Étude du microbiote de la sève d'érable et de son impact sur la ...
Transcript of Étude du microbiote de la sève d'érable et de son impact sur la ...
MARIE FILTEAU
ETUDE DU MICROBIOTE DE LA SEVE D'ERABLE ET DE SON IMPACT SUR LA QUALITÉ DU SIROP
Thèse présentée à la Faculté des études supérieures et postdoctorales de l'Université Laval
dans le cadre du programme de doctorat en Sciences et technologie des aliments pour l'obtention du grade de Philosophiœ Doctor (Ph.D)
DEPARTEMENT DES SCIENCES DES ALIMENTS ET DE NUTRITION FACULTÉ DES SCIENCES DE L'AGRICULTURE ET DE L'ALIMENTATION
UNIVERSITÉ LAVAL QUÉBEC
2011
Marie Filteau, 2011
Résumé Récemment, les méthodes de récolte de la sève d'érable, mais aussi les méthodes
d'analyses microbiologiques ont évolué. Les travaux présentés avaient pour objectif la
caractérisation du microbiote acéricole par des méthodes moléculaires et la description
de son impact quantitatif et qualitatif sur la qualité du sirop d'érable. Des analyses
microbiologiques conventionnelles, physicochimiques et sensorielles ont été effectuées
sur des échantillons de sève et de sirop provenant de sites québécois au cours de la
période de récolte. De nouvelles méthodes moléculaires culture-indépendantes (profilage
PCR communautaire, MARISA) ont permis de caractériser la structure et la composition
du microbiote dans le temps et dans l'espace. Le site de production a été identifié
comme étant le facteur le plus déterminant pour la composition alors que la période de
récolte correspondait à un changement dans la structure des communautés microbiennes.
Le séquençage de banques de clones et des essais qPCR spécifiques ont permis
respectivement d'identifier et de quantifier les principales bactéries et levures de la sève
d'érable. Puisque Pseudomonas fluorescens, Rahnella spp., Mrakia spp., Mrakiella spp.
et Guehomyces pullulons ont été retrouvés à chaque site de production et qu'ils étaient
aussi présents tout au long de la période de récolte, ces microorganismes sont considérés
comme des membres stables du microbiote acéricole. Les analyses multivariées ont
révélé des associations entre l'abondance relative de plusieurs contaminants et les
propriétés de la sève et du sirop d'érable. Notamment des levures telles que Candida
sake, Williopsis sp. et G. pullulons sont successivement associées à la quantité de
glucose et de fructose dans la sève d'érable. En fin de saison, les bactéries du groupe P.
fluorescens et les levures du genre Mrakia sont positivement associées aux flaveurs
d'érable et de vanille. Ces résultats illustrent les deux facettes de l'impact de la
communauté microbienne de la sève d'érable qui peut être associée positivement et
négativement à la qualité de cette matière première et du produit fini, le sirop d'érable.
Éventuellement, la compréhension de ces relations et de ses mécanismes permettra de
développer des stratégies de modulation du microbiote et de gestion des systèmes de
collecte.
IV
Abstract Recently, both maple sap collection systems and microbiological identification methods
have evolved. The work presented aimed at characterizing maple sap microbiota with
molecular methods and describing its quantitative and qualitative impact on maple syrup
quality. Conventional microbiological methods, physicochemical and sensory analysis
were performed on maple sap and syrup samples from Québec production sites
throughout the harvesting period. New culture-independent molecular methods
(community PCR fingerprinting, MARISA) allowed characterization of microbiota
structure and membership in time and space. Production site was identified as the most
determining factor of membership while flow period was reflected by a change in
microbiota structure. Clone library sequencing and specific qPCR assays allowed for
maple sap bacteria and yeast identification and quantification respectively. As
Pseudomonas fluorescens, Rahnella spp., Mrakia spp., Mrakiella spp. and Guehomyces
pullulons were found at every production site and were present at all flow periods, these
microorganisms are considered stable members of the maple sap microbiota.
Multivariate analysis revealed links between the relative abundance of many
contaminants and maple sap and syrup properties. Notably, Candida sake, Williopsis sp.
and G. pullulons yeasts were successively associated with glucose and fructose
concentrations in maple sap. At the end of the harvesting season, P. fluorescens group
bacteria and Mrakia yeast were positively linked to maple and vanilla attributes of maple
syrup. These results illustrate both sides of the maple sap microbiota impact on maple
sap and syrup quality. Eventually, comprehension of these relationships and their
mechanisms will lead to the development of microbiota modulation and collection
system management strategies.
Remerciements Écrire une thèse est une étape importante au cours d'une vie, elle marque le début d'une
carrière, mais aussi l'aboutissement d'un long parcours. Je prends un moment pour
remercier les personnes suivantes qui m'ont accompagnée, encouragée et soutenue en
cours de route.
Pour m'avoir intégrée dans leur laboratoire, pour avoir cru en mes capacités, pour
m'avoir encouragée et prodigué des conseils judicieux et pour m'avoir appris à
développer un esprit critique, mon directeur Denis Roy et ma codirectrice Gisèle
LaPointe. Je leur suis particulièrement reconnaissante de m'avoir permis de concilier
travail, études et famille;
Pour m'avoir formée et guidée au laboratoire, mes maîtres de stage Julie Audy et Steve
Labrie;
Pour les discussions scientifiques éclairantes, Éric Rasolofo, Sébastien Matamoros et
Luc Lagacé;
Tous les collègues de laboratoire qui ont partagé mon quotidien et ma dépendance à la
caféine, Marie-Hélène Lessard, Marianne Blain-Fortin, Marianne Arteau, Rachelle
Rioux, Patricia Savard, Emilie Desfossés-Foucault, Joseph Lupien-Meilleur et bien
d'autres;
Pour leur aide technique, les stagiaires, Mélanie Depont, Morgane Jaffrelo, Annick
Robichaud et Maud Cunat;
Ma source d'optimisme et de réconfort, ma mère Lucie;
Parce que la vie ne serait pas pareille si on ne la partageait pas avec quelqu'un
d'extraordinaire, pour tout le bonheur qu'il m'apporte, mon mari Félix;
Parce qu'un sourire de leur part me donne l'énergie pour aller plus loin, mes filles
Morgane et Agathe.
Avant-Propos Cette thèse est présentée sous forme d'articles scientifiques soumis à des revues avec
comité de lecture. Pour répondre aux exigences de la faculté des études supérieures, les
chapitres rédigés en anglais sont précédés d'un résumé en français. Les références
biliographiques sont présentées à la fin du document. Les tableaux sont appelés « Tableau »
tout au long du document, il en est de même dans les sections écrites en anglais afin
d'uniformiser la liste des tableaux.
Le manuscrit comporte cinq chapitres dont le premier intitulé « Revue de littérature » se
veut, dans un premier temps, un résumé des connaissances actuelles concernant la sève, la
microbiologie de la sève et le sirop d'érable. Dans un deuxième temps, une introduction
aux méthodes moléculaires utilisées pour l'étude des communautées microbiennes est
présentée, suivie d'un survol des analyses multivariées. Finalement, le but, les hypothèses
et les objectifs sont inclus à la fin de ce chapitre.
Le second chapitre intitulé « Diversité saisonnière et régionale du microbiote de la sève
d'érable révélée par profilage PCR communautaire et banques de clones du gène de l'ARN
ribosomal 16S » a été publié sous forme d'article dans Systematic and Applied
Microbiology (Filteau, M., Lagacé, L., LaPointe, G, Roy, D., 2010, vol. 33, p. 165-173).
Ce chapitre illustre la variabilité du microbiote de la sève d'érable dans le temps et l'espace
à l'aide d'une nouvelle approche de profilage PCR communautaire, en plus d'identifier les
principaux contaminants bactériens. J'ai bénéficié de l'aide de Marianne Blain-Fortin pour
les extractions d'ADN et de Morgane Jaffrelo pour l'isolement des bactéries. Les comptes
microbiens ont été effectués par l'équipe du Centre ACER inc. à St-Hyacinthe.
Le troisième chapitre intitulé « Corrélation de la composition de la sève d'érable avec les
communautés bactériennes et fongiques déterminées par MARISA » a fait l'objet d'une
publication dans Food Microbiology (Filteau, M., Lagacé, L., LaPointe, G, Roy, D., 2011,
vol. 28, p. 980-989). Ces travaux présentent l'étude simultanée des bactéries et des levures
dans la sève d'érable par une méthode moléculaire multiplexe et le lien entre les
populations et la composition de la sève. J'ai reçu de l'aide de Annick Robichaud et de
Vlll
Maud Cunat pour l'optimisation de la méthode multiplexe. Les analyses physicochimiques
de la sève ont été réalisées par le Centre ACER inc.
Le quatrième chapitre intitulé « Les contaminants prédominants de la sève d'érable sont
corrélés aux propriétés physicochimiques et sensorielles du sirop d'érable » quantifie par
PCR quantitative les principaux contaminants de la sève d'érable et analyse leurs relations
avec les propriétés physicochimiques et sensorielles du sirop d'érable. Ces travaux ont été
soumis au International Journal of Food Microbiology. Morgane Jaffrelo a participé à la
recherche de marqueurs moléculaires et le Centre ACER inc. a fabriqué les sirops de
laboratoire en plus d'effectuer les analyses physicochimiques et sensorielles.
Pour la réalisation de ces trois manuscrits, j 'ai mis au point les méthodes moléculaires et
réalisé la presque totalité des manipulations relatives à celles-ci. De même, j 'ai effectué
l'intégralité du traitement des données, des analyses bioinformatiques, statistiques et
multivariées. J'ai élaboré tableaux et figures et rédigé les manuscrits. Le Dr Luc Lagacé a
dirigé l'équipe du Centre ACER inc. qui a effectué la collecte des échantillons et les
analyses microbiologiques, physicochimiques et sensorielles. Il a de plus révisé les
manuscrits dont il est coauteur et a fourni de judicieux conseils relatifs à l'orientation du
projet. Le Dr Gisèle LaPointe a été un guide précieux pour la réalisation du projet et la
rédaction. Le Dr Denis Roy est à l'origine de la conceptualisation et de l'orientation du
projet de recherche et a contribué à encadrer l'analyse et l'interprétation des résultats. Les
Dr Denis Roy et Gisèle LaPointe ont orienté et révisé les manuscrits afin d'ajouter à leur
clarté et leur valeur scientifique.
Finalement, le cinquième chapitre discute les principaux résultats obtenus dans cette étude.
Il comprend également les conclusions générales et les perspectives d'avenir en
acériculture suite à ce projet.
A ma mère Lucie, à mon mari Félix, à mes filles Morgane et
Agathe.
Table des matières Résumé iii Abstract iv Remerciements v Avant-Propos vii Table des matières xi Liste des tableaux xiv Liste des figures xv Liste des abréviations xvii Introduction 1 Chapitre 1 Revue de littérature 5
1.1 Portrait socio-économique du secteur acéricole 5 1.2 La fabrication moderne du sirop d'érable 7 1.3 La qualité du sirop d'érable 8 1.4 La composition chimique de la sève d'érable 10 1.5 La composition chimique du sirop d'érable 12 1.6 Les flaveurs du sirop d'érable 14 1.7 La microbiologie acéricole 16 1.7.1 Les biofilms 20 1.7.2 La diversité microbienne 21 1.8 L'analyse des communautés microbiennes 21 1.9 Les analyses multivariées 28 1.10 But 35 1.11 Hypothèse 35 1.12 Objectifs 35
Chapitre 2 Diversité saisonnière et régionale du microbiote de la sève d'érable révélée par profilage PCR communautaire et banques de clones du gène de l'ARN ribosomal 16S 37 2.1 Résumé 37 2.2 Abstract 38 2.3 Introduction 39 2.4 Material and methods 41 2.4.1 Maple sap samples 41 2.4.2 Microbial counts and isolate selection 41 2.4.3 DNA extraction 41 2.4.4 PCR fingerprinting 41 2.4.5 16S rRNA gene amplification 44 2.4.6 Clone library construction 44 2.4.7 DNA sequencing 44 2.4.8 Alignment and phylogenetic analysis 45 2.4.9 Operational taxonomie units (OTUs) determination and community analysis....46 2.4.10 Nucleotide sequence accession numbers 46 2.5 Results 46 2.5.1 Microbial counts 46 2.5.2 Community PCR fingerprints of maple sap 47
Xll
2.5.3 Maple sap 16S rRNA gene clone libraries 53 2.6 Discussion 58 2.6.1 Maple sap microbial community membership 60 2.6.2 Maple sap microbial community structure 62 2.7 Acknowledgements 63
Chapitre 3 Corrélation de la composition de la sève d'érable avec les communautés bactériennes et fongiques déterminées par MARISA 65 3.1 Résumé 65 3.2 Abstract 66 3.3 Introduction 67 3.4 Materials and methods 69 3.4.1 Maple sap samples 69 3.4.2 Chemical analysis 69 3.4.3 ARISA and MARISA 69 3.4.4 Fungal ITS1-5.8S-ITS2 clone libraries and sequencing 71 3.4.5 Identification of peaks 72 3.4.6 Nucleotide sequence accession numbers 72 3.4.7 Multivariate and statistical analysis 72 3.5 Results 73 3.5.1 Comparison of ARISA and MARISA profiles 73 3.5.2 MARISA peak identification 74 3.5.3 MARISA profile analysis 77 3.5.4 Maple sap composition and correlations with microbial communities 79 3.6 Discussion 84 3.6.1 MARESA method 84 3.6.2 Maple sap bacterial community 85 3.6.3 Maple sap fungal community 86 3.6.4 Correlations between microbial communities and maple sap composition 88 3.7 Conclusion 90 3.8 Acknowledgements 91
Chapitre 4 Les contaminants prédominants de la sève d'érable sont corrélés aux propriétés physicochimiques et sensorielles du sirop d'érable 93 4.1 Résumé 93 4.2 Abstract 94 4.3 Introduction 95 4.4 Material and methods 97 4.4.1 Maple sap and syrup samples 97 4.4.2 Laboratory syrups 97 4.4.3 Physicochemical analysis 97 4.4.4 Sensory analysis 98 4.4.5 DNA extraction 98 4.4.6 PCR amplification and sequencing 98 4.4.7 Quantitative PCR (qPCR) 101 4.5 Results 103 4.5.1 Microbial contaminant quantification 103 4.5.2 Maple syrup physicochemical and sensorial properties 110 4.5.3 Relationship between microbial contamination and maple syrup properties 112
Xlll
4.6 Discussion 117 4.7 Acknowledgements 122
Chapitre 5 Discussion et conclusion générale 123 5.1 Comparaison des méthodes moléculaires 125 5.2 Le système de récolte acéricole, un écosystème àpart 131 5.2.1 Origine de la contamination 131 5.2.2 Composition du microbiote 132 5.2.3 Structure et stabilité 134 5.3 L'impact du microbiote, une réponse multivariée 135 5.4 Limites de l'étude 140 5.5 Perspectives 141 5.5.1 La gestion du système de collecte de la sève d'érable 141 5.5.2 La modulation du microbiote 142 5.5.3 La typicité en gage de qualité 143 5.6 Conclusion générale 144
Références 147 Annexe 1 Affiche présentée au congrès « Annual NAMSC-IMSI- OMSPA
Meetings » à Stratford, ON en octobre 2010 159 Annexe 2 Preliminary analysis for qPCR target selection 163 Annexe 3 Overview of 2005 sample characteristics 165
Liste des tableaux Tableau 1.1 Classification du sirop d'érable 9 Tableau 1.2 Classification des défauts du sirop d'érable selon la FPAQ 9 Tableau 1.3 Composition de la matière sèche de la sève d'érable 10 Tableau 1.4 Composition chimique du sirop d'érable 13 Tableau 1.5 Microorganismes retrouvés dans la sève d'érable 17 Tableau 1.6 Caractéristiques des principales méthodes moléculaires culture-
indépendantes utilisées pour l'analyse des communautés microbiennes 27 Tableau 2.1 Summary of the 16S rDNA sequences retrieved for each library 45 Tableau 2.2 Pairwise comparison of maple sap microbial communities by flow period.56 Tableau 2.3 Variation in community membership and structure among five production
sites 57 Tableau 3.1 Identification of fungal peaks 75 Tableau 3.2 Maple sap isolates used for identification of bacterial peaks 76 Tableau 3.3 Tukey-Kramer HSD mean comparison of maple sap concentrate
composition 80 Tableau 4.1 Sequences used for specific primer design 99 Tableau 4.2 Target, primers and type of qPCR assay 102 Tableau 4.3 qPCR standard curves parameters 103 Tableau 4.4 qPCRgene copy number of 2005 samples 107 Tableau 4.5 Sap concentrate psychrophilic plate counts 108 Tableau 4.6 Average physicochemical and sensorial property values of producer syrups.
I l l Tableau 5.1 Comparaison de l'abondance relative (%) des principaux contaminants
bactériens déterminée par différentes méthodes moléculaires 126 Tableau 5.2 MRBP de chacune des méthodes moléculaires sur 12 échantillons 2005.. 130 Tableau 5.3 Microorganismes nouvellement répertoriés dans la sève d'érable dans cette
étude 133 Tableau 5.4 Analyse des espèces indicatrices 139 Tableau 5.5 Correlation entre l'abondance relative de P. fluorescens et Mrakia et les
attributs sensoriels du sirop d'érable 140
Liste des figures Figure 1.1 Aire de répartition de l'exploitation commerciale de l'érable 5 Figure 1.2 Évolution de la production acéricole selon les données de la FPAQ
(2010) 6 Figure 1.3 Évolution de la production, du nombre d'entailles, de la valeur du sirop
d'érable produit au Québec et des exportations canadiennes selon les données de la FPAQ (2010) 6
Figure 1.4 La roue des flaveurs de l'érable 14 Figure 1.5 Principe des principales méthodes de profilage utilisées pour l'analyse
des communautés microbiennes 23 Figure 1.6 Construction d'une banque de clones 26 Figure 1.7 Quantification par la PCR en temps réel 28 Figure 1.8 Processus de préparation des données pour les analyses multivariées 31 Figure 1.9 Analyse en composante principale 32 Figure 2.1 Heat map and Ward dendrogram of PCR fingerprint replicates obtained
with primers L and A for 50% sap flow samples 43 Figure 2.2 Average microbial counts of 19 production sites in Québec for the 2005
season 47 Figure 2.3 Phylogenetic affiliation and typing of 44 maple sap isolates 48 Figure 2.4 Examples of PCR fingerprint consensus profiles obtained with primer L 50 Figure 2.5 Heat map and Ward dendrogram of combined consensus PCR
fingerprints obtained with primers L and A 51 Figure 2.6 Principal component analysis of combined PCR fingerprints from
primers L and A 52 Figure 2.7 Phylogenetic architecture and relative abundance of OTUso.03 of five
maple sap producers 54 Figure 2.8 Relative abundance of phylogenetic classes found in each clone library,
sorted by the sap flow period 55 Figure 3.1 Example of replicate MARISA profiles 71 Figure 3.2 Comparison of ARISA and MARISA amplification profiles of maple sap
DNA 74 Figure 3.3 Dominance curve plot of the 25 predominant MARISA peaks (out of
175 peaks) in 57 sap samples 77 Figure 3.4 NMS plot based on Bray-Curtis similarities of the Hellinger transformed
MARISA data 79 Figure 3.5 Joint plot of PCA on correlations between chemical properties (blue
vectors) of 0% sap flow period samples (green dots) and MARISA peak data (black vectors) 81
Figure 3.6 Joint plot of PCA on correlations between chemical properties (blue vectors) of 50% sap flow period samples (orange dots) and MARISA peak data (black vectors) 82
Figure 3.7 Joint plot of PCA on correlations between chemical properties (blue vectors) of 100% sap flow period samples (purple dots) and MARISA peak data (black vectors) 83
xvi
Figure 4.1 qPCR counts of maple sap predominant contaminants according to flow period in 2005 104
Figure 4.2 Total bacteria and specific qPCR count means per geographical region at the 100% flow period in 2005 105
Figure 4.3 Gene copy counts of maple sap samples throughout the 2008 harvesting season 109
Figure 4.4 Global sensorial and odor profiles of 2008 producer maple syrups 110 Figure 4.5 Ordination plot of samples from the multiple factor analysis based on
microbial relative abundance in maple sap (calculated with gene copy number) and maple syrup physicochemical and sensorial properties 113
Figure 4.6 Vector map of variables from the multiple factor analysis 114 Figure 4.7 MFA group representation 115 Figure 5.1 Schéma de concepts illustrant les facteurs qui influencent la qualité du
sirop d'érable et les éléments analysés au cours du projet 124 Figure 5.2 Comparaison de la classification hiérarchique avec la méthode de Ward
des différentes méthodes moléculaires 127 Figure 5.3 Résultats de la MFA (analyse de facteurs multiples) 128 Figure 5.4 Modélisation de l'effet quantitatif de la contamination bactérienne de la
sève d'érable sur l'analyse sensorielle du sirop de laboratoire 136 Figure 5.5 Courbes polynomials (p <0.01) correspondant à l'effet des comptes
bactériens de chacun des groupes de profils PCR communautaires sur les sucres réducteurs de la sève et du sirop de laboratoire 138
Liste des abréviations ACP; PCA: Analyse en composante principale; Principal component analysis
ADN; DNA: Acide désoxyribonucléique; desoxyribonucleic acid
ADNr; rDNA: Acide désoxyribonucléique ribosomal; ribosomal desoxyribonucleic acid
ANOSIM: Analyse de similarité; Analysis of similarity
AP-PCR: réaction de polymerisation en chaine arbitrairement amorcée; Arbitrary primed polymerase chain reaction
ARISA: Analyse de régions intergéniques ribosomales automatisée; Automated ribosomal intergenic spacer analysis
ARNr; rRNA: Acide ribonucléique ribosomal; ribosomal ribonucleic acid
AT: Nucleotides Adenine et thymine
ATCC: Collection de cultures types américaines; American type culture collection
B-ARISA: Analyse de régions intergéniques ribosomales bactériennes automatisée; Automated bacterial ribosomal intergenic spacer analysis
bp: Paire de base; Base pair
DGGE: Électrophorèse en gradient dénaturant; denaturing gel gradient electrophoresis
dNTP: désoxyribonucléotides; desoxyribonucleotides
Éch.: Échantillon
F-ARISA: Analyse de régions intergéniques ribosomales fongiques automatisée; Automated fungal ribosomal intergenic spacer analysis
FISH: Hybridation fluorescente in situ; Fluorescent in situ hybridization
FPAQ: Férédation des producteurs acéricoles du Québec
GC: Nucleotides guanine et cytosine; Guanine and cytosine nucleotides
ID: Identification
IGS: Région intergénique; intergenic spacer
ISA: Analyse d'espèce indicatrice; Indicator species analysis
ITS: Région intergénique transcrite; Internal transcribed spacer
XV111
MARISA: Analyse de régions intergéniques ribosomales automatisée multiplexe; Multiplex automated ribosomal intergenic spacer analysis
MBC: Concentration bactericide minimale; Minimal batericidal concentration
MBEC: Concentrations minimales d'éradication de biofilm; Minimal biofilm eradication concentration
MFA: Analyse de facteurs multiples; Multiple factor analysis
MRBP: Procédure de permutation multi-réponse bloquée; Blocked multiresponse permutation procedure
MRPP: Procédure de permutation multi-réponse; Multiresponse permutation procedure
NCBI: Centre national de l'information biotechnologique; National Center for Biotechnology Information
NMS: Positionnement multidimensionnel non-métrique; Nonmetric multidimensional scaling
OTU: Unité taxonomique opérationnelle; Operational taxonomie unit
PCR: Réaction de polymerisation en chaine; Polymerase chain reaction
qPCR: Réaction de polymerisation en chaine quantitative; Quantitative Polymerase Chain Reaction
QS: Quorum sensing
RAPD: Amplification aléatoire d'ADN polymorphique; Random Amplification of Polymorphic DNA
RDP: Projet base de donnée ribosomale; Ribosomal database project
rfu: Unité de fluorescence relative; Relative fluorescence unit
RISSC: Collection de séquences intergéniques ribosomales; Ribosomal Intergenic Spacer Sequence Collection
SCAR: Région amplifiée caractérisée par sa séquence; Sequence Characterized Amplified Region
SE: Erreur type; Standard Error
TGGE: Électrophorèse en gradient thermal;Thermal Gel Gradient Electrophoresis
T-RFLP: Polymorphisme de fragments de restriction terminaux; Terminal Restriction Fragment Length Polymorphism
XIX
UFC; CFU: Unités formatrices de colonie; colony forming units
U-PCR: Réaction de polymérisation en chaine non spécifique; Unspecific Polymerase Chain Reaction
UV/VIS: Ultraviolet et visible; Ultraviolet and visible
XX
Introduction
Le sirop d'érable est issu de la concentration de la sève d'érable récoltée au printemps.
À ce moment de l'année, l'amidon emmagasiné dans les racines de l'arbre est hydrolyse
et transformé en saccharose. La sève devient ainsi chargée de sucre et est entraînée vers
le sommet lorsqu'elle est sur le point de geler. Le liquide emmagasiné dans les branches
par le gel redescend par gravité dès que la température atteint 0°C (Tyree 1984). Le
climat est propice à la coulée lorsqu'il y a alternance de gel la nuit et de dégel le jour,
comme c'est le cas dans le sud-est du Canada et le nord-est des États-Unis, où l'érable
est exploité. Une composante osmotique est également impliquée dans le processus de
coulée, mais sa contribution exacte reste à déterminer (Cirelli et al. 2008). La saison de
récolte s'étend sur quelques semaines jusqu'à ce que la coulée cesse, soit à la fin des
cycles de gel et de dégel ou à l'obstruction des entailles par la croissance microbienne
(Perkins et van den Berg 2009).
De nos jours, les producteurs de sirop d'érable doivent relever le défi de la qualité s'ils
veulent rencontrer les nonnes imposées par l'industrie et faire face à un marché encore
peu développé. L'établissement de quotas a obligé les acériculteurs à miser sur la qualité
pour accroître leurs revenus, puisqu'ils ne peuvent plus compter sur l'augmentation des
volumes (Beaunoyer 2005). Une inspection a récemment révélé que près de 50% des
sirops d'érable vendus au détail ne respectent pas les normes de qualité et de saveur
(Deglise 2005).
Selon ces normes, la valeur commerciale des sirops et leur employabilité sont pondérées
par leur grade de couleur. Le grade attribué peut représenter une variation de 13% de la
valeur d'un lot. En plus de la variation de la couleur, des défauts de goût légers ou
majeurs peuvent également pénaliser le producteur. En moyenne 27% des sirops classés
par la fédération des producteurs acéricoles québécois (FPAQ) comportent de tels
défauts (FPAQ 2010).
Le système de classification basé sur le pourcentage de transmitance de la lumière ne
fait pas l'unanimité puisqu'il ne tient pas compte des subtilités des flaveurs de l'érable.
D'ailleurs, les sirops les plus clairs ne sont pas les préférés des consommateurs (Belford
et al. 1991). Un nouveau système de classification basé sur l'intensité des flaveurs a
récemment été proposé par l'Institut international du sirop d'érable. Cependant, l'état
des connaissances concernant l'origine des flaveurs de l'érable reste modeste. Une
nouvelle nomenclature de caractérisation a été publiée par Agriculture et
Agroalimentaire Canada, connue sous le nom de roue des flaveurs. Cet outil a été conçu
dans l'optique d'une uniformisation des travaux futurs. Entre temps, l'apparition de
pratiques telle que la vente de sève d'érable à des transformateurs externes nécessite que
cette matière première puisse être évaluée facilement selon son potentiel à être
transformée en produit fini respectant les normes en vigueur.
La qualité des sirops est depuis longtemps associée à la contamination microbienne de la
sève d'érable (Naghski et Willits 1957). Quelques tentatives ont été entreprises pour
développer une méthode d'analyse de la sève d'érable apte à prédire la qualité des sirops
produits. Suite à ces recherches, il a été conclu que la charge microbienne ne suffit pas à
expliquer les défauts de saveur (Dumont 1999). Il est donc nécessaire d'évaluer l'impact
à la fois de la nature et de la diversité des microorganismes présents afin de déterminer
quels sont les facteurs impliqués dans le développement des flaveurs. Ceci permettrait la
mise au point de méthodes d'analyses plus fidèles et le développement de moyens de
contrôle de la production pour minimiser les volumes de perte.
Les études récentes portant sur la contamination à l'entaille, les tubulures de collecte et
la sève d'érable ont apporté de précieuses informations concernant la phylogénie de la
communauté microbienne. Un complément à ces recherches serait d'étudier la variabilité
de la structure et de la composition des communautés microbiennes de la sève d'érable
sur une plus grand échelle, en lien avec la qualité des sirops produits, afin d'appréhender
leur rôle dans le développement des flaveurs de l'érable. Par ailleurs, une approche
moléculaire pourrait permettre d'identifier les microorganismes non-cultivables. Compte
tenu que la sève d'érable n'est disponible que pendant quelques semaines par année et
que de grands volumes sont nécessaires pour produire une quantité suffisante de sirop
pour les différentes analyses, une étude de type exploratoire associée à des analyses
multivariées s'impose. Les connaissances acquises pourront servir de fondement pour de
futures études expérimentales visant à démontrer l'impact de certains microorganismes
sur la qualité de la sève et du sirop d'érable et permettant d'élaborer de nouvelles
stratégies de contrôle de la contamination microbienne de la sève.
Chapitre 1
Revue de littérature
1.1 Portrait socio-économique du secteur acéricole L'érable est principalement exploité au Québec, en Ontario, au Nouveau-Brunswick
ainsi que dans quelques états du Nord-Est des États-Unis (Figure 1.1). Le portrait de
l'industrie acéricole a beaucoup évolué au cours des dernières décennies. Grâce à la
science et à la technologie, sources d'innovation, le secteur a connu un essor important.
Les exploitations artisanales ont fait place à de véritables érablières industrielles, de
sorte que la production a doublé en vingt ans (Figure 1.2) et le nombre d'entailles est en
constante augmentation (Figure 1.3). Les techniques modernes de récolte et de
production telles que la collecte tubulaire et l'osmose inverse ont permis d'améliorer le
rendement et de rentabiliser la production de sirop d'érable. En 2010, l'acériculture au
Québec a produit à la ferme une valeur de sirop d'érable de près de 241 millions de
dollars.
Figure 1.1 Aire de répartition de l'exploitation commerciale de l'érable. Adapté de ministère de l'agriculture, de l'alimentation et des affaires rurales de l'Ontario.
I Québec l Autres provinces i États-Unis ■ Total
-a o
100%
90% -\
80%
70% -|
60%
50%
40%
30%
20%
10%
0%
' \ /
\
r 160
- 140
- 120 1/1
91
> - 100 ai
TJ ai
TJ t / i
- 80 o
- 60 1 ro n
- 40 1 -
- 20
- 0
####&## f f f fwwfMMf Année
Figure 1.2 Évolution de la production acéricole selon les données de la FPAQ (2010).
•Production (Livres) •Entailles •Valeur ($) •Exportations ($)
300
250
200
150
100
50
- i — i — i — i - -T 1 1 1-
0 0 0 0 ai a>
r o ^ L n f ^ r ^ o o C T ï O T H r s i r n ^ - i n v o r ^ o o a i O T H r s i r n ^ L n i — r ^ o o a i O o o o o o o o o o o o o o o o i o i o i o i a i a i a i C T i a i a i o o o o o o o o o o i - i o ^ o ^ d a i a > < T i a i c i c n a i a i < L T > i j i t j i < j i c n d O O O o o o o o o o o
r ^ t - 1 r H , H T H r - t r - t T H t - H r H r H * H t H t H T H r H T - l r H t H ( N r s | f N r N i r s l ( N { N r > ( f N r N r s |
Année
Figure 1.3 Évolution de la production, du nombre d'entailles, de la valeur du sirop d'érable produit au Québec et des exportations canadiennes selon les données de la FPAQ (2010).
Le Québec est le premier producteur mondial de sirop d"érable et fournit chaque année
près de 75% de la production (Figure 1.2). Il compte plus de 13 500 producteurs
regroupés sur 7420 entreprises (FPAQ 2010). La filière acéricole québécoise a créé
l'équivalent de 12 096 emplois à temps plein directs, indirects et induits et a engendré une
richesse de 734 millions de dollars en 2009 (EcoRessources consultants 2010). Les
produits de l'érable sont vendus dans 52 pays à travers le monde et ont généré des
revenus d'exportation de 75,2 millions de dollars en 2009 (Figure 1.3). Les États-Unis,
l'Allemagne et le Japon sont les principaux acheteurs et ont chacun leurs préférences en
matière de catégories de sirops.
1.2 La fabrication moderne du sirop d'érable L'érable à sucre (Acer saccharum), et de façon plus marginale, l'érable rouge (Acer
rubrum) et l'érable argenté (Acer saccharium) sont entaillés à la fin de l'hiver.
L'acériculteur pratique des trous de 0,762 à 1,1 cm de diamètre par 5 à 6,5 cm de
profondeur dans l'écorce (Allard 1999). Les entailles à diamètre réduit épargnent
davantage l'arbre en lui infligeant une blessure minimale (Allard 1998). De plus, le
diamètre de l'arbre détermine le nombre d'entailles praticables sur celui-ci (Allard
1999). Un chalumeau est ensuite inséré dans le trou, puis relié à des tubulures
secondaires en polyethylene semi-rigide coloré, plutôt qu'à des chaudières. Ces
tubulures convergent vers des tuyaux maîtres qui amènent F eau d'érable vers une station
de pompage à vide (Sysvac). L'eau est ensuite acheminée, par une autre pompe, vers la
cabane à sucre. Elle y sera entreposée de quelques heures à quelques jours, le plus
souvent dans un réservoir situé à l'extérieur, avant d'être transformée en sirop et
produits dérivés.
Nombreux sont les acériculteurs qui concentrent la sève d'érable par osmose inverse.
Cette technique à l'origine destinée à dessaler l'eau de mer permet de concentrer la sève
d'érable environ quatre à cinq fois. Cette étape permet des économies d'énergie puisque
la sève doit bouillir moins longtemps pour atteindre la concentration finale de 66 °Brix.
Le concentré de sève obtenu revêt une couleur jaunâtre et est extrêmement périssable. Il
doit donc être bouilli le plus rapidement possible.
L'évaporation thermique se fait en semi-continu dans de grandes cuves en acier
inoxydable contrôlées par un système de chauffage à réglage automatique. Cette étape
est cruciale, parce que c'est à ce moment que se produisent les réactions chimiques
responsables du développement des flaveurs et de la couleur du sirop d'érable. Une fois
concentré, le sirop est filtré, puis transféré chaud dans les contenants pour la vente au
détail. Alternativement, il peut être vendu en barils à la FPAQ qui procédera alors à
différentes analyses pour s'assurer de la qualité et de l'authenticité du produit.
Le virage technologique qu'a pris l'industrie acéricole apporte son lot de nouveaux
problèmes, notamment l'assainissement des systèmes de tubulures. Les lignes de
tubulure peuvent s'affaisser et la sève y stagner (King et Morselli 1985). De plus, le
soleil peut réchauffer les tubulures à des températures avoisinant les températures
optimales de croissance des microorganismes (Morselli et Whalen 1979). L'écoulement
de la sève peu également être freiné par l'accumulation de matière organique qui résulte
de l'adhésion des microorganismes à la surface interne des tubulures (Frank et Willits
1961; King et Morselli 1983). Aucun produit bactéricide ou désinfectant n'est
actuellement homologué pour assainir l'entaille pendant la saison de coulée. Il est
cependant recommandé d'asperger d'alcool éthylique le voisinage immédiat de l'entaille
et de désinfecter la mèche pour prolonger la période d'asepsie (Allard 1999). Les
résultats liés à cette pratique sont cependant mitigés (Perkins et van den Berg 2009).
À la fin de la saison, un lavage des tubulures à 1'hypochlorite de sodium est
recommandé, de préférence avant la fonte des neiges, afin d'éviter de brûler la
végétation environnante (Auger et al. 2004). De plus, des résidus peuvent contaminer la
sève et se concentrer dans le sirop lui donnant un arrière-goût salé et une couleur plus
foncée si le système n'a pas été rincé adéquatement (Morselli et al. 1985). Des
recherches sont présentement en cours pour développer une méthode d'assainissement
plus efficace.
1.3 La qualité du sirop d'érable
Les normes canadiennes stipulent qu'un sirop doit contenir au minimum 66% de matière
sèche, ne doit pas fermenter, doit être limpide et de couleur uniforme, doit posséder une
saveur d'érable caractéristique de sa classe de couleur (tableau 1.1) et doit être exempt
d'odeur ou de goût désagréable. Cependant, une trace de goût de caramel, de bourgeon
ou de sève est tolérée pour les sirops de catégorie Canada n° 3 (Canada 2006). La FPAQ
qui met en marché la majorité des sirops en vrac produits au Québec classe également
les sirops en fonction des défauts présentés au tableau 1.2.
Tableau 1.1 Classification du sirop d'érable
Catégorie Classe de Classe (couramment Pourcentage de transmission couleur utilisée) de lumière
Canada n°l Extra clair AA 75% et plus Canada n°l Clair A De 60,5% à 74,9% Canada n°l Medium B De 44% à 60,4% Canada n°2 Ambré C De 27% à 43,9% Canada n°3' Foncé D Moins de 27% Toutes les couleurs mentionnées ci-haut peuvent être attribuées au sirop d'érable de
catégorie Canada n° 3 lorsque celui-ci répond uniquement aux exigences de cette catégorie Source : Règlement sur les produits de l'érable de la Loi sur les produits agricoles au Canada (C.R.C, ch. 289, annexe III)
Tableau 1.2 Classification des défauts du sirop d'érable selon la FPAQ
Code Type Description 1 Défaut d'origine naturelle ou
transformation relié à la Bois, brûlé
2 Microbiologique Moisissure, fermentation 3 Chimique Trace de résidus 4 Non identifié Ensemble de mauvais goûts ou odeurs
non identifiables 5 Défaut bourgeon Saveur de bourgeon 6 Défaut filant Texture filante
Source: Règlement des producteurs acéricoles sur les normes de qualité et le classement. (Décision 7360, a. 20, Annexe B)
La fabrication, qu'elle soit traditionnelle ou moderne, comporte de nombreux paramètres
intrinsèques et extrinsèques qui influencent la saveur et la couleur du sirop d'érable. Les
facteurs intrinsèques comprennent le métabolisme de l'arbre, la composition chimique
de la sève d'érable, le pH et la charge microbienne (Dumont et al. 1993a; Lagacé et al.
2002). Il est présumé que la composition microbienne a aussi un impact (Naghski et al.
1957b; Willits etal. 1961b; Dumont 1999).
10
Quant aux facteurs extrinsèques, ils comprennent les conditions climatiques (Lagacé
1999), l'aération, la lumière, les matériaux utilisés, le nettoyage (Morselli et al. 1985),
les conditions d'entreposage de la sève, les procédés de transformation (Dumont et al.
1993a) et la post-contamination. Ceci dit, la qualité de la matière première, la sève
d'érable, revêt une importance capitale en tant que premier maillon de la chaîne de
production du sirop d'érable.
1.4 La composition chimique de la sève d'érable La composition chimique de la sève varie au cours de la saison de récolte en fonction du
métabolisme de l'arbre et de la contamination microbienne, lesquels sont fortement
influencés par la température (Dumont 1994a). La sève ou l'eau d'érable porte bien son
nom puisqu'elle se compose d'environ 98% d'eau. Le saccharose représente de 96 à
99,99% de la matière sèche. Les autres composés détectés sont des sucres réducteurs,
des composés azotés, des composés phénoliques, des acides organiques et des minéraux
(Dumont et al. 1993a; Dumont 1994b; Morselli et al. 1996). Le tableau 1.3 fait état de
leurs différentes concentrations retrouvées dans la sève d'érable.
Tableau 1.3 Composition de la matière sèche de la sève d'érable
Composé % (p/p) Saccharose 96-99,99 Glucose 0-0,17 Fructose 0,25-10 Acide malique 0,15-1,60 Acide succinique 0,01-0,05 Acide fumarique 0,01-0,003 Composés phénoliques 0,4-0,5 Composés azotés 0,05-0,10 Acides aminés libres 0,01 Ca 0,25-0,40 K 0,25 Mg 0,025-0,03 Mn 0,025 P 0,025 Na 0,01 Fe 0,01
11
Les sucres réducteurs de la sève d'érable sont principalement du fructose et du glucose
dont la concentration varie de 0 à 0,025% de la matière sèche. Les enzymes des
microorganismes de la sève d'érable seraient responsables de l'hydrolyse du saccharose
en glucose et en fructose. Ces sucres sont particulièrement susceptibles à la
caramélisation et aux réactions de Maillard.
La présence et la nature des acides aminés dans la sève d'érable varient beaucoup d'une
sève à l'autre (Dumont 1994a). En plus du métabolisme de l'arbre, il est possible que les
microorganismes y jouent un rôle.
Les composés phénoliques seraient majoritairement dérivés de la lignine qui se
décomposerait suivant les conditions climatiques et l'action des microorganismes. Les
plus hautes concentrations de composés phénoliques sont observées en début et en fin de
saison. De plus, les profils varient considérablement d'un producteur à l'autre.
Les acides organiques, tout comme les acides aminés et les composés phénoliques,
varient entre les sèves. Cette variation est, elle aussi, attribuée au métabolisme des
microorganismes contaminants (Dumont 1994b). L'acide dominant est l'acide malique
qui peut représenter jusqu'à 99% des acides d'une sève (Morselli et al. 1996). Celui-ci
précipite sous forme de malate de calcium lors de 1'evaporation thermique et peut causer
de la turbidité s'il n'est pas complètement éliminé par filtration.
Le pH de la sève d'érable varie de 3,9 à 7,9. La flore de la sève n'est pas toujours
acidifiante, mais des baisses extrêmes de pH ont été observées et à partir de pH 6,8 et en
deçà, la sève d'érable a tendance à donner des sirops foncés au goût brûlé ou fortement
caramélisé. De même, un pH alcalin favoriserait les réactions de caramélisation lors de
l'évaporation (Dumont 1999; 2000).
Ces variations de la composition chimique de la sève d'érable témoignent de l'action
des microorganismes sur cette matière première. Les microorganismes modifient la sève
d'érable par leur métabolisme, mais également par la composition chimique de leur
propre biomasse.
12
1.5 La composition chimique du sirop d'érable Les études portant sur la composition chimique du sirop d'érable démontrent que sa
composition est extrêmement variable. Le tableau 1.4 résume l'étendue des valeurs
rapportées pour les principaux composés détectés dans le sirop d'érable (Stuckel et Low
1996; Perkins et van den Berg 2009). Il est important d'ajouter que de nombreux
composés du sirop d'érable demeurent à ce jour non identifiés (Potter et Fagerson 1992;
Kermasha et al. 1995; Abou-Zaid et al. 2008; Sabik et al. 2010; Li et Seeram 201 lb).
Les composés phénoliques forment une classe de composés qui revêt un intérêt
particulier pour le sirop d'érable. D'une part, parce que ces composés démontrent des
propriétés anti-oxydantes qui apportent une valeur ajoutée au produit d'un point de vue
nutritionnel (Theriault et al. 2006; Abou-Zaid et al. 2008) et, d'autre part, parce que ce
sont des composés aromatiques qui contribuent aux flaveurs du sirop (Underwood et
Filipic 1963; Filipic et Underwood 1964; Filipic et al. 1969; Sabik et al. 2010). La
quantité et les proportions de composés phénoliques varient en fonction du lieu de
production. Le moment de récolte de la sève influence également la quantité de
composés phénoliques, qui est plus élevée au début et en fin de saison (Kermasha et al.
1995).
13
Tableau 1.4 Composition chimique du sirop d'érable
Composé Étendue des valeurs rapportées Eau (%) 26,5-39,4 Saccharose (%) 42,3-75,6 Glucose (%) 0-9.6 Fructose (%) 0-6.8 Acide malique (%) 0.06-0.9 Acide succinique (%) 0-0.26 Acide fumarique (%) 0-0.13 Composés phénoliques (%) 0.0005-0.001 Vanilline (ppm) 0.73-4.09 Acide férulique (ppm) 1.61-2.8 Composés azotés (%) 0.001-0.077 Ca(ppm) 183-2800 K(ppm) 541-4031 Mg (ppm) 0-575 Mn (ppm) 0-252 P(ppm) 0.01-2335 Na (ppm) 0-492 Fe(ppm) 0-61 Zn (ppm) 0-527 Al (ppm) 0.01-18 B(ppm) 0.01-3 S (ppm) 0.01-100 Cu (ppm) 0-8 Tin (ppm) 0-33 Pb (ppm) 0-0.49 Cd (ppm) 0-0.09 Cl (ppm) 20-400 Thiamine (ppm) 1.3 Niacine (ppm) 0.16-1 Riboflavine (ppm) 0.046-0.6
14
1.6 Les flaveurs du sirop d'érable
Les flaveurs, c'est-à-dire la saveur et l'odeur du sirop d'érable sont à la fois complexes et
très variables (Sabik et al. 2010). Pour cette raison, certains auteurs comparent le sirop
d'érable au fromage ou au vin. La Figure 1.4 présente la roue des flaveurs de l'érable, un
vocabulaire descriptif précis et documenté des flaveurs de l'érable développé par le
gouvernement canadien et le Centre ACER inc. (Canada, 2004).
Figure 1.4 La roue des flaveurs de l'érable
15
De nombreux travaux ont cherché à isoler les composés responsables de ces flaveurs
caractéristiques (Underwood et Filipic 1963; Filipic et Underwood 1964; Underwood et
Filipic 1964; Filipic et al. 1965; Underwood et Filipic 1965; Filipic et al. 1969;
Underwood et al. 1969; Potter et Fagerson 1992; Kermasha et al. 1995; Sabik et al.
2010). Les principaux constituants impliqués incluent le 4-hydroxy-3-méthoxy-
benzaldehyde (vanilline), le 3-méthyl-2-hydroxycyclopenten-2-one (cyclotène), le 2,5-
diméthyl-4 hydroxy-2(2H)-furanone (furanéol), le 4,5-diméthyl-3-hydroxy-2(5H)-
furanone (sugar furanone) et le 2-méthoxy phénol (gaïacol) (Belford et al. 1991).
Les composés responsables des principales flaveurs se formeraient lors de la
transformation en sirop à partir de précurseurs présents dans la sève suivant différentes
réactions chimiques (Potter et Fagerson 1992). D'abord, la décomposition thermique des
sucres, dont le saccharose et le fructose, en conditions alcalines forme du cyclotène, du
furanéol et des composés dérivés. Ensuite, la réaction de Maillard qui résulte d'une
réaction entre le groupement carboxyle des sucres réducteurs et les groupements amines
des acides aminés est également responsable de la formation de composés aromatiques
et colorés. Leur nature contribue également au développement des flaveurs parce que
des composés différents seront formés pour différents acides aminés. Notamment, le
goût de bourgeon observé en fin de saison serait associé à l'augmentation des acides
aminés dans la sève de l'arbre précédant l'éclosion des bourgeons (Morselli et Feldheim
1988). Finalement, l'oxydation et l'hydrolyse alcaline des monomères de lignines
présents dans la sève seraient responsables de la formation de la vanilline et du
syringaldéhyde dans le sirop (Filipic et al. 1969; Potter et Fagerson 1992). La vanilline
serait le composé phénolique dérivé de la lignine le plus important pour la flaveur du
sirop d'érable (Filipic et al. 1969). Sa saveur serait détectable dès 0.69 ppm (Fazzalari
1978). L'acide férulique et le méthylcyclopetenolone ont également un seuil de
détection très faible (90 ppm pour l'acide férulique) (Fazzalari 1978).
16
1.7 La microbiologie acéricole La sève d'un arbre sain est presque stérile, mais se contamine à l'entaille et lors de son
passage dans les tubulures (Morselli et Whalen 1991). La composition chimique de la
sève d'érable en fait un milieu exceptionnel pour la croissance microbienne. La
contamination varie typiquement de IO2 à IO7 UFC/mL (Lagacé et al. 2002).
Les recommandations de lavage, citées précédemment, soulignent qu'il est important de
minimiser la présence des microorganismes dans la sève d'érable. Considérant la masse
microbienne globale en termes de comptes totaux aérobies mésophiles, son
augmentation a effectivement un impact généralement négatif sur la qualité finale du
sirop (Lagacé et al. 2002). Dans plusieurs cas cependant, de bons sirops ont été obtenus
avec des sèves contenant jusqu'à IO7 UFC/mL (Dumont 1999; Lagacé et al. 2002).
Lagacé et al. (2002) expliquent ce résultat par une transformation rapide où le sucre
n'aurait pas eu le temps d'être hydrolyse, tandis que Dumont (1999) souligne
l'importance de la nature et de l'activité des microorganismes. Par ailleurs, un sirop
provenant d'une sève stérile est insipide (Luc Lagacé, communication personnelle).
La microbiologie acéricole intéresse depuis longtemps les chercheurs. Déjà, au début du
20e siècle, des bactéries, levures et moisissures avaient été isolées de la sève d'érable
(Edson 1910). Le tableau 1.5 répertorie les espèces rapportées dans la sève d'érable. Il
s'agit de microorganismes généralement psychrophiles à mésophiles, aerobes stricts ou
anaerobes facultatifs.
17
Tableau 1.5 Microorganismes retrouvés dans la sève d'érable
Bactéries Gram- Source Référence Achromobacter
superficiale1
sceris' Actinobacillus
seminis Bordetella
avium Brenneria
alni Chryseobacterium
indoltheticum scophthalmum
Enterobacter aerogenes agglomérons amnigenus
Flavobacterium Solare1
Pedobacter cryoconitis
Pseudomonas
fluorescens
fulgida' geniculata2
graminis marginalis mephitica2
putida (striata, convexa) synxantha syringae
Rahnella aquatilis
Ralstonia eutropha taiwanensis
Shewanella (Pseudomonas) putrefaciens
Stenotrophomonas maltophilia
entaille et eau (Sheneman et Costilow 1958) entaille et eau (Sheneman et Costilow 1958) eau (Edson et al. 1913)
biofilm (Rasolofo 2004)
biofilm (Rasolofo 2004)
entaille (Lagacé et al. 2004) entaille et eau (Lagacé et al. 2004) entaille (Lagacé et al. 2004) biofilm (Rasolofo 2004)
eau (Fabian et Buskirk 1935) eau (Willits et al. 1961b) biofilm (Rasolofo 2004) entaille et eau (Naghski et al. 1957b; Sheneman et Costilow 1958) entaille et eau (Sheneman et Costilow 1958) entaille (Lagacé et al. 2004) entaille (Lagacé et al. 2004) entaille, eau et (Edson et al. 1913; Naghski et al. 1957b; Sheneman et biofilm Costilow 1958; Lagacé et al. 2004; Lagacé et al. 2006b) eau et biofilm (Willits et al. 1961b; Morselli et Feldheim 1988; Rasolofo
2004; Lagacé et al. 2006b) entaille (Lagacé et al. 2004) entaille et eau (Sheneman et Costilow 1958; Willits et al. 1961b) entaille (Lagacé et al. 2004) eau et biofilm (Rasolofo 2004) entaille et eau (Sheneman et Costilow 1958) entaille et eau (Sheneman et Costilow 1958; Willits et al. 1961b) biofilm (Rasolofo 2004) eau, entaille et (Lagacé et al. 2004; Lagacé et al. 2006b) biofilm eau (Lagacé et al. 2006b) biofilm (Rasolofo 2004) entaille (Lagacé et al. 2004) entaille (Lagacé et al. 2004) entaille (Lagacé et al. 2004)
entaille et eau (Sheneman et Costilow 1958)
eau et biofilm (Rasolofo 2004)
Bactéries Gram+ Source Référence Agreia Arthrobacter
rhombi Bacillus
cereus circulons
Brachybacterium conglomeratum (Micrococcus
entaille (Lagacé et al. 2004)
entaille (Lagacé et al. 2004) entaille et eau (Edson et al. 1913; Sheneman et Costilow 1958) entaille et eau (Sheneman et Costilow 1958; Lagacé et al. 2004) entaille et eau (Sheneman et Costilow 1958)
entaille et eau (Sheneman et Costilow 1958)
18
conglomaratus) Brevibacterium
casei entaille (Lagacé et al. 2004) Cellulomonas
flavigena entaille (Lagacé et al. 2004) Curtobacterium
flaccumfaciens entaille (Lagacé et al. 2004) Frigoribacterium entaille (Lagacé et al. 2004) Microbacterium entaille (Lagacé et al. 2004) Micrococcus entaille et eau (Edson etal. 1913; Sheneman et Costilow 1958)
varions entaille et eau (Sheneman et Costilow 1958) luteus entaille et eau (Sheneman et Costilow 1958; Lagacé et al. 2004) candidatus1 entaille et eau (Sheneman et Costilow 1958)
Peanibacillus borealis entaille (Lagacé et al. 2004)
Plantibacter flavus entaille (Lagacé et al. 2004)
Rhodococcus erythropolis entaille (Lagacé et al. 2004)
Rothia dentocariosa entaille (Lagacé et al. 2004)
Sanguibacter suarezii entaille (Lagacé et al. 2004)
Sarcina entaille et eau (Sheneman et Costilow 1958) Staphylococcus entaille (Lagacé et al. 2004)
warneri entaille (Lagacé et al. 2004) epidermidis entaille (Lagacé et al. 2004) caprae entaille (Lagacé et al. 2004)
Levures Source Référence Bulleromyces
albus entaille (Lagacé et al. 2005) Candida entaille et eau (Sheneman et Costilow 1958)
curvata entaille et eau (Sheneman et Costilow 1958) famata entaille et eau (Sheneman et Costilow 1958)
Cryptococcus entaille (Lagacé et al. 2005) albidus entaille et eau (Sheneman et Costilow 1958; Lagacé et al. 2005) aquaticus entaille (Lagacé et al. 2005) heveanensis entaille (Lagacé et al. 2005) hungaricus entaille (Lagacé et al. 2005) laurentii entaille et eau (Sheneman et Costilow 1958) macerans entaille (Lagacé etal. 2005) magnus entaille (Lagacé et al. 2005) victoriae entaille (Lagacé et al. 2005) wieringae entaille (Lagacé et al. 2005)
Dioszegia changbaiensis entaille (Lagacé et al. 2005) crocea entaille (Lagacé et al. 2005)
Dothidea ribesia entaille (Lagacé et al. 2005)
Leucosporidium scottii entaille (Lagacé et al. 2005)
Mrakia frigida entaille (Lagacé et al. 2005)
Pichia misumaiensis entaille (Lagacé et al. 2005)
Rhodosporidium
19
lusitaniae Rhodotorula entaille (Lagacé et al. 2005)
fujisanensis glutinis entaille et eau (Sheneman et Costilow 1958) laryngis entaille (Lagacé et al. 2005) nothofagi entaille (Lagacé et al. 2005) slooffiae entaille (Lagacé et al. 2005)
Setosphaeria monoceras entaille (Lagacé et al. 2005)
Sporobolomyces roseus entaille (Lagacé et al. 2005) ruberrimus entaille (Lagacé et al. 2005)
Guehomyces (Trichosporon) pullulons entaille et eau (Sheneman et Costilow 1958; Lagacé etal. 2005)
Udeniomyces pyricola entaille (Lagacé et al. 2005)
Zymoxenoglea eriophori entaille (Lagacé et al. 2005)
Moisissures Source Référence Alternaria entaille et eau (Sheneman et Costilow 1958) Acremonium entaille et eau (Sheneman et Costilow 1958) Aspergillus entaille et eau (Sheneman et Costilow 1958) Cladosporium entaille et eau (Sheneman et Costilow 1958) Coniothyrium entaille et eau (Sheneman et Costilow 1958) Fusarium entaille et eau (Sheneman et Costilow 1958) Pénicillium entaille et eau (Sheneman et Costilow 1958) Phoma entaille et eau (Sheneman et Costilow 1958) Rhizoctonia k , . r- • i
entaille et eau (Sheneman et Costilow 1958)
www.bacterio.cict.fr) et n'a pas de synonyme connu. 2Ne devrait plus faire partie du genre Pseudomonas.
Quelques espèces microbiennes de la sève d'érable ont déjà été associées à un effet
spécifique et possèdent des caractéristiques biologiques pertinentes. Par exemple,
Enterobacter (Aerobacter) aerogenes est un agent de détérioration de la sève d'érable
menant à la production de sirops filants (Fabian et Buskirk 1935; Québec 1984).
Pseudomonas fluorescens donne une apparence verte à la sève par la production de
pigments fluorescents et des bacilles sont responsables de la sève « laiteuse ». La sève
« rouge » serait causée par des levures rouges et certaines bactéries (Thompson 2010).
De plus, les levures produisent généralement des invertases qui pourraient augmenter la
quantité de sucres réducteurs et mener à la production de sirops caramélisés, masquant
ainsi les saveurs fines de l'érable (Naghski et al. 1957b; Naghski et Willits 1957).
À l'inverse, des souches de Pseudomonas geniculata, P. fluorescens ainsi
qu'Enterobacter agglomérons (Flavobacterium rhenanum) peuvent contribuer au
développement de la saveur caractéristique de l'érable (Naghski et al. 1957b; Willits et
20
al. 1961b). Cependant, la taxonomie de P. geniculata est aujourd'hui ambiguë et cette-
dernière ne devrait plus faire partie du genre Pseudomonas. Or, le plus proche parent
connu de P. geniculata est Stenotrophomonas maltophilia qui a récemment été retrouvé
dans le microbiote acéricole (Rasolofo 2004).
Pseudomonas est le seul genre bactérien commun à toutes les études de la littérature
ayant porté sur le microbiote acéricole et varie peu d'année en année, ce qui soutient
l'hypothèse que la microflore stable soit en partie responsable de la flaveur
caractéristique de l'érable (Lagacé et al. 2006b). Certains Pseudomonas possèdent entre
autres des enzymes capables de dégrader la lignine et de libérer les précurseurs de
flaveurs qu'elle contient tel l'acide vanillique (Ruzzi et al. 1997; Narbad et Gasson
1998).
Une seconde bactérie prédominante serait Rahnella aquatilis (Lagacé et al. 2006b). Elle
a déjà été associée à la production de gaïacol, responsable de la production d'une saveur
de fumée dans le lait au chocolat à température de réfrigération (Jensen et al. 2001).
Cette bactérie possède également une levansucrase qui catalyse la production de
polysaccharides et de glucose à partir du saccharose (Kang et al. 2004).
1.7.1 Les biofilms La majorité des microorganismes de l'environnement ne vivent pas à l'état planctonique
mais sous forme de biofilms, c'est-à-dire en communautés structurées adhérées à une
surface (Costerton et al. 1995). Le modèle structural actuel comprend des microcolonies
composées de cellules et de matrice extracellulaire parsemée de canaux servant au
transport des nutriments. La formation d'une telle cité comprend le transport d'un
microorganisme vers une surface, l'adhésion initiale, le bioattachement, la colonisation
et finalement l'agrégation et le détachement (Davey et O'Toole 2000).
Les microorganismes du microbiote acéricole ne font pas exception et forment des
biofilms sur la surface interne des tubulures de récolte (King et Morselli 1983; Rasolofo t **)
2004). Lagacé et al. (2006) ont rapporté des comptes aérobies totaux variant entre 10 et
107 UFC/cm2, un ordre de grandeur similaire à celui de la contamination planctonique de
21
la sève d'érable. En microscopie électronique, ils ont observé un biofilm mixte composé
principalement de bacilles et de quelques levures.
Les biofilms protègent les microorganismes et les rendent plus résistants aux
antibiotiques et aux produits de nettoyage. Les concentrations minimales d'éradication
de biofilm (MBEC) pour le peroxyde, F hypochlorite de sodium, l'ammonium
quaternaire et l'acide peracétique d'une souche provenant des tubulures de récolte sont
environ cinquante fois plus élevées que les concentrations bactéricides minimales
(MBC) (Lagacé 2006).
1.7.2 La diversité microbienne La diversité est une mesure importante en écologie microbienne, car elle représente la
structure d'une communauté. Elle est fonction du nombre d'espèces (richesse) et de
l'abondance relative de chacune (Felske et Osborn 2005). Cette diversité peut être
mesurée à tous les niveaux d'organisation biologique, d'un gène à une communauté,
selon l'unité taxonomique opérationnelle (OTU) désignée. Par exemple, un fragment
d'ADN commun peut être désigné pour regrouper les organismes, aussi bien qu'un
niveau hiérarchique de classification comme la classe, le genre ou l'espèce.
Dans le domaine acéricole, de récents travaux ont pu mettre en évidence la diversité des
grands groupes bactériens rencontrés (Lagacé et al. 2004; Lagacé et al. 2006b). Selon
une étude faite sur des isolats bactériens, l'indice de diversité de Shannon des
microorganismes à l'entaille serait maximal au milieu de la saison de coulée (Lagacé et
al. 2004). Selon une autre étude faite par une méthode culture-indépendante, l'indice de
diversité de Shannon de la sève et des biofilms des tubulures principales diminuerait à
mesure que la saison progresse, indiquant ainsi une dominance de certains groupes
(Lagacé et al. 2006b).
1.8 L'analyse des communautés microbiennes On estime que 90% des microorganismes de l'environnement ne peuvent être cultivés en
laboratoire compte tenu de l'état actuel des connaissances. Les méthodes dites cultures-
indépendantes permettent de contourner ce problème pour accéder à l'ensemble des
populations d'un environnement donné. Ces méthodes sont parfois qualifiées de
22
« métagénomiques », car elles ciblent l'ensemble des génomes d'une communauté
microbienne. En effet, le point de départ commun à ces méthodes est d'extraire
simultanément tout l'ADN des organismes d'un échantillon. À partir de cet ADN
communautaire, une variété de méthodes est disponible pour en étudier la composition.
Il est bien entendu que la description exhaustive de chacune de ces méthodes dépasse les
objectifs de cette thèse. C'est pourquoi ne seront introduites ici que les méthodes
d'intérêt pour l'étude présentée. Une description plus complète de ces méthodes et leur
application au secteur alimentaire est disponible dans la revue de littérature de Juste et
al. (2008).
Les méthodes de type « fingerprinting » où un profil ou empreinte d'une communauté
est généré par l'électrophorèse de marqueurs phylogénétiques amplifiés par PCR
figurent parmi les plus populaires, surtout depuis la disponibilité plus répandue
d'appareils d'électrophorèse capillaire servant au séquençage d'ADN. La Figure 1.5
illustre le principe de trois méthodes fréquemment utilisées en écologie microbienne.
La première de ces méthodes à avoir été développée est F électrophorèse en gradient
dénaturant ou « denaturing gel gradient electrophoresis » (DGGE). La technique
consiste à amplifier un marqueur phylogénétique par PCR, puis à séparer les gènes
homologues de taille semblable par électrophorèse sur un gel de polyacrylamide
comportant un gradient de substances dénaturantes (Muyzer et al. 1993). La séparation
des fragments d'ADN est basée sur la mobilité électrophorétique des molécules
dénaturées qui est réduite comparée à celle des molécules de forme hélicale. La
dénaturation des molécules d'ADN est fonction de leur séquence et de leur contenu en
bases GC. Pour stabiliser les amplicons, une pince riche en GC est ajoutée à l'une des
amorces. Il existe une variante à cette méthode qui utilise un gradient de température,
soit l'électrophorèse en gradient thermique ou « thermal gradient gel electrophoresis »
(TGGE) (Muyzer et al. 1993).
Une seconde méthode, le « terminal restriction fragment length polymorphism » (T-
RFLP), consiste à digérer les amplicons de même taille par des enzymes de restriction.
Puisqu'une des amorces a été marquée d'un fluorophore, F électrophorèse capillaire du
digestat permet de séparer les fragments de restriction terminaux en fonction de leur
23
taille (Marsh 1999). Ainsi, les homologues sont séparés en fonction de la présence et de
la position de sites de restriction.
DGGE ARISA T-RFLP
Pince GC
* * '
♦
Marqueur _ J de poid
moléculaire
Fluorophore
* .
♦
Q Taille {pb)
• N OO ISO 200 SO 300 SU 400 |
Taille (pb) 0 M 100 190 200 250 10* » f
Figure 1.5 Principe des principales méthodes de profilage utilisées pour l'analyse des communautés microbiennes.
24
Une troisième méthode appelée « automated ribosomal intergenic spacer analysis »
(ARISA) consiste à amplifier une région intergénique de l'opéron ribosomal dont la
taille est intrinsèquement polymorphique (Fisher et Triplett 1999). L'utilisation d'une
amorce marquée d'un fluorophore et F électrophorèse capillaire permettent d'obtenir un
profil de fragments séparés en fonction de leur taille.
Historiquement, le gène de l'ADNr 16S est utilisé pour l'identification phylogénétique
des bactéries et l'ADNr 18S chez les eucaryotes (Woese 1987). Ces gènes sont une
horloge moléculaire qui témoigne de l'évolution des organismes. Ils sont composés de
régions conservées essentielles à la fonction du gène et de régions variables qui évoluent
au cours du temps. Les régions conservées permettent l'utilisation d'amorces
virtuellement universelles alors que les régions variables permettent l'identification
phylogénétique. Ces marqueurs ne sont cependant pas parfaits. En effet, l'opéron sur
lequel on retrouve ces gènes est présent en un nombre variable de copies, pouvant
comporter des séquences différentes, ce qui peut occasionner des biais. La connaissance
du nombre de copies pour un organisme donné est donc un pré-requis pour une
quantification absolue. Il en va de même pour les régions intergéniques (appelées IGS
chez les bactéries et ITS chez les levures) de ces opérons, qui sont parfois exploitées
pour leur polymorphisme de taille.
Lorsqu'une communauté microbienne se compose de quelques groupes dominants, il
peut être intéressant de mesurer la diversité génétique plutôt que phylogénétique afin de
déceler des différences plus subtiles. L'outil par excellence pour observer le
polymorphisme génomique est l'empreinte électrophorétique d'une amplification de
fragments d'ADN. L'amplification peut être aléatoire (RAPD), arbitraire (AP-PCR) ou
non-spécifique (U-PCR) (Rademaker et al. 2005). Ce typage peut être utilisé sur l'ADN
total d'une communauté pour en estimer la richesse et calculer des indices de diversité
comme celui de Shannon (H). Les bandes d'ADN obtenues sont alors désignées comme
OTU (Yang et al. 2004). Les méthodes de profilage sont aussi utiles pour développer
des marqueurs génétiques spécifiques, sans connaissance préalable des génomes (Pujol
et al. 2005). Un marqueur génétique est une séquence d'ADN connue, identifiable grâce
à un simple test et associé à une caractéristique détectable. En microbiologie, de tels
25
marqueurs peuvent être utiles pour différencier des souches pathogènes, pour repérer de
bons ferments ou pour tracer des agents de biocontrôle.
Une approche différente des méthodes de profilage, basée sur le séquençage, consiste à
construire une banque de clones à partir des fragments d'ADN amplifiés et à en
sequencer une portion représentative (Figure 1.6) (Rôling et Head 2005). Plus
récemment, une autre technique de séquençage, le pyroséquençage, est devenue plus
accessible et permet d'obtenir de courtes séquences contenues dans un échantillon sans
clonage préalable (Juste et al. 2008). Le tableau 1.6 détaille les principales
caractéristiques de chacune des méthodes d'analyse des communautés microbiennes.
L'utilisation conjointe de méthodes de profilage et de séquençage s'avère une stratégie
fructueuse. Par exemple, les banques de clones, avec une identification confirmée,
peuvent fournir des fragments standards culture-indépendants pour la DGGE ou encore
permettre de valider les résultats du T-RFLP dont l'identification n'est que présomptive.
26
Séquences
•Amplification avecdesamorcesciblant le gene de l'ADNr 16S
•Introduction des produits PCRdans un vecteur plasmidique à l'aide de la topoisomérase ooo •Transformation de cellules d'Escherichia coli compétentes
•Création d'une banque de clones
•Extraction plasmidique d'un nombre représentatif de clones
o o 0 o_ O
•Séquençage de l'insert de chacun des plasmides
<*.*.* cr oo i sx
•Alignement des séquences avec les références de la base de donnée pourdéterminerl'affiliation phyllogénétique
•Utilisation de logiciels d'analyse spécialisée comme DOTUR et SONS pour comparer des banques de clones.
Figure 1.6 Construction d'une banque de clones
27
Tableau 1.6 Caractéristiques des principales méthodes moléculaires culture-indépendantes utilisées pour l'analyse des communautés microbiennes
Méthode Sensibilité Rapidité Avantages Inconvénients
T-RFLP
DGGE/TGGE +
ARISA
Banques de clones
Pyro-séquençage
++
++++
+++++
Automatique Reproductible
Versatile Bases de données
Faible coût Possibilité ++
d'identification directe
Automatique +++ Reproductible
Bases de données Identification directe
+ Nouveaux organismes
Identification directe ++ Nouveaux
organismes
Digestion enzymatique Identification indirecte
Homoplasie1
Comparaison des gels
Identification indirecte
Onéreux Analyses
bioinformatiques complexes Onéreux Analyses
bioinformatiques complexes
Homoplasie : comigration de séquences hétérogènes
Les méthodes présentées jusqu'ici ont un inconvénient majeur; elles ne sont pas
quantitatives. Il existe une variante quantitative de l'ARISA, la qARISA (Ramette
2009), mais le nombre d'échantillons pouvant être traité simultanément diminue de
façon considérable. Il en va de même pour l'hybridation fluorescente in situ ou
« fluorescent in situ hybridization » (FISH) qui permet de quantifier des populations de
microorganisme sans extraction d'ADN (Juste et al. 2008). En revanche, la PCR
quantitative (qPCR) est une technique éprouvée pour quantifier les microorganismes
d'intérêt (Smith 2005). Il s'agît d'une réaction de polymérisation en chaine
conventionnelle à laquelle s'ajoute une réaction chimique permettant de faire un suivi en
temps réel de l'amplification. Les deux réactions chimiques les plus communes sont le
SYBR et les sondes TaqMan® qui se fixent respectivement à l'ADN double brin et à
une séquence précise. La Figure 1.7 illustre le principe de la quantification par la PCR
en temps réel à l'aide d'une courbe standard.
28
0,520003 Seuil
_
28
27
26
25
24
23
22
21
"ô 20 U
Cycle seuil
10 12 U 16 ia _ 22 2i _ 28
Nombre de cycles » » «
Nombre initial de copies du gène cible
Figure 1.7 Quantification par la PCR en temps réel
1.9 Les analyses multivariées Les méthodes moléculaires génèrent rapidement des masses de résultats qui sont encore
trop souvent sous ou mal exploités. L'analyse de ces résultats par des méthodes
statistiques et multivariées appropriées demeure un aspect souvent négligé par les
microbiologistes, mais non moins critique pour l'interprétation des résultats. Puisqu'il
29
n'existe pas deux écosystèmes ni même deux échantillons identiques, la reproductibilité
des expériences contrôlées est difficile, sinon impossible à obtenir en écologie
microbienne (McArthur 2006). C'est pourquoi les analyses multivariées, qui
s'intéressent à la distribution conjointe de plusieurs variables, sont de plus en plus
employées en écologie microbienne. Elles comprennent deux grandes familles, soit les
méthodes descriptives qui cherchent à structurer ainsi qu'à résumer l'information et les
méthodes explicatives qui cherchent à expliquer la variation d'une variable dépendante
par des variables indépendantes. La brève revue ci-dessous a pour but de présenter les
méthodes d'analyse multivariées descriptives les plus communes et de citer quelques
exemples de leur utilisation pour l'analyse des communautés microbiennes. Les
fondements mathématiques ainsi que les détails techniques de chacune des méthodes
peuvent être obtenus dans les ouvrages de référence tels que Legendre et Legendre
(1998), McCune et Grace (2002) et Pages et al. (1991).
Tout d'abord, il faut savoir que les résultats bruts issus des différentes méthodes
moléculaires doivent être préparés pour les analyses multivariées (Figure 1.8). Ce
processus parfois fastidieux est nécessaire pour transformer les données brutes en une
matrice de données numériques appropriée aux analyses multivariées. Certains aspects
de cette préparation, comme le choix d'une transformation mathématique, vont affecter
les résultats, ce qui occasionne une boucle dans laquelle il est facile de se perdre. Il
devient donc important de justifier ces choix par le contexte méthodologique ou
biologique. Par exemple, une transformation peut-être appliquée afin d'homogénéiser les
variances puisque les analyses multivariées sont plus performantes ainsi (Ramette 2007).
Une transformation de Hellinger peut être appliquée aux données de communautés qui
contiennent beaucoup de zéros, les rendant ainsi plus appropriées pour l'analyse par des
méthodes linéaires (Legendre et Gallagher 2001). Une transformation de rang peut aussi
être appliquée lorsque des observations aberrantes sont présentes afin de diminuer leur
impact. Une partie de l'information est perdue par cette transformation, mais cette perte
est parfois négligeable par rapport au besoin de normaliser les distributions (McCune et
Grace 2002). Ultimement, une échelle binaire qui indique simplement la présence ou
l'absence des espèces est parfois utilisée lorsque l'intérêt est focusé sur la composition
de la communauté microbienne.
30
Les données issues d'analyses descriptives des communautés microbiennes peuvent
ensuite être représentées de façon appropriée par des techniques complémentaires, soit
l'ordination et l'analyse de groupement. Les techniques d'ordination permettent de
mettre en évidence les différences continues, c'est-à-dire les gradients, alors que les
analyses de groupement et de comparaison de groupes mettent en évidence les
discontinuités entre les objets (Legendre et Legendre 1998).
L'analyse en composante principale (ACP) est sans contredit la technique d'ordination
la plus utilisée (Ramette 2007). Elle permet de résumer l'information contenue dans une
matrice de plusieurs variables. Elle consiste à transformer des variables corrélées en
nouvelles variables indépendantes les unes des autres, appelées composantes principales.
Ces dernières sont une combinaison linéaire des variables originales. L'ACP est une
approche dite géométrique, car elle représente les variables dans un nouvel espace selon
les directions d'inertie maximale et aussi statistique, car elle recherche les axes
orthogonaux expliquant au mieux la variance des données. D'un certain point de vue,
elle permet de séparer la structure du bruit (Figure 1.9). Les résultats de F ACP sont
généralement représentés par un biplot dont les axes sont les composantes principales et
la variance expliquée par ceux-ci est fournie en pourcentage. Les objets sont représentés
par des points alors que les variables sont illustrées par des flèches dont les coordonnées
représentent la corrélation avec les composantes principales. L'angle entre les
différentes flèches représente la corrélation entre les différentes variables. Les exemples
d'utilisation de F ACP pour illustrer des données de profils microbiens sont multiples
(Wang et al. 2004; Arteau et al. 2010; Van Hoorde et al. 2010). Cependant, cette
approche est parfois remise en question puisqu'elle n'est pas toujours adaptée aux types
de relations ou aux distributions des données qui sont retrouvées en écologie (McCune et
Grace 2002; Ramette 2007).
31
Etapes
Données brutes
T-RFLP, ARISA
Profils PCR
0 90 KO 190 ZOO 2 » 300 390
4 Alignement des pics
Édition
Consensus des répétitions
: ! i l . _ j
f
^ , II. Variables
"li-naie \ * -ns s.-pU_5-pli L-pU-C-plS P c * A r « l 435 C5 3*6.65
,-ï.*-2i-p21
« M É A M M
B M t A i - l S S5»C46 M U 4 WM.71
Conversion en OTU
* A r e i 9 1144.73 au) sn.i*
Banque de clones
Séquences
ssemblage et alignement des séquences
m 1 D I I ft« -nmanwss ■rj XO ZO 30 40
iac-pii-(cz u. 50-plZ-»? Une-" — 5 0 - p l 2 - « O n e . " ' 30-pi2-«l_ « » _ " 3 0 - D _ 2 - « 7 U«C> ™"
: S I A W - CAA TC 76CKAA««A "CA. 7 AA IASTÇCÏCM rClASC"SAA77 6 : K > i / « & . 'A .V * « « . : "
S A M 4 V , " BCKAAMi, CA A.S 4-, * • . -3 » 3G ——iV7 'OcaOAA—A "CA ~ ~AA AAA - ;
Comparaison phylogénétique et retrait des chimères
.Il ■ll l l l l l l l IMII» «-C__tC1-T-T-T-l
■inao*icTotïc-«
Matrice de similarité
0 . » 0.8) 0.71 0.55 '
i o.er en O.tl
1 0.55 0.5S
1 0.1
Espèces
SITE UTOl UT02 UT03
Figure 1.8 Processus de préparation des données pour les analyses multivariées
32
b)
s? m _.
IM
U _! (0
S o a E o u
1 -
0.8 - ♦
0.6 -
♦
x«*
0.4 -
0.2 -
A^*>-
^ X j
1 1 U i
1 -0.5
♦
-0.2 -
-0.4 -
-0.6 -
-0.8 -
-1 -
♦
0.5
^ x k
1
Composante principale Cj (50%)
Figure 1.9 Analyse en composante principale, a) séparation de la structure et du bruit (traduit de Husson et Josse (2010)). b) illustration du résultat d'une ACP
Une technique d'ordination plus appropriée pour les analyses en écologie microbienne
est le « non-metric multidimensional scaling » (NMS) soit le positionnement
multidimensionnel non-métrique (McCune et Grace 2002). Elle ordonne d'abord les
distances selon leur rang et ainsi ne présume aucune corrélation linéaire entre les
variables. Un algorithme de positionnement multidimensionnel débute par une matrice
de proximité entre les objets et leur assigne une position dans un espace comportant un
nombre réduit de dimensions, défini itérativement, afin d'obtenir la solution comportant
un stress minimal. Le terme « stress » est une mesure de la différence entre le
33
positionement final et la matrice de proximité initiale. Dans une ordination NMS, la
distance entre deux objets (points) correspond à une mesure de similarité et non à une
mesure de distance euclidienne entre ceux-ci. Bien que plus difficile d'application et
d'interprétation que F ACP, le NMS a été utilisé pour illustrer les résultats de la DGGE,
du T-RFLP et de F ARISA (Casamayor et al. 2002; Culman et al. 2008; Lear et al. 2008;
Dimitroglou et al. 2009; Lee et al. 2010).
L'analyse de groupement est traditionnellement la plus utilisée des approches en
écologie microbienne puisque les microbiologistes utilisent également cette approche
pour illustrer l'évolution et la phylogénie des microorganismes sous forme de
dendrogrammes (Ramette 2007). L'analyse de groupement comprend plusieurs
méthodes comportant chacunes leurs particularités, dont la classification hiérarchique et
le partitionnement par la méthode des K centroïdes (K-means). D'une part, la
classification hiérarchique par la méthode de Ward est particulièrement recommandée
pour les analyses de profils électrophorétiques puisque l'homogénéité à l'intérieur des
groupes est maximisée (Legendre et Legendre 1998; Blackwood et al. 2003). D'autre
part, le partitionnement par la méthode des K centroïdes répartit les échantillons dans
des groupes pour lesquels chaque échantillon appartient au groupe dont la moyenne est
la plus proche de celui-ci. Cette méthode est particulièrement appropriée pour l'analyse
de larges ensembles de données (Ramette 2007).
Que les groupes soient définis à priori ou selon les résultats d'une analyse de
groupement, plusieurs méthodes multivariées sont disponibles pour les étudier. Pour
comparer les groupes d'objets via des données de communauté, la procédure de
permutation multi-réponse (MRPP) ou une méthode similaire telle que l'analyse de
similarité (ANOSIM) devrait être le choix par défaut (McCune et Grace 2002). Ces deux
méthodes non-paramétriques testent l'hypothèse d'une différence nulle entre deux ou
plusieurs groupes d'objets. Elles fournissent une mesure d'agrément intra-groupe (A
pour la MRPP et R pour FANOSIM) qui témoigne de « l'effet groupe » observé et une
valeur p associée. Les valeurs A et R varient entre -1 et 1. Une valeur positive indique
une différence entre les groupes. Pour la MRPP, une valeur A d'environ 0,3 est
considérée élevée en écologie communautaire (McCune et Grace 2002) alors que pour
34
l'ANOSIM, une valeur de 0,5 est considérée comme significative. L'ANOSIM a, entre
autres, été utilisée pour comparer des profils T-RFLP (Luna et al. 2006), ARISA (Arteau
et al. 2010) et DGGE (Demba Diallo et al. 2004; Van der Gucht et al. 2005). Pour sa
part, la MRPP a récemment été utilisée pour complementer l'ordination par NMS de
profils T-RFLP (Falk et Wuertz 2010). Finalement, l'analyse d'espèce indicatrice (ISA)
est une méthode expressément conçue pour déterminer quelles populations sont
caractéristiques d'un groupe donné (Dufrêne et Legendre 1997). Elle fournit une valeur
indicatrice (0 à 100) et une valeur/? basée sur la fidélité de l'occurrence ainsi que sur
l'abondance relative des espèces. Une espèce indicatrice parfaite aurait une valeur
indicatrice de 100.
Les techniques d'ordination et de l'analyse de groupement permettent de représenter la
similarité entre les objets en se basant sur les multiples variables mesurées. Ces
techniques d'exploration révèlent la configuration de larges ensembles de données mais
n'expliquent pas directement pourquoi une configuration particulière existe. Une
manière intuitive de traiter cet aspect est de superposer des données issues du contexte
environmental aux résultats des techniques d'ordination ou de l'analyse de groupement
(Ramette 2007) des communautés microbiennes ou vice-versa. Cette « superposition »
est en fait une régression linéaire des variables supplémentaires sur les axes
d'ordination, une fonction intégrée dans plusieurs logiciels statistiques (McCune et
Mefford 2006; Oksanen 2007).
Une technique d'ordination émergente en écologie microbienne (Haller et al. 2011;
Jassey et al. 2011), l'analyse de facteurs multiples (MFA), permet une analyse plus
directe de la relation entre les données microbiologiques et environmentales car elle
permet de combiner plusieurs ensembles et types de données dans une même analyse
tout en leur accordant une importance égale (Pages et al. 1991). La MFA s'effectue en
deux étapes. Premièrement, une ACP est effectuée sur chaque ensemble de données où
chaque élément est ensuite normalisé en divisant par la racine carré de la première
valeur propre (eigenvalue) obtenue. Deuxièmement, une ACP est pratiquée sur la
matrice conjointe des ensembles de données ainsi normalisés (Abdi et Valentin 2007).
Cette analyse exploratrice basée sur FACP permet donc d'observer simultanément la
35
configuration des objets selon plusieurs facteurs (biologiques, chimiques, sensoriels, par
exemple) et s'interprète de manière similaire. Le package FactoMineR pour le logiciel R
(Husson et al. 2009) fournit également des possibilités de résultats supplémentaires
inhérentes à la MFA comme un biplot représentant la contribution des différents groupes
de variables aux facteurs de la MFA. Cette représentation a, entre autres, été suggérée
pour superposer des connaissances biologiques (voies métaboliques) à des données de
micropuces pour étudier le cancer (de Tayrac et al. 2009). Dans le domaine alimentaire,
la MFA a été utilisée pour l'analyse sensorielle des vins (Pages 2005).
1.10 But La recherche présentée avait pour but de caractériser le microbiote de la sève d'érable et
d'évaluer son impact quantitatif et qualitatif sur la qualité du sirop d'érable.
1.11 Hypothèse Les membres stables du microbiote de la sève d'érable, c'est-à-dire les microorganismes
qui se retrouvent à tous les sites de récolte et tout au long de la période de coulée, sont
liés aux propriétés de la sève et contribuent ainsi au développement des propriétés
caractéristiques du sirop d'érable tel que la couleur et la flaveur.
1.12 Objectifs Afin de répondre au but et à l'hypothèse, les objectifs suivants ont été fixés :
Objectif 1 : Développer une méthode de profilage communautaire par PCR pour décrire
la variabilité génétique du microbiote de la sève d'érable afin d'établir la présence ou
l'absence de facteurs génétiques stables.
Objectif 2 : Au moyen de banques de clones d'ADNr 16S, identifier les bactéries
présentes dans un sous-ensemble d'échantillons représentatifs dans le but de décrire la
variation de la composition et de la structure du microbiote.
Objectif 3 : Développer un protocole ARISA multiplexe pour repérer les
microorganismes fongiques et bactériens qui sont présents de façon stable dans la sève
d'érable.
36
Objectif 4 : Au moyen d'analyses multivariées, décrire les relations entre l'abondance
relative des microorganismes déterminée par MARISA et la composition
physicochimique de la sève d'érable.
Objectif 5 : Valider le statut de contaminant stable ou occasionnel des principaux
microorganismes fongiques et bactériens par quantification des principales populations
de la sève d'érable au moyen de la qPCR.
Objectif 6 : Au moyen d'analyses statistiques et multivariées, déterminer les variations
physicochimiques et sensorielles du sirop d'érable associées aux principales populations
microbiennes.
Chapitre 2
Diversité saisonnière et régionale du microbiote de la sève d'érable révélée par profilage PCR communautaire et banques de clones du gène de l'ARN ribosomal 16S
Seasonal and regional diversity of maple sap microbiota revealed using community PCR fingerprinting and 16S rRNA gene clone libraries
2.1 Résumé Une technique de profilage communautaire basée sur l'électrophorèse capillaire de
produits PCR a été développée afin d'étudier les caractéristiques des communautés
microbiennes de la sève d'érable provenant de 19 érablières au Québec au cours d'une
saison de coulée. L'identification présomptive des fragments d'ADN amplifiés a été
attribuée par correspondance à des profils d'isolats bactériens. Les communautés
microbiennes ont ensuite été comparées par l'analyse des séquences de gènes provenant
d'une sélection représentative de 13 banques de clones du gène de l'ARNr 16S. Les
résultats des deux méthodes indiquent que tous les sites de production et les temps
d'échantillonnage ont des membres de leur microbiote en commun, mais que des
attributs distinctifs existent également. Les changements au cours de la saison de coulée
en abondance relative des populations prédominantes indiquent une tendance commune.
Pseudomonas (64%) et Rahnella (8%) étaient les deux genres les plus abondamment et
les plus fréquemment représentés parmi les 2,239 séquences analysées. Des séquences
correspondant à Janthinobacterium, Leuconostoc, Lactococcus, Weissella,
Epilitonimonas et Sphingomonas ont également été retrouvées de façon occasionnelle
dans la sève d'érable. Les microorganismes retrouvés dans la sève d'érable
appartiennent à seulement quatre classes phylogénétiques tandis qu'une grande variation
des séquences du genre Pseudomonas a été rencontrée. La prédominance du genre
Pseudomonas est suggérée comme étant un attribut typique du microbiote acéricole à
travers les érablières du Québec et au cours de la saison de coulée.
38
2.2 Abstract An arbitrary primed community PCR fingerprinting technique based on capillary
electrophoresis was developed to study maple sap microbial community characteristics
among 19 production sites in Québec over the tapping season. Presumptive fragment
identification was made with corresponding fingerprint profiles of bacterial isolate
cultures. Maple sap microbial communities were subsequently compared using a
representative subset of 13 16S rRNA gene clone libraries followed by gene sequence
analysis. Results from both methods indicate that all maple sap production sites and flow
periods share common microbiota members, but distinctive features exist as well.
Changes over the season in relative abundance of predominant populations show
evidence of a common pattern. Pseudomonas (64%) and Rahnella (8%) were the most
abundantly and frequently represented genera of the 2,239 sequences analyzed.
Janthinobacterium, Leuconostoc, Lactococcus, Weissella, Epilitonimonas and
Sphingomonas are revealed as occasional contaminants in maple sap. Maple sap
microbiota show a low level of deep diversity along with a high variation of similar 16S
rRNA gene sequences within the Pseudomonas genus. Predominance oi Pseudomonas is
suggested as a typical feature of maple sap microbiota across geographical regions,
production sites, and sap flow periods.
39
2.3 Introduction Sap collected from maple trees (Acer saccharum) during spring has traditionally been
used to produce maple syrup in the province of Québec. Sap inside the xylem of a
healthy maple tree is virtually sterile but is contaminated during tapping by bacteria,
yeast and molds (Morselli and Whalen 1991; Lagacé et al. 2002). In contrast to other
aqueous environments, maple sap is rich in sucrose and other nutrients, making it a
perfect growth medium for psychrophilic microorganisms that can exceed 107 CFU/mL
by the end of the season (Lagacé et al. 2002; Lagacé et al. 2004). Complex microbial
communities also form biofilms inside the tubing collection system that alter sap
properties as it is collected. Microbial contamination of maple sap is considered a source
of quality variation for maple syrup (Naghski et al. 1957a; Morselli and Whalen 1991;
Lagacé et al. 2002). The microbial community of maple sap could be important for
flavor development (Naghski et al. 1957a). However, its exact role has not been
elucidated yet. The latest hypothesis on this topic states that stable members of the
maple sap microbiota contribute to characteristic maple product properties (Lagacé et al.
2006b) such as flavor and color. Dark color and off-flavors such as burnt or sour are
often associated with an increased microbial load, but exceptions occur (Lagacé et al.
2002). These defects could be the result of unstable microbial communities that induce
sucrose inversion or sap acidification. The first step to confirm this hypothesis is to
demonstrate the existence of such a stable microbiota that would be similar across maple
sap collection sites. The predominant bacteria previously found over two consecutive
seasons in maple sap and biofilms in one experimental site have been identified as
belonging to the genera Pseudomonas and Rahnella (Lagacé et al. 2006b). A
comprehensive characterization of maple sap microbiota on a large scale is still needed
in order to discriminate between common and non-stable or occasional members that
may contribute to regional differences in product characteristics. Such knowledge is
essential to determining the role that these community members play in maple product
quality in order to develop new contamination control strategies.
So far, culture-independent techniques such as denaturing gradient gel electrophoresis
(DGGE) have advanced our understanding of maple sap tubing biofilm communities
(Lagacé et al. 2006b). Other culture-independent techniques used to study microbial
40
communities include 16S ribosomal RNA gene clone library analysis, a powerful
approach to identify community members and measure relative abundance (Rôling and
Head 2005). Additionally, new sequence analysis tools such as DOTUR and SONS are
available for comparing community structure and membership (Schloss and Handelsman
2005; 2006). Random amplification of polymorphic DNA (RAPD) is a PCR
fingerprinting technique that can be adapted to environmental samples, with the
advantage of treating large numbers of samples in parallel (Yan et al. 2007; Winget and
Wommack 2008). Moreover, it involves non-specific targets that require no prior
knowledge of DNA sequences (Winget and Wommack 2008). The downside of the
method is that reference organisms must be analyzed with the same method to affiliate
an organism to a phylogenetic group. Nonetheless, it can be useful to compare a large
number of samples and select a representative subset before engaging in more laborious
experiments such as clone libraries.
To assess maple sap stable microbiota on a genetic level and to identify stable and non
stable members, a new community PCR fingerprinting technique and 16S rRNA gene
clone libraries were used as a combined approach. This study monitors the genetic
variation across 19 production sites in six geographical regions at five sampling points
over the sap flow period. To our knowledge, this is the first large scale study on maple
sap microbial communities. Furthermore, a representative subset of 13 samples was used
to compare microbial community composition, diversity, structure and membership.
41
2.4 Material and methods
2.4.1 Maple sap samples Maple sap osmosis concentrates (4X, corresponding to around 8 °Brix) were obtained
from 19 Québec production sites at 0%, 25%, 50%, 75% and 100% of cumulative sap
flow during the 2005 spring season. Sap collection systems were not sanitized during the
course of the sap flow season. Concentrated maple sap samples were immediately frozen
(-20°C) after sampling until analysis.
2.4.2 Microbial counts and isolate selection Bacterial counts were performed as previously described (Lagacé et al. 2006b). Fungal
counts were obtained on acidified potato dextrose agar (Difco) incubated for 5 days at
23°C. Morphologically different isolates were selected on plate count or tryptic soy agar
incubated at 7°C for 3 to 10 days.
2.4.3 DNA extraction Maple sap osmosis concentrates (500 mL) were centrifuged for 50 min at 4°C, 12,000 x
g. Pellets were frozen at -80°C until DNA extraction. Maple sap biomass pellets were
thawed on ice and suspended in 400 uL of buffer containing 12% sucrose, 25 mM Tris-
HC1, pH 8.0 and 16 mg lysozyme (Boehringer Mannheim, Laval, QC, Canada) and
subsequently handled following a protocol previously used to extract DNA from maple
sap (Lagacé et al. 2006b). Bacterial isolate DNA was extracted with the DNeasy Blood
and Tissue Kit (Qiagen, Mississauga, ON, Canada) according to the protocol provided
for Gram-positive bacteria. Twenty-five microliters of DNA were treated with 1 pL
RNase (Roche Applied Sciences, Indianapolis, IN, USA) and the concentration of
purified DNA was determined using a NanoDrop ND-1000 spectrophotometer
(NanoDrop Technologies, Inc., Wilmington, DE, USA).
2.4.4 PCR fingerprinting Two long degenerate primers (L: 5'-6-FAM-ATYTGYGGBTRYGCSCGSCTSCTSCC-
3' and A: 5'-6-FAM-CTSGTSAAYGGBGCSATGGCSACSAC-3') were designed to
amplify unspecific PCR fragments from maple sap samples and isolate cultures. DNA
samples (100 ng each) and negative controls were deposited into a 96-well PCR plate.
42
Each PCR contained 1.25 U Taq DNA polymerase (Biolab, Dorval, QC, Canada), IX
supplied polymerase buffer, 100 pmol primer and 40 nmol total dNTP in a 50 uL total
reaction volume. PCR amplifications were performed in a Tgradient thermocycler
(Biometra, Goettingen, Germany) with a program consisting of an initial 2-min
dénaturation step at 94°C, then 10 cycles of 30 sec at 94°C, a 30-sec annealing step with
a touchdown from 60°C to 50°C (-l°C/cycle), a 2-min elongation step at 72°C, followed
by 30 additional cycles of 30 sec at 94°C, a 30-sec annealing step at 50°C, a 2-min
elongation step at 72°C and a final 5-min elongation step at 72°C.
PCR products were then purified with an Omega-30K 96-well plate (Pall Corporation,
Mississauga, ON, Canada) as follows: ten microliters of PCR product were loaded with
50 pL Tris buffer (10 mM pH 7.4), centrifuged for 5 min at 3,000 * g, then washed with
200 uL buffer. The purified product was washed and eluted with 30 uL buffer. The
loading mix for electrophoresis, consisting of 2 uL purified PCR product with 0.3 uL
MapMarker 1000 (Bioventures, Murfreesboro, TN, USA) and 10 pL formamide, was
denatured at 95°C for 5 min. Each replicate PCR plate was purified and electrophoresed
on a 3100 Genetic Analyzer (Applied Biosystems, Foster City, CA, USA).
Sequencer output files were analyzed using GeneMapper® v3.7 software (Applied
Biosystems) with the following settings: analysis range = 250-1000 bp, bin size = 1.3
bp, peak half width = 3, polynomial degree = 3, peak detection window =11, baseline =
35 rfu, and using the light smoothing option. Peak height values were then imported to a
spreadsheet (Microsoft® Excel®) for transformation. To account for method variation, a
mean consensus profile was constructed for each sample (see Figure 2.1 for example of
replicate PCR fingerprint profiles). To eliminate artifacts while accounting for potential
binning errors, average peak height in at least two replicates was reported in the
consensus profiles.
43
Background noise Fluorescence
Figure 2.1 Heat map and Ward dendrogram of PCR fingerprint replicates obtained with primers L and A for 50% sap flow samples. Samples are color coded and lettered by production site. The figure was generated with JMP 7 (SAS Institute, Cary, NC, USA).
44
Consensus fingerprint data were transformed with the Hellinger transformation, which
corresponds to the square root of relative peak heights (Legendre and Gallagher 2001;
Blackwood et al. 2003), and per sample data were normalized to a mean of 0 and a
standard deviation of 1. The statistical software JMP 7 (SAS Institute, Cary, NC, USA)
was used to perform clustering and principal component analysis to find natural groups
of samples. Two-way analysis of similarity (ANOSIM) was performed with PAST
software (http://folk.uio.no/ohammer/past/) to test the null hypothesis of no difference
between regions and sap flow periods. ANOSIM reports the level of dissimilarity
between sample groups where R values >0.5 and/7 values <0.05 are significant.
2.4.5 16S rRNA gene amplification Primers 27F (5*-AGAGTTTGATCCTGGCTCAG-3') and 788R (5'-
GGACTACCAGGGTATCTAA-3') were used to amplify the 16S rRNA gene. PCR
consisted of 1.5 U Taq DNA polymerase (Biolab), IX supplied polymerase buffer, 10
pmol of each primer, 40 nmol total dNTP and 100 ng genomic DNA in a 50 pL total
reaction volume. PCR was performed in a Tgradient thermocycler (Biometra). The
program comprised an initial 1-min dénaturation step at 94°C followed by 33 cycles of
30 sec at 94°C, a 30-sec annealing step at 53°C, a 1-min 30 sec elongation step at 72°C
and a final 5-min elongation step at 72°C. Bacterial isolate PCR products were purified
with Exosap-it® (Biolynx, ON, CA), which degrades excess primers and nucleotides.
2.4.6 Clone library construction Negative control reactions were performed for every amplification set. Three PCRs
were performed on each DNA sample as previously described. Products were then
purified with a QIAquick PCR Purification Kit (Qiagen) and pooled. Purified products
were cloned into the pCR®2.1 -TOPO® vector (Invitrogen, Carlsbad, CA, USA). A total
of 192 colonies were randomly selected and plasmid DNA was purified with a
Montage™ Plasmid MiniprepHTS Kit (Milipore, Billerica, MA, USA).
2.4.7 DNA sequencing Purified PCR products or plasmid inserts were sequenced bidirectionally with the 27F
and 788R primers using an ABI PRISM® dGTP BigDye™ Terminator v.3.0 Ready
Reaction Cycle Sequencing Kit (Applied Biosystems) and a 3100 Genetic Analyzer
45
(Applied Biosystems, Foster City, CA, USA). Sequence traces were edited manually
using Sequencing Analysis 5.1.1 (Applied Biosystems), then assembled using the Contig
Assembly Program (CAP) in BioEdit Sequence Alignment Editor version 7.0.5.2. (Hall
1999).
2.4.8 Alignment and phylogenetic analysis Phylogenetic affiliation of each sequence was attributed using BLASTN
(http://www.ncbi.nlm.nih.gov/) and the Ribosomal Database Project (RDP) classifier
(http://rdp.cme.msu.edu/). A suite of tools available at the Greengenes website
(http://greengenes.lbl.gov) was used to analyze the set of sequences. First, sequences
were screened for chimeras using the Bellerophon tool and standard settings (Huber et
al. 2004). A total of 26 putative chimeric sequences were removed from the dataset
(Tableau 2.1). The NAST alignment tool (DeSantis et al. 2006) was then used to align
the sequences according to a core set of alignment templates and the distance matrix tool
was used to determine 16S rRNA gene sequence similarities.
Tableau 2.1 Summary of the 16S rDNA sequences retrieved for each library
Number of sequences Clone library Number of chimeras left for analysis B-100 4 169 C-0 3 171 C-50 0 171 C-100 2 186 D-0 4 156 D-50 1 156 D-100 3 176 E-0 0 187 E-50 0 187 E-100 2 130 F-0 2 181 F-50 2 182 F-100 3 187 Total 26 2239
46
2.4.9 Operational taxonomie units (OTUs) determination and community analysis The resulting distance matrix was used as input to DOTUR (Schloss and Handelsman
2005). Similarity cutoffs of 97% and 99% were used to determine OTUso.03 and
OTUso.oi, respectively. A neighbor-joining tree of a representative sequence of each
OTUo.03 was constructed using MEGA4 (Tamura et al. 2007). Shannon diversity indices
and Chaol richness estimates were calculated by DOTUR to assess microbial diversity
and richness. The SONS package (Schloss and Handelsman 2006) was used to calculate
Jabund and 0 similarity indices and standard errors to compare community membership
and structure.
2.4.10 Nucleotide sequence accession numbers Clone library and pure culture 16S rRNA gene sequences are available in GenBank
under accession numbers FJ933491 to FJ935729 and GU068618 to GU068661.
2.5 Results
2.5.1 Microbial counts As expected, total aerobic counts increased over the tapping season to reach an average
of 6.7 log CFU/mL (Figure 2.2). All average counts were similar between geographical
regions, except for the average anaerobe count that was higher at 0% sap flow in the
Lower St. Lawrence region (data not shown).
47
6.5
6
5.5
u _ > S
(U DJO
— 4 5 > <
3.5
25 50 75 % cumulative sap flow
100
Total aerobic counts
Anaerobic counts
Pseudomonas counts
Psych rophilic counts
Fungi counts
Figure 2.2 Average microbial counts of 19 production sites in Québec for the 2005 season. Sampling points are evenly distributed in terms of sap flow percentage.
2.5.2 Community PCR fingerprints of maple sap The microbial community genetic pool of maple sap samples from 19 production sites in six regions of Québec at five periods over the tapping season was captured by community PCR fingerprinting.' In an effort to find a phylogenetic affiliation for relevant peaks representing DNA fragments, 44 morphologically different bacterial isolates from maple sap were typed using the same fingerprinting method (Figure 2.3). Individual profiles yielded variable peak numbers and few peaks were shared across genera. Thus, it is presumed that most peaks present in community profiles are genus or species specific, but the number of peaks does not reflect microbial richness.
48
o o o o o o o o o o o o o o o o O
1 Q\ c* c* o* o*. P O' C Oi O1 (Ji
o o o o o o o o o o o o o o o o o o o o o o
OS o- & c
CQ CQ CQ CQ
< < < < r- r- r-N N N
— — —
oo oo DO
******
S S S S 3 5 5 u pa u « 8 S
< < <: < S S S
ï ^ » I 5 £ £ £
g, «, -t.
S 2g
I S
r. r. r. i UJ BJ
o - n
a 5 ? - r
prj _ ] Dd
_ _. _. _. r. _ < < < * * * ï ï
S > S > Uh 0 0 N se
< < _. n
" • « «j ■< -.; %
£ ■■g *-3 s s s s % -c
--_ î*
* *
0i Ot Ol _ - - - N f i N ,
f ?
i : i : a a
P: P: P: f=
o o o o w
\Û sO sO \û =■)
o\ r- <J _ r-
os c os g U U U * « * : 3 3.3 ? S oo - > > . - > . Q g * < «C < S <
5 § _ _ fe fe
E £
£ £ £ 4 $ g j 3 i l 's
- ' _ i -5 ^ ^ ^ . _ a _ J _ 3 3 ^
p €, ^ p p p 8 'e *« *ft v
_ ■ _ . _ ■ _ . : ' .
£ â s *= S 2 2 2 3 S y y y y y
c, -c £ Q u 3 Ta 3 ?a S
J I Q Q 2 O C
„ a, a, o, t , a, c n S *> — — — S X | H Q CQ
t I tN I I I JO OO — 1/1 oo oo _ . _ . _ . — Q. Q.
a, a. a, ft. a, a, a. S * -C -C « fe ** , «a,
•\ a; fe fe * -c -c
■3 a <5 G, a, a; o; a;
-c -c * -c p Q s 3 a i i as Û; a; a; to
u s e ex, -c
<N <-*1 _ OO m — C 00 t - 00 u . i i , 0 * j i - « : w u j u u u f c
— O. D. — ô ô ô o ' j r f L 7 ; * ï
L' ' X
— r- r- — o o o o
— o o r- o
— a. 9- ô
K-. O
o o o o o o o o o o o o o o o o o o
_._._._. _._._._._._. a O. O. Q. D. O
t- c- r-o o o o o o o o o o o o o o o o o o o o o o o o o o o o o o o o o o o o
"■ '
LU
Figure 2.3 Phylogenetic affiliation and typing of 44 maple sap isolates. The left axis is a neighbor-joining tree (1000 bootstrap replicates) composed of partial 16S rRNA gene sequences from each isolate. Distance units represent number of base substitutions per site. There were a total of 714 positions in the final dataset. Blast results for closest cultured strains are identified in the table. The image on the right represents the joint consensus PCR fingerprint profiles obtained with primers L and A for each isolate.
49
In all, 87 out of 95 maple sap DNA samples were positive for both primers, i.e., they had
detectable DNA fragments from 250 to 1000 bp. A total of 636 possible peak positions
were analysed of which 41.2% were presumptively identified. No peak was shared by all
samples. However, five peaks (0.7%) were found across all production sites and 152
peaks (22.3%), including these five, were found throughout the sap flow season.
Among the five peaks found across all production sites, peaks L10, LI25 and A63 were
present in both Pseudomonas and Rahnella isolate profiles. Peak L324 was present in
one Pseudomonas isolate (75-pl5_P4) and peak L300 was not found among isolate
profiles. Peaks L69, LI42 and A41 were found in 17, 17 and 18 production site profiles
respectively as well as in several isolate profiles of the genus Pseudomonas only. Peaks
associated only with Rahnella isolates were individually found in 14 production sites at
most, but altogether they were present at all 19 production sites. Similarly,
Janthinobacterium, Chryseobacterium and Epilitonimonas associated peaks were found
in 13, 9 and 5 production sites, respectively. Sample consensus profiles with some of the
presumptively identified peaks are shown in Figure 2.4.
To explore gene pool variation among microbial communities, PCR profiles were
classified using Ward's method, which is known to be a suitable clustering method to
find natural groups (Blackwood et al. 2003) (Figure 2.5). Collection site was the most
significant clustering criterion observed, as profiles from the same production site were
generally grouped together. However, some 0% and 25% sap flow samples clustered
apart. Samples from Chaudière-Appalaches and Estrie clustered more closely than
samples from other regions. To confirm that these observations were not caused by the
clustering method, principal component analysis (Figure 2.6) was used as an alternative
method. Score plots show no separate cluster, although 0% and 25% flow samples as
well as Chaudière-Appalaches samples are mostly positive for principal component 3.
As a third method, two-way ANOSIM confirms that profiles were not significantly
influenced by geographical region (R = -0.049, p = 0.827) or sap flow period (R =
0.0446, p = 0.188).
50
B-100 C-0 C-50 C-100 D-0 D-50 D-100 E-0 E-50 E-100 F-0 F-50 F-IOO
L 516 Pseudomonas —""■►
L324 Pseudomonas—"""► I L311 R a h n e l l a - ^ M
L300—>
L 2 6 3 — ^ L254 Stenotrophomonas—"^
L213
L198 Pseudomonas
L174
L142 Pseudomonas
L125 Pseudomonas. Rahnella—***^
L\04 Rahnella—*>
L86 Chryseobacterium—^
L69 Pseudomonas—^
L53—>•
L38 Planlibacter—^.
L17 Janlhinobacterium L10 Pseudomonas. Rahnella'
Figure 2.4 Examples of PCR fingerprint consensus profiles obtained with primer L. Columns correspond to results from producers B, C, D, E and F at 0%, 50% or 100% of sap flow period. Presumptive phylogenetic affiliations of peaks based on maple sap bacterial isolate profiles are identified on the left.
51
Primer L JL
Figure 2.5 Heat map and Ward dendrogram of combined consensus PCR fingerprints obtained with primers L and A. Samples are colored by geographical region and labeled with a letter for the production site followed by flow period in % sap flow. The figure was generated with JMP 7 (SAS Institute, Cary, NC, USA).
52
-10
10
E 8 o
-10 -
% flow geographical region period ■ Lower St-Lawrenœ ■ 0 +■ Center of Québec ■ 25 X Chaudière-Appalaches . 5 0 D Estne
X + A • 75 O Lauren tid es- Lanaud—es
D + . 100 ^ Mauricie
x ° * M — ■**
> n + x ' ■
+
M — ■** > n + x ' ■
X
j
X
X QD ^ ^ & ' * \^— <_d
x
W >+ "^ - I
+
X X
„ 4 ^ yN0 ^
_r~ ■ *
s k ,_
o + + *
x
W >+ "^ - I
+
X X
„ 4 ^ D
+ ^ +
i> ^ + +
+ ^ +
' I -20 -10 0 i ' i
10 20 ■ i ' i '
-20 -10 ( 1 f I f
10 I 20
Principal component 1 Principal component 2
Figure 2.6 Principal component analysis of combined PCR fingerprints from primers L and A. Sample are colored according to % flow period and marked by geographical region. Eigenvalues are 48.78 (7%), 36.87 (5%) and 30.22 (4%) for principal component (Axis) 1, 2 and 3 respectively. The figure was generated with JMP 7 (SAS Institute, Cary, NC, USA).
53
2.5.3 Maple sap 16S rRNA gene clone libraries To complement the PCR-based community fingerprints, 13 clone libraries were
constructed with partial 16S rRNA gene amplification of sap samples. Four production
sites at the 0%, 50% and 100% sap flow periods were selected to evaluate variation
between geographical sites over the season. An additional 100% sample from a fifth
production site was added to assess inter-site variation within a region. A total of 2,239
sequences was retained after removal of chimeras and grouped into operational
taxonomie units (OTU) using the furthest neighbor method in DOTUR. Species-level
OTU is generally defined as containing sequences that are >97% identical because it is
the historically accepted level for species definition when the complete 16S rRNA
sequence is taken into account (Gevers et al. 2005; Schloss et al. 2005). However, for
environments with low deep diversity, a more stringent analysis using a 99% identity
cutoff can allow a better understanding of the microbial community. Therefore, both
similarity thresholds of 97% (OTU003) and 99% (OTU001) were applied and yielded 85
OTUS003 and 167 OTUsooi, respectively.
The phylogenetic architecture and relative abundance of OTUso.03 are shown in Figure
2.7 and Figure 2.8. The largest OTU003, belonging to the Gammaproteobacteria class
and the Pseudomonas genus, contained 1,427 sequences (64% of the total). The second
largest OTU0.03 also belonged to the Gammaproteobacteria class, but was affiliated with
the Rahnella genus and contained only 173 sequences (8%). Other common OTUso.03
belonged to the genus Janthinobacterium, Chryseobacterium, Epilitonimonas and
Sphingomonas. Some less frequent but significantly abundant OTUso.o3were members of
the lactic acid bacteria group belonging to the genera Leuconostoc, Lactococcus and
Weissella.
54
B-100 C-0 C-SO C-IOO D-0 D-50 D-lOO E-0 E-50 E-IOO F-0 F-50 F-lOO
- ■ = _
0.05
<
- Sphmg<amonas
^. Alphaproteobactena
Acltnobacteria
Rahnella
V (iammaproieobacteha
j Pseudomonas 4r"
I >- Betaproteobactena
— Janthmobactermm Bacteria
^ ( lostridta
Bacili
( hryseobactenum
>■ Flavobaclena —Epilithonimonas
Hacteroldetes
>- Sphmgobadena
Figure 2.7 Phylogenetic architecture and relative abundance of OTUso 03 of five maple sap producers. The left axis is a neighbor-joining tree (1000 bootstrap replicates) composed of representative sequences from each of the 85 OTUsoo3- Distance units represent the number of base substitutions per site. There were a total of 562 positions in the final dataset. Relative abundance of OTUso.03 in each sample in the heat plot is indicated by a colorscale value in percent. Columns correspond to clone library results from producers B, C, D, E and F at 0%, 50% or 100% of sap flow period. Phylogenetic classes and genera are identified on the right.
55
100
ai o c ro ■o c 3 _ ro > I _
i Actinobacteria i Alphaproteobacteria i Sac//// i Bacteroidetes i Betaproteobactena i Clostridia i Flavobacteria i Gammaproteobacteria 86.5 87.8 74.9 91.7 i Sphingobacteria 0.6 1.2 1.6 0.0
Figure 2.8 Relative abundance of phylogenetic classes found in each clone library, sorted by the sap flow period. Production sites are labeled by letter.
56
A total of 38 OTUS003 (74 OTUsooi) contained only one sequence each. Overall, 1,834
(82%) sequences were 100% identical to at least one other sequence and 405 (18%)
sequences were unique. Only 17 of the 85 identified OTUsoo3 were identified at all sap
flow periods, although they represent 90% of the total of 2,239 sequences. Unique
OTUsoo3 were identified for each sap flow period, and were most abundant at the
beginning of the season (26) and minimal at mid-season (8).
Tableau 2.2 Pairwise comparison of maple sap microbial communities by flow period
OTU 0.03
Chaol shared richness (OTUs)
abund abund e BSE
0%-100% 45 0.94 0.10 0.85 0.02
0%-50% 48 0.90 0.15 0.99 <0.01
50%-100% 22 0.90 0.10 0.89 0.02
OTU 0.01
0%-100% 68 0.83 0.08 0.33 0.03
0%-50% 63 0.84 0.08 0.43 0.04
50%-100% 176 0.97 0.07 0.83 0.03
The indices calculated by SONS were used to further describe the relationships between
microbial communities while taking into account species coverage and undetected
species. The Jabund value estimates the community membership overlap of two samples,
with probability between 0 and 1 that a randomly selected OTU in one community is
present in the other (Schloss and Handelsman 2006). The Jabund value and its standard
error reported suggest that community membership at 97% similarity was similar among
all sap flow periods tested (Tableau 2.2). However, the Jabund index is lower at 99%
similarity, showing that differences are detected especially between the community of
the 0% sap flow and those of the other periods.
Community structure was further characterized by taking into account OTUs abundance
using the similarity indices 0 (Tableau 2.2). Values range from 0 (completely dissimilar
community structure) to 1 (identical community structure) (Schloss and Handelsman
2006). OTUsooi indicate differences in community structure between all flow periods
57
whereas OTUS003 indicate a difference only for the 100% flow period. These results
suggest that shifts in bacterial community structure were largely a result of changing
abundance patterns of organisms, rather than the appearance of novel organisms.
Tableau 2.3 Variation in community membership and structure among five production sites
OTUo.03 Chaol shared
richness (OTUs) Jabund Jabund OC 0 0SE
E-F 59 1.00 0.06 0.82 0.03
E-C 27 0.85 0.13 0.93 0.01
E-D 21 0.84 0.13 0.94 0.01
E-B 21 0.86 0.12 0.92 0.02
F-C 50 0.94 0.20 0.85 0.03
F-D 26 0.94 0.21 0.87 0.03
F-B1 25 0.93 0.23 0.80 0.05
C-D 23 0.78 0.20 0.96 0.01
C-B 25 0.90 0.13 0.94 0.02
D-B 21 0.87 0.13 0.97 0.02
OTUo.01
E-F 100 0.99 0.10 0.31 0.04
E-C 92 0.81 0.10 0.48 0.05
E-D 46 0.75 0.09 0.60 0.04
E-B 26 0.69 0.10 0.41 0.04
F-C 31 0.93 0.10 0.21 0.03
F-D 37 0.90 0.12 0.34 0.04
F-B1 30 0.89 0.11 0.52 0.07
C-D 44 0.68 0.12 0.72 0.04
C-B 22 0.79 0.10 0.51 0.06
D-B 38 0.74 0.09 0.63 0.06
Producing sites F and B belong to the same geographical region.
Of the 85 OTUsoo3 identified, 7 OTUs<io3 (81% of all sequences) were present at all
production sites, whereas 49 OTUso.o3 (4% of all sequences) were specific to one
production site. Microbial communities were compared pairwise using SONS (Tableau
2.3). The J und value and its standard error suggest that community memberships for
58
OTU so .03 were quite similar. However, greater differences were detected for OTUsooi-
With respect to community structure, although all sites showed only small differences at
97% similarity, a drastic decrease in 0 values is seen at 99% similarity (Tableau 2.3).
The Shannon diversity index was used as an estimate of the relative diversity captured
by each sampling period for each production site. Results indicate no common pattern in
diversity change over the season (data not shown). However, the Shannon index is
highest for the 100% sap flow samples, suggesting highest diversity at the end of the
flow season.
Sequences (32 out of 44) from the isolates are identical to sequences (321) from 10
different OTUs(ooi) which total 66.7% of the 2239 sequences retrieved. Furthermore, 12
isolate 16S rRNA gene sequences have no identical sequence in the clone libraries,
meaning that these isolates represent a rare fraction of the microbiota.
2.6 Discussion Maple syrup producers are already advised to sanitize their tapping equipment to
minimize microbial contamination of tap holes (Allard 1999). Nevertheless, maple sap
microbial contamination remains a critical issue for maple syrup quality. Each year, on
average 11% of maple syrups are rejected because of flavor defects and 20% are
classified with slight off-flavors (FPAQ 2008). Some causes of defects are cleaning
agent residue, excess of defoaming agents and microbial spoilage of sap. For instance,
Enterobacter (Aerobacter) aerogenes causes ropiness in maple syrup, and is the only
reported case of a spoilage agent in maple sap (Fabian and Buskirk 1935). Up until now,
no study has extensively explored the microbial communities and their potential role in
maple sap and syrup quality. This study focused on giving a comprehensive portrait of
maple sap microbial communities representative of the Québec industry. Results show
evidence of stable microbial community members in maple sap along with a pattern in
the evolution of their relative abundance over the season.
A new community PCR fingerprinting method using RAPD with a combination of
previously reported modifications such as the use of degenerate primers, long primers,
59
touchdown PCR (Sakallah et al. 1995; Gillings and Holley 1997; Trevino-Castellano et
al. 2003; Yan et al. 2007) and capillary electrophoresis combined with fluorescent
primers (Corley-Smith et al. 1997) was used to survey the genetic variation in maple sap
microbial communities from six geographical regions of Québec at five different flow
periods evenly distributed over the season by sap volume percentage. This new method
was rapid, avoiding digestion time needed by other community fingerprinting methods
such as terminal restriction fragment length polymorphisms (T-RFLP). The profiles
were reproducible, and did not give a higher number of classification errors than T-
RFLP (Blackwood et al. 2003). The number of classification errors for replicate PCR
profiles (one out of 38 possible grouping errors, see Figure 2.1) was comparable to T-
RFLP (two out of 32 possible grouping errors) (Blackwood et al. 2003). Maple sap
community fingerprint clustering and PCA agreed with clone library OTUo.oi structure
analysis, indicating a more important difference between 0% and other flow periods.
This confirms that the method is useful to fingerprint communities composed of closely
related species sharing high 16S rRNA sequence similarity. Moreover, PCR fingerprints
of maple sap isolates demonstrate a high level of genetic diversity even for isolates with
similar partial 16S rRNA gene sequences. Although fragments cannot directly be used to
identify members of a community, they can be presumptively attributed to isolates typed
with the same fingerprinting method. Alternatively, they can be cloned and used as
genetic markers (Yan et al. 2007).
To complete the PCR fingerprinting results, this study analyzed the microbial
communities identified in a subset of 13 representative samples with 16S rRNA gene
clone libraries with two OTU cutoff values (97% and 99% similarity). The
predominance of Pseudomonas in the Lower St-Lawrence, Mauricie, Estrie and Center
of Québec regions suggests that this is not a unique feature for only one region of
Québec (Lagacé et al. 2004; Lagacé et al. 2006b). Furthermore, the presence of
Rahnella, first reported by a previous DGGE study in only the Center of Québec region
(Lagacé et al. 2006b), was also found in each of the five production sites analyzed.
For the first time, the 16S rRNA gene clone libraries revealed the presence of
Janthinobacterium, Leuconostoc, Lactococcus, Weissella, Epilitonimonas and
60
Sphingomonas in maple sap. These new findings could be attributed to the increased
resolution of the method compared to DGGE or conventional cultivation methods, but
also to the large-scale sampling. Distinctive microbiota members that occur sporadically
may not have enough support to be used as geographical biomarkers, but these potential
contaminants may be correlated with other types of flavor defects. Among others, lactic
acid bacteria were occasional but relatively abundant contaminants that could be
responsible for sap acidification, which is sometimes associated with flavor defects
(Dumont 1999). Janthinobacterium is also known as a psychrotrophic food spoilage
agent (Jay et al. 2005) that can form biofilms (Pantanella et al. 2007) and some strains
of Janthinobacterium lividum can utilise sucrose as the sole source of carbon (Shivaji et
al. 1991). The genus Ralstonia, although it was previously reported as an important
contaminant of maple tree tap holes (Lagacé et al. 2004), was not found in maple sap
sampled with clone libraries, suggesting that it is only an occasional contaminant when
taking into account multiple production sites.
2.6.1 Maple sap microbial community membership This study demonstrates that maple sap microbial communities share common members.
All production sites are contaminated by at least 104 CFU/mL oi Pseudomonas by the
end of the season, and all PCR fingerprints contained presumptive Pseudomonas peaks.
One peak common to all 19 production sites was presumptively attributed to a single
Pseudomonas isolate whose 16S rRNA gene sequence corresponded to the most
abundant OTU003 (and OTUo.oi)- This OTU003, along with 6 others, was found in the
five production sites analyzed with clone libraries. They are affiliated with
Pseudomonas, Rahnella, Janthinobacterium, Sphingomonas, Chryseobacterium and
Frigoribacterium. Peaks associated with Rahnella isolates were also found in the 19
production site PCR fingerprints. One common peak (L300) could not be presumptively
attributed to an isolate, perhaps because only a few isolates of Janthinobacterium and
Chryseobacterium and no isolates of Sphingomonas and Frigoribacterium were
recovered for typing.
Other evidence supporting shared membership of maple sap communities is the Jabund
values that are extremely high, even for OTUsO.01. ANOSIM and principal component
61
analysis of PCR fingerprint data also reflect the close membership of the communities as
no significant dissimilarity was found and no separate cluster of samples was formed.
Such a strong common membership between maple sap communities, across all
producing regions of Québec is most certainly not random. It could mean that there are
common selection factors determining the major members of the microbiota in maple
sap. For instance, the ability to adhere and form biofilms inside the polyethylene
collection tubing system is a selective advantage oi Pseudomonas (Lagacé et al. 2006a),
an extremely versatile microorganism that can flourish in nearly all moist environments
(Grice et al. 2008). Moreover, microorganisms adapted to grow at low temperature and
able to resist freeze and thaw cycles required for maple sap to flow are more likely to be
selected in this environment. Producers also store unprocessed sap in closed tanks which
could favor microorganisms capable of growth in the absence of oxygen, such as the
enteric bacterium Rahnella that produces acid from sucrose (El-Hendawy et al. 2003).
The flow period comparison indicated that the 0% flow period is the most different in
term of membership. This may reflect a common source of initial contamination,
perhaps containing microorganisms that are not able to grow in maple sap. The origin of
contamination in maple sap has not yet been studied, but it has been hypothesized that
bacterial contamination most likely comes from the surrounding environment (Morselli
and Whalen 1991; Lagacé et al. 2004). A study using culture methods to survey bacteria
in maple tap holes found some degree of analogy with forest soil microbial communities
(Lagacé et al. 2004). Lamarche et al. (2007) showed that forest floor bacterial
community composition varies across the southern boreal landscape of Québec as a
function of stand type, stand age and geological parent material. Given that sugar bushes
all have the same dominant stand type (Acer saccharum), it is possible that common
contaminants of maple sap are also a common feature of the surrounding soils. However,
the maple sap microbial community has only a low level of deep diversity compared to
other environmental samples, such as soil, which can harbor more that 20 bacterial
divisions (Dunbar et al. 2002). In maple sap, members of only four divisions were
recovered: Proteobacteria, Actinobacteria, Bacteroidetes and Firmicutes. Interestingly,
these are the same divisions as those reported for human skin microbiota, where
Pseudomonas and Janthinobacterium are also predominant members (Grice et al. 2008).
62
2.6.2 Maple sap microbial community structure Community structure, reflected by relative abundance, evolves over the flow period.
Structural changes occur mostly in the second half of the season, as higher Pseudomonas
than anaerobe counts occur at mid-season but similar counts occur at the end.
Meanwhile, Pseudomonas relative abundance decreases towards 100% sap flow, as
Rahnella and other lactic acid bacteria increase. However, even greater structural change
occurs between 0% and 50% sap flow for OTUo.oi- Interestingly, the relative abundance
of several Pseudomonas OTUsooi drops between the 0% and 50% flow period sampling
points. This is probably why structural changes are not reflected by microbial counts for
those sampling points. Also, the higher diversity for 100% sap flow samples is
consistent with a decrease of the relative abundance of the predominant OTU toward the
end of the season, as it is generally minimal at 50% and maximal at 100% sap flow
volume, although this may differ among sampling sites. For instance, Lagacé et al.
(2006b) found less DGGE band diversity at the end of the season. Our findings indicate
that structural differences occur among production sites, underlining the importance of
sampling different regions.
This overall microbial community variation pattern was not expected and could be
partially responsible for certain observed seasonal changes in maple syrup quality, such
as darkening color. In fact, Pseudomonas spp. use an intracellular phosphorylase instead
of an extracellular invertase enzyme, meaning that they do not hydrolyse sucrose to
glucose and fructose (Latour and Lemanceau 1997) which further react in the Maillard
reaction during the heating process, leading to dark pigment production. Future work
could validate the hypothesis that, when present in sufficient amounts in maple sap,
Pseudomonas may prevent darkening of maple syrup by inhibiting or competing with
invertase producing microorganisms.
In conclusion, predominance of Pseudomonas is suggested as a general characteristic of
the maple sap microbial community across geographical regions, production sites, and
sap flow periods. It has been hypothesised that a stable microbiota present in the
biofilms could be associated with the development of characteristic maple syrup color
and flavor (Lagacé et al. 2006b). Pseudomonas would undoubtedly contribute to this
63
stable microbiota (Lagacé et al. 2004; Lagacé et al. 2006b). Rahnella could also be
considered a stable member of the maple sap microbiota, although it was not always a
predominant member. Additionally, the variation in relative abundance observed within
the microbial population might be associated with maple sap composition changes in
sugars, organic acids and phenolic compounds that in turn may affect syrup quality.
Further work is necessary to validate the association between particular microbiota
members and flavor development. Quantitative real time PCR associated with
corresponding syrup quality data could be useful to answer the ultimate question: which
organisms are beneficial and which are detrimental to maple sap and syrup quality?
2.7 Acknowledgements This work was supported by the NSERC Canada Research Chair awarded to D. Roy and
an NSERC Strategic Project grant awarded to D. Roy, G. LaPointe and L. Lagacé. The
authors acknowledge the support of the Centre ACER Research Fund (St-Norbert
d'Arthabaska, Québec, Canada).
We are grateful to C. Charron and R. Desruisseaux for their technical help. We thank
Éric Rasolofo (Laval University) for providing some pure cultures isolated from maple
sap biofilm.
Chapitre 3
Corrélation de la composition de la sève d'érable avec les communautés bactériennes et fongiques déterminées par MARISA
Correlation of maple sap composition with bacterial and fungal communities determined by multiplex automated ribosomal intergenic spacer analysis (MARISA)
3.1 Résumé Lors de la récolte, la sève d'érable est contaminée par des bactéries, levures et
moisissures qui colonisent ensuite le système de collecte tubulaire. Le microbiote
bactérien a davantage été caractérisé que le microbiote fongique, mais l'impact de ces
deux composantes sur la qualité demeure indéterminé. Cette étude se concentre sur
l'identification des membres bactériens et fongiques et l'analyse de la corrélation de la
composition du microbiote avec les propriétés de la sève d'érable. Une analyse de
régions intergéniques ribosomales automatisée multiplexe (MARISA) a été développée
afin d'obtenir une identification présomptive des membres bactériens et fongiques
d'échantillons d'eau d'érable récoltés sur 19 sites de production, à trois reprises au cours
de la période de coulée. Les résultats indiquent que la communauté fongique de la sève
d'érable est principalement composée de levures apparentées à Mrakia spp., Mrakiella
spp., Guehomyces pullulans, Cryptococcus victoriae et Williopsis saturnus. Les pics
correspondant à Mrakia, Mrakiella et Guehomyces ont été identifiés dans les
échantillons de tous les sites de production et celles-ci peuvent être considérées comme
des membres stables du microbiote acéricole fongique. Une analyse multivariée basée
sur les profils MARISA et la composition chimique de la sève montre des correlations
entre Candida sake, Janthinobacterium lividum, Williopsis sp., Leuconostoc
mesenteroides, Mrakia sp., Rhodococcus spp., Pseudomonas tolaasii, G. pullulans et la
composition de la sève à différentes périodes de coulée. Cette étude apporte de
66
nouveaux éléments concernant le lien entre la communauté microbienne et la qualité de
la sève d'érable.
3.2 Abstract During collection, maple sap is contaminated by bacteria and fungi that subsequently
colonize the tubing system. The bacterial microbiota has been more characterized than
the fungal microbiota, but the impact of both components on maple sap quality remains
unclear. This study focused on identifying bacterial and fungal members of maple sap
and correlating microbiota composition with maple sap properties. A multiplex
automated ribosomal intergenic spacer analysis (MARISA) method was developed to
presumptively identify bacterial and fungal members of maple sap samples collected
from 19 production sites during the tapping period. Results indicate that the fungal
community of maple sap is mainly composed of yeast related to Mrakia spp., Mrakiella
spp., Guehomyces pullulans, Cryptococcus victoriae and Williopsis saturnus. Mrakia,
Mrakiella and Guehomyces peaks were identified in samples of all production sites and
can be considered dominant and stable members of the fungal microbiota of maple sap.
A multivariate analysis based on MARISA profiles and maple sap chemical composition
data showed correlations between Candida sake, Janthinobacterium lividum, Williopsis
sp., Leuconostoc mesenteroides, Mrakia sp., Rhodococcus spp., Pseudomonas tolaasii,
G. pullulans and maple sap composition at different flow periods. This study provides
new insights on the relationship between microbial community and maple sap quality.
67
3.3 Introduction Maple sap is an abundant resource in the Province of Québec. It is collected during the
spring season when the temperatures span the freezing point, allowing the sap to flow,
which is then used to produce maple syrup and other maple products. Maple sap is
mainly composed of water (95-99%), sucrose (1-5%), and other constituents including
reducing sugars, organic acids and phenolic compounds present in variable amounts
(Morselli et al. 1996; Perkins and van den Berg 2009).
Initially practically sterile inside the tree (Morselli and Whalen 1991), maple sap harbors
an increasing number of microorganisms as the flow season progresses and the
temperatures get milder (Lagacé et al. 2002; Lagacé et al. 2004). Bacteria, yeast and
molds compose the microbiota and mixed biofilms colonize the sap collection system
tubing (Lagacé 2006). Growth of microorganisms can modify several sap constituents,
which in turn may affect the maple syrup quality. Conversion of sucrose to invert sugars
by microbial invertase is the main problem because invert sugars react with free amino
acids during the boiling process producing Maillard reactions. The reaction products
cause undesirable dark pigmentation and burnt flavor in maple syrup (Naghski et al.
1957a; Morselli and Whalen 1991).
The bacterial microbiota of maple sap has recently been studied, indicating that
Pseudomonas spp. are predominant and stable bacterial members that can be found in
each production site throughout the tapping season (Filteau et al. 2010). The other main
groups of bacteria in maple sap belonged to Rahnella, Janthinobacterium, Leuconostoc,
Epilithonimonas, Chryseobacterium and Sphingomonas genera, but their occurrence
could not be confirmed for every site. In contrast, information available on the fungal
microbiota of maple sap is scarce and could be regarded as outdated because studies
were conducted before modern sap collection methods were introduced (Edson et al.
1913; Sheneman et Costilow 1958). Only one recent study identified yeasts isolated
from maple sap (Lagacé et al. 2005). The most frequently encountered species were
Cryptococcus victoriae, Guehomyces (Trichosporon) pullulans and Sporobolomyces
roseus. However, cultivation conditions are known to bias the fungal qualitative and
quantitative community structure (Pitkâranta et al. 2008).
68
The fungal microbiota role in maple sap quality could be as important as the role of the
bacterial microbiota. Indeed, yeasts and molds are efficient fermentative agents that
could alter maple sap composition as it is collected. For instance, a pioneer study
investigated the individual effect of several bacterial and fungal isolates in maple sap
and found that isolates of Pseudomonas geniculata and Enterobacter agglomérons
(Flavobacterium rhenanum) could enhance maple flavor while yeast isolates enhanced
burnt flavor (Naghski et al. 1957a). To our knowledge, the relationship between maple
sap composition and its complex bacterial and fungal microbiota has never been studied.
Knowledge of those relationships would further help understand how microorganisms
interact and modulate maple sap quality. So far, the maple sap fungal microbiota has
never been studied with culture-independent methods, which could reveal the presence
of significant uncultivable microorganisms. Therefore, an accurate portrait of maple sap
fungal community diversity and stability is needed.
The molecular era has enabled community analysis of virtually any environment with
fingerprinting methods based on ribosomal opérons, thus by-passing the need for culture
methods. In the past decade, semi-automated techniques such as terminal restriction
fragment length analysis (T-RFLP) and automated ribosomal intergenic spacer analysis
(ARISA) have been developed to assess soil microbial diversity (Ranjard et al. 2001;
Blackwood et al. 2003). T-RFLP is usually based on the amplification of the 16S rRNA
gene with a subsequent enzymatic restriction step while ARISA is based on the
amplification of the intergenic region between the 16S and the 23S rRNA genes (IGS
region). For fungi, the target of choice is the internal transcribed region (ITS) between
the small subunit and the large subunit including the 5.8S rRNA gene. A multiplex T-
RFLP reaction has even been developed to simultaneously study bacterial and fungal
communities of soil samples (Singh et al. 2006), hence increasing the information for
the same amount of material and effort. However, ARISA would be more effective in
detecting the presence of bacteria accounting for less than 5% of total amplified product
(Danovaro et al. 2006) and involves no time-consuming enzymatic restrictions because
of the inherent variation in length of the target region. Despite these advantages, few
applications of ARISA to food matrices have been published (Cardinale et al. 2004;
Ikeda et al. 2007; Arteau et al. 2010).
69
The aim of this study was to simultaneously analyze the bacterial and fungal microbiota
composition of maple sap samples collected from 19 production sites during the sap
flow period by developing a multiplex ARISA (MARISA) method. Clone libraries,
ARISA on bacterial isolates and database analysis were also performed to presumptively
identify fungal and bacterial predominant members. Finally, MARISA profiles and
corresponding sap chemical properties were subjected to multivariate analysis to bring a
better understanding of the impact of maple sap microbial community changes on maple
sap composition.
3.4 Materials and methods
3.4.1 Maple sap samples Concentrated maple sap samples (4X, corresponding to around 8 °Brix), microbial
counts and DNA extractions were obtained from a previous study (Filteau et al. 2010).
Samples were from 19 Québec production sites collected 0%, 50% and 100% of
cumulative sap flow during the 2005 spring season for a total of 57 samples.
3.4.2 Chemical analysis The pH of maple sap concentrates was determined using a PHM82 combined electrode
(Radiometer Copenhagen). Concentrations of simple sugars and organic acids were
measured with a high performance liquid chromatography system (Waters, Milford,
MA) using protocols previously described (Dumont et al. 1993b). Phenolic compounds
were analyzed using protocols of Kermasha et al. (1995), Deslauriers (2000) and
Dumont et al. (1993b). The percentage of total soluble solids (°Brix) was measured with
a digital refractometer AR200 (Reichert Scientific Instruments, Buffalo, N.Y., U.S.A)
compensated at 20°C. Sap chemical composition values were normalized to 66 °Brix
which is the final sugar concentration of maple syrup in Canada.
3.4.3 ARISA and MARISA A previously published ARISA protocol was adapted to analyze maple sap DNA
samples (Arteau et al. 2010). Two primer pairs were used to amplify bacterial and
fungal intergenic ribosomal fragments from maple sap DNA samples. Primers 2234C
(5'-GTTTCCGTAGGTGAACCTGC-3') and 3126T (5'-
70
ATATGCTTAAGTTCAGCGGGT-3') were used to amplify the polymorphic ITS1-
5.8S-ITS2 region of fungal genomic DNA. For bacterial organisms, primers S-D-Bact-
1522-b-S20 (5'-TGCGGCTGGATCCCCTCCTT-3') and L-D-Bact-132-a-A-18 (5'-
CCGGGTTTCCCCATTCGG-3') were used to amplify the IGS region (Ranjard et al.
2001). Primers 2234C and S-D-Bact-1522-b-S20 were respectively labeled at their 5'
end with 6FAM and HEX fluorochromes. Each PCR contained 100 ng DNA, 2.5 U Taq
DNA polymerase (Biolab, Dorval, QC, Canada), IX supplied polymerase buffer, 40
nmol total dNTP in a 50 pL total reaction volume. Initially, 15 pmol of each primer was
used for both individual and multiplex PCR, but amplification in multiplex reaction was
weak, especially for bacterial amplicons. Therefore a total amount of 60 pmol primer
was used and the following ratios were tested; 1:1, 1:2 and 5:7 of fungal and bacterial
primers, respectively. Optimized conditions retained for MARISA were 10 pmol of each
fungal primer and 20 pmol of each bacterial primer. PCR amplifications were performed
in triplicate along with a negative control in a Tgradient thermocycler (Biometra,
Goettingen, Germany) with a program consisting of an initial 3-min denaturing step at
94°C, then 25 cycles of 1 min at 94°C, a 30-sec annealing step at 55°C, a 1-min
elongation step at 72°C, followed by a final 5-min elongation step at 72°C. PCR
products were then purified with the QIAquick PCR purification kit (QIAGEN,
Missisauga, ON, Canada) according to the manufacturer's centrifugation protocol and
eluted in 20 pL. Purified PCR product concentration was determined using a Nanodrop
ND-1000 spectophotometer (Nanodrop technologies, Inc. Wilmington, DE, USA).
Subsequently, 20 ng of purified PCR product were loaded with 9.6 pL formamide and
0.4 pL ROX labelled MapMarker 1000 (Bioventures, Murfreesboro, TN, USA) and
electrophoresed on a 3100 Genetic Analyzer (Applied Biosystems, Foster City, CA,
USA).
Sequencer output files were analyzed using GeneMapper® v3.7 software (Applied
Biosystems) with the following settings: analysis range = 150-1000 bp, bin size = 1.2
bp, peak half width = 2, polynomial degree = 3, peak detection window = 1 1 , blue
baseline = 20 rfu, green baseline = 30 rfu and using the light smoothing option. Peak
height values and sizes were then imported to a spreadsheet (Microsoft® Excel®) for
transformation. To account for peak height variation, a mean consensus profile was
71
constructed for each sample. Figure 3.1 shows example of triplicate profiles. Average
peak height of reproducible amplicons (present in at least two replicates) was reported in
the consensus profiles. Consensus fingerprint peak height data was transformed with the
Hellinger transformation, which corresponds to the square root of relative peak heights
(Legendre and Gallagher 2001; Blackwood et al. 2003).
Fragment length (bp)
Figure 3.1 Example of replicate MARISA profiles. PCR, purification and capillary electrophoresis were performed independently for each replicate.
3.4.4 Fungal ITS1-5.8S-ITS2 clone libraries and sequencing Unlabelled primers 2234C and 3126T were used to amplify the ITS1-5.8S-ITS2 region
of samples 100-pl 1 and 50-pl2. PCR was carried out as for ARISA in triplicate for each
DNA sample including a negative control. Products were then purified with a QIAquick
PCR Purification Kit (QIAGEN) and pooled. Purified products were cloned into the
pCR®2.1-TOPO® vector (Invitrogen, Carlsbad, CA, USA). A total of 96 colonies for
each library were randomly selected and plasmid DNA was purified with a Montage™
72
Plasmid MiniprepHTS Kit (Millipore, Billerica, MA, USA). Plasmid inserts were
screened for sequence length variation and representative clones were sequenced
bidirectionally with Ml3 primers and with the 2234C and 3126T unlabelled primers
using an ABI PRISM® dGTP BigDye™ Terminator v.3.0 Ready Reaction Cycle
Sequencing Kit (Applied Biosystems) and a 3100 Genetic Analyzer (Applied
Biosystems, Foster City, CA, USA). Sequence traces were edited and assembled using
Geneious Pro 4.8.4 (Biomatters Ltd, Auckland, NZ). Affiliation of each sequence was
attributed using BLASTN (http://www.ncbi.nlm.nih.gov/).
3.4.5 Identification of peaks DNA of 15 representative maple sap bacterial isolates obtained from a previous study
(Filteau et al. 2010) and plasmids of 26 representative fungal clones were used as
template for ARISA. To avoid overscaling fluorescence, only 2 ng of purified PCR
product was used for capillary electrophoresis. Experiments were repeated three times to
ensure sizing accuracy. Additionally, the Ribosomal Intergenic Spacer Sequence
Collection (RISSC) database (http://egg.umh.es/rissc/) was used to attribute presumptive
identification of bacterial peaks. Peak sizes minus -150 bp, corresponding to S-D-Bact-
1522-b-S-20 primer and about 130 bp of the 23S rRNA gene (Ranjard et al. 2001) were
compared to intergenic spacer lengths (IGS). Only previously reported bacteria in maple
sap were considered for presumptive identification with the RISSC database.
3.4.6 Nucleotide sequence accession numbers Clone sequences are available in GenBank under accession numbers HQ267062 to
HQ267087.
3.4.7 Multivariate and statistical analysis The software PC-ORD (MjM Software, Gleneden Beach, Oregon, USA) was used to
perform multivariate analysis. To test significance of flow period and production site, a
blocked multiresponse permutation procedure (MRBP, Euclidean distance) was used.
Subsequently, nonmetric multidimentional scaling (NMS) was used, as it is an
ordination method well suited for community ecology avoiding the assumption of linear
relationship among variables (McCune and Grace 2002). Principal component analysis
73
(PCA) was used to ordinate normalized chemical properties of sap samples because it is
an ideal technique for data with approximately linear relationships among variables
(McCune and Grace 2002). An indirect gradient analysis approach was used to assess
relationships between maple sap chemical composition and microbial community data
(Ramette 2007). Joint plots show the correlation of the MARISA data (vectors) to the
principal components. For a given species (or peak), the line forms the hypotenuse of a
right triangle with the two other sides being r2 values between the species and each of the
two axes (McCune and Grace 2002). The statistical software JMP 7 (SAS Institute,
Cary, NC, USA) was used to perform a blocked ANOVA to compare means of chemical
property values between flow periods. When significant, it was followed by a Tukey-
Kramer HSD test.
3.5 Results
3.5.1 Comparison of ARISA and MARISA profiles To validate the optimized MARISA protocol, it was compared to the traditional ARISA
protocol for three maple sap DNA samples (in triplicate for each sample). Results show
that nearly all peaks were amplified by both methods, although individual peak height
could vary (Figure 3.2). The overall reproducibility of the method was improved with
the multiplex protocol as the mean coefficient of variation of total peak heights was 18%
and 11% for fungal and bacterial MARISA peaks, respectively, compared to 20% and
46% for bacterial and fungal ARISA peaks, respectively.
74
600 Frag ment length (bp)
Figure 3.2 Comparison of ARISA and MARISA amplification profiles of maple sap DNA. Example of a) individual fungal ARISA, b) multiplex ARISA, c) individual bacterial ARISA.
3.5.2 MARISA peak identification Overall, MARISA profiles showed 41 different reproducible fungal peaks, i.e. present in
at least two replicates of a given sample, ranging from 360 to 713 bp, and 134 bacterial
peaks ranging from 185 to 806 bp (corresponding to IGS of 35 to 656 bp). Predominant
peaks were presumptively identified by three approaches; fungal clone libraries, ARISA
of maple sap bacterial isolates and RISSC database analysis. A total of 26 representative
clones were sequenced and their amplicon size confirmed by ARISA. They were
attributed to 11 different fungal peaks including the five most frequently encountered
(Tableau 3.1). Representative maple sap bacterial isolate DNA was used as template for
ARISA to identify the main bacterial peaks. Peak numbers ranged from zero
(Chryseobacterium piscium) to six (Janthinobacterium lividum) per isolate (Tableau
3.2). Additionally, peaks were presumptively attributed to Leuconostoc mesenteroides,
Lactotoccus lactis, Lactobacillus reuteri, Pseudomonas syringae, Pseudomonas tolaasii,
Pseudomonas fragi, Pseudomonas stutzeri and Rhodococcus spp. using RISSC database
analysis.
75
Tableau 3.1 Identification of fungal peaks
Sequence ID Blastn closest strain and GenBank accession % Sequence number identity length
Peak size MARISA peak ID
100-pll-H12 Candida sake AJ549822 98.6 429 428 F55 50-pl2-B9 Cryptococcus victoriae AF444447 99.8 508 510 F73 50-pl2-E8 Cryptococcus victoriae AF444469 100.0 508 510 F73 50-pl2-G12 Bulleromyces albus AF444662 100.0 531 534 F76 100-pll-H8 Cadophora melinii DQ404351 100.0 572 573 F83 50-pl2-H7 Cadophora melinii DQ404351 99.8 571 573 F83 50-pl2-A5 Williopsis saturnus EF194844 86.4 594 596 F90 50-pl2-E3 Cadophora malorum GU212430 99.5 601 598 F91 100-pll-C5 Rhodotorula sp. EU872492 99.6 596 600 F92 100-pll-D5 Guehomyces pullulans ABO 18034 100.0 608 611 F94 100-pll-F8 Guehomyces pullulans ABO 18034 100.0 608 611 F94 50-pl2-F12 Guehomyces pullulans ABO 18034 99.8 608 611 F94 100-pll-F7 Guehomyces pullulans AF444417 99.5 610 611 F94 50-pl2-G10 Rhodotorula arctica AB478857 99.1 613 618 F95 100-pll-B12 Mrakia sp. AY038834 99.9 627 631 F101 100-pll-H4 Mrakia sp. AM922288 99.6 627 631 F101 100-pll-Cl Mrakia sp. AM922288 99.8 627 631 F101 100-pll-C9 Mrakia sp. AM922288 99.8 627 631 F101 100-pll-E3 Mrakia sp. AM922288 100.0 628 631 F101 100-pll-Hl Mrakia sp. AM922288 99.7 627 631 F101 50-pl2-Al Mrakia sp. AY038829 99.8 627 631 F101 50-pl2-F2 Mrakia gelida AF 144485 98.7 630 631 F101 50-pl2-D2 Mrakia gelida AF144485 98.1 626 631 F101 50-pl2-A3 Mrakia gelida AF 144485 99.1 628 631 F101 50-pl2-F10 Mrakiella niccombsii AY029346 99.8 635 637 F103 100-pll-G8 Mrakiella aquaticus AF410469 98.4 634 637 F103
76
Tableau 3.2 Maple sap isolates used for identification of bacterial peaks Isolate Closest cultured strains and accession no. Similarity (%) Fragment size
100-pl2_6 P. fluorescens AF336352 100 668 100-p8_B 1 P. marginalis DQ232743 100 665 75-pl5_P2 P. a«tart/c„AM933518 100 674 100-p8_C5 P. lu r idaEUmm 99 670-681 0-pl2_4 P. brenneri EU 169172 100 654-667
0-pl2_3 P. collierea AM42W16 100 672-753 100-p8_A2 P. fluorescens EF552157 100 668 75-pl5_P4 P. gessardii AF074384 100 669 100-pl2_4 P. putida EU554430 99 670
100-p8_Cl Rahnella aquatilis DQ862542 99 590-607-721 100-p8_D8 Rahnella aquatilis FJ811859 99 607-612-723-730 100-p8_D2 Rahnella aquatilis AY253919 98 598-728 100-p8_G2 Stenotrophomonas maltophilia AJ011332 99 679
100-p8_9 Janthinobacterium lividum EU642885 100 648-654-656-658-670-675 100-p8_E7 Chryseobacterium piscium DQ862541 99 -
After compilation of the three identification methods, almost all dominant peaks, i.e.
frequent and abundant peaks, could be presumptively attributed to at least one organism
(Figure 3.3). Pseudomonas fluorescens, Mrakia spp, Mrakiella spp. and G. pullulans
were the most stable, as their corresponding peaks were found throughout the flow
season, and were present at all production sites. The most frequent fungal peak,
attributed to Mrakia spp., was reproducibly present in 55 of the 57 samples analysed,
while the P. fluorescens peak was found in 50 samples. A peak corresponding to a
Rahnella isolate ranked 5th in frequency, but only 10th in relative abundance. It was
found in 17 production sites (37 of 57 samples), mostly in 50% and 100% sap flow
samples (data not shown). The J. lividum isolate had five (out of six) peaks ranking high
in relative abundance (7th to 18th rank, Figure 3.3), although three of these peaks could
also be attributed to Pseudomonas isolates. Other frequent peaks corresponded to the
genera Cryptococcus, Pseudomonas, Lactobacillus, Leuconostoc, Stenotrophomonas,
Ralstonia and Williopsis. Two bacterial (B229 and B183) and one fungal (F81) frequent
peaks could not be attributed.
77
iWMopsis sp AStenotrophomonaslRalstonia
A P synngae A B183 (unknown)
A P. synngae A Leuconostoc mesenteroides
A P antartica/ Janminobacterium tvidum A Janthinobacterium lividum
• F81 (unknown) A P. marginats
A Janthinobacterium tvidum AB229 (unknown)
A Lactobacillus reuteri A P stutzen
A Rahnella sp A P. colterea
A P. kjrida/P putda I Janthinobacterium lividum A P. brenneri/ Janthinobacterium lividum
AP.Iurida ^Cryptococcus victoriae
• Mrakiella spp • Guehomyces pullulans
• Mrakia spp. A P fluorescens
Bacteria • Yeast
APgessardi
Frequency (rank)
Figure 3.3 Dominance curve plot of the 25 predominant MARISA peaks (out of 175 peaks) in 57 sap samples. Peaks are ordered and evenly spaced from most frequent (left) to less frequent (right) and from most abundant (bottom) to less abundant (top). Peaks identified with clones or isolates are indicated in black and peaks identified with the RISSC database are indicated in blue.
3.5.3 MARISA profile analysis The MRBP method was used to test the null hypothesis that no difference in microbial
profiles exists between the three flow periods and 19 production sites. This method
calculates the agreement test statistic A (A = \ - (observed delta/expected delta)) and a
p-value. When all items within groups are identical (small within-group distance gives a
low observed delta), A = 1 and when heterogeneity within groups equals expectation by
chance, A = 0. Values of A below 0 indicate that heterogeneity exceeds that expected by
chance, so that grouping is not significant (large within-group distance gives a high
observed delta). An A value of 0.3 is considered fairly high in community ecology,
meaning that differences between biological groups are not due to chance (McCune and
Grace 2002). The MRBP results indicate that MARISA profiles were similar between
0% and 50% sap flow periods groups (A = 0.04, p O.0001) and even slightly more
similar between 50% and 100% groups (A = 0.02, p <0.0001). Overall, the difference
between flow period groups was fairly small (A = 0.04, p O.00001). When using fungal
78
peak data only to examine similarity between flow periods, the result was comparable (A
= 0.05, p = 0.00001) to when using bacterial peak data ((A = 0.04, p O.00001). In
contrast, a considerable effect of production site was found (A = 0.16,/? <0.00001). This
difference is notably higher for fungal peak data (A = 0.25, p <0.00001) than bacterial
peak data (A = 0.14,p O.OOOOl).
MARISA profile differences were visualized using the non-parametric NMS ordination
method (Figure 3.4). Samples represented in species space (MARISA peak data) do not
form distinct groups, although the 0% flow period samples are located in the upper left
quadrant, while 50% and 100% samples are mostly located in the center of both axes,
which represent a gradient of species. Figure 3.4 shows that Pseudomonas marginalis,
Cadophora malorum, Pseudomons lurida and the unidentified fungal peak F81 are
mostly found in 0% sap flow samples while Pseudomonas gessardii, P. fluorescens and
P. stutzeri were most abundant in 50% and 100% sap flow samples.
79
5 03 S o
t 03
O 03
s> 03
03 e/3
CD
Sapflc >w period: ▲ o%1 • 50% ■|100%| >w period: ▲ o%1 • ■|100%|
■
/
X
A
_N
\ / ^ * ~"*
A
80< A
A A
_ k *
Je •
A
i
A ▲ â ■ y
/■• ■
CM
1 ■
A #
■ ■
• • •
▲
•
■ J
40« •
A
■ \ • y ■
<
■ A
0< ■
•
> 40 Axis 1 80
F81, P. lurida, I
P. fluorescens, P. stutzeh
Figure 3.4 NMS plot based on Bray-Curtis similarities of the Hellinger transformed MARISA data. Correlation of axis with the original data matrix are r2 = 0.29 and 0.24 for axis 1 and 2 respectively. Ellipses group 75% of samples. Presumptive identification of peaks correlated (r2 >0.25) with the axis are shown along the arrows. Stress of the plot = 0.19,/? = 0.004.
3.5.4 Maple sap composition and correlations with microbial communities Maple sap composition (pH, sugars, organic acids, phenolic compounds, bacterial and
fungal viable counts) were measured for each sample and means were compared
between sampling periods (Tableau 3.3). Most components varied significantly over the
80
flow season, especially between 50% and 100% flow periods. Microbial counts
increased during the season resulting in sucrose hydrolysis, release of monosaccharides
and organic acids. Hence, multivariate analysis was performed separately for each
sampling period.
Tableau 3.3 Tukey-Kramer HSD mean comparison of maple sap concentrate composition
Sap property' 0% sap flow 50% sap flow 100% sap flow pH 7.69 A2 7.67 A 7.36 B Sucrose (% w/w) 63.31 A 64.29 A 59.26 B Glucose (% w/w) 0.12 A 0.28 A 0.97 B Fructose (% w/w) 0.08 A 0.20 A 0.85 B Galactose (% w/w) 0.58 A 0.96 B 1.17 C Maltotriose (% w/w) 0.07 A 0.17 A 0.79 B Malic acid (% w/w) 0.45 A 0.67 B 0.68 B Oxaloacetic acid (% w/w) <0.01 A 0.03 B 0.06 C Fumaric acid (% w/w) <0.01 A 0.01 B 0.02 C Vanillin (% w/w) 1.36 A 1.02 B 0.77 B Coniferol (% w/w) 0.07 - 0.05 - 0.02 -Syringaldehyde (% w/w) 1.28 A 0.98 B 0.65 C Bacterial counts (log CFU/mL) 5.02 A 6.11 B 6.75 c Fungi counts (log CFU/mL) 3.98 A 4.52 B 5.19 c
Chemical composition expressed in % w/w is normalized to 66 °Bx Different letters indicate a significant difference between means of a property atp = 0.05
Principal component analysis was used to ordinate chemical variation of maple sap
samples for each flow period (Figs. 3.5 to 3.7). Chemical parameters are plotted as
vectors, their length and angle reflects the direction and strength of relationships of the
variables with the principal components. Principal components 1 and 2 describe between
60.3% and 72.6% of total variance among sap samples. Component 1 mainly reflects
variability in sucrose content and component 2 mainly reflects variability in pH. Other
trends in sap properties such as content in invert sugars, organic acids and phenolic
compounds fluctuate between sampling periods as they are not consistently correlated
with an axis and consequently with each other. For example, in 0% sap flow samples
(Figure 3.5), malic acid is negatively correlated with sucrose (opposite vector direction)
while in 50% sap samples (Figure 3.6), these parameters are not correlated
(perpendicular vector direction).
81
80
CM
C . CD c o Q . E o O
40
Gala Malic
Fructose, Glucose, Fu a
B150
C. sake Sucrose
F 66 J. lividum
Vanillin nïïerol
Syringaldehyde
40 Component 1 80
Figure 3.5 Joint plot of PCA on correlations between chemical properties (blue vectors) of 0% sap flow period samples (green dots) and MARISA peak data (black vectors). Randomization test (999 permutations) indicates that the first 2 axes are significant. Variance represented is 44.4% and 22.0% for axis 1 and 2 respectively. Black vectors indicate the importance of MARISA peaks with coefficients of determination r2 >0.30.
82
150
E o O
Syringaldehyde
Vanill
Fumari Oxaloaœticaci
B226, B163.B160
Fructosi plucose
Maltotriose
Sucrose
Galactose
b)
Malic acid Coniferol
L. meter Mraki
Rhodococcuss Syringaldehyd
Maltotriose? Fumaricac
B226. B163, B161, B16I Oxaloaceticacld
Glucose, Fructose
Vanillin*
teroides, B148 nn Galactose
Sucrose
c)
L. mesenteroidesf B113, B148 Galactose * /
Rtmdococcusspp Mrakia spp.
Maltotriose Syringaldehyde
P. tolaasii, Williopsis 3pT"
Vanillin
40 80 Component 1 Component2
Figure 3.6 Joint plot of PCA on correlations between chemical properties (blue vectors) of 50% sap flow period samples (orange dots) and MARISA peak data (black vectors). According to the randomization test, the first 3 components are significant. Variance represented is 38.1%, 22.2% and 15.8% for axis 1, 2 and 3 respectively, a) PCA components 1 and 2, b) PCA components 1 and 3, C) PCA components 2 and 3. Black vectors indicate the correlations of MARISA peaks with coefficients of determination r >0.30.
83
80
CM C ■D C o Q. E o O
40
0'
Fumaric acid
Oxaloacetica
G. pullulans
^Vanillin
.pH
rSyringaldehyde
"Sucrose
"Malic acid
ConiferoF
• Galactose
40 Component 1 80
Figure 3.7 Joint plot of PCA on correlations between chemical properties (blue vectors) of 100% sap flow period samples (purple dots) and MARISA peak data (black vectors). Randomization test indicates that the first 2 axes are significant. Variance represented is 53.7% and 18.9% for axis 1 and 2 respectively. Black vectors indicate the correlation of MARISA peaks with coefficients of determination r2 >0.30.
Likewise, correlations with MARISA profile data are different for each flow period
(only the correlations with r2 >0.3 are shown). At the beginning of the season, the
presumptively identified peak belonging to Candida sake was correlated (same vector
direction) with invert sugars, maltotriose and organic acids while J. lividum was
correlated with phenolic compounds (Figure 3.5). Halfway through the tapping season,
more correlations were observed (Figure 3.6) as the third principal component
84
contributed to explaining almost 16% of the variance. MARISA peaks corresponding to
P. tolaasii and to Williopsis saturnus were correlated with reducing sugars (Figure
3.6A). Peaks corresponding to Mrakia spp., L. mesenteroides and Rhodococcus spp.
were correlated with coniferol and malic acid (Figures 3.6B and C). At the end of the
season, the peak attributed to G.pullulans was correlated with glucose, fructose and
maltotriose (Figure 3.7).
3.6 Discussion Microorganisms in maple sap have been considered a problem because they can stop sap
flow or even clog the tubing system. However, the presence of a stable population of
microorganisms such as P. fluorescens in maple sap gives rise to the question about the
impact of these microorganisms on maple sap composition and syrup quality. The high
concentration factor (-40 L of sap are required to produce 1 L of syrup) and the wide
range of flavor compounds found in maple syrup support the hypothesis that stable
members of the maple sap microbiota contribute to characteristic maple syrup properties
such as color and flavor. This study focused on identifying the stable fungal members of
maple sap microbiota, as well as correlating the microbial diversity to variation of maple
sap composition over the collecting season. For this purpose, a new multiplex automated
ribosomal intergenic spacer analysis technique targeting both bacterial and fungal
organisms was developed. Results demonstrate the presence of several stable fungal
members and multivariate analysis shows different correlations between maple sap
composition and microbial community members for each flow period.
3.6.1 MARISA method In food microbiology, when large numbers of samples are required for describing
microbial community patterns, automated fingerprinting methods such as T-RFLP and
ARISA are preferred (Juste et al. 2008). However, food matrices are rich environments
that often harbor complex microbiota composed of phylogenetically distant
microorganisms such as bacteria and fungi. Therefore, multiple taxon analysis, i.e.
several parallel reactions and consequently a large amount of DNA, is often required to
obtain a complete picture. Maple sap collected early in the season was less contaminated
and extraction yielded less DNA. For these reasons, a new multiplex ARISA protocol
85
was developed. Results confirm that MARISA and ARISA are comparable in terms of
reproducibility and sensibility. Also, as reported previously for ARISA on aquatic
samples (Danovaro et al. 2006), MARISA enabled distinction of closely related maple
sap Pseudomonas spp. isolates. Given these advantages, the MARISA method has a high
potential of application in food microbiology, especially for food matrices rich in closely
related Pseudomonas species such as maple sap in which this genus was the most
abundantly and frequently represented in the 16S rRNA gene sequences analyzed
(Filteau et al. 2010).
However, like any other PCR based method, MARISA is subject to systematic biases
(Kanagawa 2003; Juste et al. 2008). For example, the Chryseobacterium soli isolate did
not yield any detectable amplicon. This could be explained by the fact that over 8% of
bacterial strains sequenced so far do not yield a PCR fragment using ARISA primers
because their ribosomal genes are not organized as an operon (Kovacs et al. 2010). Also,
to adapt the protocol, PCR optimization was required and bacterial primer
concentrations were doubled compared to fungal primer concentrations to amplify the
maximum number of peaks with both primer sets. The poor signal obtained at first
probably resulted from the higher number of peaks amplified by bacterial primers,
primer specificity (Polz and Cavanaugh 1998), rrn operon copy number heterogeneity
(Crosby and Criddle 2003), and differences in starting template concentration in the
sample (fungi counts were at least one log below bacterial counts, Tableau 3.3).
3.6.2 Maple sap bacterial community The bacterial community of maple sap has previously been investigated with community
fingerprinting profiles and 16S rRNA gene clone libraries (Filteau et al. 2010). Results
have shown a common membership along with a variation pattern in relative abundance
of closely related sequences of Pseudomonas 16S rRNA genes, especially between 0%
and 50% flow periods. The MARISA method was sensitive enough to further refine
these trends. Firstly because two gradients of Pseudomonas species are responsible for
most of the variation in relative abundance and secondly because clusters of samples
from all flow periods overlap, thus confirming the common membership. The MRBP
analysis further shows that differences between samples originate from sampling sites
86
rather than flow periods, which is in agreement with previous results (Filteau et al.
2010). Moreover, the predominance and stability of P. fluorescens was confirmed for
this sample set demonstrating the robustness of the MARISA method and lending
further credence to correlations observed with chemical data.
As for Rahnella, an associated peak was frequently found, but not at every sampling site.
The relative abundance of this peak was also lower than that for other frequently found
peaks. As a different primer set was used for MARISA and clone libraries in the
previous study (Filteau et al. 2010), it is likely that this lower relative abundance results
from a true ecological difference between species rather than a primer efficiency bias.
Therefore, it remains unclear whether Rahnella is a stable member or not. Hence, a more
sensitive quantitative method such as real-time PCR would be useful to clarify its status
in the maple sap community.
Additionally, the ranking in relative abundance and frequency of Pseudomonas spp.,
Janthinobacterium, Leuconostoc and Stenotrophomonas/Ralstonia was further defined,
revealing these microorganisms as the most important occasional contaminants.
However, not all peaks could be identified and some peaks accounted for more than one
organism, thus reducing the resolution. Increasing IGS database content and creation of
an ITS database would obviously be a useful tool for future MARISA profile
interpretation.
3.6.3 Maple sap fungal community One of the main focuses of this study was to establish which fungal organisms are
consistently found in maple sap and thus can be termed stable members. The notion of
stability in the case of the maple sap microbiota is of particular interest as it would be
the stable members that are partly responsible for the general quality of maple syrup, its
color and empyreumatic flavor for example. Meanwhile, occasional contaminants could
be responsible for its typicity and for certain types of less frequent off-flavors and
texture defects. For instance, the bacteria Enterobacter (Aerobacter) aerogenes was
found to be responsible for an occasional ropy texture in maple sap but has not been
reported as a frequent contaminant (Lagacé et al. 2004; Lagacé et al. 2006b; Filteau et
al. 2010).
87
The multiplex method allowed us to discern the variations in fungal communities
through the flow season and between 19 production sites. MRBP analysis showed
similar results for the fungal community as for the bacterial community, but with
stronger dissimilarities between production sites. This indicates that fungi, and in a
lesser measure, bacteria, could act as significant contributors to maple syrup typicity as
the production site is the main determinant of typicity (Clément et al. 2010).
Paradoxically, the present results indicate that three types of yeast, namely Mrakia sp.,
Mrakiella spp. and G. pullulans can be considered a stable feature of the maple sap
microbial community because they were found at all sampling sites and throughout the
flow season. This contrasts with the fact that only one bacterium, P. fluorescens, can be
considered a stable member and underlines the potential importance of the fungal
microbiota in maple syrup flavor development.
The Mrakia and Mrakiella genera are closely related on the phylogenetic and
physiognomic level. They are generally isolated from cold climates. Mrakia has also
been reported in indoor dust from buildings during the winter season (Pitkâranta et al.
2008). They are defined as obligate psychrophilic yeasts as they do not grow at
temperatures above 20°C, their optimal growth temperature being 12-15°C (Thomas-
Hall et al. 2010). Some strains can even grow at -7°C (Raspor and Zupan 2006). This
ability would clearly be a competitive advantage because maple sap is collected when
the temperature spans the freezing point. Psychrophilic yeasts are considered a reservoir
of cold-active enzymes, Mrakia and Mrakiella can notably assimilate glucose and
sucrose (Thomas-Hall et al. 2010). G. pullulans is commonly found in nature and is part
of the normal microbiota of humans. Some strains isolated from soil can biodegrade
lignin (Slâvikovâ et al. 2002).
Other yeasts identified belong to the genera Cryptococcus, Cadophora, Rodotorula,
Williopsis, Candida and Bulleromyces. Although some of these yeast have been isolated
from maple sap before (Sheneman and Costilow 1958; Lagacé et al. 2005), Mrakiella,
Cadophora and Williopsis have not. The fact that a frequent and abundant member such
as Mrakiella has not been previously found in maple sap underlines the importance of
culture-independent methods. Another point of interest is the fact that no mold
88
sequences were found in the clone libraries, when several isolates of molds have been
identified in maple sap (Sheneman and Costilow 1958). This could be the result of bias
introduced by cultivation or by DNA extraction. The peak F81 has also not been
attributed to a sequence, but a Pénicillium roqueforti strain yielded an amplicon of the
corresponding size in a study using the same ARISA protocol (Arteau et al. 2010). The
fact that peak F81 was most abundant in 0% flow period samples while clone libraries
were constructed from 50% and 100% flow period samples could explain why
sequences corresponding to this amplicon size were not recovered.
Along with peak F81, a gradient of Cadophora malorum was found throughout the
tapping season, perhaps as a response to environmental factors such as the increasing
temperature and changes in sap composition. C. malorum is a plant pathogen that has
been found to cause wood decay notably in Antarctica (Di Marco et al. 2004; Blanchette
et al. 2010). It is possible that this species is found mostly at the beginning of the season
because it could colonize the bark of the tree, but not the collection system tubing which
by the end of the season appears to be the main microbial contamination reservoir of
maple sap. Also, Cryptococcus and, Rhodotorula were found as predominant
basidiomycetous yeasts on tree bark (Bhadra et al. 2008), indicating that despite the
effort of producers to sterilize tapholes with denatured alcohol (Perkins and van den
Berg 2009), fungal contamination from the tree bark may occur.
3.6.4 Correlations between microbial communities and maple sap composition Changes observed in maple sap composition can directly result from tree metabolism
and microbial activity and indirectly from environmental conditions such as air
temperature. Hydrolysis of sucrose to glucose and fructose is generally attributed to
microbial activity (Perkins and van den Berg 2009). Changes in sugar composition
(except for galactose) are observed between the middle and the end of the season, when
microorganisms reach 106 CFU/mL. It could mean that below this contamination level,
the impact of microorganisms on maple sap sugar composition is negligible.
It is presumed that for a given sampling period, tree metabolism and environmental
conditions are similar for all production sites. Therefore, the correlations observed
89
would result only from microbial community differences. On one hand, correlations
could be seen because those specific microorganisms may cause changes in maple sap
composition. For example, the fact that P. tolaasii can produce acid from glucose (Holt
et al. 1994) could explain why it is negatively correlated with pH at 50% sap flow. On
the other hand, correlations could be attributable to the sap composition that is favorable
to those organisms. For instance, vanillin could be the substrate of J. lividum, a strictly
aerobic psychrophile with an oxidative metabolism that can occasionally cause food
spoilage (Hess et al. 1990; Holt et al. 1994).
Interestingly, relationships (r2 >0.3) between peaks and chemical gradients (principal
components) were never observed over more than one flow period. This is probably due
to the fact that the environmental conditions and the overall sap composition changes
significantly between flow periods, allowing for different microorganisms to
successively occupy an ecological niche. For example, C. sake and G. pullulans are both
correlated with reducing sugars but at different flow periods. G. pullulans was found as
a late-colonizing yeast of birch spring sap exudates, displacing other yeasts such as
Cryptococcus, Rhodotorula and Candida (Golubev et al. 2002). Notably, G. pullulans
peak intensity was higher in 100% sap flow samples while Cryptococcus and Candida
were more abundant in 0% sap flow samples (data not shown). C. sake was reported
predominant on leaves of a subantartic grass during the spring season, where leaves are
subject to freeze and thaw cycles, although its optimal growth temperature is between 20
and 25°C (Hurst et al. 1984). G. pullulans is also characterized by low survival of
alternating freezing and thawing but has a higher growth rate and a lower optimal
growth temperature (Golubev et al. 2002). Therefore, C. sake and G. pullulans could
occupy the same niche in maple sap and have a significant influence on maple syrup
produced from sap collected early or late in the season, respectively. However, C. sake
is a fermentative microorganism while G. pullulans is generally not. This is reflected by
the fact that C. sake is correlated with organic acids in addition to reducing sugars.
Therefore, their impact on maple syrup properties might differ.
Another interesting point is that P. fluorescens and Mrakiella were not found to be
correlated with the variables measured at any flow period. It is possible that the stability
90
of the distribution and dominance of these microorganisms reflect their ability to adapt
rapidly to the changing temperature, but also that their main substrate would not
significantly change over the season. Inversely, they would not have a significant impact
on the sap properties measured in this study, meaning that their main substrate in maple
sap is unknown. P. fluorescens is known for its ability to degrade lignin-related
compounds (Vicuna et al. 1988; Gasson et al. 1998) and a wide range of phenolic
compounds, mainly derived from lignin, are present in maple sap (Kermasha et al.
1995).
3.7 Conclusion Stability of dominant maple sap bacterial community members has been recently
observed for the first time through the flow period and over two consecutive seasons for
one production site (Lagacé et al. 2006b). Now it appears that this stability is a common
feature of maple sap collected in the province of Québec, for both bacterial and fungal
members, supporting the hypothesis that stable microorganisms contribute to maple
syrup characteristic properties such as color and flavor. Stable members have been
identified as P. fluorescens, Mrakia, Mrakiella and G. pullulans. Moreover, it is
suggested that the fungal microbial community of maple sap may be a significant
component of maple syrup typicity, with regards to the production site. Furthermore,
observed correlations between both bacterial and fungal community members such as J.
lividum, L. mesenteroides, P. tolaasii, Rhodococus spp., C. sake, Williopsis sp., Mrakia
sp. and G. pullulans and maple sap composition pinpoint that these organisms could be
related to maple sap quality variation. Of course, the correlations found here are limited
to this descriptive study and further work supported by inferential statistics would be
necessary for generalization of these conclusions. Additional experiments including
quantitative measurement of specific populations in maple sap and corresponding maple
syrup physicochemical and sensorial data will determine whether these trends remain
consistent and further define the role of these microorganisms. These new findings about
the role of maple sap microbiota in maple syrup quality and typicity suggest that maple
syrup may deserve a controled origin appellation.
91
3.8 Acknowledgements This work was supported by the NSERC Canada Research Chair awarded to D. Roy and
an NSERC Strategic Project grant awarded to D. Roy, G. LaPointe and L. Lagacé. The
authors acknowledge the support of the Centre ACER Research Fund (St-Norbert
d'Arthabaska, Québec, Canada). We are grateful to C. Charron and R. Desruisseaux for
their technical help.
92
Chapitre 4
Les contaminants prédominants de la sève d'érable sont corrélés aux propriétés physicochimiques et sensorielles du sirop d'érable
Maple sap predominant microbial contaminants are correlated with the physicochemical and sensorial properties of maple syrup 4.1 Résumé
Le procédé de transformation de la sève et la contamination microbienne de
celle-ci sont des aspects importants qui affectent la qualité du sirop d'érable. Dans la
présente étude, deux ensembles d'échantillons de 2005 et 2008 ont été utilisés pour
évaluer la variation de la qualité du sirop d'érable et sa relation avec les populations
microbiennes tout en tenant compte du procédé de transformation, du site et de la
période de récolte. L'abondance des bactéries (le groupe Pseudomonas fluorescens et
deux sous-groupes, Rahnella spp., Janthinobacterium spp., Leuconostoc mesenteroides)
et levures (Mrakia spp., Mrakiella spp., Guehomyces pullulans) prédominantes dans la
sève d'érable a été mesurée par la PCR quantitative. Les propriétés du sirop d'érable on
été analysées par des méthodes physicochimiques et sensorielles. Les résultats indiquent
que P. fluorescens, Mrakia spp., Mrakiella spp. G. pullulans and Rahnella spp. sont des
contaminants stables de la sève d'érable puisqu'ils ont été retrouvés à chaque site de
production et à toutes les périodes de coulée. L'analyse de facteurs multiples rapporte un
lien entre l'abondance relative du groupe P. fluorescens et Mrakia spp. dans la sève
d'érable et les flaveurs d'érable et de vanille. Ce résultat supporte la contribution de ces
microorganismes ou d'un consortium de contaminants prédominants aux propriétés
caractéristiques du sirop d'érable.
94
4.2 Abstract Maple sap processing and microbial contamination are significant aspects that affect
maple syrup quality. In this study, two sample sets from 2005 and 2008 were used to
assess the maple syrup quality variation and its relationship to microbial populations,
with respect to processing, production site and harvesting period. The abundance of
maple sap predominant bacteria (Pseudomonas fluorescens group and two subgroups,
Rahnella spp., Janthinobacterium spp., Leuconostoc mesenteroides) and yeast (Mrakia
spp., Mrakiella spp., Guehomyces pullulans) was assessed by quantitative PCR. Maple
syrup properties were analyzed by physicochemical and sensorial methods. Results
indicate that P. fluorescens, Mrakia spp., Mrakiella spp. G. pullulans and Rahnella spp.
are stable contaminants of maple sap, as they were found for every production site
throughout the flow period. Multiple factor analysis reports a link between the relative
abundance oi P. fluorescens group and Mrakia spp. in maple sap with maple and vanilla
odor as well as flavor of maple syrup. This evidence supports the contribution of these
microorganisms or a consortium of predominant microbial contaminants to the
characteristic properties of maple syrup.
95
4.3 Introduction Maple syrup quality, specifically its commercial value, is currently defined by its color
and flavor intensity. Dark color and off-flavors have been attributed to microbial
spoilage of sap prior to processing (Morselli and Whalen 1991; Morselli et al. 1996;
Lagacé et al. 2002). Indeed, the majority of maple sap samples have been shown to
contain less than 10 CFU/ml when obtained aseptically from healthy trees (Morselli and
Whalen 1991). When outside the tree, maple sap provides a rich nutrient medium for
microorganisms that can exceed 107 CFU/mL by the end of the sap flow season (Lagacé
et al. 2002; Lagacé et al. 2004; Lagacé et al. 2006b). Furthermore, plastic tubing
surfaces of modem sap collection systems allow formation of microbial biofilms
(Lagacé et al. 2006b) which can also clog the collection system and cause sap flow to
stop prematurely (Perkins and van den Berg 2009). However, highly contaminated saps
do not always turn into defective syrups (Dumont 1999; Lagacé et al. 2002). Pioneer
studies even found that sap fermentation can enhance the characteristic maple flavor
(Naghski et al. 1957a; Willits et al. 1961a). Predominant microbial contaminants can
contribute to the maple syrup characteristic properties while occasional contaminants
can affect typicity or add to defects (Lagacé et al. 2006b; Filteau et al. 2010; 2011).
Recent studies using culture-independent methods showed that Pseudomonas sp.,
Mrakia spp., Mrakiella spp. and Guehomyces pullulans were major members of maple
sap microbiota while Cryptococcus victoriae, Rahnella spp., Janthinobacterium lividum
and Leuconostoc mesenteroides were occasional contaminants (Lagacé et al. 2006b;
Filteau et al. 2010; 2011). Moreover, the relative abundance of certain microorganisms
such as J. lividum, L. mesenteroides, G. pullulans and Mrakia spp. were correlated with
maple sap composition at different harvesting periods (Filteau et al. 2011).
The contribution of predominant contaminants in maple sap to syrup quality, especially
its flavors, remains poorly understood. Bacteria and yeast are associated with sucrose
hydrolysis into reducing sugars by Maillard reactions during processing of maple sap.
These reactions are responsible for dark colored maple syrups. Only a fraction of the
numerous (over 200) volatile flavor compounds detected in maple syrup have been
identified so far (Potter and Fagerson 1992; Sabik et al. 2010). Therefore, sensory
96
analyses remain the decisive way to assess maple syrup quality. Also, maple syrup
flavor variations have been attributed to the processing method, time of season with
regards to microbial contamination and region of production (Perkins and van den Berg
2009). However, further characterization is required in order to associate flavor variation
with these factors.
A specific quantification method targeting predominant microbial contaminants is
needed to assess the potential impact of these microorganisms on maple syrup
properties. Quantitative PCR (qPCR) is an accurate culture-independent quantification
method that has been successfully applied to quantify both bacteria and yeast in food
matrices (Makino et al. 2010; Hierro et al. 2007; Rasolofo et al. 2010).
The aim of this study was to assess the correlation between the abundance of maple sap
predominant contaminants and maple syrup properties that could support the hypothesis
that these members of the maple microbiota play a role in the development of maple
syrup properties. Therefore, specific quantification assays of maple sap bacterial
contaminants such as Pseudomonas fluorescens, Rahnella spp., Janthinobacterium spp.,
L. mesenteroides, and yeasts such as Mrakia spp., Mrakiella spp. and G. pullulans were
developed. Relationships between microbial relative abundance and maple syrup
physicochemical and sensorial properties variations across harvesting seasons and
production sites were evaluated using multiple factor analysis (MFA). MFA is an
emerging method in microbial ecology (Lamentowicz et al. 2010; Haller et al. 2011;
Jassey et al. 2011) well suited for analysis of multiple large datasets (de Tayrac et al.
2009). The method, based on the principal component analysis (PCA) technique, allows
simultaneous ordination of multiple groups of variables defined on the same objects
(Pages et al. 1991). It was used to get an integrative picture and seek common structure
among the microbial, physicochemical and sensorial datasets.
97
4.4 Material and methods
4.4.1 Maple sap and syrup samples A first set of maple sap osmosis concentrates (4X, ~8 °Brix) and corresponding syrups
were obtained from 19 Québec production sites located in six regions (Lower St-
Lawrence, Mauricie, Estrie, Center of Québec, Chaudière-Appalaches and Laurentides-
Lanaudières) at 0%, 25%, 50%, 75% and 100% of cumulative sap flow during the 2005
tapping season (N = 95). A second set of maple sap concentrates (N = 22, 2 samples
missing) and corresponding producer syrups (N = 24) were obtained in 2008 by
sampling all production batches (6 to 9 batches expressed in cumulative sap flow %)
coming from three different sites. Sap concentrates and syrups were immediately frozen
(-20°C) after sampling until analysis. Microbial counts for the 2005 samples were
obtained from a previous study (Filteau et al. 2010).
4.4.2 Laboratory syrups To control for the effect of the variation in the transformation process by the producers,
syrups were produced with a laboratory scale standardized procedure from sap osmosis
concentrates of 0, 50 and 100% cumulative sap flow periods of 2005 (N = 57). The
protocol consisted of boiling the concentrated sap on a gas stove to reach a concentration
of 20 °Brix and then boiling the solution in a smaller container to reach the final
concentration of 66 °Brix.
4.4.3 Physicochemical analysis The pH was determined using a PHM82 combined electrode (Radiometer Copenhagen).
The percentage of total solids was measured with a digital refractometer AR200
(Reichert Scientific Instruments, Buffalo, N.Y., U.S.A) and expressed in °Brix
compensated at 20°C. Concentrations of simple sugars and organic acids were measured
with a high performance liquid chromatography system (Waters, Milford, MA) using
previously described protocols (Lagacé et al. 2002, Dumont et al. 1993b). Phenolic
compounds were analyzed using published protocols (Dumont et al. 1993b; Kermasha et
al. 1995; Deslauriers 2000). Sugar and acid percentages were expressed in
weight/weight while phenolic compounds were expressed in ug/g or ppm. Syrup
98
viscosity was determined with a digital rheometer Brookfield model DV-II (Stought,
MA) with a no. 18 spindle at 12 rpm. Syrup color intensity was determined at 560 nm
using a UV/VIS spectrophotometer Lambda 14 (Perkin Elmer) with pure glycerol as
reference. Color intensity is expressed as percent light transmittance. Data were
normalized to 66 °Brix.
4.4.4 Sensory analysis Both laboratory and producer syrup samples coming from 0, 50 and 100% sap flow
periods of year 2005 (N = 114) and year 2008 producer syrups (N = 24) were submitted
to five trained taste panelists for sensory evaluation. Tasters were trained to refer to
categories from the flavor wheel of maple products (http://agr.gc.ca/maple_wheel). They
were asked to grade the intensity of the most common odor and taste categories (maple,
vanilla, plant ligneous, empyreumatic, confectionary) on a scale from 0 to 7. They were
also asked to give a global note, on a scale of 1 to 4, 1 corresponding to a strong off-
flavor, 2 to a light off-flavor, 3 to a regular syrup and 4 to a syrup with a strong maple
flavor. Averages were calculated from the scores of the five panelists.
4.4.5 DNA extraction DNA from maple sap concentrate was extracted using the DNeasy Blood and Tissue Kit
(Qiagen, Mississauga, ON, Canada), according to the protocol provided for Gram-
positive bacteria. Columns were eluted twice to ensure maximum DNA recovery. One
hundred microliters of DNA were treated with 1 pL RNase (Roche Applied Sciences,
Indianapolis, IN, USA). Concentration of purified DNA was determined using a
NanoDrop ND-1000 spectrophotometer (NanoDrop Technologies, Inc., Wilmington,
DE, USA). DNA was diluted to a final concentration of 2-20 ng per microliter.
4.4.6 PCR amplification and sequencing Maple sap isolate internal recA sequences were amplified with the conserved primers
recAF (5'-TCSGGYAARACCACSCTGAC-3') and recAR (5'-
RTACCAGGCRCCGGACTTCT-3') (Hilario et al. 2004) (Tableau 4.1). For Rahnella, a
sequence characterized amplified region (SCAR marker) was recovered from a
community PCR fingerprint (Filteau et al. 2010) and sequenced. Specific primers A149-
99
439F (5'-CGATGGAGCCTTTCCCGTAT-3') and A149-439R (5'-
CTGCTGATCCGTGGTAAATCC-3') were designed to amplify a 376 bp region in
Rahnella isolates. PCR reactions consisted of 2 U of Taq DNA polymerase (Biolab,
Dorval, Qc), IX supplied Thermopol buffer, 25 pmol of each primers, 40 nmol total
dNTP, 100 ng of genomic DNA, in a 50 uL total reaction volume. PCR amplifications
were carried out in a Tgradient thermocycler (Biometra, Goettingen, Germany) with the
program consisting of an initial 2 min dénaturation step at 94°C then 35 cycles of 30 sec
dénaturation step at 94°C, 30 sec annealing step at 55°C, a 45 sec polymerization step at
72°C and a final 5 min elongation step at 72°C. PCR products were purified with
ExoSAP-IT® (USB Corporation, Cleveland, USA). Purified products were sequenced
on both strands. Sequencing was made with the ABI PRISM® dGTP BigDye™
Terminator v.3.0 Ready Reaction Cycle Sequencing Kit (Applied Biosystems, Foster
City, CA, USA) and an Applied Biosystems 3100 Genetic Analyzer (Applied
Biosystems, Foster City, CA, USA). The sequence assembly was performed using the
CAP contig assembly program within BioEdit Sequence Alignment Editor version
7.0.5.2. (Hall 1999). Maple sap isolates gene sequences are available in GenBank under
accession numbers JN190888 to JN190922.
Tableau 4.1 Sequences used for specific primer design.
Assays Sequences used for alignment Accession number
Specific to
P. fluorescens group (recA)
100-p8_A2 75-pl5_P4 75-pl5_T4 75-pl5_T2 100-p8 Bl 100-p8_Fl 100-p8Jjl 100-p8_C5 100-p8_H4 75-pl5_Tl 100-pl2 6 75-pl5_p3 100-p8 B3 0-pl2_l 75-pl5 PI 0-pl2_4 0-pl2 3 0-pl2_5 100-pl2J 75-pl5_P2
JN190888 Isolates related to : P. JN190889 fluorescens, P. fluorescens JN 190890 biovar C, P. veronii, P. lurida, JN 190891 P. extremaustralis, P. JN 190892 collierea, JN 190893 Reference sequence JN 190894 (genebank): P. synxantha, P. JN 190895 marginalis JN 190896 JN 190897 JN 190898 JN 190903 JN 190899 JN 190901 JN 190900 JN 190904 JN 190902 JN 190905 JN 190906 JN 190907
100
P. fluorescens subgroup 1 (recA)
P. fluorescens subgroup 2 (recA)
Rahnella (SCAR A149)
Janthinobacterium (recA)
L. mesentoroides (recA)
Mrakia (ITS1-5.8S-I.TS2)
100-p8_A2 75-pl5_P4 75-pl5_T4 75-pl5_T2 0-pl2_5
0-pl2_l 75-pl5 PI 0-pl2 4
100-p8_D2 100-p8 F2 100-p8_F3 100-p8 H2 100-p8_D8 100-p8 D7
100-pl2-9 Janthinobacterium sp. Marseille
JN 190888 JN 190889 JN 190890 JN 190891 JN 190905
JN 190901 JN 190900 JN 190904
JN190916 JN190917 JN190918 JN190919 JN 190920 JN 190921
JN190914 NC009659
L. mesenteroides (isolate from centre ACER inc.) JN 190915 L. mesenteroides strain: NRIC 1541 AB354944 L. mesenteroides subsp. dextranicum strain NCDO 529T AJ621685 L. mesenteroides subsp. dextranicum strain NCDO 525T AJ621686 L. mesenteroides subsp. cremoris strain LMG 6909T AJ621687 L. mesenteroides subsp. mesenteroides ATCC 8293 CP000414
Mrakiasp. CBS 8918 AY038834.1 Mrakia sp. CBS 8910 AY038827.1 Mrakia sp. CBS 8912 AY038829.1 Mrakia sp. YSAR9 AM922288.1 Mrakia gelida strain CBS5272 AF144485.1 Mrakiastokesii strain CBS 10622 EU149810.I M. stokesii strain CBS5917 AF144486.1 Mrakia nivalis strain CBS5266 AF144484.1 Mrakia frigida strain CBS5688 AF144482.1 Mrakia sp. CBS 8907 AY038836.1 Mrakia sp. CBS 8909 AY038828.1 Mrakia sp. CBS 8921 AY038826.1 Mrakia sp. CBS 8919 AY038835.1 50-pl2-D2 HQ267076 100-pll-Cl HQ267079 50-pl2-Al HQ267081 100-pll-Hl HQ267078 100-plIB 12 HQ267080 100-pll-H4 HQ267082 100-pll-C9 HQ267077 50-pl2-A3 HQ267084 100-pll-E3 HQ267083 50-pl2-F2 HQ267085
Isolates related to : P. fluorescens, P. fluorescens biovar C Reference sequence (gencbank): P. fluorescens
Isolates related to : P. collierea Reference sequence (gencbank): P. fluorescens SBW25, P. marginalis
Isolates related to : R. aquatilis, Rahnella sp.
Isolate related to: J. lividum Reference sequence: Janthinobacterium sp. Marseille
L. mesenteroides
Mrakia spp.
Mrakiella (ITS1-5.8S-ITS2)
G. pullulans (ITS1-5.8S-ITS2)
100-pll-G8 50-pl2-F10 Cryptococcus niccombsii Cryptococcus aquaticus C. aquaticus strain H1 C. aquaticus strain H2 M aquatica strain DBVPG 4994 M. aquatica strain DBVPG 4990
100-pl 1-D5 100-pl1-F8 50-pl2-F12 100-pl 1-F7 G. pullulans strain CBS 2532
HQ267086 HQ267087 AY029346.1 AF410469.1 AY052487.1 AY05 2488.1 GQ911548.1 GQ911547.1
HQ267071 HQ267072 HQ267073 HQ267074 AF444417
Mrakiella spp.
G pullulans
101
4.4.7 Quantitative PCR (qPCR) Specific primers were designed to monitor target organisms (Tableau 4.2) identified as
predominant in maple sap (Filteau et al. 2010; 2011) and based on preliminary results
(annexe 2). Specific bacterial qPCR primers and probes were selected from the
consensus sequences of maple sap isolates and NCBI GenBank reference sequences
(Tableau 4.1) using Primer Express 2.0. The recA gene was used as the target region
whenever possible as it is a single-copy gene for most eubacteria (Lin et al. 2006). For
Rahnella, a sequence amplified characterized region (SCAR) was targeted because the
rec A gene sequence could not be obtained for all isolates. Specific fungal qPCR primers
were designed within ribosomal intergenic spacer fragments (ITS1-5.8S-ITS2 region)
previously obtained (Filteau et al. 2011) and NCBI GenBank reference sequences
(Tableau 4.1). qPCR primers were synthesized by Integrated DNA Technologies
(Coralville, I A). To estimate qPCR efficiencies of primer sets, PCR products were 10-
fold serially diluted in sterile water and the calibration curve slope was used in the
following equation: E = io(~1/slope) (Tableau 4.3). The specificity of the primers was
verified by NCBI primer tool (http://www.ncbi.nlm.nih.gov/tools/primer-blast/) and by
qPCR assays using bacterial isolates or fungal clone DNA.
qPCR was performed with the ABI PRISM® 7500 system (Applied Biosystems). PCR
products were amplified according to the following protocol: initial hold for 10 min at
95 °C, followed by 40 two-step cycles at 95 °C for 15 sec and 60 °C for 60 s. qPCR
were performed in a -10 uL volume including 5 pL 2x master mix and 4.5 pL or 5 uL
DNA for TaqMan® and SYBRgreen assays respectively. Primer and probe sequences
and concentrations are given in Tableau 4.2. For SYBR green reactions, after
amplification, dissociation curve analysis was performed by increasing the temperature
by 1 °C every 20 sec from 65 °C to 94 °C, to confirm primer specificity. qPCR was done
in triplicate for each sample (N = 28 for 2005, N = 22 for 2008). In each run, negative
controls without DNA for each primer set were included. The concentration of genomic
DNA from sap samples and specific PCR products were determined using a NanoDrop
102
ND-1000 spectrophotometer (NanoDrop Technologies). A 10-fold serial dilution series
of specific PCR products was used to construct the standard curves (Tableau 4.3).
Tableau 4.2 Target, primers and type of qPCR assay
Target organisms Locus Master
mix Primers Qty Each
(nmol) Probe
Qty (nmol)
Total bacteria 16S rDNA TaqMan®
F Bact 1369 R Prokl492 1800 (Suzuki et al. 2000) 250 16S
rDNA (Suzuki 2000)
P. fluorescens group recA SYBR Green 300
P./7uorescens subgroup 1 recA TaqMan®
Pfluo-2S5F TGTTACCGGTGATTTTACGCAG
Pfluo-409R 900
OTUl-332f TCGATCTCGGCCTTCGGCAC
C 250
P. fluorescens subgroup 2
CATGCTGGTGCGCTCCA OTU4-222r P. fluorescens subgroup 2 recA TaqMan® 900 CAGCCCTGGTACCCAAGGC
TGAAATC 250
Rahnella SCAR A149-
439 TaqMan®
OTU5-193F CCACCAGCACAGCAAAATCA
OTU5-263R CGCAAACCGGTCAGTTCAG
900 OTU5-220
CATCGCAAACATCAGCAGG CCAAG
250
Janthinobacterium
OTU10-171F SYBR AATCGTCGGGTAAAACCACG Green OTU 10-23 IR
CCGCCCAGTTTTTGCATTT
300
L. mesenteroides
Leuco-229F SYBR GGATACAGGCGAACAGGGATT Green Leuco-331R
GGCACGAGGTACTAATGCAGC
300
G. pullulans ITS
Guehomyces-3&8F SYBR TGAGCGCTGCTGCTTTGTT Green Guehomyces-49%R
CGCATTGCTGCAACTGTCC
300
Mrakia ITS
Mrakia-92F SYBR CATACACCTGTGCACCGTTTG Green M&M-236R
GCGAGAACCAAGAGATCCGTT
300
Mrakiella ITS
Mrakiella-SiF SYBR CCCTGTGAATCGTTTGGCTT Green M&M-236R
GCGAGAACCAAGAGATCCGTT
300
103
Tableau 4.3 qPCR standard curves parameters
Target organism R: intercept SE slope SE Efficiency
(%)
Range
(copy nb)
Total bacteria 0.997 42.8456 0.1569 -3.5511 0.0278 91.25 102-108
P. fluorescens group 0.999 36.6074 0.0806 -3.3774 0.0154 97.74 103-107
P. fluorescens
subgroup 1 0.998 35.3837 0.1185 -3.2722 0.0242 102.12 102-107
P. fluorescens
subgroup 2 0.998 35.5474 0.1076 -3.3144 0.0231 100.32 102-107
Rahnella 0.999 40.1841 0.0853 -3.7255 0.0159 85.53 102-108
Janthinobacterium 0.999 36.3064 0.0723 -3.2943 0.0142 99.69 103-107
L. mesenteroides 0.999 35.5415 0.0475 -3.3331 0.0097 99.53 10°-107
G. pullulans 0.999 35.5469 0.0531 -3.3684 0.0113 98.10 10°-107
Mrakia 0.999 35.9994 0.0616 -3.3872 0.0135 97.35 10°-107
Mrakiella 0.997 35.8962 0.1027 -3.3594 0.0219 98.46 10°-107
Gene copy numbers were calculated as in Rasolofo et al. (2010). Total qPCR bacterial
cell counts were approximated using an adjustment of 16S rRNA gene copies per cell as
bacteria found in maple sap have an average of 4.28 copies per genome (rrnDB website
http://ribosome.mmg.msu.edu/rrndb/index.php, (Lee et al., 2009). Relative abundance of
specific counts was used to avoid co-linearity issues, i.e. to distinguish the specific count
variation from the total microbial variation. It was calculated by dividing the target copy
number by the adjusted 16S rRNA gene copy number. Statistical analyses were
performed with JMP 7 (SAS Institute Inc, Cary, NC, USA). MFA was performed on
ranked transformed data with the R software 2.12.1 (R Development core team 2008)
using the FactoMineR package (Husson et al. 2009).
4.5 Results
4.5.1 Microbial contaminant quantification The qPCR count of P. fluorescens group, P. fluorescens subgroups and Rahnella
increased throughout the 2005 season (Figure 4.1). Janthinobacterium, L.
mesenteroides, Mrakia, Mrakiella and G. pullulans qPCR counts were highest at the
50% flow period. Total bacteria and specific qPCR counts as well as their calculated
104
relative abundance did not differ significantly between geographical regions at the 100%
flow period in 2005 (Figure 4.2).
9
7 -
6 -
8 Ol c oi 4 BO
10% 150% 1100%
o
a:
_ J o 1— DÛ __ 3
_ s
o DO
X I _J
o 0
_ i 1/1 o c b l •-0
o c
C c « <u OJ o o c: • 1/1 o 6! ï -, o o
E o
Figure 4.1 qPCR counts of maple sap predominant contaminants according to flow period in 2005. Tukey-Kramer HSD test indicates that 0% flow period samples are significantly different (p <0.05) from 50% flow period samples for each contaminant measured. The difference between the 50% and the 100% flow period samples is significant (p <0.05) for the P. fluorescens group only.
105
9
6
â 5
o OJ
<v 4 DO ao o
_ j
3 -
Lower St-Lawrence Center of Québec Chaudière-Appalaches Estrie Laurentides-Lanaudières Mauricie
o _. DÛ
Q. O
_ o
4j C -c
fc 3 C
-S 6 i ~
2 V) CuO 0 0 o _ "3 OJ
*--i __ _ ce O c a. OJ
*--i 3 t/1
-a o
c 13
eu <-0 v i c <U
o 0) "g c
•S S o
Vl f/1
"g c ~ J
■ ^ i 0) QJ o <X
3 ■fc,
a;
O 3 a:
»
<u Jx a
Figure 4.2 Total bacteria and specific qPCR count means per geographical region at the 100% flow period in 2005. Means were not significantly different (Kruskal-Wallis test, p >0.05).
Specific qPCR assays of P. fluorescens group, P. fluorescens subgroup 2, Rahnella,
Mrakia and G. pullulans were positive for all samples (Tableau 4.4 and Figure 4.3). P.
fluorescens subgroup 1 assays were negative for five 2008 samples, Janthinobacterium
for one 2008 sample, and Mrakiella for one 2005 sample. Also, Janthinobacterium, L.
mesenteroides and Mrakiella gave few cycle thresholds falling outside the standard
curve. Counts were thus extrapolated from the standard curves for use in multivariate
analyses.
In 2005, maximum psychrophilic plate counts were observed at the 100% flow period
for 13 out of 19 production sites. Minimum psychrophilic counts were found at the 0%
sap flow period for 18 sites (Tableau 4.5). Total 16S rRNA gene copy numbers ranged
from 7.1 to 8.9 log per mL at the end of the 2005 harvest season. A paired t-test showed
106
that the 16S rRNA copy numbers for total bacteria were significantly higher (p <0.0001,
N = 28) than 2005 psychrophilic plate counts by a mean difference of 1.3 log, but counts
were correlated (r2 = 0.70, p O.0001). In 2008, the maximum 16S rRNA gene copy
numbers for each production site was reached before the 100% sap flow period while the
minimum was found between 0 and 80% of sap flow. The 16S rRNA gene copy means
in sap were not significantly different between 2005 and 2008 (Wilcoxon test).
107
Tableau 4.4 qPCR gene copy number of 2005 samples P. P. P. L.
Total Janthino- G. Site period fluorescens fluorescens fluorescens Rahnella mesenter- Mrakia Mrakiella
bacteria bacterium pullulans group subgroup 1 subgroup 2 oides
8.60E+07 3.30E+06 4.60E+05 2.80E+05 I.60E+05 1.50E-05 6.49E+04 I.95E+03 I.17E+04 4.33E-H13
3.50E+08 2.30E+07 4.50E+O6 1.80E+O6 3.40E+06 3.50E+O5 5.06E+06 1.02E+06 1.15E+06 4.51E+06
3.20E+05 2.50E+04 3.30E+O3 5.00E+03 3.90E+03 2.10E+O2 5.85E+0O 9.17E+03 9.32E+03 2.70E+03
2.30E+07 1.20E+06 1.90E+05 2.20E+05 6.30E+O4 7.00E+04 5.36E+03 1.82E+04 6.48E+03 1.11E+04
8.50E+08 3.70E+07 4.90E+06 3.30E+O6 9.00E+06 2.50E+O5 6.35E+01 3.65E+06 1.52E+06 4.47E+06
9.90E+05 7.60E+04 1.50E+O4 1.30E+O4 2.00E+03 1.90E+03 4.75E+00 1.20E+03 1.49E+03 2.09E+03
1.20E+O8 6.40E+06 8.50E+05 8.90E+05 3.20E+06 9.90E+04 1.75E+03 5.89E+06 5.82E+06 2.39E+06
8.80E+06 5.0OE+O5 7.80E+04 1.10E+05 2.00E+04 7.40E+03 6.68E+01 2.09E+05 3.96E+04 1.45E+04
3.70E+O7 1.40E+06 3.90E+05 2.60E+05 9.80E+04 2.0OE+O5 2.90E+04 4.81E+04 2.68E+05 5.13E+04
1.70E+08 1.10E+07 1.70E+06 1.50E+06 8.90E+05 2.80E+O5 9.45E+04 6.29E+06 4.37E+06 2.07E+06
8.20E+04 6.00E+03 9.50E+02 8.20E+02 8.60E+02 2.80E+02 5.19E+00 4.38E+02 7.26E+02 3.38E+02
7.40E+06 7.70E+05 3.10E+05 1.30E+O4 7.20E+03 4.50E+O5 2.06E+04 1.34E+03 3.35E+04 4.69E+03
6.00E+07 6.20E+06 2.80E+06 1.50E+05 1.40E+05 3.60E+04 2.77E+01 1.67E+05 6.17E+05 1.39E+05
4.10E+07 3.50E+06 1.00E+06 2.70E+05 2.90E+05 6.80E+05 1.63E+04 2.10E+05 7.96E+05 0
2.50E+08 1.30E+07 2.40E+06 9.50E+05 2.30E+05 1.20E+04 5.28E+04 2.97E+06 8.76E+06 9.84E+06
1.30E+08 8.60E+06 1.00E+06 8.80E+05 4.00E+05 1.50E+06 2.39E+04 2.98E+05 7.15E+05 4.06E+05
4.00E+08 2.10E+07 3.30E+06 2.80E+06 2.40E+06 4.70E+02 1.22E+00 1.02E+05 2.61E+05 1.66E+05
1.60E+08 6.20E+06 1.60E+06 3.0OE+O5 1.10E+06 5.10E+04 8.31E+02 1.68E+06 8.10E+05 3.49E+06
2.10E+08 1.50E+07 4.20E+O6 5.80E+05 3.50E+05 2.90E+O4 1.22E+02 1.24E+07 4.44E+06 1.12E+06
1.60E+08 8.00E+06 2.00E+06 7.20E+05 2.80E+O5 4.00E+05 7.21E+02 2.10E+05 4.60E+05 4.94E+04
6.80E+08 4.60E+07 1.10E+07 2.40E+06 8.20E+05 5.90E+04 1.80E+02 9.11E+06 5.54E+06 6.44E+06
2.40E+08 2.10E+07 4.20E+O5 1.30E+06 1.50E+04 6.00E+04 1.14E+08 1.03E+05 4.00E+06 3.62E+06
8.70E+07 6.40E+06 1.10E+O5 5.50E+04 4.70E+04 7.00E+04 7.43E+05 3.41E+04 5.38E+05 3.41E+05
4.40E+08 4.40E+07 9.80E+06 3.20E+06 5.20E+06 1.50E+06 4.10E+03 1.30E+06 1.00E+06 4.74E+05
1.70E+08 1.30E+07 1.20E+06 1.10E+06 4.90E+04 2.40E+04 6.44E+03 2.40E+06 1.93E+06 4.19E+06
1.50E+O7 1.80E+06 8.10E+04 1.30E+05 1.90E+04 9.00E+04 1.30E+03 1.39E+04 1.83E+05 4.52E+05
5.40E+07 6.90E+06 1.00E+06 5.90E+05 4.40E+05 1.20E+06 4.82E+04 1.04E+05 3.78E+05 9.46E+04
9.40E+07 6.40E+06 2.20E+05 5.30E+05 2.10E+05 3.20E+05 2.16E+06 1.75E+05 4.29E+05 1.71E+06
B 50 B 100 C 0 c 50 c 100 D 0 D 100 E 0 E 50 E 100 F 0 F 50 F 100 G 100 H 100 1 50 1 100 J 100 K 100 M 100 N 100 P 100 0 100 R 100 S 100 T 100 U 100 V 100
108
Tableau 4.5 Sap concentrate psychrophilic plate counts
Production 2005 sap flow period site 0%* 25% 50% 75% 100%
B ^> 5.11 5.72 6.51 6.57 * 6.98 C 6.02 ^ 5.61 6.34 5.86 * 7.55 D ^> 5.59 5.90 6.07 6.00 O 7.02 E ^ 5.51 5.86 6.17 6.55 O 6.99 F 1> 4.22 5.57 6.55 6.52 T> 6.80 G ^> 5.57 5.60 + 6.35 6.33 5.93 H ^> 5.08 5.46 6.33 6.67 <T 7.14 I ^> 5.90 5.96 6.26 * 7.40 7.10 J # 4.46 5.76 4.94 5.76 T> 6.40 K V 5.37 5.63 6.12 6.07 0 7.40 M ^> 6.40 6.67 6.63 0 6.91 6.47 N ^ 5.16 5.85 6.26 6.39 T> 7.19 P ^> 4.81 5.23 6.03 6.23 T> 6.79 Q * 4.05 5.71 5.66 5.49 /y 6.95 R ^> 3.71 5.64 6.25 6.25 1> 7.04 S 0 5.11 5.27 5.92 6.53 T> 6.84 T ^ 4.00 5.09 5.97 T> 6.31 5.67 U ^ 4.24 4.74 5.88 * 6.38 6.27 V * 5.09 5.76 5.85 1> 6.05 5.81
*Results are expressed as Log CFU / mL. Up and down arrows indicate maximum and minimum counts for each site, respectively.
a)
109
Site
b) SiteX
20 40 60 % of cum ulative sap flow
Site Y
80 100
SiteZ
20 40 60 80 % of cumulative sap flow
0 20 40 60 80 % of cumulative sap flow
0 20 40 60 80 % of cum ulative sap flow
100
* ~" P.Huorescens group ♦
— Rahnella 1 P. fluorescenssubgroup 1
Mrakia ' ~ L . mesenteroides
' Janthinobacterium — P. lluorescenssubgroup 2 — G. pullulans
■ " " Mrakiella
Figure 4.3 Gene copy counts of maple sap samples throughout the 2008 harvesting season, a) Ajusted 16S gene copy number, b) Specific target results for each production site
110
4.5.2 Maple syrup physicochemical and sensorial properties Producer and laboratory syrup values for pH, sucrose, vanillin, vanilla odor, plant
ligneous taste, plant ligneous odor and transmittance significantly decreased over the
harvesting period while glucose, fructose, galactose, maltotriose, oxaloacetic acid,
fumaric acid, coniferol, empyreumatic taste, confectionary odor and confectionary taste
significantly increased (2005 producer syrup values are shown in Tableau 4.6). Global
sensory analysis and maple taste were highest at the 50% flow period. Syringaldehyde
and vanilla taste changes were not significant for producer syrups but they were for
laboratory syrups. Physicochemical and sensorial properties of producer and laboratory
syrups did not differ significantly between geographical regions, except for vanillin in
producer syrups and coniferol and syringaldehyde in laboratory syrups (data not shown).
Although variations throughout the harvest season were similar for producer and
laboratory syrups, several physicochemical and sensorial properties were significantly
different in a matched paired test (Table 4.5). Sensorial profiles of 2008 syrups varied
between production sites as well as between flow periods (Figure 4.4).
_ _ _ _ _ _ _
5 ï 84-1 _ -o tfl
| 2 1
0 6
5 01
S4
_ _ _ _ _ _ _ _
■Global ■Vanilla HI Confectionery tfl Plant ligneous HEmpyreumatic ■ Maple
- _ IL li 1* _
i _ l_l_ _ hlL _Ji 20 25 50 60
% sap flow 87.5 100
Figure 4.4 Global sensorial and odor profiles of 2008 producer maple syrups. Similar results were obtained for flavor profiles.
I l l
Tableau 4.6 Average physicochemical and sensorial property values of producer syrups.
Characteristics1 2005 flow period
0% 50% 100%
Mean difference between Producer syrup and Laboratory syrup2
Global appreciation* 2.23 2.63 2.35 -0.25*** Maple odor*/taste* 0.74/0.88 1.04/1.31 0.57/0.80 -0.29***/-0.38*** Vanilla odor*/taste 0.87/1.04 0.72/0.86 0.53/0.63 -0.40***/-0.42*** Confectionary odor*/taste* 1.37/1.92 2.07/2.95 2.85/3.44 0.19/0.17
Plant ligneous odor*/taste* 3.59/3.53 1.54/1.54 1.61/1.05 0.31/0.19
Empyreumatic odor*/taste* 1.48/1.41 2.21/2.13 2.96/3.32 0.19/-0.001
pH* 8.15 7.90 7.32 0.32*** Sucrose (%)* 63.81 63.15 61.25 n go***
Glucose (%)* 0.06 0.14 0.48 -0.25*** Fructose (%)* 0.03 0.08 0.40 -0.004 Maltotriose (%)* 0.07 0.13 0.49 -0 11***
Galactose (%)* 0.49 0.95 1.20 0.02 Vanillin (%)* 1.37 0.75 0.45 -1.56*** Coniferol (%)* 0.68 1.34 1.93 -0.10 Syringaldehyde (%) 1.64 1.38 1.71 -0.61*** Oxaloacetic acid (%) * <0.01 0.04 0.05 0.003
Malic acid (%) * 0.42 0.45 0.54 -0.11*** Fumaric acid (%)* <0.01 <0.01 0.01 -0.005*** Viscosity 186.74 176.37 169.74 21.89*** Transmittance (%) * 70.39 61.05 41.16 -6.66***
* indicates a significant Kruskal-Wallis test atp <0.05, N=57 ***** indicates a significant Wilcoxon Signed-Rank test difference atp <0.0001, N=57
112
4.5.3 Relationship between microbial contamination and maple syrup properties To evaluate the impact of the predominant maple sap microbiota members on maple
syrup quality without any bias from the transformation process or the metabolic changes
linked to the harvesting period, results of laboratory syrups from the end of the 2005
season (100% flow period) were used to analyze qPCR results, physicochemical and
sensorial properties. The 100% flow period was preferred because it usually shows the
maximum microbial load and high variance in syrup quality and was therefore the period
most likely to reflect the microbial impact on maple syrup quality. A second set of
samples from 2008 was also analyzed to test the robustness of the relationships observed
between the qPCR results and the sensory analysis.
For multiple factor analysis, variables were grouped in categories (odors, flavors, acids,
sugars, aromatic compounds, physical properties, bacteria and yeasts). The MFA results
can be interpreted as results from a principal component analysis: coordinates of a
sample are its values for the common factor (axis) (Figure 4.5) and the coordinates of a
variable are its correlations with these factors (Figure 4.6). As a complementary
analysis, k-means hierarchical clustering was performed after the MFA on the resulting
first three factors and is projected on the first factorial map (Figure 4.5). The result is an
integrative graphical output; the factorial axes illustrate the main continuous gradients,
while the dendrogram illustrates discontinuous factors (classes). MFA also yields a
representation of groups of variables (Figure 4.7) where their proximity indicates a
common structure for the first two factors.
113
(a)
to E CD C
0 2
Factor 1 (45.04%)
- 4 - 3 - 2 - 1 0 1 2 3
Factor 1(26.87%)
Figure 4.5 Ordination plot of samples from the multiple factor analysis based on microbial relative abundance in maple sap (calculated with gene copy number) and maple syrup physicochemical and sensorial properties. K-means clustering was performed after the MFA and is projected on the MFA ordination space. Number of clusters was defined automatically, a) 100% flow period samples of 2005. b) 2008 samples. Letters indicate the production site and numbers indicate the harvesting day of April 2008.
114
(a)
o> CO
o 03
LL
un 6
Maltot Maltot Fr ructose
o o
Oxalacatic acid i.ose.Total barfteria îose.Glucosi "
i n d
OMaplel " fmaplAMra/t/a.Globbl
Pfjuprgscens grou| OVànilla
FVanillal
k. Transmittance Malic acid
» J Transmittsmce
Viscosity
-1.0 —\ \ r -0.5 0.0 0.5
Factor 1(45.04%)
—r 1.0
(b)
_
o o
O
O
d
_ d
-1.0 -0.5 0.0 0.5 1.0
Factor 1(26.87%) Figure 4.6 Vector map of variables from the multiple factor analysis, a) Variables for samples from the 2005 season. For clarity purposes, only variables with cos2 >0.5 are shown. Results from the producer syrups were included as supplementary variables, i.e. they do not influence the MFA results. They are represented by broken line vectors and blue labels, b) Variables for samples from the 2008 season. All variables are shown. F = taste and O = odor.
115
(a) P J
00
o ro
oo d
d
d
CN
d
o d
Physical DPoperties
Physical properties
Aromatics
Yeasts
° ^o r s Bacteria
Flavors* . •
A_ i Acids
Acids Flavors i .Sugars
A Aromatics
▲Sugars k Odors
0.0 0.2 i
0.4 —r 0.6
—r 0.8
—r 1.0
Factor 1(45.04%)
( b ) p -
oo -d
ro IT) o CO
CN 1—
o <) t ro
LL
o
CN -
d
o -d
Bacteria ▲
Odors
Flavors A
Period A
Yeasts Site
i
0.0 —r 0.2
—r 0.4
—r 0.6 0.8
—r 1.0
Factor 1 (26.87 %)
Figure 4.7 MFA group representation. Each group of variables is projected on the factor map created by the MFA. Active groups (black) and supplementary groups (blue) are plotted, a) 100% flow samples from 2005 b) samples collected throughout the 2008 flow period. Supplementary qualitative variables "period" and "site" are also shown.
116
MFA results for the 100% flow period 2005 samples indicate that the first two factors
account for nearly 57% of the total variation (Figure 4.5a). Samples clustered in two
groups well discriminated by the first factor. Looking at the corresponding vector map
(Figure 4.6a), the cluster la syrups can be described as rich in reducing sugars, fumaric
and oxaloacetic acids and are dominated by empyreumatic and confectionery attributes
while their sap is highly contaminated. In contrast, cluster 2a sap samples are
characterized by high relative abundance of the P. fluorescens group and Mrakia along
with high pH, sucrose, malic acid and vanillin content in syrups. These syrups are light
colored and their odor and flavor are globally optimal, dominated by maple and vanilla.
The representation of groups of variables (Figure 4.7a) shows that all groups contribute
to the first factor, but that the second factor is mostly due to physical properties. Thus
the first factor corresponds to a direction having a strong inertia for the groups, in other
words, many variables of each group are related to this factor. Laboratory and producer
syrups can also be distinguished. The physical properties are the group of variables that
has the most different structure between the two syrup sample sets. The bacteria group
has a structure similar to the sugars, acids, flavors and odors, while the yeast group has a
structure closer to the aromatic compounds.
For the 2008 samples, only 46% of the variance was explained by the first two factors
(Figure 4.5b). The samples are grouped in three clusters. Cluster lb is separated from the
others mostly by the first factor and is composed exclusively of samples from production
site Z. Clusters 2b and 3b are separated by the second component, which is related to the
harvesting period (Figure 4.7b). The vector map (Figure 4.6b) shows that cluster lb
syrup lacks maple and vanilla attributes and saps have low relative abundance of
Mrakia, Mrakiella and P. fluorescens group. On the other hand, cluster 2b samples have
a high global appreciation, maple and vanilla attributes and their sap microbiota is
characterized by high relative abundance of Mrakia, Mrakiella and P. fluorescens group
and subgroup 1. Cluster 3b syrups have plant ligneous attributes and lack empyreumatic
ones. Their sap microbiota has a low level of total bacteria but higher relative abundance
of Rahnella, Leuconostoc and P. fluorescens group and subgroup 2. The representation
117
of groups of variables (Figure 4.7b) shows that flavors and odors have a structure more
similar to the bacteria group of variables than to the yeast group.
4.6 Discussion Maple sap microbial contamination may cause syrup defects such as dark color, strong
empyreumatic flavor and slimy texture (Fabian and Buskirk 1935; Morselli and Whalen
1991). However, some microbial contamination could be desirable. Pioneer studies
found bacterial strains that enhanced maple flavor (Naghski et al. 1957a; Willits et al.
1961a).
In a previous study, it was shown that some microbial contaminants were correlated with
maple sap properties at different periods over the harvesting season, potentially affecting
maple syrup quality (Filteau et al. 2011). The present study reports consistent
relationships between the relative abundance of P. fluorescens group and Mrakia in
maple sap, as determined by qPCR, and desirable attributes of maple syrup.
Specific qPCR assays were developed to measure the abundance of the most frequently
found microorganisms in maple sap (Filteau et al. 2010; 2011). As the number of copies
per genome of the rrn operon varies greatly between organisms, detection could have
been biased in previous studies (Crosby and Criddle 2003). Specific bacterial qPCR
assays were thus designed using single copy targets such as the recA gene (Lin et al.
2006). For example, in the present study, the ranking in relative abundance found with
calculated gene copy number was similar to results obtained from clone libraries and
MARISA in our previous study (Filteau et al. 2011). However, the relative abundance
calculated for the P. fluorescens group (-6-7%) was around 10 times lower than what
was previously found with clone libraries (-60-70%) (Filteau et al. 2010; 2011). This
result suggests that the maple sap microbiota is potentially far more diverse than
previously suspected.
For the targeted yeast, single copy targets were not available as reference from maple
sap. Also, attempts to measure total fungal contamination were made based on published
protocols (Kabir et al. 2003; Manter and Vivanco 2007). However primer dimer
formation and low sensitivity prevented accurate quantification that may be due to
118
differences in laboratory equipment and reagents. Therefore, the relative abundance of
specific yeasts was calculated using the 16S rRNA gene copy number which was
considered representative of the total contamination, based on plate count results
(bacterial plate counts were always superior to fungal plate counts). For yeast,
significant correlation was found between 16S gene copy numbers and fungal counts in
the samples from the 2005 season.
Although microbial contamination generally increased over the tapping season, plate and
qPCR counts indicate fluctuations in microbial contamination throughout the flow
period and from site to site. Atypically, site Z already had more than 108 adjusted 16S
rDNA copies/mL when the season started. This could be attributable to the 20 year-old
main collection lines present in the system because older collection tubing could carry
over more microorganisms from season to season. Sites X and Y, which had collection
systems aged 10 and 8 years at the time had lower starting gene counts. However, those
sites that are located next to each other had a difference of two log 16S adjusted gene
copies/mL for samples collected the same day. This illustrates that microbial
contamination is linked to microenvironmental conditions and to sap flow rates which
vary between sites and harvesting years. Nevertheless, P. fluorescens group and Mrakia
remained on average the two most abundant contaminants in both 2005 and 2008
sampling sets. This reflects their ability to rapidly adapt to changing environmental
conditions, making them the most stable contaminants of maple sap. This stability
supports the hypothesis that they are implicated in the development of characteristic
maple flavors.
The Rahnella group counts were positive in every sample of both the 2005 and 2008
harvesting seasons. Therefore it could be considered a stable contaminant. Its low
relative abundance and the high genetic diversity found between isolates could explain
why this genus was not reported in all samples in the previous studies using clone
libraries and MARISA (Filteau et al. 2010; 2011).
The maple syrup grading system is currently based on the % of light transmittance; the
most valued being the lightest in color, the absence of off-flavors and presence of
119
characteristic flavors. In agreement with previous consumer studies (Belford et al.,
1991), the trained panelists generally preferred the 50% flow period samples which were
the strongest in maple flavor, but not the lightest in color. In fact, the early season light
colored syrup often had a plant ligneous off-flavor and received a lower global
appreciation score, as in cluster 3b. As for the 100% flow period syrups, some of them,
as in Cluster la, had a strong confectionary or empyreumatic flavor, masking the
delicate maple flavor. In fact, MFA results underscore the existence of a main sensorial
gradient and validate splitting this gradient into three distinct flavor categories of syrups;
plant ligneous, maple/vanilla and empyreumatic. The plant ligneous category can be tied
to the early harvesting period, the empyreumatic category is encountered later and the
maple/vanilla category is associated with mid and late harvesting periods.
Comparison of the physicochemical and sensorial properties of producer and laboratory
syrups indicates that the process type had a non-negligible impact on the final syrup
quality, the physical attributes being the most affected. Laboratory syrups were generally
better tasting and lighter in color than the corresponding producer syrup. This could be
explained by the fact that laboratory syrups were produced in small scale batches
whereas syrups are produced in a continuous flow by producers. Therefore, laboratory
syrups were probably heated for a shorter period of time, allowing a greater amount of
volatile compounds to remain in the syrup. The differences observed for maple odor and
flavor support the hypothesis that compounds contributing to the characteristic maple
flavor are developed during processing and from precursor compounds present in sap.
Also, it is consistent with current knowledge about maple flavor origin, which would be
produced either by thermal decomposition of sugars (sucrose and glucose) under
alkaline conditions, Maillard reactions as well as oxidation and hydrolysis of lignin
monomers (Potter and Fagerson 1992). Even though heating conditions were less severe
for the laboratory than for the producer syrups, Maillard reactions involving fructose
occurred in both, leading to empyreumatic flavors. Therefore, the sap composition in
reducing sugars and free amino acids would be a critical quality control point to avoid
undesirable strong empyreumatic off-flavors.
120
The MFA results showed that although there was a distance between the laboratory and
producer syrup measures, both sets had similar structure with respect to the microbial
groups of variables. Thus, the microbial impact is strong enough to be observed despite
the variation attributable to the transformation process. This also suggests that part of the
microbial impact on maple syrup properties is not tied to processing techniques.
In 2005, P. fluorescens and Mrakia were strongly linked to maple and vanilla attributes
for 100% flow period samples. Similar observations were made with 2008 samples for
three producers, throughout the harvesting period. Therefore it can be concluded that the
microbial impact of P. fluorescens and Mrakia on sensorial properties are time stable
features independent of other production factors. As for the P. fluorescens subgroups,
Rahnella, Janthinobacterium, G. pullulans and Mrakiella, their contribution to MFA
first factors was less important (cos2 >0.5). They could be more susceptible to the
environmental conditions changing with the harvesting period or season. This agrees
with previous results that showed correlations with maple sap composition at 0% sap
flow for Janthinobacterium, at 50% sap flow fori., mesenteroides and at 100% sap flow
for G. pullulans (Filteau et al. 2011).
P. fluorescens was not correlated with maple sap composition in the previous study,
perhaps because some potential substrates were not included in the measurements that
were carried out. Results obtained here support this hypothesis as the strongest
relationships observed were not with chemical composition of syrup, but with sensorial
properties. As many of the maple syrup flavor components remain unidentified (Potter
and Fagerson 1992, Sabik et al. 2010), further work in this area is necessary to
understand the impact of these microorganisms on maple sap chemistry.
The total 16S rRNA gene copy counts were positively related to empyreumatic flavors
and negatively to pH, sucrose and % light transmittance. This result was expected as the
increase in microbial contamination over the season has been associated with sucrose
hydrolysis in glucose and fructose which further leads to Maillard reactions during the
maple syrup processing that contribute to the burnt flavor and dark color. However, the
relative abundance of the P. fluorescens group is consistently opposite to the
121
empyreumatic flavor. P. fluorescens does not possess extracellular invertase enzymes
(Latour and Lemanceau 1997). It can utilize sucrose, but it is possible that another
preferred substrate is available in maple sap. P. fluorescens are good competitors in
moist environments, for instance, they can secrete fluorescent siderophores that trap
iron, making it a limited resource for other microorganisms (Paulsen et al. 2005). P.
fluorescens bacteria are also able to rapidly form biofilms inside the collection system
(Lagacé et al. 2006b). These abilities could explain why their relative abundance is
associated with favorable maple syrup properties, because they would limit the growth
of other contaminants. Therefore, the stable presence oi P. fluorescens, which are known
biocontrol and plant-promoting growth bacteria (Silby et al. 2009) would be a desirable
feature of the maple sap microbiota.
Among the yeasts, the relationship between the relative abundance oi Mrakia and maple
syrup properties was the strongest. The Mrakia genus is a relatively recently described
one and very few studies have been dedicated to it. In this study, it was found in
association with Mrakiella and Guehomyces, two closely related genera that have similar
optimal growth conditions (Hurst et al. 1984; Thomas-Hall et al. 2010).
Janthinobacterium, L. mesenteroides, Mrakia, Mrakiella and G. pullulans qPCR counts
were all highest at the 50% flow period, when the maple flavor is also at its highest.
Thus, high maple flavored syrup is obtained at an optimum contamination level.
Results point to a gradual process in flavor development throughout the season, the plant
ligneous flavors would give way to vanilla flavor which is replaced by maple flavor. A
degradation process of lignin by microorganisms, most probably P. fluorescens and
Mrakia, leading to liberation of lignin monomers in sap could be proposed. Also, in
early 2008 samples, Rahnella which can produce gai'acol (Jensen et al. 2001), a
substance found in plant ligneous type syrups (Sabik et al. 2010), was associated with
plant ligneous attributes.
In conclusion, quantification of specific contamination allowed us to assess the impact
of the predominant contaminants in maple sap on maple syrup quality. Although
microbial contamination can cause spoilage of maple sap, there is accumulating
122
descriptive evidence that the most stable part of the maple sap microbiota, namely P.
fluorescens group bacteria and Mrakia yeasts, positively contribute to maple syrup
attributes such as maple and vanilla flavors. The next challenge will be to
experimentally demonstrate such a positive impact and study its underlying mechanism.
This will require testing the effect of specific populations or consortia in a model maple
sap collecting system. Confirmation of these findings could represent a breakthrough for
maple sap contamination control and sanitation strategies and could be a key to the
natural production of value added products such as highly flavored maple syrup.
4.7 Acknowledgements
This work was supported by NSERC in the form of a Canada Research Chair awarded to
D. Roy and a NSERC Strategic Project grant awarded to D. Roy, G. LaPointe and L.
Lagacé. The authors acknowledge the support of the Centre ACER Research Fund (St-
Norbert d'Arthabaska, Québec, Canada) and their expert technical assistance.
Chapitre 5
Discussion et conclusion générale La problématique contemporaine de l'industrie acéricole réside dans la qualité de ses
produits qui varie considérablement. Avant tout, il faut comprendre que cette variation
est le résultat d'un assemblage complexe de facteurs biologiques et environnementaux
(Figure 5.1). La description de l'influence qualitative et quantitative du microbiote de la
sève d'érable sur la qualité du sirop d'érable était au cœur des objectifs de cette thèse
(Figure 5.1 A). Chacun des éléments depuis le microbiote jusqu'au sirop d'érable ont été
pris en compte sur un ensemble d'échantillons provenant de six régions de la province
de Québec récoltés tout au long de la saison de coulée 2005 et quelques échantillons de
la saison 2008. La variation spatiotemporelle des communautés microbiennes, de la
composition de la sève ainsi que des propriétés physicochimiques et sensorielles du
sirop a été caractérisée. Le site de production a été identifié comme étant le facteur le
plus important pour expliquer la variation de la composition du microbiote alors que la
période de récolte influence surtout la structure des communautés microbiennes. Cinq
populations stables ont été identifiées dans la sève d'érable (Pseudomonas fluorescens,
Rahnella spp., Mrakia spp., Mrakiella spp. et Guehomyces pullulans) par des méthodes
moléculaires. De plus, l'association entre l'abondance relative de plusieurs contaminants
et les propriétés de la sève et du sirop d'érable a été révélée par les analyses
multivariées. Notamment, l'abondance relative de P. fluorescens et Mrakia spp. a été
corrélée positivement aux flaveurs d'érable et de vanille par la MFA. Éventuellement, la
compréhension de cette influence permettra de poursuivre la recherche pour développer
des stratégies de modulation du microbiote (Figure 5.1B) ou de gestion des systèmes de
collecte (Figure 5.1C) dans le but de contrôler les propriétés des produits de l'érable.
124
-O-
Humain
Érable (génétique,
métabolisme)
Environnement 1 ^ ^ (climat, sol, e tc . ) ! ^ ^
Système de collecte
Analyses moléculaires
culture-indépendantes
Microbiote (composition, abondance)
Sève d'érable
Fabrication de sirop en
laboratoire
Analyses Physicochimiques
et sensorielles
Analyses Physicochimiques
et microbiologiques
Transformation
Sirop d'érable
Figure 5.1 Schéma de concepts illustrant les facteurs qui influencent la qualité du sirop d'érable et les éléments analysés au cours du projet. La flèche A représente le but de la thèse qui était de décrire le microbiote de la sève et son influence sur la qualité du sirop. Les flèches B et C représentent les voies possibles pour moduler le microbiote et mettre les connaissances acquises à profit.
125
5.1 Comparaison des méthodes moléculaires Au cours des travaux menées pour cette thèse, 12 échantillons de sève (site C à F, 0, 50
et 100% de la saison de coulée 2005) ont été soumis à plusieurs méthodes moléculaires,
soit une méthode de profilage PCR communautaire, une banque de clones d'ADNr 16S,
une MARISA et de la qPCR. Chacune de ces méthodes comporte des spécificités qui
leur ont valu d'être choisies pour répondre à chacun des objectifs. Bien que le but
premier de ces travaux ne soit pas la comparaison de méthodes, cette thèse ne saurait
être complète sans une comparaison de l'ensemble de ces résultats. Par ailleurs,
certaines analyses ont été associées soit à des données physicochimiques de la sève, soit
à des données physicochimiques et sensorielles du sirop (annexe 3), mais aucune analyse
n'a pris en compte tous ces résultats à la fois. La présente section a donc pour objectif de
discuter de l'analyse comparative et simultanée des résultats des différentes méthodes
moléculaires utilisées pour l'analyse des populations microbiennes de la sève d'érable.
La comparaison de l'abondance relative des principales bactéries présentes dans la sève
d'érable révèle des résultats différents pour chaque méthode moléculaire (Tableau 5.1).
Ceci s'explique par la différence de spécificité des méthodes puisqu'elles ciblent
chacune un gène différent. Elles sont également soumises à des biais différents. Les
banques de clones ainsi que la MARISA sont soumises à un biais d'amplification PCR.
Le nombre de copies du gène par génome est aussi un biais pour ces deux méthodes. La
MARISA est également biaisée du fait qu'il peut y avoir plus d'un pic par
microorganisme et un pic peut représenter plusieurs microorganismes à la fois
(homoplasie). Le biais PCR peut aussi être plus important pour la MARISA, car les
fragments ont des tailles différentes. Ainsi, la qPCR s'avère la méthode la plus fiable,
mais est beaucoup plus spécifique et l'information obtenue ne concerne que les espèces
ciblées contrairement aux banques de clones et à la MARISA qui représentent
l'ensemble présumé de la population. Les résultats montrent que la qPCR donne une
valeur généralement dix fois plus faible que la MARISA et les banques de clones
d'ADNr 16S. Ainsi, la diversité calculée pour les résultats des banques de clones et de la
MARISA sous-estime la diversité réelle présente dans la sève d'érable.
126
Tableau 5.1 Comparaison de l'abondance relative (%) des principaux contaminants
bactériens déterminée par différentes méthodes moléculaires
Ech. P. fluorescens Rahnella Janthinobacterium L. mesenteroides
< G
_
_ _
< --1 y .
o _ _ < _
_ _ _
_ _ _
< _ < _
_ _
C-0 2.34 9.94 1.04 4.68 7.01 1.23 1.17 4.76 0.07 0.00 0.00 0.00
C-50 7.05 39.12 0.82 14.04 2.76 0.31 2.34 2.98 1.15 4.09 0.00 0.02
C-l 00 3.23 22.15 0.57 13.44 1.41 1.05 1.08 0.00 0.03 21.51 0.00 0.00
D-0 7.05 4.36 1.51 0 0.00 0.20 1.28 6.70 0.19 0.00 0.00 0.00
D-50 4.62 11.56 0.80 4.49 4.55 0.27 3.85 0.00 0.30 0.00 0.00 0.02
D-100 7.39 7.22 0.72 22.73 20.28 2.67 6.25 0.00 0.08 0.00 0.00 0.00
1-0 4.28 5.96 0.89 2.14 0.00 0.22 0.53 0.00 0.08 0.00 0.00 0.00
E-50 12.3 8.45 1.04 2.14 7.42 0.26 0.53 5.55 0.54 0.00 0.00 0.08
E-100 4.62 16.32 0.99 6.15 4.80 0.51 3.08 4.44 0.16 3.08 0.00 0.05
F-0 2.21 25.37 1.17 0.55 0.00 1.05 0.00 41.21 0.34 0.55 0.00 0.01
F-50 65.38 86.51 4.16 1.65 2.11 0.10 0.00 2.22 6.12 0.00 0.00 0.28
F-100 56.68 60.69 4.58 8.02 2.00 0.23 0.53 0.00 0.06 0.00 0.00 0.00
moyenne 14.76 24.80 1.52 6.67 4.36 0.68 1.72 5.66 0.76 2.44 0.00 0.04 'OTUlo.oi 2Fragment B201 + B202 correspondant aux isolats 100-p8_A2 et 75-pl5_P4 qui ont une séquence du gène d'ARNr 16S identique à OTUl0.oi 3P. fluorescens sous-groupe 1, basé sur les séquences recA des isolats identiques à l'OTUlooi 4Somme des fragments B169, B233 et B237 correspondants aux isolats de R. aquatilis et Rahnella sp. 'Somme des fragments B186 et B192 correspondants à l'isolât de Janthinobacterium lividum
Une analyse du regroupement des échantillons, suite à une classification hiérarchique
(Figure 5.2), indique que les différences d'abondance relative observées au Tableau 5.1
affectent moins les analyses de similarité globale. En effet, la topologie des
dendrogrammes, c'est-à-dire l'organisation des ramifications, est comparable pour toutes
les méthodes à l'exception de la qPCR. On dénote un certain regroupement des
échantillons récoltés en début de saison tandis que les échantillons de milieu et de fin de
saison se regroupent davantage par site de production. La topologie du dendrogramme
des OTUso oi se rapproche davantage de celle des méthodes de profilage que de celle des
OTUsoo3 Dans le cas de la qPCR, les échantillons sont plus nettement regroupés par
période d'échantillonnage. Cette méthode comprend une quantification de la population
127
bactérienne totale, ce qui explique en partie cette différence. Ainsi, la méthode qPCR
cible les microorganismes permettant de bien différencier la période de coulée.
2> ; = >
_>J Profilage PCR communautaire
;_? Banques de clones (OTUs003)
E-
c-F ' E-
E c-C D-
D D"
__h _3
; = ► MARISA
E ■ D F • c-E" c-D-
C D E F-
F
_J
QPCR
Période de récolte 0% 50% 100%
Banques de clones (OTUSQ.OI)
Figure 5.2 Comparaison de la classification hiérarchique avec la méthode de Ward des différentes méthodes moléculaires. Les embranchements sont espacés également pour faciliter les comparaisons. Les lettres réfèrent aux sites de production.
Puisque les résultats obtenus par les méthodes moléculaires diffèrent, quelle méthode
permet la plus grande discrimination entre les sites de production et laquelle représente
le mieux l'impact sur la sève et le sirop? Afin de répondre à cette question, une MFA
comprenant les résultats des banques de clones (OTU0.03), de la MARISA (résultats
128
séparés pour les amorces bactériennes (B-ARISA) et fongiques (F-ARISA)), de la qPCR
et les résultats physicochimiques et sensoriels a été faite (Figure 5.2). Le logiciel
FactoMineR impose un maximum de 255 variables, par conséquent les résultats des
profils PCR communautaire et les OTUo.oi ont été omis.
-
3
o a
I—
00 ©
©
©
r 4 ©
© ©
B-ARISA OTUo.03
▲ F-ARISA _ A
qPCR Bactéries
Analyse sensorielle
Sève
qPCR Levures
A
Période Site Sirop m
Analyse sensorielle Sirop
0.0 r
0.2 —r 0.4
- r -
0.6 0.8 1.0
Facteur 1(25.56%)
Figure 5.3 Résultats de la MFA (analyse de facteurs multiples) pour les groupes de variables actives, qui sont prises en compte pour la MFA (en rouge) et supplémentaires, qui sont superposées aux résultats de la MFA (en bleu). Cercle : données des sirops des producteurs. Carré : données des sirops de laboratoires. Triangle : données caractérisant les sèves.
Selon les résultats, le facteur 1 est principalement attribuable aux propriétés
physicochimiques et sensorielles des sirops, tant de laboratoire que des producteurs. Le
facteur 2 est principalement attribuable aux OTU003 et à la MARISA. Selon ce schéma,
129
la composition de la sève d'érable possède une structure semblable à celle des bactéries
quantifiées par qPCR. Cette méthode donne également les résultats se rapprochant le
plus des propriétés du sirop d'érable. Il semble logique que les résultats de la qPCR
soient les plus rapprochés des résultats physicochimiques et sensoriels puisqu'ils ciblent
seulement les contaminants stables ou abondants, donc ceux potentiellement les plus
impliqués dans le développement des propriétés du sirop. Ce raffinement élimine en
quelque sorte le bruit de fond attribuable aux espèces rares, qui accompagne la MARISA
et les banques de clones d'ADNr 16S. Par ailleurs, la qPCR comporte une mesure de la
quantité totale de bactéries et reflète donc à la fois l'effet quantitatif et qualitatif. Cette
analyse integrative vient donc renforcer les résultats obtenus au chapitre 4 en ce qui
concerne le rapprochement entre les populations bactériennes ciblées et les propriétés du
sirop, mais elle positionne également les propriétés de la sève ainsi que les autres
méthodes moléculaires.
Quant à la période et au site d'échantillonnage, l'abondance relative des levures
mesurée par qPCR est le groupe de variables dont la structure serait la plus similaire. Ce
résultat concorde avec les résultats du chapitre 3 qui indiquent que la F-ARISA
partitionne mieux les échantillons par site que la B-ARISA (voir aussi l'annexe 1).
Cependant, l'écart entre la qPCR des levures et la F-ARISA est inattendu. De plus, le
groupe qPCR levure ainsi que le site et la période de récolte sont peu associés aux
premiers facteurs de la MFA. Il est possible que ces variables soient plus éloignées
suivant les facteurs subséquents. Une façon de vérifier la validité de cette association est
de faire une MRBP pour chacun des ensembles de données de ces quatre producteurs
(Tableau 5.2)
130
Tableau 5.2 MRBP de chacune des méthodes moléculaires sur 12 échantillons 2005
Ensemble de données
Profil PCR communautaire 0.121 0.006
OTUo.03 0.218 0.020
OTUo.oi 0.203 0.030
F-ARISA 0.119 0.005
B-ARISA 0.087 0.003
qPCR levures 0.017 0.314
qPCR bactéries 0.108 0.129
Selon les résultats de la MRBP, la qPCR levures est l'ensemble de données qui sépare le
moins les échantillons en fonction du site. Une absence de structure commune pour les
deux facteurs principaux de la MFA explique donc la proximité entre le groupe qPCR
levure et le site. Ce résultat est cohérent parce que les trois levures ciblées par la qPCR
sont communes à tous les sites échantillonnés. De même, la qPCR bactéries cible
principalement des bactéries stables et n'est pas significative en MRBP, ce qui concorde
avec la MFA qui indique que les résultats de la qPCR bactérie ne sont pas structurés par
site. La MRBP indique également que les banques de clones séparent mieux les
échantillons en fonction du site que les autres méthodes. Les différences entre les sites
proviennent surtout des contaminants occasionnels rares qui correspondent au bruit de
fond cité précédemment. Ainsi, selon l'objectif de l'étude, ce qui est considéré comme
du bruit de fond ici, les espèces rares, pourrait être le signal recherché par une autre
étude visant à soutenir la notion de terroir par exemple. Dans ce contexte, l'utilisation
des banques de clones d'ADNr 16S serait pertinente. Toutefois, puisque la F-ARISA
obtient un résultat supérieur à la B-ARISA et que le pyroséquençage est plus sensible
que les banques de clones, le pyroséquençage d'ADNr 18S constituerait l'approche la
plus performante pour distinguer les échantillons par site de production.
L'utilisation de méthodes de pointe telles que la qPCR a permis d'atteindre les objectif 5
et 6 du projet qui étaient de valider le statut de contaminant stable ou occasionnel des
131
principaux microorganismes de la sève et de déterminer les variations physicochimiques
et sensorielles du sirop d'érable associées à ceux-ci. Cependant, l'utilisation préalable de
méthodes d'analyse des populations générales telles que la MARISA et les banques de
clones a été indispensable pour identifier et déterminer les cibles adéquates.
L'exploitation de la complémentarité de ces méthodes a donc été une approche optimale.
D'autres méthodes complémentaires telles la cytométrie de flux auraient peut-être
apporté une perspective différente aux résultats. En effet, en marquant l'ADN avec le
4',6'-diamino-2-phenylindole (DAPI), un fluorophore colorant les régions riches en AT,
il est possible de séparer et récolter les cellules microbiennes en fonction de leur taille et
de leur contenu en ADN par cytométrie de flux. Des sous-populations d'intérêt peuvent
ensuite être étudiées par des méthodes moléculaires (Mou et al. 2005).
5.2 Le système de récolte acéricole, un écosystème à part
5.2.1 Origine de la contamination Le système de récolte acéricole est un écosystème unique, créé par l'homme mais
alimenté par la nature. En récoltant la sève, des microorganismes qui en d'autres temps
ne pourraient y accéder, y trouvent une niche accueillante. En effet, seulement quelques
microorganismes répertoriés à ce jour dans la sève sont reconnus comme
phytopathogènes (P. syringae, Rhodococcus, Leifsonia) (Setubal et al. 2005). La
majorité des microorganismes retrouvés sont plutôt ubiquitaires, ils proviennent
potentiellement du sol (Lagacé et al. 2004), de la phyllosphère ou même de l'homme.
Quelque soit la source de contamination, les tubulures laissées en place abritent une
quantité importante de microorganismes jusqu'à l'automne (Lagacé et al. 2011) et donc
potentiellement jusqu'à la saison suivante. Ainsi, l'âge des tubulures pourrait être relié
au niveau élevé de contamination initiale de la sève d'érable observé chez le producteur
Z en 2008. De plus, l'utilisation récurrente des tubulures pourrait contribuer à la stabilité
observée du microbiote pour un même site (Lagacé et al. 2006b). Ainsi, une solution
pour un producteur dont la qualité de la sève est problématique d'année en année serait
de remplacer complètement le système de tubulures.
132
5.2.2 Composition du microbiote Selon les connaissances actuelles, les communautés microbiennes de la sève se
composent principalement de bactéries à Gram négatif (92%) aérobies strictes (85%) et
de levures en nombre moins important. Avant le début de cette étude, plusieurs
contaminants du système de collecte de la sève d'érable avaient été identifiés (Tableau
1.5). De nombreux autres contaminants viennent maintenant s'ajouter à cette liste
(Tableau 5.3). Ce sont pour la plupart des contaminants rares, retrouvés dans peu
d'échantillons et en faible proportion. Certains sont des contaminants occasionnels,
retrouvés dans une minorité d'échantillons, mais parfois en proportions plus
importantes. D'autres sont des contaminants prédominants, c'est-à-dire présents dans la
majorité des échantillons et en proportions plus appréciables. Une nouvelle levure
répertoriée, Mrakiella, est même un membre stable du microbiote, retrouvé en
proportions dominantes dans quasi tous les échantillons. L'étendue de l'échantillonnage
a probablement contribué à la détection de ces microorganismes dans la sève d'érable.
Cependant, ces nouveaux résultats sont principalement attribuables aux outils
moléculaires culture-indépendants qui ont une sensibilité élevée et qui permettent de
soustraire les pressions de la culture en laboratoire. Ainsi, Mrakiella et
Janthinobacterium, pourtant deux contaminants fréquents, n'avaient pas été isolés lors
d'études précédentes, probablement en raison de leur température optimale basse et de
leur rythme de croissance plus lent.
Parmi les nouveaux résultats figurent également plusieurs bactéries lactiques capables de
fermentation et de production de flaveurs (Han et al. 2007). Leur présence occasionnelle
pourrait expliquer les flaveurs lactées identifiées dans la roue des flaveurs de l'érable
(Canada, 2004).
La connaissance approfondie de la composition du microbiote de la sève d'érable
apporte aussi un élément important pour la valorisation de ce produit; l'absence ou la
faible probabilité de retrouver naturellement des agents pathogènes résistants à la
pasteurisation puisque non-répertoriés à ce jour dans les travaux sur le sujet. En effet, le
microbiote est surtout composé de psychrophiles qui ne sont pas reconnus pour résister à
la pasteurisation. Ceci ouvre donc la porte à la possibilité de développer des produits à
base de sève d'érable pasteurisée.
133
Tableau 5.3 Microorganismes nouvellement répertoriés dans la sève d'érable dans cette étude
Bactéries Statut comme contaminant de la sève d'érable
Carnobacterium Rare Brevundimonas Rare Clostridium Rare Devosia Rare Duganella Rare Dyadobacter Rare Epilitonimonas Occasionnel Erwinia Rare Hafnia Rare Humicoccus Rare Hymenobacter Rare Janthinobacterium Prédominant Klebsiella Rare Lactobacillus Rare Lactococcus Occasionnel Leifsonia Rare Leuconostoc Prédominant Chitinophaga Rare Massilia Rare Ochrobacterium Rare Pantoea Rare Parkia Rare Propionicimonas Rare Pigmentiphaga Rare Pse udochrobactrum Rare Proteiniphilum Rare Serratia Rare Sodalis Rare Sphingobacterium Rare Sphingomonas Occasionnel Subtercola Rare Variovorax Rare Weissella Occasionnel
Levures
Mrakiella Williopsis (Apparenté à) Cadophora
Stable Occasionnel Rare
134
5.2.3 Structure et stabilité Une certaine stabilité du microbiote d'année en année pour un même site avait déjà été
observée (Lagacé et al. 2006b). Il a été démontré ici que la composition du microbiote
de chaque site est relativement constante au cours d'une saison, mais que sa structure
varie selon la période de récolte. La variation de l'abondance relative de certaines
espèces parentes de P. fluorescens explique en grande partie le changement de structure
observé entre le début et la fin de la période de coulée. Ce changement résulte
probablement de la hausse des températures et de l'activation concomitante du
métabolisme de l'arbre qui favorisent une sous-population de microorganismes.
Souvent, les membres les plus abondants d'une communauté microbienne ne sont pas les
joueurs clés, mais représentent les espèces les plus tolérantes vis-à-vis un large éventail
de paramètres environnementaux (Bombach et al. 2010). C'est pourquoi la notion de
stabilité a d'abord été considérée plutôt que l'abondance de chacune des populations. Il a
été démontré qu'il existe des populations stables i.e. présentes dans tous les systèmes de
récolte acéricoles à un moment ou un autre de la saison, soit P. fluorescens, Rahnella,
Mrakia, G. pullulans et Mrakiella. Les microorganismes se retrouvant à tous les sites et
tout au long de la période de récolte de la sève d'érable, sont susceptibles de participer
aux processus menant aux propriétés caractéristiques du sirop d'érable même s'ils sont
peu abondants. Il n'y a pas d'ambigtiité en ce qui concerne P. fluorescens, Mrakia,
Mrakiella et G. pullulans, car ils sont à la fois des membres stables du microbiote et
parmi les plus abondants. Par contre, la qPCR montre que Rahnella n'est pas toujours un
membre abondant, mais qu'il est toujours présent. Ce microorganisme avait déjà été
identifié comme un membre important du microbiote acéricole (Lagacé et al. 2006b). Sa
capacité à produire du gaïacol (Jensen et al. 2001), substance retrouvée dans les sirops à
caractère « plante ligneux » (Sabik et al. 2010) devrait être considérée lors de travaux
futurs.
Ces cinq populations se retrouvent tout au long de la période de coulée dans la sève des
19 érablières échantillonnées en 2005 et aussi dans la sève de trois autres érablières en
2008. Guehomyces, Mrakia et Mrakiella sont des microorganismes phylogénétiquement
proches (Thomas-Hall et al. 2010) qui ont aussi pu être isolés conjointement d'un
135
glacier européen (Branda et al. 2010). Il est envisageable que ces levures soient en
compétition pour la même niche écologique au sein des biofilms qui tapissent les
tubulures de récolte de la sève d'érable. Or, P. fluorescens et Rahnella possèdent des
caractéristiques physiologiques bien distinctes. Une hypothèse plausible serait que les
membres stables du microbiote acéricole participent à un consortium microbien, c'est-à-
dire à une collaboration temporaire où chaque microorganisme contribue par un élément
génétique distinct à compléter un processus métabolique. Puisqu'une sève stérile produit
du sirop insipide et sans saveur (Lagacé 2006), il est possible que la résultante de cet
objectif commun soit un précurseur de la saveur d'érable.
5.3 L'impact du microbiote, une réponse multivariée
Les résultats des échantillons récoltés en 2005 montrent qu'il existe une quantité
optimale de microorganismes dans la sève pour une saveur maximale du sirop et que
cette valeur est généralement atteinte en milieu de saison (Figure 5.4). Une hypothèse
pour expliquer cet effet est qu'au-delà d'un certain degré de contamination, le
métabolisme des populations change et son impact sur la qualité de la sève et du sirop
également. Il est connu que plusieurs mécanismes de communication microbienne
appelés « quorum sensing » (QS) ont une réponse seuil-dépendante caractéristique. Les
cellules ne répondent pas proportionnellement au signal chimique, mais diffèrent plutôt
la réponse jusqu'à ce qu'un seuil critique du signal soit détecté (Wintermute et Silver
2010). Le QS régule notamment les voies métaboliques menant à la formation de
biofilms chez plusieurs bactéries dont certaines souches de P. fluorescens (Wei et Zang
2006). King et Morselli (1985) ont d'ailleurs observé que la tubulure de récolte de la
sève est propice à la formation de biofilms par P. fluorescens et que celle-ci n'est
détectable que lorsque la contamination est élevée. Ainsi, il est possible que le QS soit
également responsable de la régulation d'un mécanisme qui est lié à la disparition de la
flaveur « plante-ligneux » retrouvée dans les sirops du début de la période de récolte. Il
n'est pas exclu que la faculté de certains Pseudomonas à dégrader la lignine et à libérer
les précurseurs de flaveurs tel l'acide vanillique (Ruzzi et ai. 1997; Narbad et Gasson
1998) soient l'un de ces mécanismes. A l'inverse, une contamination importante est
136
souvent liée à la présence de sucres réducteurs dans la sève. Ceux-ci participent aux
réactions de Maillard lors de la transformation en sirop et il en résulte des flaveurs
empyreumatiques qui masquent les flaveurs d'érable et de vanille. Si les populations qui
participent à la production des flaveurs d'érables diffèrent de celles qui libèrent les
sucres réducteurs dans la sève, alors le ratio optimal entre ces populations peut être
modulé pour la production d'un sirop de qualité optimale.
Période - o% x 50% ♦ 100%
r2 = 0.345, p<0.0001 r2 = 0.683 si 5 éch. aberrants exclus
4.5 5 5.5 6 6.5 7
Comptes bactériens (UFC/mL)
Figure 5.4 Modélisation de l'effet quantitatif de la contamination bactérienne de la sève d'érable sur l'analyse sensorielle du sirop de laboratoire
Bien que l'effet « dose-réponse » soit évident, comme dans d'autres études, on remarque
des échantillons pour lesquels la composante quantitative de la contamination
bactérienne ne suffit pas à expliquer les résultats de l'analyse sensorielle (Dumont 1999;
Lagacé et al. 2002). Puisqu'ici les sirops ont été fabriqués selon une méthode
standardisée, il est exclu que le procédé de transformation en soit la cause. L'aspect
137
qualitatif, c'est-à-dire la composition des communautés microbiennes de la sève est donc
un effet à considérer.
Des échantillons ayant des microbiotes différents ont-ils une relation de type « dose-
réponse » quantitative différente? La réponse réside dans l'intégration des résultats
moléculaires, physicochimiques et microbiologiques. La Figure 5.5 montre
qu'effectivement, certains groupes d'échantillons aux microbiotes génétiquement
similaires (formés à partir d'une analyse de groupement par la méthode de Ward sur les
profils PCR communautaires) ont un effet quantitatif significativement différent sur la
quantité des sucres réducteurs de la sève et du sirop d'érable. À noter que le mécanisme
de libération des sucres réducteurs dans la sève par les microorganismes est connu
depuis longtemps et suggère le sens de cette relation cause à effet, mais il n'est pas exclu
que ces variables soient interdépendantes.
Quels microorganismes caractérisent ces groupes? Une ISA à partir des profils MARISA
(Tableau 5.4) teste si les fragments sont statistiquement plus abondants et fréquents pour
chaque groupe. Une espèce indicatrice parfaite pour un groupe donné serait présente
uniquement dans les profils de ce groupe et aurait une valeur indicatrice égale à 100. Les
résultats révèlent que Candida sake et R. aquatilis sont des espèces indicatrices du
groupe 1. Cryptococcus victoriae est indicatrice du groupe 2 alors que P. syringae et une
espèce apparentée à Williopsis sont indicatrices du groupe 3. Aucune espèce indicatrice
n'a été significativement révélée par l'analyse pour le groupe 4. En fait, en comparant
l'abondance relative des espèces mesurées par la qPCR il s'avère que ce groupe
comporte une abondance relative supérieure de bactéries du groupe P. fluorescens (p =
0.09). Ce résultat marginalement significatif est attribuable au nombre réduit
d'échantillons analysés en qPCR (N = 28). Au minimum, 47 échantillons auraient été
nécessaires pour obtenir une différence significative (p - 0.05). Les bactéries du groupe
P. fluorescens regroupent plusieurs espèces phylogénétiquement proches, mais qui
correspondent à des fragments MARISA distincts. Ces fragments pris séparément n'ont
pas donné de résultat significatif en ISA, par conséquent P. fluorescens ne figure pas au
tableau 5.4.
138
Sèves Sirops de laboratoire Groupe
Comptes bactériens UFC/mL Comptes bactériens UFC/mL
Figure 5.5 Courbes polynomials (p <0.01) correspondant à l'effet des comptes bactériens de chacun des groupes de profils PCR communautaires sur les sucres réducteurs de la sève et du sirop de laboratoire.
139
Tableau 5.4 Analyse des espèces indicatrices
Fragment Identification Groupe Valeur P (MARISA) présomptive (profil PCR
communautaire) indicatrice
F55 Candida sake 1 60.6 0.0004
B237 Rahnella aquatilis 1 59.2 0.0004
F73 Cryptococcus victoriae 2 40.1 0.0218
B222 P. syringae 3 82.6 0.0002
F90 Williopsis sp. 3 37.3 0.0188
Seul les meilleurs fragments indicateurs identifiés sont rapportés pour chaque groupe.
Ainsi, à contamination bactérienne égale (mais >106 UFC/mL), un échantillon de sève
dont le microbiote est caractérisé par la présence de C. sake et Rahnella, deux
microorganismes fermentaires, aura une quantité de sucres réducteurs plus élevée qu'un
échantillon dont le microbiote est caractérisé par une proportion plus élevée de P.
fluorescens. Ces résultats montrent donc que des microbiotes composés d'un assemblage
de populations différentes ont un comportement différent à partir d'une quantité critique,
soit environ IO6 UFC/mL. Cette quantité critique coïncide étrangement avec la quantité
optimale de contamination bactérienne observée à la Figure 5.4. Pour les études
ultérieures portant sur l'effet de différentes populations sur la sève, il serait avisé
d'exclure les sèves qui n'ont pas atteint ce seuil de contamination.
Outre cet impact différentiel modélisé pour des groupes de communautés microbiennes
génétiquement similaires, les relations entre l'abondance relative de populations
spécifiques et les propriétés de la sève et des sirops ont été investigués. Des liens avec la
composition de la sève impliquant C. sake et J. lividum ont été mis en évidence pour les
échantillons récoltés en début de saison, Williopsis sp., Leuconostoc mesenteroides,
Mrakia sp., Rhodococcus spp. et Pseudomonas tolaasii en milieu de saison ainsi que G.
pullulans en fin de saison. De plus, il a été mis en évidence par la MFA pour deux
échantillonnages indépendants que P. fluorescens et Mrakia sont corrélés aux attributs
de vanille et d'érable du sirop. Une analyse complémentaire montre que la corrélation
entre P. fluorescens et la saveur d'érable n'est pas significative pour les sirops de
140
laboratoire, alors qu'elle est significative pour les sirops des producteurs (Tableau 5.5).
Cette différence suggère que l'impact de P. fluorescens sur la saveur d'érable est lié au
procédé de transformation, plus précisément aux températures de conservation et de
transformation de la sève. En effet, les sèves transformées en laboratoire ont d'abord été
congelées, puis ont été bouillies en « batch » tandis que les sèves transformées par les
producteurs ont été directement transformées en semi-continu.
Tableau 5.5 Correlation entre l'abondance relative de P. fluorescens et Mrakia et les attributs sensoriels du sirop d'érable
Groupe taxonomique Variable Sirop de laboratoire
Spearman p Prob >|p|
Sirop des producteurs
Spearman p Prob >|p|
Groupe P. fluorescens
Mrakia spp.
Analyse sensorielle 0.4707 0.0420 0.4567 0.0493
Odeur de vanille 0.7270 0.0004 0.1923 0.4303
Saveur de vanille 0.5031 0.0281 0.2761 0.2525
Odeur d'érable 0.3945 0.0946 0.3778 0.1108
Saveur d'érable 0.3752 0.1135 0.5984 0.0068
Analyse sensorielle 0.3691 0.1199 0.1661 0.4968
Odeur de vanille 0.5415 0.0166 0.2561 0.2899
Saveur de vanille 0.3446 0.1486 0.1784 0.4648
Odeur d'érable 0.2034 0.4035 0.1064 0.6646
Saveur d'érable 0.3972 0.0922 0.4007 0.0891
Additionnellement, l'abondance relative de P. fluorescens est corrélée négativement à la
contamination bactérienne totale. Une hypothèse pour expliquer le mécanisme à
l'origine de cette observation est que P. fluorescens en occupant l'espace à priori, réduit
l'attachement des autres microorganismes aux tubulures. Il contribuerait ainsi à
maintenir une population totale plus faible et à préserver la qualité de la sève d'érable.
5.4 Limites de l'étude Compte tenu que les microorganismes abritent le même espace, y forment des biofilms
et partagent les ressources, compte tenu de la communication inter-espèce, des stratégies
de compétition, etc., il est impossible d'ignorer la codépendance de la réponse de ces
141
variables biologiques. Les analyses multivariées sont donc incontournables pour
analyser les associations complexes qui unissent les populations microbiennes, mais
elles ne permettent aucune inference par rapport à la causalité des relations observées.
Bien que certaines analyses d'ordination contrainte comme la « redundancy analysis »
(RDA) puissent établir des corrélations entre des variables réponses et des variables
explicatrices (Ramette 2007), l'interdépendance entre le microbiote et la composition de
la sève exclut ce type d'analyses. En fait, seule une expérience avec des paramètres
contrôlés permettrait réellement de démontrer l'effet d'une population en particulier.
Malheureusement plusieurs considérations pratiques limitent les initiatives de recherche
expérimentale; la sève d'érable n'est disponible que quelques semaines par année, un
effet significatif ne sera pas nécessairement mesurable directement dans la sève et la
production de sirop demande de grands volumes de sève.
5.5 Perspectives
5.5.1 La gestion du système de collecte de la sève d'érable Au fil du temps, de nombreuses mesures visant à contrer l'activité microbienne dans la
sève d'érable ont été tentées. À l'époque de la collecte par chaudières, des couvercles
étaient utilisés pour empêcher les débris de tomber dans la sève et d'introduire ainsi des
microorganismes. Plus tard, des pastilles de paraformaldehyde ont été utilisées pour
aseptiser les entailles. Cette mesure étant devenue illégale, les producteurs se sont
tournés vers d'autres moyens, comme la stérilisation de la sève par les rayons
ultraviolets, l'assainissement des équipements et la filtration de la sève (Chapeskie
2005).
À la lumière des nouvelles informations sur la composition du microbiote acéricole,
certains éléments de gestion du système de collecte peuvent être envisagés (Figure
5.1C). Par exemple, l'utilisation d'équipements aseptisés pourrait être combinée au port
de gants pour l'entaillage dans le but de réduire la contamination initiale. Encore, le
contrôle des conditions d'entreposage, comme le refroidissement des cuves de collecte
et l'aération de la sève pourraient limiter la croissance des microorganismes fermentaires
comme les levures qui peuvent altérer la sève entreposée (Chapeskie 2005). La filtration
142
sélective de la sève d'érable pourrait également représenter un moyen de contrôle des
levures qui sont plus volumineuses que les bactéries. Puisque trois des membres stables
du microbiote acéricole sont des levures, l'impact d'une telle pratique sur les flaveurs du
sirop devrait être évalué. À ce jour, aucune étude n'a évalué l'effet de cette pratique
pourtant déjà largement répandue en Ontario (Chapeskie 2005).
5.5.2 La modulation du microbiote La modulation du microbiote acéricole pour contrôler la qualité microbiologique de la
sève est une perspective qui a motivé le développement de ce projet, mais est-elle
possible? Compte tenu des multiples sources de contamination environnementales
potentielles et de l'influence du climat, peut-on espérer moduler de manière stable la
communauté microbienne qui colonise tout le système de collecte de la sève d'érable? Il
faut l'espérer, et surtout le valider. Les objectifs futurs utilisant la modulation du
microbiote sont divers; limiter la contamination totale et ainsi réduire la teneur en sucres
réducteurs de la sève; optimiser les propriétés organoleptiques du sirop d'érable;
augmenter naturellement le contenu en molécules à valeur ajoutée du sirop d'érable.
La présence récurrente dans la sève de P. fluorescens et R. aquatilis évoque une
possibilité de biocontrôle, car ceux-ci sont déjà reconnus en tant qu'agent de biocontrôle
dans d'autres contextes (Pujol et al. 2005; Calvo et al. 2007). Puisque le groupe P.
fluorescens semble avoir un impact supérieur sur les propriétés désirables du sirop
d'érable aux sous-groupes ciblés au chapitre 4, il est probable que la fonction impliquée
soit commune à plusieurs souches ou espèces. Ainsi, une étude ciblant spécifiquement
les populations du groupe P. fluorescens pourrait permettre de déceler la présence d'une
entité plus fortement corrélée que la moyenne. Une méthode de type T-RFLP combinée
à des amorces spécifiques au groupe P. fluorescens, telles que celles développées au
chapitre précédent, pourrait être envisagée. Une telle étude devrait être accompagnée
d'analyses plus poussées des profils phénoliques et autres composés potentiellement
responsables des flaveurs (Bail 2007). Au stade actuel des connaissances, une étude
similaire sur Mrakia serait plus difficile à mettre en œuvre étant donné le peu
d'information physiologique et génétique disponible à son sujet.
143
Pour valider les corrélations, des études expérimentales seront nécessaires. Les
paramètres de laboratoire ne peuvent reproduire les conditions environnementales et la
complexité de l'habitat que constitue le système de collecte. Une inoculation des
tubulures est envisageable, mais nécessiterait beaucoup de moyens pour ne tester que
peu de souches. Une façon ingénieuse de contourner ce problème, serait d'adapter le
concept de microcosme in situ utilisé en écologie environnementale (Bombach et al.
2010). Ce type d'expérience figure parmi les seuls à obtenir une reproductibilité et un
contrôle en écologie microbienne (McArthur 2006). Par exemple, de petites matrices
comme des billes poreuses, pré-colonisées par des souches de P. fluorescens, pourraient
être introduites dans un réservoir ou une chaudière de collecte de la sève. Un contrôle
non-inoculé permettrait d'effectuer des statistiques inférentielles afin de déterminer
quels aspects de la communauté microbienne autochtone sont influencés par le
traitement. Une autre approche serait de sélectionner suffisamment d'échantillons de
sève ayant produit des sirops dont des propriétés ont été mesurées à priori, appartenant à
chaque classe de qualité. Les corrélations observées entre les microorganismes et les
propriétés de la sève et du sirop au cours de cette thèse pourraient ainsi être corroborés
par tests de statistiques inférentielles sur l'abondance relative des microorganismes
mesurée par la qPCR. De plus, un effort de clonage et d'isolement devrait être consacré
à l'identification des amplicons MARISA inconnus, soit prédominants ou corrélés aux
propriétés de la sève, afin de cibler également ces microorganismes.
5.5.3 La typicité en gage de qualité Une perspective qui découle des résultats présentés, mais qui n'implique pas la
modulation du microbiote concerne la classification du sirop d'érable. De prime à bord,
l'optimisation de la qualité du sirop d'érable semble être un objectif plutôt simpliste,
compte tenu du système de classification en vigueur. Or, c'est en observant la roue des
flaveurs que toute la complexité des flaveurs de l'érable est révélée. En réalité,
seulement quelques catégories de flaveurs principales sont assez fréquemment
rencontrées pour être étudiées quantitativement. De plus, l'intensité de chacune des
flaveurs dominantes est présente sous forme de gradient.
144
Puisque la fabrication du sirop d'érable comporte plusieurs éléments similaires à la
fabrication du vin, il serait peut-être adéquat d'adopter un système de classification du
sirop fondé sur la typicité du produit, plutôt que sur une notion arbitraire comme la
couleur. L'analyse spectroscopique de sèves et de sirops a montré que le site de
production est le facteur principalement lié à la typicité (Clément et al. 2010). La
composition globale du microbiote acéricole est également spécifique au site de
production, particulièrement les populations fongiques. De plus, la stabilité des
communautés microbiennes dans le temps pourrait contribuer au maintien de la typicité.
Un système de classification misant sur la typicité des produits comme les appellations
d'origine contrôlée pourrait apporter une valeur ajoutée aux produits de l'érable
québécois. Les résultats présentés ici ne couvrent que les principales régions
productrices de sirop d'érable du Québec. Une étude plus élargie apporterait sans aucun
doute davantage de connaissances et permettrait d'établir des caractéristiques propres
aux sirops du Québec dont le climat est, d'un point de vue microbiologique,
substantiellement différent de celui des autres régions de production de l'érable, soit
l'Ontario, le Nouveau-Brunswick et des États-Unis.
5.6 Conclusion générale Les travaux ont permis d'identifier les principaux contaminants bactériens et fongiques
de la sève d'érable et d'obtenir certains isolats bactériens représentatifs. La variation de
la composition et de la structure du microbiote en cours de saison et ce à l'échelle
provinciale a été caractérisée. Les travaux ont également contribué au développement de
nouvelles méthodes pour l'étude des communautés microbiennes. Notamment le
profilage PCR communautaire reflète la variation génomique de populations complexes.
Sa simplicité et rapidité d'exécution en ont fait un outil idéal pour cette étude à large
spectre et pour sélectionner les échantillons représentatifs pour les 13 banques de clones
d'ADNr 16S séquencées. De plus, une nouvelle méthode multiplexe, la MARISA a été
développée et des essais qPCR spécifiques pour quantifier les contaminants
prédominants de la sève d'érable ont été mis au point. Finalement, l'utilisation
d'analyses multivariées a permis de mettre en évidence les tendances et les liens entre
les populations microbiennes et les caractéristiques de la sève et du sirop d'érable.
145
Tous les résultats obtenus convergent pour supporter l'hypothèse de départ. D'une part il
y a des populations microbiennes stables dans la sève d'érable (P. fluorescens, Rahnella,
Mrakia, Mrakiella et G. pullulans) et, d'autre part, il y a une corrélation entre
l'abondance relative des populations de P. fluorescens et Mrakia et les attributs de
vanille et d'érable du sirop. De plus, des contaminants occasionnels tels que L.
mesenteroides et Janthinobacterium sont liés à des propriétés physicochimiques de la
sève à différents moments de la période de récolte et contribuent ainsi probablement à la
typicité du produit. Ces conclusions ne sont bien sûr limitées qu'aux échantillons de
l'étude de par la nature descriptive de l'approche. Pour préciser ces conclusions, en plus
des méthodes moléculaires ciblées comme la T-RFLP spécifique, les acides aminés et
les composés phénoliques nouvellement identifiés dans la sève et le sirop (Legault et al.
2010; Li et Seeram 2010; 201 la; 201 lb) devraient être inclus dans les analyses futures.
La stratégie de microcosme in situ mentionnée précédemment, les nouveaux outils
d'analyse de la sève comme les méthodes spectrométriques et le développement récent
d'un évaporateur modèle pour la fabrication de sirop à l'échelle pilote représentent des
perspectives de recherche intéressantes.
Références Abdi, H. et Valentin, D. (2007) Multiple factor analysis. In Encyclopedia of
measurement and statistics ed. Salkind, N. p. 14. Thousand Oaks (CA): Sage. Abou-Zaid, M.M., Nozzolillo, C, Tonon, A., Coppens, M. et Lombardo, D.A. (2008)
High-performance liquid chromatography characterization and identification of antioxidant polyphenols in maple syrup. Pharmaceutical Biology 46, 117-125.
Allard, G.B. (1998) Petite entaille, petite blessure et rendement supérieur? ... Forêts de chez nous, 24-29.
Allard, G.B. (1999) L'entaillage des érables. St-Hyacinthe: Centre ACER inc. Arteau, M., Labrie, S. et Roy, D. (2010) Terminal-restriction fragment length
polymorphism and automated ribosomal intergenic spacer analysis profiling of fungal communities in camembert cheese. International Dairy Journal 20, 545-554.
Auger, D., Blanchet, D., Bastien, L., Dumont, M.-C, Gendron, N. et Théroux, R. (2004) Exploitation acéricole des érablières du domaine de l'état. Guide des bonnes pratiques environnementales, 50.
Bail, D.W. (2007) The chemical composition of maple syrup. Journal of Chemical Education 84, 1647-1650.
Beaunoyer, M. (2005) Erablière aux mille érables - une production à valeur ajoutée. Forêts de chez nous, 12-15.
Belford, A.L., Lindsay, R.C. et Ridley, S.C. (1991) Contributions of selected flavor compounds to the sensory properties of maple syrup. Journal of sensory studies 6,101-118.
Bhadra, B., Rao, R.S., Singh, P.K., Sarkar, P.K. et Shivaji, S. (2008) Yeasts and yeastlike fungi associated with tree bark: Diversity and identification of yeasts producing extracellular endoxylanases. Current Microbiology 56, 489-494.
Blackwood, C.B., Marsh, T., Kim, S.H. et Paul, E.A. (2003) Terminal restriction fragment length polymorphism data analysis for quantitative comparison of microbial communities. Applied Environmental Microbiology 69, 926-932.
Blanchette, R.A., Held, B.W., Arenz, B.E., Jurgens, J.A., Baltes, N.J., Duncan, S.M. et Farrell, R.L. (2010) An antarctic hot spot for fungi at shackleton's historic hut on cape royds. Microbial Ecology 60, 29-38.
Bombach, P., Hubschmann, T., Fetzer, I., Kleinsteuber, S., Geyer, R., Harms, H. et Muller, S. (2010) Resolution of natural microbial community dynamics by community fingerprinting, flow cytometry, and trend interpretation analysis. Advances in Biochemical Engineering / Biotechnology 124, 151-181.
Branda, E., Turchetti, B., Diolaiuti, G., Pecci, M., Smiraglia, C. et Buzzini, P. (2010) Yeast and yeast-like diversity in the southernmost glacier of Europe (Calderone Glacier, Apennines, Italy). F EMS Microbiology Ecology 72, 354-369.
Calvo, J., Calvente, V., de Orellano, M.E., Benuzzi, D. et Sanz de Tosetti, M.I. (2007) Biological control of postharvest spoilage caused by Pénicillium expansum and Botrytis cinerea in apple by using the bacterium Rahnella aquatilis. International Journal of Food Microbiology 113, 251-257.
Canada (2004) Roue des flaveurs de l'érable: Agriculture et Agroalimentaire Canada et Centre ACER inc. www.agr.gc.ca/roue_erable
148
Canada (2006) Règlements sur les produits de l'érable: Ministère de la justice du Canada.
Cardinale, M., Brusetti, L., Quatrini, P., Borin, S., Puglia, A.M., Rizzi, A., Zanardini, E., Sorlini, C , Corselli, C. et Daffonchio, D. (2004) Comparison of different primer sets for use in automated ribosomal intergenic spacer analysis of complex bacterial communities. Applied and Environmental Microbiology 70, 6147-6156.
Casamayor, E.O., Massana, R., Benlloch, S., Ovreâs, L., Diez, B., Goddard, V.J., Gasol, J.M., Joint, L, Rodriguez-Valera, F. et Pedrôs-Aliô, C. (2002) Changes in archaeal, bacterial and eukaryal assemblages along a salinity gradient by comparison of genetic fingerprinting methods in a multipond solar saltern. Environmental Microbiology 4, 338-348.
Chapeskie, D. (2005) La filtration de l'eau d'érable ed. l'Ontario, ministère de l'Agriculture et de l'Alimentation de l'Ontario: imprimeur de la Reine pour l'Ontario.
Cirelli, D., Jagels, R. et Tyree, M.T. (2008) Toward an improved model of maple sap exudation: The location and role of osmotic barriers in sugar maple, butternut and white birch. Tree Physiology 28, 1145-1155.
Clément, A., Lagacé, L. et Panneton, B. (2010) Assessment of maple syrup physico-chemistry and typicity by means of fluorescence spectroscopy. Journal of Food Engineering 97', 17-23.
Corley-Smith, G.E., Lim, C.J., Kalmar, G.B. et Brandhorst, B.P. (1997) Efficient detection of DNA polymorphisms by fluorescent RAPD analysis. Biotechniques 22, 690-692, 694, 696 passim.
Costerton, J.W., Lewandowski, Z., Caldwell, D.E., Korber, D.R. et Lappin-Scott, H.M. (1995) Microbial biofilms. Annual Review of Microbiology 49, 711-745.
Crosby, L.D. et Criddle, CS. (2003) Understanding bias in microbial community analysis techniques due to rrn operon copy number heterogeneity. Biotechniques 34, 790-794, 796, 798.
Culman, S.W., Gauch, H.G., Blackwood, C.B. et Thies, J.E. (2008) Analysis of T-RFLP data using analysis of variance and ordination methods: A comparative study. Journal of Microbiological Methods 75, 55-63.
Danovaro, R., Luna, G.M., DeH'anno, A. et Pietrangeli, B. (2006) Comparison of two fingerprinting techniques, terminal restriction fragment length polymorphism and automated ribosomal intergenic spacer analysis, for determination of bacterial diversity in aquatic environments. Applied and Environmental Microbiology 72, 5982-5989.
Davey, M.E. et O'Toole G, A. (2000) Microbial biofilms: From ecology to molecular genetics. Microbiology and Molecular Biology Reviews 64, 847-867.
de Tayrac, M., Le, S., Aubry, M., Mosser, J. et Husson, F. (2009) Simultaneous analysis of distinct omics data sets with integration of biological knowledge: Multiple factor analysis approach. BMC Genomics 10, 32.
Deglise, F. (2005) Bouffe et malbouffe: Un rapport salé pour le sirop d'érable. Dans Le Devoir. Québec.
Demba Diallo, M., Willems, A., Vloemans, N., Cousin, S., Vandekerckhove, T.T., de Lajudie, P., Neyra, M., Vyverman, W., Gillis, M. et Van der Gucht, K. (2004) Polymerase chain reaction denaturing gradient gel electrophoresis analysis of the
149
N2-fixing bacterial diversity in soil under Acacia tortilis ssp. Raddiana and Balanites aegyptiaca in the dryland part of Senegal. Environ Microbiol 6, 400-415.
DeSantis, T.Z., Jr., Hugenholtz, P., Keller, K., Brodie, E.L., Larsen, N., Piceno, Y.M., Phan, R. et Andersen, G.L. (2006) Nast: A multiple sequence alignment server for comparative analysis of 16S rRNA genes. Nucleic Acids Research 34, W394-399.
Deslauriers, I. (2000) Recovery, separation and characterization of phenolic compounds and flavonoids from maple products. Mémoire de maitrise, Department of food science and agricultural chemistry. Montreal: McGill University.
Di Marco, S., Calzarano, F., Osti, F. et Mazzullo, A. (2004) Pathogenicity of fungi associated with a decay of kiwifruit. Australasian Plant Pathology 33, 337-342.
Dimitroglou, A., Merrifield, D.L., Moate, R., Davies, S.J., Spring, P., Sweetman, J. et Bradley, G. (2009) Dietary mannan oligosaccharide supplementation modulates intestinal microbial ecology and improves gut morphology of rainbow trout, Oncorhynchus mykiss (walbaum). Journal of Animal Science 87, 3226-3234.
Dufrêne, M. et Legendre, P. (1997) Species assemblages and indicator species: The need for a flexible asymmetrical approach. Ecological Monographs 67, 345-366.
Dumont, J. (1994a) Caractéristiques chimiques et nutritives du sirop d'érable. Les acides aminés de la sève et du sirop d'érable. St-Hyacinthe, QC: Centre ACER inc.
Dumont, J. (1994b) L'eau d'érable. St-Hyacinthe, QC: Centre ACER inc. Dumont, J. (1999) Mise au point d'un outil de mesure rapide permettant d'évaluer la
tendance d'une sève à donner un sirop ayant un défaut de goût majeur No. 322-FIN-0299. St-hyacinthe, QC: Centre ACER Inc.
Dumont, J. (2000) Validation d'une méthode d'évaluation de la qualité de l'eau d'érable. St-Hyacinthe, QC: Centre ACER inc.
Dumont, J., Allard, G. et Riendeau, L. (1993a) Étude des facteurs les plus susceptibles de contrôler le développement de la qualité (saveur et couleur) du sirop d'érable. M.A.P.A.Q. et Agriculture Canada, A. p.37: Entente auxiliaire Canada-Québec sur le développement agro-alimentaire.
Dumont, J., Saucier, L., Allard, G.B. et Aurouze, B. (1993b) Microbiological, physicochemical and sensory quality of maple syrup aseptically packaged in paper-based laminate. International Journal of Food Science and Technology, 28,83-93.
Dunbar, J., Barns, S.M., Ticknor, L.O. et Kuske, CR. (2002) Empirical and theoretical bacterial diversity in four Arizona soils. Applied and Environmental Microbiology 68, 3035-3045.
EcoRessources consultants (2010) Les retombées économiques de l'industrie acéricole au Québec et au Canada: Fédération des producteurs acéricoles du Québec.
Edson, H., Jones, C. et Carpenter, C. (1913) Microorganisms of maple sap. Vermont Agricultural Experiment Station Bulletin, 167.
Edson, H.A. (1910) The influence of micro-organisms upon the quality of maple syrup. Journal of Industrial and Engineering Chemistry-Us 2, 325-327.
150
El-Hendawy, H.H., Osman, M.E. et Sorour, N.M. (2003) Characterization of two antagonistic strains of Rahnella aquatilis isolated from soil in Egypt. Folia Microbiologica 48, 799-804.
Fabian, F.W. et Buskirk, H.H. (1935) Aerobacter aerogenes as a cause of ropiness in maple sirup. Industrial and Engineering Chemistry 27, 349-350.
Falk, M.W. et Wuertz, S. (2010) Effects of the toxin 3-chloroaniline at low concentrations on microbial community dynamics and membrane bioreactor performance. Water Research 44, 5109-5115.
Fazzalari, F.A. (1978) Compilation of odor and taste threshold values data. Philadelphia, PA: American Society For Test Mate.
Felske, A. et Osborn, A. eds. (2005) DNA fingerprinting of microbial communities. New York, NY: Taylor & Francis Group.
Filipic, V.J., Underwood, J.C. et Willits, CO. (1965) Identification of methylcyclopentenolone and other compounds in maple sirup flavor extract. Journal of Food Science 30, 1008-1015.
Filipic, V.J. et Underwood, J.C. (1964) Some aromatic compounds in sap composition of maple sap + sirup. Journal of Food Science 29, 464-468.
Filipic, V.J., Underwood, J.C. et Dooley, CJ. (1969) Trace component of the flavor fraction of maple syrup. Journal of Food Science 34, 105.
Filteau, M., Lagacé, L., LaPointe, G. et Roy, D. (2010) Seasonal and regional diversity of maple sap microbiota revealed using community PCR fingerprinting and 16S rRNA gene clone libraries. Systematic and Applied Microbiology 33, 165-173.
Filteau, M., Lagacé, L., LaPointe, G. et Roy, D. (2011) Correlation of maple sap composition with bacterial and fungal communities determined by multiplex automated ribosomal intergenic spacer analysis (MARISA). Food Microbiology 28, 980-989.
Fisher, M. M. et Triplett, E.W. (1999) Automated approach for ribosomal intergenic spacer analysis of microbial diversity and its application to freshwater bacterial communities. Applied and Environmental Microbiology 65, 4630-4636.
FPAQ (2008) Dossier économique 2008: Fédération des producteurs acéricoles du Québec.
FPAQ (2010) Dossier économique 2010: Fédération des producteurs acéricoles du Québec.
Frank, H.A. et Willits, CO. (1961) Bacterial growth in maple sap collected with plastic tubing. Food technology 15, 374-378.
Gasson, M.J., Kitamura, Y., McLauchlan, W.R., Narbad, A., Parr, A.J., Parsons, EX., Payne, J., Rhodes, M.J. et Walton, N.J. (1998) Metabolism of ferulic acid to vanillin. A bacterial gene of the enoyl-SCoA hydratase/isomerase superfamily encodes an enzyme for the hydration and cleavage of a hydroxycinnamic acid SCoA thioester. Journal of Biological Chemistry 273, 4163-4170.
Gevers, D., Cohan, F.M., Lawrence, J.G., Spratt, B.G., Coenye, T., Feil, E.J., Stackebrandt, E., Van de Peer, Y., Vandamme, P., Thompson, F.L. et Swings, J. (2005) Opinion: Re-evaluating prokaryotic species. Nature Reviews Microbiology 3, 733-739.
151
Gillings, M. et Holley, M. (1997) Amplification of anonymous DNA fragments using pairs of long primers generates reproducible DNA fingerprints that are sensitive to genetic variation. Electrophoresis 18, 1512-1518.
Golubev, W.I., Pfeiffer, I. et Golubeva, E. (2002) Mycocin production in Trichosporon pullulans populations colonizing tree exudates in the spring. FEMS Microbiology Ecology 40, 151-157.
Grice, E.A., Kong, H.H., Renaud, G., Young, A.C, Bouffard, G.G., Blakesley, R.W., Wolfsberg, T.G., Turner, M.L. et Segre, J.A. (2008) A diversity profile of the human skin microbiota. Genome Research 18, 1043-1050.
Hall, T.A. (1999) Bioedit: A user-friendly biological sequence alignment editor and analysis program for windows 95/98/nt. Nucleic Acids Symposium Ser. 41 95-98.
Haller, L., Tonolla, M., Zopfi, J., Peduzzi, R., Wildi, W. et Pote, J. (2011) Composition of bacterial and archaeal communities in freshwater sediments with different contamination levels (Lake Geneva, Switzerland). Water Research 45, 1213-1228.
Han, X.Y., Sun, D.Q., Xiang, L., Huo, G.C et Jiang, Y.J. (2007) Gene regulation to lactic acid bacteria for increasing production of flavor metabolite. Wei Sheng Wu Xue Bao 47, 1105-1109.
Hess, T.F., Schmidt, S.K., Silverstein, J. et Howe, B. (1990) Supplemental substrate enhancement of 2,4-dinitrophenol mineralization by a bacterial consortium. Applied and Environmental Microbiology 56, 1551-1558.
Hierro, N., Esteve-Zarzoso, B., Mas, A. et Guillamôn, J.M. (2007) Monitoring of Saccharomyces and Hanseniaspora populations during alcoholic fermentation by real-time quantitative PCR. FEMS Yeast Research 7, 1340-1349.
Hilario, E., Buckley, T.R. et Young, J.M. (2004) Improved resolution on the phylogenetic relationships among Pseudomonas by the combined analysis of atp D, car A, rec A and 16A rDNA. Antonie Van Leeuwenhoek 86, 51-64.
Holt, J.G., Krieg, N.R., Sneath, P.H.A., Staley, J.T. et Williams, S.T. (1994) Bergey's manual of determinative bacteriology. Baltimore, MA: Williams & Wilkins.
Huber, T., Faulkner, G. et Hugenholtz, P. (2004) Bellerophon: A program to detect chimeric sequences in multiple sequence alignments. Bioinformatics 20, 2317-2319.
Hurst, J.L., Pugh, G.J.F. et Walton, W.H. (1984) The effect of temperature on the growth of Candida sake isolated from the leaves of a subantarctic grass. Microbial Ecolology 10, 89-93.
Husson, F. et Josse, J. (2010) Multivariate data analysis; special focus on clustering and multiway methods. Dans useR! the R user conference. Gaithersburg, MA: National Institute of Standards and Technology (NIST).
Husson, F., Josse, J., Le, S. et Mazet, J. (2009) FactoMineR: Factor analysis and data mining with R. In R package: Available from http://CRAN.R-project.org/package=FactoMineR.
Ikeda, S., Fuji, S.I., Sato, T., Furuya, H., Naito, H., Ytow, N., Ezura, H., Minamisawa, K. et Fujimura, T. (2007) Microbial diversity in milled rice as revealed by ribosomal intergenic spacer analysis. Microbes and Environments 22, 165-174.
Jassey, V.E., Gilbert, D., Binet, P., Toussaint, M.L. et Chiapusio, G. (2011) Effect of a temperature gradient on Sphagnum fallax and its associated living microbial
152
communities: A study under controlled conditions. Canadian Journal of Microbiology 57, 226-235.
Jay, J.M., Loessner, M.J. et Golden, D.A. (2005) Modern food microbiology. New-York, NY: Springer.
Jensen, N., Varelis, P. et Whitfield, F.B. (2001) Formation of guaiacol in chocolate milk by the psychrotrophic bacterium Rahnella aquatilis. Letters in Applied Microbiology 33, 339-343.
Juste, A., Thomma, B.P.H.J. et Lievens, B. (2008) Recent advances in molecular techniques to study microbial communities in food-associated matrices and processes. Food Microbiology 25, 745-761.
Kabir, S., Rajendran, N., Amemiya, T. et Itoh, K. (2003) Quantitative measurement of fungal DNA extracted by three different methods using real-time polymerase chain reaction. Journal of Bioscience and Bioengineering 96, 337-343.
Kanagawa, T. (2003) Bias and artifacts in multitemplate polymerase chain reactions (PCR). Journal of Bioscience and Bioengineering 96, 317-323.
Kang, S.A., Lee, J.C, Park, Y.M., Lee, C, Kim, S.H., Chang, B.L, Kim, C.H., Seo, J.W., Rhee, S.K., Jung, S.J., Kim, S.M., Park, S.K. et Jang, KH. (2004) Secretory production oi Rahnella aquatilis ATCC 33071 levansucrase expressed in Escherichia coli. Journal of Microbiology and Biotechnology 14, 1232-1238.
Kermasha, S., Goetghebeur, M. et Dumont, J. (1995) Determination of phenolic compound profiles in maple products by high-performance liquid-chromatography. Journal of Agricultural and Food Chemistry 43, 708-716.
King, W.G. et Morselli, M.F. (1983) Microorganisms on plastic tubing walls. Maple syrup digest 23, 23-28.
King, W.G. et Morselli, M.F. (1985) Bacterial adhesion to plastic tubing walls. Maple syrup digest 25, 28-31.
Kovacs, A., Yacoby, K. et Gophna, U. (2010) A systematic assessment of automated ribosomal intergenic spacer analysis (ARISA) as a tool for estimating bacterial richness. Research in Microbiology 161, 192-197.
Lagacé, L. (1999) Détermination d'une méthodologie de lavage de la tubulure. St-Hyacinthe: Centre ACER inc.
Lagacé, L. (2005) Communication personnelle directe, Québec, QC. Lagacé, L. (2006) Étude de la flore microbienne et de la formation du biofilm dans les
systèmes de récolte de la sève d'érable. Dans Département de pathologie et de microbiologie. 223 p. St-Hyacinthe, QC: Université de Montréal.
Lagacé, L., Boucher, J. et Beaulieu, D. (2011) Évaluation de l'alcool isopropyliquepour l'assainissement du système de collecte de la sève d'érable.St-Hyacinthe, QC: Centre ACER inc.
Lagacé, L., Girouard, C, Dumont, J., Fortin, J. et Roy, D. (2002) Rapid prediction of maple syrup grade and sensory quality by estimation of microbial quality of maple sap using ATP bioluminescence. Journal of Food Science 67, 1851-1854.
Lagacé, L., Jacques, M., Mafu, A.A. et Roy, D. (2006a) Biofilm formation and biocides sensitivity of Pseudomonas marginalis isolated from a maple sap collection system. Journal of Food Protection 69, 2411-2416.
Lagacé, L., Jacques, M., Mafu, A.A. et Roy, D. (2006b) Compositions of maple sap microflora and collection system biofilms evaluated by scanning electron
153
microscopy and denaturing gradient gel electrophoresis. International Journal of Food Microbiology 109, 9-18.
Lagacé, L., Jacques, M., Pitre, M., Mafu, A.A. et Roy, D. (2005) Microbiology of maple sap and biofilm formation in maple sap collection systems. In 3rd International Symposium on Sap Utilization (ISSU). Bifuka, Japan: Hokkaido University Press, Sapporo, Japon.
Lagacé, L., Pitre, M., Jacques, M. et Roy, D. (2004) Identification of the bacterial community of maple sap by using amplified ribosomal DNA (rDNA) restriction analysis and rDNA sequencing. Applied and Environmental Microbiology 70, 2052-2060.
Lamarche, J., Bradley, R.L., Hooper, E., Shipley, B., Simao Beaunoir, A.M. et Beaulieu, C (2007) Forest floor bacterial community composition and catabolic profiles in relation to landscape features in Quebec's southern boreal forest. Microbial Ecology 54, 10-20.
Lamentowicz, M., Lamentowicz, L., van der Knaap, W.O., Gabka, M. et Mitchell, E.A. (2010) Contrasting species-environment relationships in communities of testate amoebae, bryophytes and vascular plants along the fen-bog gradient. Microbial Ecology 59, 499-510.
Latour, X. et Lemanceau, P. (1997) Métabolisme carboné et énergétique des Pseudomonas spp fluorescents saprophytes à oxydase positive. Agronomie 17, 427-443.
Lear, G., Anderson, M.J., Smith, J.P., Boxen, K. et Lewis, G.D. (2008) Spatial and temporal heterogeneity of the bacterial communities in stream epilithic biofilms. FEMS Microbiology Ecology 65, 463-473.
Lee, C , Kim, J., Shin, S.G., O'Flaherty, V. et Hwang, S. (2010) Quantitative and qualitative transitions of methanogen community structure during the batch anaerobic digestion of cheese-processing wastewater. Applied Microbiology and Biotechnology 87, 1963-1973.
Legault, J., Girard-Lalancette, K., Grenon, C , Dussault, C et Pichette, A. (2010) Antioxidant activity, inhibition of nitric oxide overproduction, and in vitro antiproliferative effect of maple sap and syrup from Acer saccharum. Journal of Medicinal Food 13, 460-468.
Legendre, P. et Gallagher, E.D. (2001) Ecologically meaningful transformations for ordination of species data. Oecologia 129, 271-280.
Legendre, P. et Legendre, L. (1998) Numerical ecology. Amsterdam: Elsevier Science BV.
Li, L. et Seeram, N.P. (2010) Maple syrup phytochemicals include lignans, coumarins, a stilbene, and other previously unreported antioxidant phenolic compounds. Journal of Agricultural Food Chemistry 58, 11673-11679.
Li, L. et Seeram, N.P. (2011a) Quebecol, a novel phenolic compound isolated from Canadian maple syrup. Journal of Functional Foods 3, 125-128.
Li, L. et Seeram, N.P. (2011b) Further investigation into maple syrup yields 3 new lignans, a new phenylpropanoid, and 26 other phytochemicals. Journal of Agricultural and Food Chemistry 59, 7708-7716.
Lin, Z., Kong, H., Nei, M. et Ma, H. (2006) Origins and evolution of the recA/rad51 gene family: Evidence for ancient gene duplication and endosymbiotic gene
154
transfer. Proceedings of the National Academy of Sciences of the USA 103, 10328-10333.
Luna, G.M., Dell'Anno, A. et Danovaro, R. (2006) DNA extraction procedure: A critical issue for bacterial diversity assessment in marine sediments. Environmental Microbiology 8, 308-320.
Makino, H., Fujimoto, J. et Watanabe, K. (2010) Development and evaluation of a realtime quantitative PCR assay for detection and enumeration of yeasts of public health interest in dairy products. International Journal of Food Microbiology 140, 76-83.
Manter, D.K. et Vivanco, J.M. (2007) Use of the ITS primers, itslf and its4, to characterize fungal abundance and diversity in mixed-template samples by qPCR and length heterogeneity analysis. Journal of Microbiological Methods 71, 7-14.
Marsh, T.L. (1999) Terminal restriction fragment length polymorphism (T-RFLP): An emerging method for characterizing diversity among homologous populations of amplification products. Current Opinion in Microbiology 2, 323-327.
McArthur, J.V. (2006) Microbial ecology an evolutionary approach. Burlington, MA: Academic Press, Elsevier.
McCune, B. et Grace, J.B. (2002) Analysis of ecological communities. Gleneden Beach, OR: MJM Software Design.
McCune, B. et Mefford, J. (2006) PC-ORD In Multivariate analysis of ecological data. Gleneden Beach, Oregon: MjM software.
Morselli, M.F. et Feldheim, W. (1988) Maple syrup - a review. Zeitschrift Fur Lebensmittel-Untersuchung Und-Forschung 186, 6-10.
Morselli, M.F., Mollica, Willits, CO. et Hills (1996) Maple chemistry and quality. Dans North american maple syrup producers manual édité par Koelling, M.R. et Heiligmann, R.B. pp. 162-171. Columbus, OH: The Ohio State University.
Morselli, M.F. et Whalen, M.L. (1979) Temperature effect on sap storage. Maple syrup digest 19, 22-23.
Morselli, M.F. et Whalen, M.L. (1991) Aseptic tapping of sugar maple (Acer saccharum) results in light color grade syrup. Revue Canadienne De Recherche Forestière 21, 999-1005.
Morselli, M.F., Whalen, M.L. et Baggett, K.L. (1985) Characteristics of maple syrup processed from bleach-treated sap. Journal of Food Protection 48, 204-206.
Mou, X., Moran, M.A., Stepanauskas, R., Gonzalez, J.M. et Hodson, R.E. (2005) Flow-cytometric cell sorting and subsequent molecular analyses for culture-independent identification of bacterioplankton involved in dimethylsulfoniopropionate transformations. Applied and Environmental Microbiology 71, 1405-1416.
Muyzer, G., de Waal, E.C et Uitterlinden, A.G. (1993) Profiling of complex microbial populations by denaturing gradient gel electrophoresis analysis of polymerase chain reaction-amplified genes coding for 16S rRNA. Applied and Environmental Microbiology 59, 695-700.
Naghski, J., Reed, L.L. et Willits, CO. (1957a) Maple sirup X. Effect of controled fermentation of maple sap on color and flavor of maple sirup. Food Research 22, 176-181.
155
Naghski, J., Reed, L.L. et Willits, CO. (1957b) Maple sirup X. Effect of controlled fermentation of maple sap on the color and flavor of maple sirup. Food Research 22, 176-181.
Naghski, J. et Willits, CO. (1957) Maple sirup. XL Relationship between the type and origin of reducing sugars in sap and the color and flavor of maple sirup. Food Research 22, 567-571.
Narbad, A. et Gasson, M.J. (1998) Metabolism of ferulic acid via vanillin using a novel CoA-dependent pathway in a newly-isolated strain oi Pseudomonas fluorescens. Microbiology 144 (5), 1397-1405.
Oksanen, J. (2007) Multivariate analysis of ecological communities in R: Vegan tutorial. p.39.
Pages, J. (2005) Collection and analysis of perceived product inter-distances using multiple factor analysis: Application to the study of 10 white wines from the Loire valley. Food Quality and Preference 16, 642-649.
Pages, J., Escofier, B. et Haury, J. (1991) Multiple factor-analysis - a method to analyze several groups of variables measured on the same set of individuals. Applied Multivariate Analysis in SAR and Environmental Studies 2, 33-83.
Pantanella, F., Berlutti, F., Passariello, C , Sarli, S., Morea, C et Schippa, S. (2007) Violacein and biofilm production in Janthinobacterium lividum. Journal of Applied Microbiology 102, 992-999.
Paulsen, I.T., Press, CM., Ravel, J., Kobayashi, D.Y., Myers, G.S., Mavrodi, D.V., DeBoy, R.T., Seshadri, R., Ren, Q., Madupu, R., Dodson, R.J., Durkin, A.S., Brinkac, L.M., Daugherty, S.C, Sullivan, S.A., Rosovitz, M.J., Gwinn, M.L., Zhou, L., Schneider, D.J., Cartinhour, S.W., Nelson, W.C, Weidman, J., Watkins, K., Tran, K, Khouri, H., Pierson, E.A., Pierson, L.S., 3rd, Thomashow, L.S. et Loper, J.E. (2005) Complete genome sequence of the plant commensal Pseudomonas fluorescens pf-5. Nature Biotechnology 23, 873-878.
Perkins, T.D. et van den Berg, A.K. (2009) Maple syrup production, composition, chemistry, and sensory characteristics. Advances in Food and Nutrition Research 56, 101-143.
Pitkâranta, M., Meklin, T., Hyvarinen, A., Paulin, L., Auvinen, P., Nevalainen, A. et Rintala, H. (2008) Analysis of fungal flora in indoor dust by ribosomal DNA sequence analysis, quantitative PCR, and culture. Applied and Environmental Microbiology 74, 233-244.
Polz, M.F. et Cavanaugh, CM. (1998) Bias in template-to-product ratios in multitemplate PCR. Applied and Environmental Microbiology 64, 3724-3730.
Potter, T.L. et Fagerson, LS. (1992) Phenolic-compounds in maple syrup. Dans Phenolic Compounds in Food and Their Effects on Health I, édité par C Ho, C. Y. Lee et M. Huang, pp. 192-199. Washington, DC: American chemical society.
Pujol, M., Badosa, E., Cabrefiga, J. et Montesinos, E. (2005) Development of a strain-specific quantitative method for monitoring Pseudomonas fluorescens eps62e, a novel biocontrol agent of fire blight. FEMS Microbiology Letters 249, 343-352.
Québec (1984) Le sirop d'érable filant, p.2: Conseil des productions végétales du Québec. Ministère de l'Agriculture Pêcheries et a/imentation du Québec
Rademaker, J.L.W., Henk, J.M. et Vinuesa, P. (2005) Molecular typing of environmental isolates. New-York, NY: Taylor & Francis Group.
156
Ramette, A. (2007) Multivariate analyses in microbial ecology. FEMS Microbiology Ecology 62, 142-160.
Ramette, A. (2009) Quantitative community fingerprinting methods for estimating the abundance of operational taxonomie units in natural microbial communities. Applied and Environmental Microbiology 75, 2495-2505.
Ranjard, L., Poly, F., Lata, J.C, Mougel, C , Thioulouse, J. et Nazaret, S. (2001) Characterization of bacterial and fungal soil communities by automated ribosomal intergenic spacer analysis fingerprints: Biological and methodological variability. Applied and Environmental Microbiology 67, 4479-4487.
Rasolofo, E. (2004) Étude des propriétés physico-chimiques des microorganismes adhères dans les tubulures de collecte de l'eau d'érable et de leurs biosurfactants. In Département des Sciences des Aliments et de Nutrition. 107 p. Ste-Foy, QC: Université Laval.
Rasolofo, E.A., St-Gelais, D., LaPointe, G. et Roy, D. (2010) Molecular analysis of bacterial population structure and dynamics during cold storage of untreated and treated milk. International Journal of Food Microbiology 138, 108-118.
Raspor, P. et Zupan, J. (2006) Yeasts in extreme environments. Dans Biodiversity and ecophysiology of yeasts, p. 371-417. Berlin Heidelberg, Allemangne: Springer.
Rôling, W.F.M. et Head, LM. (2005) Prokaryotic systematics: PCR and sequence analysis of amplified 16S rRNA genes. Dans Molecular microbial ecology édité par Osborn, A.M. et Smith, J.C. p.25-64. New-York, NY: Taylor & Francis Group.
Ruzzi, M., Barghini, P., Montebove, F. et Ponente, A.S. (1997) Effect of the carbon source on the utilization of ferulic, m- and p-coumaric acids by a Pseudomonas fluorescens strain. Annali Di Microbiologia Ed Enzimologia 47, 87-96.
Sabik, H., Martin, N. et Fortin, J. (2010) Identification of potential impact odorants in four typical maple syrups using headspace solid-phase microextraction with gas chromatography-mass spectrometry. Dans Recent advances in food and flavor chemistry, proceedings of the 12e international flavor conference édité par Ho, C et Mussinan, C p.69-77.
Sakallah, S.A., Lanning, R.W. et Cooper, D.L. (1995) DNA fingerprinting of crude bacterial lysates using degenerate RAPD primers. PCR Methods and Applications 4, 265-268.
Schloss, P.D. et Handelsman, J. (2005) Introducing DOTUR, a computer program for defining operational taxonomie units and estimating species richness. Applied and Environmental Microbiology 71, 1501-1506.
Schloss, P.D. et Handelsman, J. (2006) Introducing SONS, a tool for operational taxonomie unit-based comparisons of microbial community memberships and structures. Applied and Environmental Microbiology 72, 6773-6779.
Setubal, J.C, Moreira, L.M. et da Silva, A.C. (2005) Bacterial phytopathogens and genome science. Current Opinion in Microbiology 8, 595-600.
Sheneman, J.M. et Costilow, R.N. (1958) Identification of microorganisms from maple tree tapholes. Food Research 24, 146-151.
Shivaji, S., Ray, M.K., Seshu Kumar, G., Reddy, G.S.N., Saisree, L. et Wynn-Williams, D.D. (1991) Identification oi Janthinobacterium lividum from the soils of the islands of Scotia Ridge and from antarctic peninsula. Polar biology 11, 261-21 \.
157
Silby, M.W., Cerdeno-Târraga, A.M., Vernikos, G.S., Giddens, S.R., Jackson, R.W., Preston, G.M., Zhang, X.X., Moon, CD., Gehrig, S.M., Godfrey, S.A.C., Knight, C.G., Malone, J.G., Robinson, Z., Spiers, A.J., Harris, S., Challis, G.L., Yaxley, A.M., Harris, D., Seeger, K., Murphy, L., Rutter, S., Squares, R., Quail, M.A., Saunders, E., Mavromatis, K., Brettin, T.S., Bentley, S.D., Hothersall, J., Stephens, E., Thomas, CM., Parkhill, J., Levy, S.B., Rainey, P.B. et Thomson, N.R. (2009) Genomic and genetic analyses of diversity and plant interactions of Pseudomonas fluorescens. Genome Biology 10 (5).
Singh, B.K., Nazaries, L., Munro, S., Anderson, LC. et Campbell, CD. (2006) Use of multiplex terminal restriction fragment length polymorphism for rapid and simultaneous analysis of different components of the soil microbial community. Applied and Environmental Microbiology 72, 7278-7285.
Slàvikovâ, E., Kosikovâ, B. et Mikulâsovâ, M. (2002) Biotransformation of waste lignin products by the soil-inhabiting yeast Trichosporon pullulans. Canadian Journal of Microbiology 48, 200-203.
Smith, C. (2005) Quantitative real-time PCR. Dans Molecular microbial ecology édité par Osborn, A.M. and Smith, C. pp. 151-166. New-York, NY: Taylor and Francis Group.
Stuckel, J.G. et Low, N.H. (1996) The chemical composition of 80 pure maple syrup samples produced in North America. Food Research International 29, 373-379.
Suzuki, M. T., Taylor, L. T. et DeLong E. F. (2000) Quantitative analysis of small-subunit rRNA genes in mixed microbial populations via 5'-nuclease assays. Applied and Environmental Microbiology 66, 4605-4614.
Tamura, K., Dudley, J., Nei, M. et Kumar, S. (2007) Mega4: Molecular evolutionary genetics analysis (mega) software version 4.0. Molecular Biology and Evolution 24, 1596-1599.
Theriault, M., Caillet, S., Kermasha, S. et Lacroix, M. (2006) Antioxidant, antiradical and antimutagenic activities of phenolic compounds present in maple products. Food Chemistry 98, 490-501.
Thomas-Hall, S.R., Turchetti, B., Buzzini, P., Branda, E., Boekhout, T., Theelen, B. et Watson, K. (2010) Cold-adapted yeasts from Antarctica and the italian Alps-description of three novel species: Mrakia robertii sp. Nov., Mrakia blollopis sp. Nov. And Mrakiella niccombsii sp. Nov. Extremophiles 14, 47-59.
Thompson, S. (2010) Microbiological spoilage of high-sugar products. Dans Compendium of the microbiological spoilage of foods and beverages édité par Sperber, W.H. et Doyle, M.P. p.301-324. New-York, NY: Springer.
Trevino-Castellano M., Rodriguez-Nôvoa S., Llovo-Taboada J., Garcia-Zabarte A., Garcia-Riestra C. et Regueiro-Garcia B.J. (2003) Combined used of RAPD and touchdown PCR for epidemiological studies of Aspergillus fumigatus. Enfermedades Infecciosas y Microbiologia Clinica 21, 472-476.
Tyree, M. (1984) Maple sap exudation: How it happens. Maple Syrup Journal 4, 10-11. Underwood, J.C. et Filipic, V.J. (1965) Maple products - qualitative determination of
syringaldehyde and dihydroconiferyl alcohol in maple sirup. Journal of the Association of Official Agricultural Chemists 48, 689-693.
Underwood, J.C, Filipic, V.J. et Bell, R.A. (1969) GLC flavor profile of maple sirup. Journal of the Association of Official Analytical Chemists 52, 717-719.
158
Underwood, J.C. et Filipic, V.J. (1963) Gas chromatographic identification of components in maple sirup flavor extract. Journal of the Association of Official Agricultural Chemists 46, 334-337.
Underwood, J.C. et Filipic, V.J. (1964) Source of aromatic compounds in maple sirup flavor. Journal of Food Science 29, 814-818.
Van der Gucht, K., Vandekerckhove, T., Vloemans, N., Cousin, S., Muylaert, K, Sabbe, K, Gillis, M., Declerk, S., De Meester, L. et Vyverman, W. (2005) Characterization of bacterial communities in four freshwater lakes differing in nutrient load and food web structure. FEMS Microbiology Ecology 53, 205-220.
Van Hoorde, K., Heyndrickx, M., Vandamme, P. et Huys, G. (2010) Influence of pasteurization, brining conditions and production environment on the microbiota of artisan gouda-type cheeses. Food Microbiology 27, 425-433.
Vicuna, R., Gonzalez, B., Ruttimann, C, Sapag, A. et Seelenfreund, D. (1988) Biochemical and genetic studies of bacteria metabolizing lignin-related compounds. Archivos de biologiay medicina expérimentales (Santiago) 21, 247-255.
Wang, M., Ahrne, S., Antonsson, M. et Molin, G. (2004) T-RFLP combined with principal component analysis and 16S rRNA gene sequencing: An effective strategy for comparison of fecal microbiota in infants of different ages. Journal of Microbiological Methods 59, 53-69.
Wei, H.L. et Zhang, L.Q. (2006) Quorum-sensing system influences root colonization and biological control ability in Pseudomonas fluorescens 2p24. Antonie Van Leeuwenhoek 89, 267-280.
Willits, CO., Frank, H.A. et Bell, R.A. (1961a) Flavor and color through controlled fermentation of maple sap. Food Technology XV, 473-474.
Willits, CO., Frank, H.A. et Bell, R.A. (1961b) Maple sirup XIX. Flavor and color through controlled fermentation of maple sap. Food technology 15, 473-474.
Winget, D.M. et Wommack, K.E. (2008) Randomly amplified polymorphic DNA PCR as a tool for assessment of marine viral richness. Applied and Environmental Microbiology 74, 2612-2618.
Wintermute, E.H. et Silver, P.A. (2010) Dynamics in the mixed microbial concourse. Genes Development 24, 2603-2614.
Woese, CR. (1987) Bacterial evolution. Microbiology Reviews 51, 221-271. Yan, X., Xu, Z., Feng, X., Liu, Y., Liu, B., Zhang, X., Zhu, C et Zhao, L. (2007)
Cloning of environmental genomic fragments as physical markers for monitoring microbial populations in coking wastewater treatment system. Microbial Ecology 53, 163-172.
Yang, Y.H., Yao, J. et Wang, M.C (2004) RAPD marker and substrate utilization pattern applied to study microbial community diversity in the soil affected by agricultural chemicals. Journal of Environmental Science and Health B 39, 125-138.
Annexe 1
Affiche présentée au congrès « Annual NAMSC-IMSI-OMSPA Meetings» à Stratford, ON en octobre 2010.
Résumé Au cours de la récolte, l'eau d'érable est contaminée par des bactéries, des levures et des
moisissures qui colonisent le système de récole tubulaire. Le microbiote bactérien formé
a récemment été étudié, mais les populations fongiques ne sont pas bien caractérisées et
leur impact sur la qualité de l'eau d'érable demeure flou. La présente étude identifie les
microorganismes fongiques et décrit leur distribution parmis 19 sites de production
localisés dans six régions du Québec, au début, au milieu et à la fin de la période de
récolte. Une méthode culture-indépendante nommée MARISA a été développée et
utilisée en conjonction avec des banques de clones pour identifier les principaux
contaminants fongiques. Les résultats indiquent que la communauté fongique est
composée principalement de levures apparentées aux genres Mrakia, Mrakiella,
Guehomyces, Cryptococcus and Williopsis. De plus, Mrakia, Mrakiella et Guehomyces
peuvent être considérés comme des membres stables du microbiote puisqu'ils ont été
retrouvés dans tous les sites de production et du début à la fin de la période de récolte.
Finalement, le site de production a été identifié comme étant le facteur pricipal de
diversité. Ces résultats apportent de nouvelles connaissances à propos de la
microbiologie acéricole et de son impact potentiel sur la qualité de la sève et de la
typicité du sirop d'érable.
160
Abstract
Upon being tapped, maple sap is contaminated by bacteria and fungi that further
colonize the tubing of the collection system. The bacterial microbiota formed has
recently been studied, but the fungal microbiota is not well characterized and their
impact on maple sap quality remains unclear. This study focused on identifying fungal
members and describing their distribution among 19 production sites located in 6
regions of Québec, at three flow periods. A culture-independent method named
multiplex automated ribosomal intergenic spacer analysis (MARISA) was developed
and used in conjunction with clone libraries to identify predominant microbiota
members. Results indicate that the fungal community of maple sap is mainly composed
of yeast related to Mrakia, Mrakiella, Guehomyces, Cryptococcus and Williopsis.
Moreover, Mrakia, Mrakiella and Guehomyces can be considered stable members as
they were found across the 19 production sites sampled and throughout the tapping
season. Finally, the production site was identified as the main diversity factor. These
results bring significant new insights about maple sap microbiology and its potential
impact on maple sap quality and syrup typicity.
161
c y Yeast communities of maple sap, a discriminating feature
El UNIVERSITÉ
LAVAL
Marie Filteau1, Luc Lagacé
2, Gisèle LaPointe
1 and Denis Roy1
' i W M d w rtutracejoaues etaP>meTBfoi_oonneii(IHWl. D*»rteme« dnScient** deii'iTiencief de T_roon. u-ive-i te uv» Givey* QC.CJ-ia<_ 'Centre de '*t**rctie. * développe*-*-* « (_ t■>-airrt*FC-.TOof »_■ _ » • : _ * ne (ACER) St-Norb-t (_Vthiù_U_. GOP « 0 . QC.Cana<_
Email: den_roy0fua _ « i ci
Introduction DJ Results Wu Results M a p l e sap is a rich g r o w t h m e d i u m f o r mic roo rgan isms . As
t h e harvest ing season progresses and t h e t e m p e r a t u r e
gets mi lder , bac te r ia , yeast and m o l d s f o r m b io f i lms ins ide
t h e t ub i ng co l lec t ion system.*
Mic rob ia l c o m m u n i t i e s - formed can a l te r m a p l e sap
compos i t i on a n d qual i ty . The bacter ia l m i c r o b i o t a has
recen t l y been s t u d i e r f but l i t t l e is k n o w n a b o u t t h e fungal
m e m b e r s of th is ecosystem.
- * -Tb ta l aerobic counts - • - Anaerobic counts - _ - Pseudomonas counts ■**■ Psychrophilic counts - • - F u n g i counts
Fig. 1 . Maple sap microbial contamination increases throughout harvesting season.*
1 . I d e n t i f i c a t i o n o f f u n g a l c o n t a m i n a n t s :
A t o t a l of 4 1 dis t inc t peaks, each po ten t i a l l y co r respond ing
t o a t y p e o f yeast or m o l d w e r e uncove red in m a p l e sap
fungal prof i les . Cloning a n d sequenc ing of PCR p r o d u c t s
a l l owed i den t i f i ca t ion of 11 peaks (Table 1).
A i m s o f t h i s s t u d y :
Ident i fy map le sap funga l c o n t a m i n a n t s w i t h a
cu l tu re - independent approach.
2. M o n i t o r fungal c o m m u n i t y var ia t i on over t h e
harvest ing season and be tween p r o d u c t i o n sites.
3. Assess t h e i m p o r t a n c e o f factors con t r i bu t i ng t o
d iscr iminate fungal commun i t i es .
cooopftco w m loo o m sn
W A o ( « M v n u M.4 594 SM
Catopiiorii m a t j r w * 99 5 U l S M
Khoobtonto sp. 99.» S M 600
_UFftarn>«s<H«MOM: 100.0 H t 611
* r i o a c r » u « orctsu 99.1 613 61S
Mrafcosp 100.0 628 631
M r o k a gthtto 9 9 1 621
Klrokarho _cco—_J I 9 9 1 63S
M r M o r * > a 9 _ * t _ M . 4 U 4 |
2. Funealcommunitv variation:
Relat ive a b u n d a n c e var ia t i on main l y occu r red b e t w e e n
harvest ing per iods whi le presence-absence va r i a t i on
was most ly observed be tween p r o d u c t i o n sites (Fig.2).
Material and Methods Li—
E x p e r i m e n t a l d e s i g n :
March Apr* _ ^ P . _ >
Harvesting period (20O5|
Culture-independent method:
c - _ _ _ _ x mi TT. muai
Mult ip lex automated r ibosomal intergenic spacer analysis (MARISA)
Fig 2. Example of fungal profiles variat ion over harvesting season ( left) and across product ion sites (right).
Identification of fungal peaks: Cloning Sequencing
V J_
"
■ Candida sake m Cryptococcus victoriae
■ Cadophora melinii ■ Williopsis sp.
■ Cadophora moforum ■ Guehomyces p u t u h n s
■ Rhodotorula a t t ka a Mrakia spp.
■ Mrokieta spp. ■ Other
Fig 3. Relative abundance of fungal peaks throughout t he harvesting season
3. Discriminating factors:
Accord ing t o a d isc r im inan t analysis, t h e m o s t i m p o r t a n t
va r i a t i on f ac to r o f t h e f unga l c o m m u n i t y compos i t i on w a s
t h e p r o d u c t i o n si te , followed by t h e flow p e r i o d and t h e n
t h e geographica l reg ion .
Based on t h e funga l pro f i l e data, t h e harves t ing per iod
was pred ic ted w i t h o u t misclassi f icat ion The harvest ing
t i m e w a s pred ic ted w i t h a 5% error ra te and t he
geograph ica l reg ion was p r e d i c t e d w i t h a 9 % er ro r ra te
(F ig .4 } .
-Bis St L i . CT» •CeiXre-d-Q uébec ■CwudiSf-e-AoM ac"_s
Circles -ecesent "wx' region e_i mated
Figure 4. Regional discriminant analysis canonical plot of maple sap samples based on fungal profi les.
Discussion IL > Only yeast sequences w e r e recovered f r o m maple sap,
a l t h o u g h n o t all peaks have been i den t i f ied .
1 M a p l e sap yeasts are ei ther :
* • Cold adap ted microorgan isms ( M r a k i a and Mrak ie l l a )
•Ve ry c o m m o n in na tu re {Guehomyces)
• Associated w i t h h u m a n n o r m a l mic rob io ta (Guehomyces)
- A p l a n t pathogen ( C a d o p h o r a m a l o r u m )
• Present on t ree bark (Cryptococcus and fthodoforu/o)
• Fermen ta t i ve (Candida sake)
■ M r a k i a , M r a k i e l l a and Guehomyces can b e considered
stab le m e m b e r s o f t h e m a p l e sap m i c r o b i o t a . There fo re ,
t h e y cou ld be imp l i ca ted in d e v e l o p m e n t of character is t ic
m a p l e a t t r i bu tes a long w i t h t h e stab le bac ter ia l m e m b e r ,
Pseudomonas .
• Thei r re la t i ve a b u n d a n c e var ia t i on over t he t app ing
season c o u l d b e r e l a t e d t o var ia t ion o f map le sap
c o m p o s i t i o n and chang ing env i ronmen ta l cond i t ions .
• O t h e r yeasts are occasional con tam inan ts t h a t cou ld b e
respons ib le f o r m a p l e sy rup t yp i c i t y and f o r ce r ta in off-
f lavors . For examp le , Wil l iopsis is k n o w n t o produce f r u i t y
f lavors .
■ Thei r var iab le occu r rence a m o n g p r o d u c t i o n sites cou ld
resu l t f r o m d i f fe ren t c o n t a m i n a t i o n sources re la ted t o
ster i l i za t ion pract ices.
• Fungal mic rob io ta prof i les show d isc r im ina t ing fea tu res
t h a t cou ld s u p p o r t va lue a d d e d c la ims for map le sy rup o f
con t ro l l ed or ig in . However , t h e re la t ionsh ip b e t w e e n
t hese var ia t ions and sy rup qua l i t y m u s t be f u r t h e r
exp lo red .
Annexe 2
Preliminary analysis for qPCR target selection
s s 2 o
s « 3 o
ii _ 3 S S C c
(D -? ? (O rt * ^ ^
S * S o
E D
- I- i - i - »-O O O O
_ _ _ ■*» o «o £ >. >. <N f- •»
^ c Q» a p p P " » - O O Ë F F F F Û - O U O L U U J O O O
0TU1
Maple taste
Maple odor
Van illa taste
Van illa odor
OTU2
OTU6
OTU36
OTU4
Plant ligneous taste
Plant ligneouse odor
OTU5
Confectionary taste
Confertionaryodor
Emp y reumati c taste
Emp y reumati c o dor
OTU27
OTU 10
OTU45
Organoleptic properties OTU1
r P
OTU2
r P
OTU4
r p
OTU5
r P
OTU6
r P
OTU10
r P
OTU 27
r P
OTU36
r p
OTU45
r p
Confectionary odor -0 32 0.2805 -0 40 0 1737 -0 39 0.1911 0 51 0.0745 -0 33 0 2641 0.45 01200 0 57 0 0422 -024 0.4252 0.48 0.0943
Con fectionany taste -0 18 0 5592 -025 0.4128 -0.43 0.1434 0 37 0.2177 -0 41 0.1622 0 63 00209 042 0.1502 -0 33 0.2672 0 65 00156
Empyreumaticodor -0.25 0.4018 -0.42 0.1491 -0.48 0.0971 0 6 ! 0 0259 -0 57 0 0434 0 58 0 0389 0.67 0 0118 -0.53 0.0654 0 72 00059
Empyreumatictaste -0.15 0.6319 -0 57 0 0429 -0 48 0.1008 0 52 0 0227 -0 55 0 0500 044 0.1299 :, so 0 0287 -0 50 0.0811 0 60 0 0288
Maple odor 0 67 00115 0 02 09462 -0 42 0.1577 -012 0.6985 -0.18 0.5527 -0 23 0.4418 -0.30 03216 -0.10 0.7332 - 039 0.1862
Maple taste 0 56 0 0484 0 16 0.6103 -0.30 0.3213 -0 02 0.9387 -0.10 0.7381 -0 01 0.9676 -0.29 0.3440 -0.02 0.9573 -0.21 0.4925
Plant ligneous odor -0.38 0.1968 0 35 0.2408 Q 7 g 00014 -0.43 0.1423 0 ~2 00059 -038 01981 -0.29 0.3298 0 63 0 0217 -0 35 02428
Plant ligneous taste -0 41 0.1696 0 39 0.1869 0.81 0 0007 -0.44 0.1283 0 76 0 0026 -0 35 02384 -023 0.4584 0 67 0 0118 -0.31 0.3060
Vanillaodor -0.05 0.8836 0 20 0.5090 -012 0.7020 -0.24 0.4356 042 0.1541 -0.30 0.3178 -0.44 0.1307 0 53 0.0596 -0 56 00460
Vanilla taste -0.18 0.5534 0 18 0.5543 0.05 0 8783 -0 25 04131 0 2 5 0.4022 -0.23 0 4571 -0.02 0.9568 0.42 0.1488 -0.36 02292
Clustering of the correlations between the relative abundance of selected OTUsooi from 16S rRNA gene clone libraries and maple syrup organoleptic characteristics. Correlation coefficient and/? values are reported in the accompanying table.
164
P. synxantha P. poae P. lurida P. trivialis 0TU2 P. Ilbaniensis
•P. costantinii •P. reactans
N P fulgida P. orientalis P. cedrella
- P tolaasii -P. panacis TP. veronii
4 OTU 1 I P. brennerii IP. gessardii 'p. proteolytica
— P. fluorescens |—P. fluorescens
-P. marginalis -P. riiodesiae j P. collierea J"OTU6 |LoTU4 rP. aurantiaca 1-P. aureofaciens TP Uni
H P. borealis l p . frederiksbergensis I P. nigulae *P. mandetii
f-P. corrugata
H P. chlororaphis P. tremae P. meliae
-P. ficuserectae -P. viridifiava rP. savastanoi
P. cannabina P. congelans P. synngae P. avellanae
£ P. abietaniphila P. graminis P. gingen
i- P. jessenii J -P . entomophila
^ ■ P . pul/da t p . pui/da
i — Rahnella aquatilis genosp. 1 l i— Rahnella genosp. 2 t rOTUS
^Rahnella genosp. 3 i OTU 45 I Achromobacter xylosoxidans
r Janthinobacterium agaricidamnosum L0TUIO 1 Janthinobacterium lividum .OTU 36 I Rhodococcus erythropolis
1 0TU27 - I i—Pedobactercryoconitis
*—I r- Pedobacter hartonius ^ - Sphingobacterium sp.
— Pedobacter westerhofensis
gi|4433345| gi|21726937| gi|34494539| gi|21726939| 0-p12_2406 gi|3047379| gi|20146542| gi|15705389| gi|21726938| gi|3142686| gi|3142690| gi|1907110| gi|56789958| gi|3142689| 5O-p15_2308 gi|8778106| gi|3309635| gi|27901527| gi|10567496| gi|1907102| gi|1907103J gi |3142688| gi|166408585| 0-p15_2205 0-p7_404 gi|18076613| gi|18076614| gi|14517354| gi|4138313| gi|12406960| gi|3309634| gi|3065756| gi|4433326| gi|1907097| gi|21726934| gi|4165388| gl|19071011 gi|10567522| gi|89001390| gi|21726935| gi|21726936| gi|4433327| gi|1224102| gi|4138390| gi|1841469| gi|15705393| gi|3212001| gi|59859795| gi|453512| gi|531253| gi|2290395| gi|2290272| 100-p7_2202 gi|2290396| 100-p12_306 gi|173700| gipi9846772| 100-p8_501 gi |219846773| 0-p8_510 gi|854411| 100-p12_408 gi|19310051| gi|125858413| gi|3970887| gi|1258584111
t l 0.15 I A.. -*—y ^ c
Phylogenetic relationship between representative sequence from selected OTUso.oi and reference sequences. The evolutionary history was inferred using the Neighbor-Joining method. Tree is inferred from 1000 bootstrap replicates. Units represent the number of base substitutions per site. All positions containing gaps and missing data were eliminated from the dataset (Complete deletion option). There were a total of 583 positions in the final dataset.
Annexe 3
Overview of 2005 sample characteristics
Ward's two-way clustering classification of maple samples and characteristics. Values were standardized so that the color intensity refers to variation from the mean. Sap (underlined) or syrup characteristics are presented in red to green scale covering -3 to 3 standard deviations. Letters refer to production site.