12.0 cM) (Fig. 2-a).

For fine mapping of the Pi60(t) locus, 1629 001-99-1-susceptible F2 individuals were genotyped with the flankingmarkers B3 and C6, and 12 newly developed parental polymor-phic InDel markers in the target interval of 8.8 cM, namely,K4-1, K2-1, K1-4, B1, Y10, E12, H6, H4, B14, C13, C7 and C6(Table 2). Pi60(t) was narrowed to a 0.58 cM interval (629 kb) onchromosome 11, flanked by InDel markers K1-4 (0.49 cM) andB14 (0.09 cM) and it co-segregated with five InDel markers (B1,Y10, E12, H6 and H4; Fig. 1-b). To further reduce the Pi60(t)region, 745 001-99-1-resistant F2 individuals were also geno-typed with the above 14 markers, and five individuals, P118, P6,

enetic map of Pi60(t) using 160 susceptible F2 plants. The, centromere; b: Fine genetic map of map of Pi60(t) using 1629c: Marker genotypes and response phenotypes of fivemap of the Pi60(t) region based on the Nipponbare sequence.line: marker positions; red bold horizontal line: predictedence. The colored horizontal block: scaffold; white block: gapd bold horizontal line: predicted gene.

Fig. 2 – Genetic and physical map of the Pi61(t) region. a: Rough genetic map of Pi61(t) using 124 susceptible F2 plants. Thenumbers above the bold horizontal line, genetic distance (cM); CEN, centromere; b: Fine geneticmap ofmap of Pi61(t) using 1911susceptible F2 plants. The numbers in parentheses, number of recombinants; c: Physical map of the Pi61(t) region based onNipponbare sequence. Colored horizontal block, BAC/PAC clone; vertical red dashed line, marker positions; red bold horizontalline, predicted gene; d: Physical map of the Pi61(t) region based on the 93-11 sequence. Colored horizontal block, scaffold; whiteblock, gap in 93-11 sequence; vertical red dashed line, marker positions; red bold horizontal line, predicted gene.

8 T H E C R O P J O U R N A L 1 ( 2 0 1 3 ) 2 – 1 4

P115, P11 and P2, were identified as distinct recombinants withat least one crossover between marker loci K1-4 and E12(Fig. 1-c). The F3 progenies derived from these five recombinantsshowed the expected segregating or homozygous resistantresponses after challenge with isolate 001-99-1, completelycorresponding to their genotypes at the two marker loci(Fig. 1-c). Thus Pi60(t) was delimited to a 274 kb region flankedby InDel markers K1-4 and E12.

For fine mapping of the Pi61(t) locus, a total of 2102 99-26-2-susceptible F2 individuals were genotyped with 14 InDel andSSRmarkers, viz. G2, G7, RM101, E4, T7, M1, M2, M9, G8, 12-5, P1,RRS63, RM27990 and 12-6 (Table 3). As a result, Pi61(t) waslocated to a 0.15 cM interval (200 kb) on the short arm ofchromosome 12, flanked by markers M2 (0.10 cM) and S29(0.05 cM) and co-segregating with marker M9 (Fig. 2-b).

3.4. Construction of physical maps of Pi60(t) and Pi61(t)

For Pi60(t), the target 274 kb region (6,374,147–6,648,601 bp) wascovered by four PAC/BAC clones, including 48 putative genesannotated in the Gramene and TIGR databases (Fig. 1-d); theseincluded 8 intact NBS-LRR genes (Os11g11550, Os11g11580,Os11g11770, Os11g11790, Os11g11810, Os11g11940, Os11g11950and Os11g11960), 12 expressed proteins, 16 hypothetical pro-teins and 12 retrotransposons. Sequence alignment of theNBS-LRR genes showed that 93-11 contained only six NBS-LRRgenes, viz. BGIOSGA034264, BGIOSGA034263, BGIOSGA035032,BGIOSGA035036, BGIOSGA034259 and BGIOSGA034258, corre-sponding to Os11g11770, Os11g11790 (SasRGA4 allele of Pia),Os11g11810 (SasRGA5 allele of Pia), Os11g11940, Os11g11950 andOs11g11960at identity levels of 79.1%, 89.5%, 45.7%, 96.4%, 84.5%and 89.2% in protein sequence, respectively.

For Pi61(t), the target 200 kb region (9,924,675–10,124,186)in the Nipponbare sequence was covered by six PAC/BACclones, including 44 putative genes annotated in theGramene and TIGR database (Fig. 2-c), viz. 5 tandem NBS-LRR type genes, Os12g17410, Os12g17420, Os12g17430,Os12g17480 and Os12g17490 in a 40 kb cluster, 21 retro-transposons, 1 transposon, 11 hypothetical proteins and 6expressed proteins. However, only four NBS-LRR genes canbe amplified in cv. 93-11 using the specific primers (Table 4),viz. BGIOSGA018510, BGIOSGA018508, BGIOSGA018507 andBGIOSGA018506, corresponding to Os12g17410, Os12g17430,Os12g17480 and Os12g17490 at identity levels of 68.7%, 99.3%(2-amino acid differences), 99.7% (3-amino acid differences)and 99.7% (3-amino acid differences) in protein sequences,respectively.

3.5. Allelism of Pi60(t) and Pia/PiCO39

Two other major blast R genes, Pi30(t) and cloned Pia/PiCO39,were previously mapped in the vicinity of Pi60(t) (6,374,147–6,648,601 bp) on chromosome 11 [11,37,38]. Pi30(t) was roughlylocated within an interval of 6.1 Mb (441,392–6,578,785), andpresumed to be Pia [59]. Sequencing of the two Pia/PiCO39alleles in 93-11 showed that the two alleles, viz. BGIOSGA034263and BGIOSGA035032, corresponded with the dual gene func-tions required of Pia/PiCO39, SasRGA4 and SasRGA5, respective-ly, at identity levels of 100 and 99.19% in protein sequence[37,38]. The variance of 0.81% (nine amino acids) between theprotein sequences of BGIOSGA035032 and SasRGA5 was in theHMA domain (amino acids 1001–1070), C′-end (amino acids1071–1116) and theNBSdomain (amino acid 416: V → M) (Fig. 3).The slight variance of the two Pia/PiCO39 alleles in cv. 93-11may

Fig. 3 – Amino-acid alignment of SasRGA5 and BGIOSGA035032. SasRGA5: the second Pia/PiCO39 allele in cv. Sasanishiki;BGIOSGA035032: the second Pia/PiCO39 allele in cv. 93-11.

9T H E C R O P J O U R N A L 1 ( 2 0 1 3 ) 2 – 1 4

Table 7 – Reactions of 16 rice genotypes to five M. oryzae differential isolates.

Cultivar or line R gene Isolate (pathotype codea)

001-99-1(241.6)

P-2b(303.0)

RB17(423.2)

GZ26(541.0)

99-26-2(437.1)

93-11 Pi60(t), Pi61(t) R(0)b R(0) S(5) R(0) R(0)LTH None S(5) S(5) S(5) S(5) S(5)IRBLa-A Pia/PiCO39 R(1) S(5) S(5) R(0) S(5)IRBLa-C Pia/PiCO39 R(1) S(5) S(5) R(1) S(5)Aichi Asahi Pia/PiCO39, Pi19(t) R(1) S(5) S(5) R(0) S(4)CO39 Pia/PiCO39 R(1) R(0) S(4) R(0) S(4)IR64c Pi30(t) R(1) R(1) R(1) R(0) R(0)IRBLta-K1 Pita S(5) S(4) R(1) R(0) S(4)IRBLta-CT2 Pita S(4) S(4) R(2) R(0) S(4)IRBLta-CP1 Pita S(5) S(5) S(5) S(4) S(4)IRBL12-M Pi12(t) S(5) R(0) S(4) R(0) R(0)IRBL19-A Pi19(t) S(4) S(4) S(5) S(4) S(5)IRBL20-IR24 Pi20(t) R(1) R(1) S(5) R(0) R(2)IRBLta2-Pi Pita-2 S(5) S(5) R(0) R(0) S(4)IRBLta2-Re Pita-2 S(5) S(5) R(0) R(0) S(4)2F-128-1 Pita-2 S(5) S(4) R(1) S(4) S(5)

a Based on avirulence or virulence to 12 Kiyosawa et al. differential varieties [67].b Number in parenthesis after R/S is the response level to the corresponding isolate [4].c IR64 is a broad-spectrum blast resistant cultivar, harboring six R genes, viz. Pi20(t), Pita, Pib, Pik-s, Piz-t and one unknown gene [58], or six R genes,Pi25(t), Pi27(t), Pi29(t), Pi30(t), Pi31(t) and Pi32(t) [59].

10 T H E C R O P J O U R N A L 1 ( 2 0 1 3 ) 2 – 1 4

not affect the function of Pia/PiCO39 because cultivar 104(Peh-kuh-tsao-tu) with the same two Pia alleles as 93-11 wasearlier deduced to harbor just the Pia gene [37]. In addition,the Pi60(t)-differential isolate 001-99-1 was avirulent to all fourPia/PiCO39-harboring lines, namely, IRBLa-A, IRBLa-C, AichiAsahi and CO39 (Table 7). These results indicated that Pi60(t)could be Pia/PiCO39 or its allele.

Differences in amino acids aremarked in rectangular blocks.

3.6. Differentiation of Pi61(t) from other blast R genes

Eleven blast R genes, namely, Pita, Pita-2, Pi6(t), Pi12(t), Pi19(t),Pi20(t), Pi21(t), Pi39(t), Pi42(t), Pi58(t) and Pi157(t), are reportedin the vicinity of Pi61(t) (9,924,675–10,124,186). Their targetregions were roughly 5.6 kb (10,603,772–10,609,330), 3.1 Mb(10,078,620–13,211,331), 14.8 Mb (4,053,339–18,867,450), 8.1 Mb(6,988,220–15,120,464), 4.6 Mb (8,826,555–13,417,087), 3.6 Mb(6,988,220–10,603,823), 9.4 Mb (6,988,220–16,395,622), 38 kb(10,614,346–10,652,094), 4.2 Mb (8,073,819–12,248,913), 3.4 Mb(7,461,555–10,900,056) and 9.2 Mb (8,826,555–18,050,447), respec-tively [11,57,68–71]. To distinguish Pi61(t) from neighboring Rgenes, eight monogenic lines for Pita, Pita-2, Pi12(t), Pi19(t) andPi20(t), i.e., IRBLta-CT2, C104PKT, IRBLta2-Pi, IRBLta2-Re,F128-1, IRBL12-M, IRBL19-A and IRBL20-IR24, were tested withfive differential isolates, 001-99-1, P-2b, RB17, GZ26 and 99-26-2,and compared with the donor 93-11 (Table 7). Differentialreactions were clearly observed among the eight lines, exceptfor IRBL12-M and IRBL20-IR24 (Table 7), suggesting that Pi61(t)was different from Pita, Pita-2 and Pi19(t).

Pi39(t) was at least 490 kb (10,124,186–10,614,346) awayfrom Pi61(t) according to the distances between markers mosttightly linked to the two genes. In addition, Pi39(t) was mappedusing the same differential isolate CHL724 as was Pi41, which

also originated from cv. 93-11 and delimited to 16,534,669–16,588,406 bp on chromosome 12 [47,69]. This indicated thatPi39(t) could not be present in 93-11 together with Pi41.Therefore, we concluded that Pi61(t) was different from Pi39(t).As for Pi42(t), its co-segregating markers, including RRS63, wereat least 0.19 cM from Pi61(t) (Fig. 2-b). The target region of Pi42(t)contained six candidate NBS-LRR genes, and among themLOC_Os12g18374 was short-listed as a potential candidate ofPi42(t) based on restriction analysis of 11 candidate R gene-derived sequence tagged sequence (CRG-STS) markers [70].However, LOC_Os12g18374 (10,621,450–10,630,781) was at least497 kb (10124186–10621450) from Pi61(t). This indicated thatPi61(t) was be different from Pi42(t). For the other six Rgenes, appropriate differential isolates (for Pi12(t) and Pi20(t))or mono-genic lines (for Pi6(t), Pi21(t), Pi58(t) and Pi157(t)) arelacking, and therefore we could not distinguish Pi61(t) fromthem.

4. Discussion

The availability of public sequence information for rice subspe-cies japonica cv. Nipponbare and the indica cv. 93-11 has enabledthe development of high density molecular markers, andaccelerated fine mapping of blast R genes [21,40,69,70]. In thisstudy, we verified that the sequenced indica rice cv. 93-11conferred broad-spectrum resistance against multiple Chineseand Japanese M. grisea isolates, and identified two dominantblast R genes, Pi60(t) and Pi61(t), by using BSA-RCA linkageanalysis combined with bioinformatics analyses. Pi60(t) wasfinely mapped to a 274 kb interval on chromosome 11, andPi61(t) was finely mapped to a 200 kb interval on chromosome12. Previously, Yang et al. [47] identified blast R gene Pi41 in cv.

11T H E C R O P J O U R N A L 1 ( 2 0 1 3 ) 2 – 1 4

93-11, at least 6.3 Mb (10276467–16582733) away from Pi61(t).These results indicated that 93-11 possessed at least three blastR genes, viz. Pi60(t), Pi61(t) and Pi41.

Many relatively durable or broad-spectrum blast resistantrice cultivars possess more than two R genes. IR64 [58,59],Moroberekan [49,72–74], Suweon 365 [11,75], Teqing [76],Sanhuangzhan 2 [50], Digu [26,32,77] and Gumei 2 [51] possessat least 6, 5, 4, 3, 3, 3 and 3 blast R genes, respectively. Onthe other hand, single genes, such as Pi9, Pi2 (Piz-5), Piz-t, Pizand Pigm, were reported to confer broad-spectrum resistance[21,24,25,78]. In the case of 93-11, Pi41 was identified usingisolates CHL724 and CHL743 from the cold japonica rice-growingregion (Jilin of China) [47], whereas Pi60(t) was identified usingisolate 001-99-1 from an indica cropping region (Jiangsu ofChina), and Pi61(t) was identified using isolate 99-26-2 from atemperate japonica region (Hebei of China). To test the resis-tance specificity of Pi60(t), Pi61(t) and Pi41(t), we inoculated F2populations of the cross LTH × 93-11 using 18 differentialisolates (except 001-99-1 and 99-26-2) from different geographicorigins, and genotyped 30–100 extremely susceptible F2 individ-uals from13 small population-isolate combinations segregatingin 3R:1S ratiosusing tightly-linkedmarkers forPi60(t), Pi61(t) andPi41. Pi60(t) conferred resistance to four isolates, including twoindica-derived isolates (one from Jiangsu and the other fromHunan of China), and two Japanese japonica-derived isolates.Pi61(t) conferred resistance to six isolates, including twoindica-derived isolates (one from Guangdong and the otherfrom Fujian of China) and four japonica-derived isolates (oneeach from Liaoning, Heilongjiang, Hebei and Beijing of China).Pi41 conferred resistance to three isolates, one indica-derivedisolate (from Guangdong of China) and two japonica-derivedisolates (both from Beijing of China) (data not shown). Thus,the three R genes in 93-11 showed no obvious specificity toindica- or japonica-derived isolates, suggesting that their com-bined actions may constitute the broad-spectrum resistance incv. 93-11, particularly to Chinese japonica-derived isolates.

It is well established that two-thirds of over 70major blast Rgenes mapped to date are clustered, especially on chromo-somes 6, 11 and 12 [11–13]. Considering the difficulties in testingfor allelism between an unknown blast R gene and othersmapping within a cluster [15,59,76], fine-scale mapping anddifferential pathotesting are regarded as alternatives for allel-ism tests [47,71]. In this study Pi61(t) wasmapped in the vicinityof 11 previouslymapped R genes. Of these Pita, Pita-2 and Pi19(t)were considered to be different from Pi61(t) by comparing theirreactions with that of 93-11 against differential isolates(Table 7). Pi39(t) was excluded due to its similarity to Pi41(t) in93-11 and a physical distance of 490 kb from Pi61(t) [47,69].Pi42(t) could also be excluded according to the physical distanceof at least 497 kb between its only short-listed potentialcandidate gene, LOC_Os12g18374, and Pi61(t) [70]. We thus canconclude that Pi61(t) should be different from some nearby Rgenes, including Pita, Pita-2, Pi19(t), Pi39(t) and Pi42(t). However,we could not determine the differentiation of Pi61(t) from sixother mapped genes (Pi6(t), Pi12(t), Pi20(t), Pi21(t), Pi58(t) andPi157(t)) in this region due to their rough physical regions andunknown response spectra. In the Pi60(t) cluster, Pia and PiCO39were both cloned and confirmed to be the same gene [37,38].Even though the SasRGA4 and SasRGA5 alleles in 93-11 are quitesimilar to the Pia/PiCO39 alleles in Sasanishiki and CO39, we

could not completely exclude the possibility that Pi60(t) and Pia/PiCO39 had a more complex relationship due to the DNAsequence variations between the six NBS-LRR alleles inresistant cv. 93-11 and those in susceptible cv. Nipponbare. Sofar, we have cloned the two Pia alleles (BGIOSGA034263and BGIOSGA035032) in 93-11, and co-transformation of thetwo candidates is underway for clarification of the nature ofPi60(t).

It is notable that both the Pi60(t) and Pi61(t) clusters areembedded in recombination-suppressed regions [47,68,70]. Inthe 0.58 cM interval (629 kb) of Pi60(t) delimited bymarkers K1-4and B14, and the 0.15 cM interval (200 kb) of Pi61(t) delimited bymarkers M2 and S29, the physical/genetic distance ratios are1084 kb cM−1 and 1333 kb cM−1, respectively. The low recombi-nation ratesmay be due to lack of sequence homology betweenthe parental genotypes, abdundance of repetitive sequencesnear the centromeres and transposon/retrotransposon-richregions [47,68,70]. These situations further increase the diffi-culties of performing allelism tests between R genes within acluster, even though large segregating populations were used.Therefore, fine mapping and cloning of each of the clustered Rgenes will be essential to elucidate their relationships and todissect their detailed race- or isolate-specificities.

NBS-LRR proteins represent the largest class of R genes inplants, and nearly 500 NBS-LRR genes have been identified inboth Nipponbare and 93-11 [31]. Eighteen of 20 cloned blast Rgenes (except Pid2 and pi21) encode NBS-LRR proteins[21,26,35,40]. Colocalizations of the NBS-LRR genes and blastresistance loci were identified through genetic analyses[14,59]. Therefore, NBS-LRR genes are themost likely potentialcandidates for further blast R genes [70]. In our study, eightintact NBS-LRR genes in the 274 kb region encompassing Pi60(t)were identified in the Nipponbare sequence, but only sixintact NBS-LRR genes were identified in the 93-11 sequencein the Gramene database (Fig. 1-d), including the two alleles ofPia/PiCO39 (SasRGA4 and SasRGA5). On the other hand, fourNBS-LRR genes exist in the 200 kb target region of Pi61(t) in93-11, and all of them showed differences in comparison withthe corresponding NBS-LRR genes in Nipponbare. Therefore, itis difficult to shortlist candidate genes for Pi61(t). We need tofurther reduce the target interval of Pi61(t), or to transform allfour NBS-LRR genes into susceptible cultivars for complemen-tation tests. In addition, another blast R gene, Pi41(t), present in93-11 was predicted as a NBS-LRR-type gene [47]. Therefore, wepostulate that the broad-spectrum blast resistance in 93-11 ismediated bymultiple NBS-LRR genes, representing a molecularmechanism of broad-spectrum resistance different from Digu[77], and Pi2, Pi9 and Piz-t [79].

5. Conclusion

In summary, the broad-spectrum blast resistant cv. 93-11harbors at least three R genes, Pi60(t) on chromosome 11, andPi61(t) and Pi41 on chromosome 12. Pi60(t) and Pi61(t) are bothembedded in recombination-suppressed regions with severalclustered NBS-LRR genes. We identified two tightly linkedflanking markers, K1-4 and E12, and two co-segregatingmarkers, Y10 and B1, for Pi60(t); and two tightly linked flankingmarkers G8 and M2, and one co-segregating marker M9 for

12 T H E C R O P J O U R N A L 1 ( 2 0 1 3 ) 2 – 1 4

Pi61(t). Thesemarkers should ensure rapid and accurate transferof the two R genes from 93-11 into new breeding lines throughMAS. The delineation of physical positions and the short-listedcandidate genesof the twoblastR loci have set solid foundationsfor positional cloning of Pi60(t) and Pi61(t).

Acknowledgments

We thank Dr. Yulin Jia, USDA-ARS Dale Bumpers National RiceResearch Center, Stuttgart, Arkansas, USA for helpful discus-sion. This work was supported by grants from the NationalNatural Science Foundation of China (Grant No. 30871606), theSpecial Fund for Agro-scientific Research in the Public InterestProgram of China (Grant No. 20120314), and the Major Scienceand Technology Project to Create New Crop Cultivars usingGene Transfer Technology (Grant No. 2011ZX08001-002).

R E F E R E N C E S

[1] D. Siluê, J.L. Notteghem, D. Tharreau, Evidence of agene-for-gene relationship in the Oryza sativa-Magnaporthegrisea pathosystem, Phytopathology 82 (1992) 577–580.

[2] R.S. Zeigler, J. Tohme, R. Nelson, M. Levy, F.J. Correa Victoria,Lineage exclusion: a proposal for linking blast populationanalysis to resistance breeding, in: R.S. Zeigler, S.A. Leong,P.S. Teng (Eds.), Rice Blast Disease, CAB international,Wallingford, UK, 1994, pp. 267–292.

[3] Y. Jia, G.T. Bryan, L. Farrall, B. Valent,Natural variationat thePi-tarice blast resistance locus, Phytopathology 93 (2003) 1452–1459.

[4] D.J. Mackill, J.M. Bonman, Inheritance of blast resistance innear-isogenic lines of rice, Phytopathology 82 (1992) 746–749.

[5] E. Zhou, Y. Jia, J. Correll, F.N. Lee, Instability of theMagnaporthe oryzae avirulence gene AVR-Pita alters virulence,Fung Genet. Biol. 44 (2007) 1024–1034.

[6] Y. Dai, Y. Jia, J. Correll, X. Wang, Y. Wang, Diversification andevolution of the avirulence gene AVR-Pita1 in field isolates ofMagnaporthe oryzae, Fung Genet. Biol. 47 (2010) 973–980.

[7] S. Hittalmani, A. Parco, T.V. Mew, R.S. Zeigler, N. Huang, Finemapping and DNA marker-assisted pyramiding of the threemajor genes for blast resistance in rice, Theor. Appl. Genet.100 (2000) 1121–1128.

[8] S.A. Goff, D. Ricke, T.H. Lan, G. Presting, R. Wang, M. Dunn, J.Glazebrook, A. Sessions, P. Oeller, H. Varma, D. Hadley, D.Hutchison, C. Martin, F. Katagiri, B.M. Lange, T. Moughamer,Y. Xia, P. Budworth, J. Zhong, T. Miguel, U. Paszkowski, S.Zhang, M. Colbert, W.L. Sun, L. Chen, B. Cooper, S. Park, T.C.Wood, L. Mao, P. Quail, R. Wing, R. Dean, Y. Yu, A. Zharkikh, R.Shen, S. Sahasrabudhe, A. Thomas, R. Cannings, A. Gutin, D.Pruss, J. Reid, S. Tavtigian, J. Mitchell, G. Eldredge, T. Scholl,R.M. Miller, S. Bhatnagar, N. Adey, T. Rubano, N. Tusneem, R.Robinson, J. Feldhaus, T. Macalma, A. Oliphant, S. Briggs, Adraft sequence of the rice genome (Oryza sativa L. ssp.japonica), Science 296 (2002) 92–100.

[9] J. Yu, S. Hu, J. Wang, G.K. Wong, S. Li, B. Liu, Y. Deng, L. Dai, Y.Zhou, X. Zhang, M. Cao, J. Liu, J. Sun, J. Tang, Y. Chen, X.Huang, W. Lin, C. Ye, W. Tong, L. Cong, J. Geng, Y. Han, L. Li,W. Li, G. Hu, X. Huang, W. Li, J. Li, Z. Liu, L. Li, J. Liu, Q. Qi, J.Liu, L. Li, T. Li, X. Wang, H. Lu, T. Wu, M. Zhu, P. Ni, H. Han, W.Dong, X. Ren, X. Feng, P. Cui, X. Li, H. Wang, X. Xu, W. Zhai, Z.Xu, J. Zhang, S. He, J. Zhang, J. Xu, K. Zhang, X. Zheng, J. Dong,W. Zeng, L. Tao, J. Ye, J. Tan, X. Ren, X. Chen, J. He, D. Liu, W.Tian, C. Tian, H. Xia, Q. Bao, G. Li, H. Gao, T. Cao, J. Wang, W.Zhao, P. Li, W. Chen, X. Wang, Y. Zhang, J. Hu, J. Wang, S. Liu,

J. Yang, G. Zhang, Y. Xiong, Z. Li, L. Mao, C. Zhou, Z. Zhu, R.Chen, B. Hao, W. Zheng, S. Chen, W. Guo, G. Li, S. Liu, M. Tao,J. Wang, L. Zhu, L. Yuan, H. Yang, A draft sequence of the ricegenome (Oryza sativa L. ssp. indica), Science 296 (2002) 79–92.

[10] IRGSP, The map-based sequence of the rice genome, Nature436 (2005) 793–800.

[11] E. Ballini, J.B. Morel, G. Droc, A. Price, B. Courtois, J.L.Notteghem, D. Tharreau, A genome-wide meta-analysis ofrice blast resistance genes and quantitative trait loci providesnew insights into partial and complete resistance, Mol. PlantMicrobe Interact. 21 (2008) 859–868.

[12] Y. Koide, N. Kobayashi, D. Xu, Y. Fukuta, Blast resistancegenes and their selection markers in rice (Oryza sativa L.),JIRCA Work Rep. 63 (2009) 95–122.

[13] J. Liu, X. Wang, T. Mitchell, Y. Hu, X. Liu, L. Dai, G. Wang,Recent progress and understanding of the molecularmechanisms of the rice-Magnaporthe oryzae interaction, Mol.Plant Pathol. 11 (2010) 419–427.

[14] R.J. Wisser, Q. Sun, S.H. Hulbert, S. Kresovich, R.J. Nelson,Identification and characterization of regions of the ricegenome associated with broad-spectrum, quantitativedisease resistance, Genetics 169 (2005) 2277–2293.

[15] Y. Deng, X. Zhu, Y. Shen, Z. He, Genetic characterization andfine mapping of the blast resistance locus Pigm(t) tightlylinked to Pi2 and Pi9 in a broad-spectrum resistant Chinesevariety, Theor. Appl. Genet. 113 (2006) 705–713.

[16] S. Chen, L. Wang, Z. Que, R. Pan, Pan QGenetic and physicalmapping of Pi37(t), a new gene conferring resistance to riceblast in the famous cultivar St. No. 1, Theor. Appl. Genet. 111(2005) 1563–1570.

[17] X. Liu, L. Wang, S. Chen, F. Lin, Q. Pan, Genetic and physicalmapping of Pi36 (t), a novel rice blast resistance gene located onrice chromosome 8, Mol. Genet. Genomics 274 (2005) 394–401.

[18] R. Fjellstrom, C.A. Conaway-Bormans, A.M. McClung, M.A.Marchetti, A.R. Shank, W.D. Park, Development of DNAmarkers suitable for marker assisted selection of three PiGenes conferring resistance to multiple Pyricularia griseapathotypes, Crop. Sci. 44 (2004) 1790–1798.

[19] R. Fjellstrom, A.M. McClung, A.R. Shank, SSR markers closelylinked to the Pi-z locus are useful for selection of blastresistance in a broad array of rice germplasm, Mol. Breed. 17(2006) 149–157.

[20] K. Hayashi, H. Yoshida, I. Ashikawa, Development ofPCR-based allele-specific and InDel marker sets for nine riceblast resistance genes, Theor. Appl. Genet. 113 (2006) 251–260.

[21] L. Hua, J. Wu, C. Chen, W. Wu, X. He, F. Lin, L. Wang, I.Ashikawa, T. Matsumoto, L. Wang, Q. Pan, The isolation ofPi1, an allele at the Pik locus which confers broad spectrumresistance to rice blast, Theor. Appl. Genet. 125 (2012)1047–1055.

[22] Z. Wang, M. Yano, U. Yamanouchi, M. Iwamoto, L. Monna, H.Hayasaka, Y. Katayose, T. Sasaki, The Pib gene for rice blastresistance belongs to the nucleotide binding and leucine-richrepeat class of plant disease resistance genes, Plant J. 19(1999) 55–64.

[23] G.T. Bryan, K. Wu, L. Farrall, Y. Jia, H.P. Hershey, S. McAdams, R.Tarchini, G. Donaldson, K. Faulk, B. Valent, A single amino aciddifference distinguishes resistant and susceptible alleles of therice blast resistance gene Pi-ta, Plant Cell 12 (2000) 2033–2045.

[24] S. Qu, G. Liu, B. Zhou, M. Bellizzi, L. Zeng, L. Dai, B. Han, G.L.Wang, The broad-spectrum blast resistance gene Pi9 encodesa nucleotide-binding site-leucine-rich repeat protein and is amember of a multigene family in rice, Genetics 172 (2006)1901–1914.

[25] B. Zhou, S. Qu, G. Liu, M. Dolan, H. Sakai, G. Lu, M. Bellizzi, G.L.Wang, The eight amino-acid differences within threeleucine-rich repeats between Pi2 and Piz-t resistance proteinsdetermine the resistance specificity to Magnaporthe grisea,Mol. Plant Microbe Interact. 19 (2006) 1216–1228.

13T H E C R O P J O U R N A L 1 ( 2 0 1 3 ) 2 – 1 4

[26] X. Chen, J. Shang, D. Chen, C. Lei, Y. Zou, W. Zhai, G. Liu, J. Xu,Z. Ling, G. Cao, B. Ma, Y. Wang, X. Zhao, S. Li, L. Zhu, AB-lectin receptor kinase gene conferring rice blast resistance,Plant J. 46 (2006) 794–804.

[27] X. Liu, F. Lin, L. Wang, Q. Pan, The in silico map-based cloningof Pi36, a rice coiled-coil nucleotide-binding site leucine-richrepeat gene that confers race-specific resistance to the blastfungus, Genetics 176 (2007) 2541–2549.

[28] F. Lin, S. Chen, Z. Que, L. Wang, X. Liu, Q. Pan, The blastresistance gene Pi37 encodes a nucleotide bindingsite-leucine-rich repeat protein and is a member of aresistance gene cluster on rice chromosome 1, Genetics 177(2007) 1871–1880.

[29] I. Ashikawa, N. Hayashi, H. Yamane, H. Kanamori, J. Wu, T.Matsumoto, K. Ono, M. Yano, Two adjacentnucleotide-binding site-leucine-rich repeat class genes arerequired to confer Pikm-specific rice blast resistance, Genetics180 (2008) 2267–2276.

[30] S.K. Lee, M. Song, Y.S. Seo, H.K. Kim, S. Ko, P. Cao, J.P. Suh, G.Yi, J.H. Roh, S. Lee, Rice Pi5-mediated resistance toMagnaporthe oryzae requires the presence of twocoiled-coil–nucleotide-binding–leucine-rich repeat genes,Genetics 181 (2009) 1627–1638.

[31] J. Shang, Y. Tao, X. Chen, Y. Zou, C. Lei, J. Wang, X. Li, X. Zhao,M. Zhang, Z. Lu, J. Xu, Z. Cheng, J. Wan, L. Zhu, Identificationof a new rice blast resistance gene, Pid3, by genome widecomparison of paired nucleotide-binding site-leucine-richrepeat genes and their pseudogene alleles between the twosequenced rice genomes, Genetics 182 (2009) 1303–1311.

[32] J. Chen, Y. Shi, W. Liu, R. Chai, Y. Fu, J. Zhuang, J. Wu, A Pid3allele from rice cultivar Gumei2 confers resistance toMagnaporthe oryzae, J. Genet. Genomics 38 (2011) 209–216.

[33] K. Hayashi, H. Yoshida, Refunctionalization of the ancientrice blast disease resistance gene Pit by the recruitment of aretrotransposon as a promoter, Plant J. 57 (2009) 413–425.

[34] A. Takahashi, N. Hayashi, A. Miyao, H. Hirochika, Uniquefeatures of the rice blast resistance Pish locus revealed bylarge scale retrotransposon-tagging, BMC, Plant Pathol. 10(2010) 175, (http://www.biomedcentral.com/1471-2229/10/175).

[35] S. Fukuoka, N. Saka, H. Koga, K. Ono, T. Shimizu, K. Ebana, N.Hayashi, A. Takahashi, H. Hirochika, K. Okuno, M. Yano, Lossof Function of a proline-containing protein confers durabledisease resistance in rice, Science 325 (2009) 998–1001.

[36] N. Hayashi, H. Inoue, T. Kato, T. Funao, M. Shirota, T.Shimizu, H. Kanamori, H. Yamane, Y. Hayano-Saito, T.Matsumoto, M. Yano, H. Takatsuji, Durable panicleblast-resistance gene Pb1 encodes an atypical CC-NBS-LRRprotein and was generated by acquiring a promoter throughlocal genome duplication, Plant J. 64 (2010) 498–510.

[37] Y. Okuyama, H. Kanzaki, A. Abe, K. Yoshida, M. Tamiru, H.Saitoh, T. Fujibe, H. Matsumura, M. Shenton, D.C. Galam, J.Undan, A. Ito, T. Sone, R. Terauchi, A multifaceted genomicsapproach allows the isolation of the rice Pia-blast resistancegene consisting of two adjacent NBS-LRR protein genes, PlantJ. 66 (2011) 467–479.

[38] S. Cesari, G. Thilliez, C. Ribot, V. Chalvon, C. Michel, S. Rivas,L. Alaux, H. Kanzaki, Y. Okuyama, J.B. Morel, E. Fournier, D.Tharreau, T. Kroja, The rice resistance protein pairRGA4/RGA5 recognizes the Magnaporthe oryzae effectorsAVR-Pia and AVR1-CO39 by direct binding, Plant Cell 25 (2013)1463–1481.

[39] A.K. Rai, S.P. Kumar, S.K. Gupta, N. Gautam, N.K. Singh, T.R.Sharma, Functional complementation of rice blastresistance gene Pi-kh(Pi54) conferring resistance to diversestrains of Magnaporthe oryzae, J. Plant Biochem. Biot. 20(2011) 55–65.

[40] C. Zhai, F. Lin, Z. Dong, X. He, B. Yuan, X. Zeng, L. Wang, Q.Pan, The isolation and characterization of Pik, a rice blast

resistance gene which emerged after rice domestication,New Phytol. 189 (2011) 321–334.

[41] B. Yuan, C. Zhai, W. Wang, X. Zeng, X. Xu, H. Hu, F. Lin, L.Wang, Q. Pan, The Pik-p resistance to Magnaporthe oryzae inrice is mediated by a pair of closely linked CC-NBS-LRR genes,Theor. Appl. Genet. 122 (2011) 1017–1028.

[42] Y. Jia, Z. Wang, P. Singh, Development of dominant riceblast Pi-ta resistance gene markers, Crop. Sci. 42 (2002)2145–2149.

[43] Y. Jia, Z. Wang, R.G. Fjellstrom, K.A.K. Moldenhauer, M.A.Azam, J. Correll, F.N. Lee, Y. Xia, J.N. Rutger, Rice Pi-ta geneconfers resistance to the major pathotypes of the rice blastfungus in the United States, Phytopathology 94 (2004)296–301.

[44] Z. Dai, B. Zhao, X. Liu, G. Xia, C. Tan, B. Zhang, H. Zhang, Anew middle-mature indica rice variety Yangdao 6 with highyielding, high quality and multiple disease resistance,Jiangsu Agric. Sci. 4 (1997) 13–14, (in Chinese with Englishabstract).

[45] Z. Dai, A. Li, L. Huang, G. Liu, C. Zhou, H. Zhang, Utilization ofan elite rice germplasm — Yangdao 6 with high combiningability created by 60Co-γirridation, Acta Agric. Nucl. Sin. 20 (2)(2006) 83–86, (in Chinese with English abstract).

[46] H. Zhang, Z. Dai, B. Zhao, X. Kong, G. Xia, A. Li, C. Pan, C.Zhou, B. Wang, N. Huang, C. Tan, Z. Zhu, Construction ofideal plant type of an elite indica rice cultivar Yangdao 6with high yield and good grain quality, J. Yangzhou Univ.(Agric. Life Sci. Ed.) 29 (3) (2008) 1–6, (in Chinese with Englishabstract).

[47] Q. Yang, F. Lin, L. Wang, Q. Pan, Identification andmapping ofPi41, a major gene conferring resistance to rice blast in theOryza sativa subsp. indica reference cultivar 93-11, Theor.Appl. Genet. 118 (2009) 1027–1034.

[48] D. Huang, Characterization and SSR mapping of rice blastresistance genes, Postdoctoral Research Working Report ofthe Graduate School of Chinese Academy of AgriculturalSciences, Beijing, 2005. 78 , (in Chinese with Englishabstract).

[49] G.L. Wang, D.J. Mackill, J.M. Bonman, S.R. McCouch, M.C.Champoux, R.J. Nelson, RFLP mapping of genes conferringcomplete and partial resistance to blast in a durably resistantrice cultivar, Genetics 136 (1994) 1421–1434.

[50] B. Liu, S. Zhang, X. Zhu, Q. Yang, S. Wu, M. Mei, R. Mouleon, J.Leach, T. New, H. Leung, Candidate defense genes aspredictors of quantitative blast resistance in rice, Mol. PlantMicrobe. Interact. 17 (2004) 1146–1152.

[51] J. Wu, Y. Fan, D. Li, K. Zheng, J. Zhuang, H. Leung, Geneticcontrol of rice blast resistance in the durably resistantcultivar Gumei 2 against multiple isolates, Theor. Appl.Genet. 111 (2005) 50–56.

[52] J. Wu, X. Liu, L. Dai, G. Wang, Advances on the identificationand characterization of broad spectrum blast resistancegenes in rice, Chin. Bull. Life Sci. 19 (2007) 233–238.

[53] X. Zhu, S. Chen, J. Yang, S. Zhou, L. Zeng, J. Han, J. Su, L. Wang,Q. Pan, The identification of Pi50(t), a new member of the riceblast resistance Pi2/Pi9 multigene family, Theor. Appl. Genet.124 (2012) 1295–1304.

[54] Z. Ling, T. New, J. Wang, C. Lei, N. Huang, Development ofnear-isogenic lines of rice and their differential ability to theblast pathogen, Int. Rice Res. Notes 20 (1995) 13–14.

[55] Z. Ling, T. New, J. Wang, C. Lei, N. Huang, Development ofChinese near isogenic lines of rice and their differentialability of pathogenic races of blast fungus, Sci. Agric. Sin. 33(4) (2001) 1–8, (in Chinese with English abstract).

[56] N. Kobayashi, M.J. Telebanco-Yanoria, H. Tsunematsu, H.Kato, T. Imbe, Y. Fukuta, Development of new sets ofinternational standard differential varieties for blastresistance in rice (Oryza sativa L.), Jpn. Agric. Res. Q 41 (2007)31–37.

14 T H E C R O P J O U R N A L 1 ( 2 0 1 3 ) 2 – 1 4

[57] N. Hayashi, I. Ando, T. Imbe, Identification of a new resistancegene to a Chinese blast fungus isolate in the Japanese ricecultivar Aichi Asahi, Phytopathology 88 (1998) 822–827.

[58] N. Kobayashi, L.A. Ebron, D. Fujita, Y. Fukuta, Identification ofblast resistance genes in IRRI-bred rice varieties bysegregation analysis based on a differential system, JIRCASWork Rep. 63 (2009) 69–86.

[59] C. Sallaud, M. Lorieux, E. Roumen, D. Tharreau, R. Berruyer, P.Svestasrani, O. Garsmeur, A. Ghesquiere, J.L. Notteghem,Identification of five new blast resistance genes in the highlyblast-resistant rice variety IR64 using a QTL mappingstrategy, Theor. Appl. Genet. 106 (2003) 794–803.

[60] D. Chen, R.S. Zeigler, S.W. Ahn, R.J. Nelson, Phenotypiccharacterization of the rice blast resistance gene Pi2(t), PlantDis. 80 (1996) 52–56.

[61] C. Lei, J. Wang, S. Mao, L. Zhu, Z. Ling, Gene analysis of blastresistance in indica variety Zhaiyeqing 8, Chin. J. Genet. 23(1996) 273–277.

[62] M.G. Murray, W.F. Thompson, Rapid isolation of highmolecularweight plantDNA,Nucl. Acids Res. 8 (1980) 4321–4325.

[63] R.W. Michelmore, I. Paran, R.V. Kesseli, Identification ofmarkers linked to disease-resistance genes by bulkedsegregant analysis: a rapid method to detect markers inspecific genomic regions by using segregating populations,Proc. Natl. Acad. Sci. U.S.A. 88 (1991) 9828–9832.

[64] Q. Zhang, B.Z. Shen, X.K. Dai, M.H. Mei, Saghai Maroof M A, LiZ B. Using bulked extremes and recessive class to map genesfor photoperiod-sensitive genic male sterility in rice, Proc.Natl. Acad. Sci. U.S.A. 91 (1994) 8675–8679.

[65] C.J. Sanguinetti, N.E. Dias, A.J. Simpson, Rapid silver stainingand recovery of PCR products separated on polyacrylamidegels, Biotechniques 17 (1994) 914–921.

[66] K. Gu, D. Tian, F. Yang, L. Wu, C. Sreekala, D. Wang, G.L.Wang, Z. Yin, High-resolution genetic mapping of Xa27(t), anew bacterial blight resistance gene in rice, Oryza sativa L,Theor. Appl. Genet. 108 (2004) 800–807.

[67] S. Kiyosawa, H. Ikehashi, H. Kato, Z. Ling, Pathogenicity testof Philippine isolates of blast fungus using two sets of ricevarieties, Jpn. J. Breed 31 (1981) 367–376.

[68] W. Li, C. Lei, Z. Cheng, Y. Jia, D. Huang, J. Wang, X. Zhang, N.Su, X. Guo, H. Zhai, J. Wan, Identification of SSR markers for abroad-spectrum blast resistance gene Pi20(t) formarker-assisted breeding, Mol. Breed. 22 (2008) 141–149.

[69] X. Liu, Q. Yang, F. Lin, L. Hua, C. Wang, L. Wang, Q. Pan,Identification and fine mapping of Pi39(t), a major geneconferring the broad-spectrum resistance to Magnaportheoryzae, Mol. Genet. Genomics 278 (2007) 403–410.

[70] P.K. Kumar, S. Pathania, P. Katoch, T.R. Sharma, P. Plaha, R.Rathour, Genetic and physical mapping of blast resistancegene Pi-42(t) on the short arm of rice chromosome 12, Mol.Breed. 25 (2010) 217–228.

[71] Y. Koide, M.J. Telebanco-Yanoria, Y. Fukuta, N. Kobayashi,Detection of novel blast resistance genes, Pi58(t) and Pi59(t), in aMyanmar rice landrace based on a standard differentialsystem, Mol. Breed. (2013) (online), http://dx.doi.org/10.1007/s11032-013-9865-5.

[72] T. Inukai, R.S. Zeigler, S. Sarkarung, M. Bronson, L.V. Dung, T.Kinoshita, R.J. Nelson, Development of pre-isogenic lines forrice blast-resistance by marker-aided selection from arecombinant inbred population, Theor. Appl. Genet. 93 (1996)560–567.

[73] N.I. Naqvi, B.B. Chattoo, Molecular genetic analysis andsequence characterized amplified region-assistedselection of blast resistance in rice, Rice Genet. 3 (1996)570–576.

[74] D. Chen, dela Viña M, Inukai T, Mackill D J, Ronald P C, NelsonR J. Molecular mapping of the blast resistance gene, Pi44(t), ina line derived from a durably resistant rice cultivar, Theor.Appl. Genet. 98 (1999) 1046–1053.

[75] S.N. Ahn, Y.K. Kim, H.C. Hong, S.S. Han, S.J. Kwon, H.C. Choi,H.P. Moon, S.R. McCouch, Molecular mapping of a new genefor resistance to rice blast (Pyricularia grisea Sacc), Euphytica116 (2000) 17–22.

[76] R.E. Tabien, Z. Li, A.H. Paterson, M.A. Marchetti, J.W. Stansel,S.R.M. Pinson, Mapping of four major rice blast resistancegenes from ‘Lemont’ and ‘Teqing’ and evaluation of theircombinatorial effect for field resistance, Theor. Appl. Genet.101 (2000) 1215–1225.

[77] X. Chen, J. Shang, C. Lei, J. Xu, S. Li, L. Zhu, Genetic andmolecular analysis of blast resistance in a universal blastresistant variety, Digu, in: G.L. Wang, B. Valent (Eds.),Advances in Genetics, Genomics and Control of Rice Blast,Springer of Congress + Business Media B.V., USA, 2009,pp. 149–159.

[78] Y. Deng, X. Zhu, J. Xu, H. Chen, Z. He, Map-based cloningand breeding application of a broad-spectrum resistancegene Pigm to rice blast, in: G.L. Wang, B. Valent (Eds.),Advances in Genetics, Genomics and Control of Rice Blast,Springer of Congress + Business Media B.V., USA, 2009,pp. 161–171.

[79] J. Wu, H. Mizuno, M. Hayashi-Tsugane, Y. Ito, Y. Chiden, M.Fujisawa, S. Katagiri, S. Saji, S. Yoshiki, W. Karasawa, Physicalmaps and recombination frequency of six rice chromosomes,Plant J. 36 (2003) 720–730.