ASIEH RASOOLIZADEH
TRANSCRIPTIONAL ANALYSIS OF TRANOSEMA ROSTRALE ICHNOVIRUS (TrIV) GENES, WITH
EMPHASIS ON THE REP GENE FAMILY
Mémoire présenté à la Faculté des études supérieures de l’Université Laval
dans le cadre du programme de maîtrise en biologie pour l’obtention du grade de Maître ès Sciences (M.Sc.)
DÉPARTEMENT DE BIOLOGIE FACULTÉ DES SCIENCES ET DE GÉNIE
UNIVERSITÉ LAVAL QUÉBEC
2009
© Asieh Rasoolizadeh, 2009
RÉSUMÉ
La guêpe endoparasitoïde Tranosema rostrale transmet un ichnovirus (“TrIV”) à son hôte
lépidoptère, Choristoneura fumiferana, au moment de la ponte. Ce virus, lequel possède
un génome segmenté d’ADNdb et ne peut se répliquer que dans l’ovaire du parasitoïde,
est essentiel à la survie de la guêpe immature à l’intérieur de son hôte. Dans une étude
antérieure, 86 cadres de lecture ouverts (ORF) ont été identifiés dans le génome de TrIV,
dont 35 qui ont pu être affectés à des familles de gènes ichnoviraux connues. La balance
n’affichait aucune similitude à des gènes connus. Dans le but d’évaluer (i) la précision de
l'annotation du génome de TrIV et (ii) l'importance relative de chaque famille de gènes
dans le succès du parasitisme par T. rostrale, une analyse transcriptionnelle de type qPCR
a été réalisée chez des larves de C. fumiferana infectées ainsi que dans des ovaires de T.
rostrale. Alors que la majorité (91%) des ORF attribués à des familles de gènes connues
ont produit des transcrits dans les larves infectées, mais à des niveaux très variables, cette
proportion était plus faible (67%) pour un échantillon de 12 ORF non-attribués. Parmi les
sept familles de gènes présentes dans le génome de TrIV, la famille rep est la mieux
représentée, avec 17 membres; tous se sont avérés être exprimés dans des larves infectées
et/ou les ovaires de guêpe. Dans les chenilles infectées, cependant, les transcrits de deux
d'entre eux, F1-1 et F1-2, étaient beaucoup plus abondants que ceux des autres gènes rep.
De plus, le profil transcriptionnel de la famille rep était clairement différent dans les
ovaires de guêpe, où le gène C166-1 a génére le plus abondant des transcrits rep, ce qui
suggère que différents membres de cette famille pourraient avoir des fonctions
spécifiques dans chaque hôte. L'abondance relative des segments génomiques était plus
élevée pour les deux segments portant les trois gènes rep les plus fortement exprimés
chez des chenilles infectées, mais la corrélation entre ces deux variables était faible pour
les autres gènes rep, suggérant que des facteurs additionnels sont impliqués dans la
régulation de l'expression des gènes rep chez les larves infectées. Des différences entre
les gènes rep de TrIV ont également été observées en ce qui a trait à l'abondance relative
des transcripts dans différents tissus de C. fumiferana, ce qui suggère l’existence de rôles
distincts ou d’une spécialisation pour chacun des membres de cette famille à l’intérieur
de différents tissus. Lorsqu’on compare les niveaux de transcripts rep, dans des chenilles
infectées, à ceux de gènes appartenant à d'autres familles connues du génome de TrIV, un
gène de la famille TrV (TrV1) et un gène rep (F1-1) se sont avérés beaucoup plus
fortement transcrits que tous les autres gènes examinés, soulignant l'importance probable
de ces deux familles dans la subjugation de C. fumiferana par T. rostrale. Dans les
ovaires de guêpe, le profil transcriptionnel était dominé par un gène rep et par un membre
d'une famille nouvellement décrite et identifiée parmi des ORF qui n’avaient pu être
attribués à des familles connues; ces gènes codent pour les protéines sécrétées affichant
un nouveau motif cystéine.
ABSTRACT
The endoparasitic wasp Tranosema rostrale transmits an ichnovirus (“TrIV”) to its
lepidopteran host, Choristoneura fumiferana, during parasitization. This virus, which has
a segmented dsDNA genome and can replicate only in the wasp’s ovaries, is essential to
the survival of the immature wasp within its host. In a prior study, 86 putative open
reading frames (ORFs) were identified in the TrIV genome, including 35 that could be
assigned to previously recognized ichnoviral gene families. The balance displayed no
similarity to known genes. In an effort to assess (i) the accuracy of the TrIV genome
annotation and (ii) the relative importance of each gene family in the success of
parasitism by T. rostrale, a temporal and tissue-specific qPCR transcriptional analysis
was conducted in infected C. fumiferana hosts and T. rostrale wasp ovaries. The majority
(91%) of putative ORFs assigned to known gene families were observed to be expressed
in infected larvae, albeit at widely varying levels, but this proportion was lower (67%) for
a sample of 12 unassigned ORFs. Among the seven known gene families present in the
TrIV genome, the rep family is the numerically most important one, with 17 members; all
of these were shown to be expressed in infected larvae and/or wasp ovaries. In infected
caterpillars, however, two of them, F1-1 and F1-2, had much more abundant transcripts
than the others. The rep transcriptional profile was markedly different in wasp ovaries,
where the C166-1 gene generated the most abundant rep transcripts, suggesting that
different members of this family may have host-specific functions. Relative abundance of
genome segments was highest for the two segments bearing the three most highly
iii
expressed rep genes, but the correlation between these two variables was poor for the
other rep genes, suggesting that some other factors are involved in the regulation of rep
gene expression in infected larvae. Inter-gene differences were also observed in the
relative abundance of TrIV rep transcripts in different C. fumiferana tissues, pointing to
tissue-specific roles or specialized functions for individual members of this gene family.
In comparing rep transcript levels to those of genes belonging to other known TrIV gene
families, a TrV (TrV1) and a rep (F1-1) gene clearly outnumbered all other genes
examined in infected caterpillars, pointing to the likely importance of these two gene
families in host subjugation by T. rostrale. In wasp ovaries, the transcriptional profile
was dominated by a rep gene and a member of a newly described family identified
among previously unassigned ORFs; these genes encode secreted proteins displaying a
novel cysteine motif.
iv
AVANT-PROPOS – FOREWORD
During my graduate studies, I have met several people at Laval University who have
shared their knowledge and experience with me to make my work both possible and more
pleasant. I take this opportunity to thank them all from the bottom of my heart. More
specifically, I would like to thank my co-supervisor, Dr. Michel Cusson. He generously
welcomed me to his lab, gave me the opportunity to develop my competences, and
provided me with scientific training on a daily basis. Dr. Cusson has a distinct way of
dealing with problems and gives his students an opportunity to discover themselves and
recognize their abilities. It has always been a great pleasure to share with him new
results, and his constant cheering, interest and enthusiasm allowed me to push through
and get through several difficult tasks.
I would also like to thank my director, Prof. Conrad Cloutier, for taking time to assess my
manuscript and help me get through the Master’s program. I will never forget the first
course I took with him, which he (naturally) gave in French, a lovely language that,
unfortunately, I do not fully grasp yet; he patiently helped me throughout the semester.
Furthermore, I would like to express my gratitude to the members of our laboratory at the
Laurentian Forestry Centre (LFC). In particular, I thank Catherine Béliveau and Don
Stewart, two molecular biologists who have helped me by providing valuable and
friendly guidance during my stay at LFC.
I will also be eternally grateful for the support I received from the few real friends I made
at Laval University; their friendly support was much appreciated, and I sincerely thank
them all.
Last, but not least, I wish to express my profound gratitude to my parents. Although I am
living far away from them, they are always in my heart. The distance did not keep them
from providing invaluable advice and generous support. I have always benefited from
their gracious words and encouragements, which allowed me, during hard times, to keep
moving forward and continue on my career path.
v
TABLE OF CONTENTS
RÉSUMÉ…………………………………………………………………………………………ii
ABSTRACT………….. ............................................................................................................... iii
AVANT-PROPOS – FOREWORD .............................................................................................. v
TABLE OF CONTENTS ............................................................................................................. vi
LIST OF FIGURES...................................................................................................................... ix
LIST OF TABLES ....................................................................................................................... xi
CHAPITRE 1….INTRODUCTION ........................................................................................... 1
1.1 La tordeuse des bourgeons de l’épinette, Choristoneura fumiferana ............................ 2
1.1.1 Cycle Vital ................................................................................................................. 2
1.2 Les parasitoïdes.............................................................................................................. 4
1.3 Polydnavirus .................................................................................................................. 4
1.3.1 Classification ............................................................................................................. 5
1.3.2 Cycle Vital ................................................................................................................. 6
1.3.3 Organization du genome............................................................................................ 7
1.3.4 Bracovirus.................................................................................................................. 8
1.3.5 Ichnovirus .................................................................................................................. 9
1.4 La guêpe Tranosema rostrale, un parasitoïde de la TBE............................................. 10
1.4.1 Le polydnavirus de Tranosema rostrale (TrIV) ...................................................... 10
1.5 Objectifs du projet........................................................................................................ 11
1.6 Référence ..................................................................................................................... 13
CHAPITRE 2….Tranosema rostrale ichnovirus repeat element genes display distinct transcriptional patterns in caterpillar and wasp hosts .......................................... 18
2.1 Summary ...................................................................................................................... 18
2.2 Résumé......................................................................................................................... 19
2.3 Introduction.................................................................................................................. 20
2.4 Material and methods................................................................................................... 22
2.4.1 RNA and DNA extraction ....................................................................................... 22
2.4.2 Reverse transcription and qPCR.............................................................................. 23
2.4.3 Bioinformatics ......................................................................................................... 24
2.5 Results and Discussion................................................................................................. 25
vi
2.5.1 Critical assessment of the LRE methodology.......................................................... 25
2.5.2 Transcript abundance in parasitized larvae.............................................................. 26
2.5.3 Transcript abundance in CF-injected larvae ............................................................ 29
2.5.4 Transcript abundance in wasp ovary and head-thorax complexes........................... 30
2.5.5 Gene dosage............................................................................................................. 32
2.5.6 Comparison of TrIV rep proteins and identification of non-polydnaviral rep homologs ................................................................................................................. 34
2.6 References.................................................................................................................... 38
CHAPITRE 3….Global transcriptional profile of Tranosema rostrale ichnovirus genes in infected lepidopteran hosts and wasp ovaries...................................................... 42
3.1 Abstract ........................................................................................................................ 42
3.2 Résumé......................................................................................................................... 43
3.3 Introduction.................................................................................................................. 44
3.4 Materials and Methods................................................................................................. 46
3.4.1 RNA extraction........................................................................................................ 46
3.4.2 cDNA library construction ...................................................................................... 46
3.4.3 Bioinformatics analyses........................................................................................... 47
3.4.4 Amplification of ORF-specific cDNAs from the cDNA library ............................. 47
3.4.5 Reverse transcription and quantitative real-time PCR (qPCR)................................ 48
3.5 Results.......................................................................................................................... 49
3.5.1 Detection of TrIV transcripts in infected larvae ...................................................... 49
3.5.2 Transcript abundance of TrIV ank, inx, Cys-motif, PRRP and N genes.................. 52
3.5.3 Transcript abundance of TrIV “unassigned” genes ................................................. 53
3.5.4 Comparison of transcript abundance across all TrIV gene families ........................ 55
3.5.5 Accuracy of splicing junction predictions ............................................................... 57
3.6 Discussion .................................................................................................................... 58
3.7 References.................................................................................................................... 61
CHAPITRE 4….Conclusion ..................................................................................................... 65
4.1 Références.................................................................................................................... 70
ANNEXE A…..Effect of TrIV rep gene expression on host gene transcription, as determined by microarray analysis.............................................................................................. 71
A.1 Introduction .................................................................................................................... 71
A.2 Material and methods ..................................................................................................... 72
A.3 Results ............................................................................................................................ 73
vii
viii
A.4 Discussion....................................................................................................................... 74
A.5 References ...................................................................................................................... 75
ANNEXE B…. Supplementary data for chapter 2: .................................................................... 76
ANNEXE C…. Supplementary data for chapter 3: .................................................................... 78
LIST OF FIGURES
Figure 1-1 Schéma du cycle vital de la tordeuse des bourgeons de l'épinette. ............................... 3
Figure 1-2 Représentation schématisée du cycle vital de Tranosema rostrale (Laforge, 1999). . 11
Figure 2-1 Transcript levels of 17 TrIV rep genes in naturally parasitized C. fumiferana 6th instar
larvae, as determined by quantitative real-time RT-PCR using total RNA extracted from whole
caterpillars, 1, 3 and 5 d post-parasitization (p.p.). ...................................................................... 27
Figure 2-2 Transcript levels of 17 TrIV rep genes in naturally parasitized 6th instar larvae, as
determined by quantitative real-time RT-PCR using total RNA extracted from four different
tissues: FB, fat body; CE, cuticular epithelium; HC, haemocytes; MG, midgut. The larvae were
parasitized within 24 h after the molt to the 6th (last) stadium, and the RNA extracted from
individual tissues 2 days after parasitization. ................................................................................ 28
Figure 2-3 Transcript levels of 17 TrIV rep genes in 6th instar larvae injected with 0.5 FE of T.
rostrale calyx fluid, as determined by quantitative real-time RT-PCR using total RNA extracted
from whole caterpillars, 1, 3 and 5 d post-injection (p.i.).. .......................................................... 29
Figure 2-4 Transcript levels of 17 TrIV rep genes in T. rostrale ovaries and head-thorax
complexes, as determined by quantitative real-time RT-PCR....................................................... 31
Figure 2-5 Assessment of genome segment abundance within the TrIV packaged genome, as
determined by quantitative real-time PCR using viral DNA as template...................................... 33
Figure 2-6 ClustalX alignment of all known and predicted TrIV rep family proteins. Black
arrows indicate the positions of conserved cysteine residues........................................................ 36
Figure 2-7 ClustalX alignment of selected ichnoviral rep proteins from TrIV, HfIV, and HdIV, as
well as a rep-like protein from the granulovirus HearGV. ............................................................ 37
Figure 3-1 qPCR determination of transcript levels of 11 TrIV putative genes (23), distributed
among five gene families, in C. fumiferana 6th instar larvae, 3 d following natural parasitization
by T. rostrale (3 d p.p.) ................................................................................................................. 52
Figure 3-2 ClustalW alignment of amino acid sequences deduced from selected TrIV unassigned
ORFs that were found to form groups of two or more related proteins. A) Four related proteins
x
displaying a novel C-terminal cysteine motif (cysteine residues are shown as white letters against
black background). ........................................................................................................................ 54
Figure 3-3 qPCR determination of transcript levels of 12 TrIV putative ORFs selected among 51
unassigned ORFs (23), in C. fumiferana 6th instar larvae, 3 d following natural parasitization by
T. rostrale (3 d p.p.) or injection of 0.5 FE T. rostrale calyx fluid (3 d p.i.), as well as in T.
rostrale adult ovaries. Putative genes are here clustered according to whether they are orphan or
belong to a family (“OSSP” and “unassigned family B”; see caption of Fig. 2). ......................... 55
Figure 3-4 Comparison of transcript abundance among selected representatives of all known
TrIV gene families, in C. fumiferana 6th instar larvae, 3 d following injection of 0.5 FE T. rostrale
calyx fluid (3 d p.i.). ...................................................................................................................... 56
Figure 3-5 Comparison of transcript abundance among selected representatives of all known
TrIV gene families, in adult T. rostrale ovaries. ........................................................................... 56
LIST OF TABLES
Table 2-1 Critical assessment of the accuracy of LRE-based qPCR determinations (Rutledge and
Stewart, 2008a,b) by comparison with estimates obtained by application of the “limiting dilution
assay” (LDA) method (Wang and Spadoro, 1998)........................................................................ 25
Table 3-1 Overall assessment of the expression (detected or not; + or ) of known and predicted
TrIV ORFs in TrIV-infected C. fumiferana larvae........................................................................ 50
Table 3-2 Differences between predicted and observed splicing junctions for two TrIV spliced
genes, TrV3 and a Cys-motif gene. ................................................................................................ 57
CHAPITRE 1
INTRODUCTION
Les insectes (classe Insecta) constituent le groupe taxonomique le plus important au sein
de l’embranchement des arthropodes. Ils forment également le taxon le plus diversifié,
avec plus d’un million d’espèces connues. Bien que la majorité des insectes aient des
effets directs ou indirects bénéfiques ou neutres sur l’activité humaine, une faible
proportion (<1% de toutes les espèces d’insectes décrites) est considérée comme lui étant
nuisible (Gullan et Cranston, 2000 ; Coulson et Witter, 1984). Les insectes nuisibles sont
généralement divisés en trois grandes catégories fonctionnelles: (i) ceux qui transmettent
des maladies aux humains et aux animaux domestiques, (ii) ceux qui détruisent des
produits fabriqués par l’Homme et (iii) ceux qui détruisent ou réduisent la croissance des
cultures agricoles et des arbres (Ross, 1965).
Pour la gestion des insectes ravageurs, on a recours à différents produits antiparasitaires
tels que les insecticides chimiques et biologiques. La répression des ravageurs forestiers
au moyen de pulvérisations d’insecticides chimiques conventionnels a joué un rôle
important dans la protection des forêts pendant plusieurs années. Cependant, leurs effets
négatifs sur l’environnement et la santé humaine ont graduellement entrainé leur
bannissement complet en milieu forestier en Amérique du Nord (Armstrong & Ives,
1995). Maintenant, on tend à utiliser des insecticides microbiens ou des insecticides de
synthèse à risques réduits, lesquels ciblent une fonction spécifique aux insectes et ont, par
1
conséquent, peu ou pas d’effets sur des organismes non-ciblés. Ainsi, des bactéries, des
virus, des champignons et des nématodes ont fait l’objet d’évaluations comme agents de
lutte biologique (Lacey et al, 2001), et certains ont été homologués et commercialisés.
Ces pesticides ont un moindre impact sur l’environnement et la santé humaine. Leur
utilisation entraîne donc une réduction des résidus de pesticides conventionnels et
contribue à la préservation des ennemis naturels.
1.1 La tordeuse des bourgeons de l’épinette, Choristoneura fumiferana
La tordeuse des bourgeons de l’épinette (TBE), Choristoneura fumiferana (Lepidoptera :
Tortricidae), est le ravageur forestier le plus important des forêts de conifères de l’est du
Canada. La TBE cause des dommages au cours de sa période larvaire en se nourrissant
des bourgeons et des jeunes pousses d’arbres. Une attaque sévère répétée sur plusieurs
années peut entraîner la mort des arbres infestés (Armstrong & Ives, 1995). La TBE
attaque principalement le sapin baumier (Abies balsamea), mais elle peut aussi causer des
damages importants à l’épinette rouge (Picea rubens), l’épinette blanche (Picea glauca)
et l’épinette noire (Picea mariana). Les populations de TBE atteignent des niveaux
épidémiques de façon cyclique et constituent ainsi une menace pour plus de cinquante
millions d’hectares de forêt. Les peuplements gravement affectés prennent une coloration
rouille en raison de la présence d’aiguilles desséchées et retenues par des fils de soie
tissés par les larves. À l’automne, la majorité des aiguilles mortes sont emportées par le
vent et les peuplements ainsi défoliés deviennent grisâtres (Dajoz, 2000).
1.1.1 Cycle Vital
Choristoneura fumiferana a un cycle vital comprenant six stades larvaires (Fig. 1-1). Les
papillons s’accouplent vers la mi-juillet et les femelles pondent leurs œufs directement
sur les aiguilles de sapin et d’épinette. Suite à l’éclosion de l’œuf, la larve (chenille) de
premier stade tisse, dans la cime de l’arbre, un petit abri de soie appelé « hibernacle ».
2
C’est alors que la chenille mue au deuxième stade larvaire et interrompt son
développement jusqu’à la fin de l’hiver ; pendant cette période de dormance appelée
diapause, la chenille cesse de se nourrir. En mai, la larve de deuxième stade quitte son
hibernacle et mue au troisième stade larvaire, après quoi elle commence à se nourrir de
jeunes aiguilles. Généralement, c’est aux stades avancés de développement (4e, 5e et 6e
stades) que cet insecte cause le plus de dommages au feuillage. Les larves sont reconnues
à leur corps brun (18-24 mm de longueur) et leur tête noire. Au mois de juin, la larve de
6e stade cesse de se nourrir et entreprend la recherche d’un endroit, de préférence la cime
des arbres, pour sa pupaison et sa métamorphose. Les papillons adultes émergent vers la
fin juin-début juillet (Dajoz, 2000).
Figure 1-1 Schéma du cycle vital de la tordeuse des bourgeons de l'épinette. (https://email.nrcan.gc.ca/exchweb/bin/redir.asp?URL=http://www.srd.gov.ab.ca/forests/health/insects/sprucebudworm.aspx
La TBE est attaquée par de nombreux prédateurs et parasitoïdes. La plupart des insectes
parasitoïdes font partie de l’ordre des Diptères (mouches et moustiques) et de l’ordre des
Hyménoptères (guêpes, abeilles et fourmis). Différents parasitoïdes s’attaquent à
différents stades développementaux de la TBE, tels les œufs, les jeunes larves, les larves
plus âgées et les pupes (Dajoz, 2000).
3
1.2 Les parasitoïdes
Les parasitoïdes forment un vaste groupe d’ennemis naturels que l’on peut diviser en
deux grandes catégories selon que le développement de leurs stades immatures est
complété à l’extérieur (i.e., sur la face externe ; ectoparasitoïdes) ou à l’intérieur de l’hôte
(endoparasitoïdes). Dans un cas comme dans l’autre, la parasitoïde entraîne ultimement la
mort de son hôte. Les parasitoïdes Hyménoptères appartiennent au sous-ordre des
Apocrita, au sein duquel on trouve deux superfamilles. La mieux connue de celles-ci,
Ichneumonidea, est composée des familles Ichneumonidae et Braconidae. Les femelles
appartenant à ces familles utilisent leur ovipositeur (appendice abdominal) pour parasiter
leur hôte (i.e., y pondre un œuf ; Hajek, 2004).
Les insectes hôtes réagissent à la présence de corps étrangers tels les œufs d’un
endoparasitoïde en les « encapsulant », c’est-à-dire en les couvrant de plusieurs couches
d’hémocytes, une réaction qui est généralement accompagnée d’une mélanisation de la
capsule. Cette réponse est connue sous le nom d’encapsulement (Asgari, 2007).
Toutefois, certains parasitoïdes ont développé des moyens de se protéger contre cette
réaction ou même de l’inhiber. Plusieurs facteurs naturels qui sont injectés dans la larve
hôte au moment de la ponte, tels des venins, des protéines ovariennes, et des particules
pseudovirales, sont impliqués dans la protection de l’œuf et de la jeune larve contre la
réponse immunitaire de l’hôte. Alors que certains de ces facteurs protègent la guêpe
immature de façon passive, d’autres participent à l’inhibition active de la réponse
immunitaire de l’hôte. Par exemple, les œufs de Braconidae, au moment de leur éclosion,
libèrent des cellules géantes connues sous le nom de « tératocytes » ; ces cellules ont été
impliquées dans la suppression de la réponse immunitaire de l’hôte (Asgari, 2007).
Certains virus ont un effet semblable.
1.3 Polydnavirus
Parmi les agents transmis par certaines guêpes endoparasitoïdes à leur hôte pour inhiber
l’encapsulation, on compte les polydnavirus (PDV), lesquels constituent un groupe de
4
virus uniques en raison de l’association mutualiste obligatoire qu’ils forment avec
certaines guêpes endoparasitoïdes des familles Braconidae et Ichneumonidae. Le génome
des polydnavirus est constitué de plusieurs segments génomiques circulaires d’ADNdb ;
cette particularité génomique est d’ailleurs à l’origine de leur nom (Polydisperse DNA
Virus). Les PDV sont transmis à l’hôte Lépidoptère au moment de l’oviposition, et
l’expression de certains de leurs gènes est essentielle au succès du développement de
l’œuf et de la larve de guêpe dans la chenille hôte (Stoltz, 1993; Krell et al., 1982;
Turnbull & Webb, 2002).
1.3.1 Classification
Les virus sont classifiés en fonction de la nature de leur génome (ADN ou ARN, simple
ou double brin, linéaire ou circulaire, segmenté ou non, etc.), de la morphologie de leur
virion, de leur spectre d’hôtes, et de leur cycle vital. Le "International Committee on
Taxonomy of Viruses" (ICTV) reconnait présentement les PDV comme formant une
famille distincte, les Polydnaviridae, laquelle inclut les seuls virus (connus) possédant un
génome segmenté composé d’ADN circulaire double brin. Tel que mentionné ci-dessus,
les PDV sont associés à certaines guêpes des familles Braconidae et Ichneumonidae;
l’ICTV reconnait de ce fait deux genres, les Bracovirus (BV) et les Ichnovirus (IV). Bien
qu’ils partagent de nombreuses caractéristiques, les IV et les BV semblent avoir des
origines évolutives distinctes (Whitefield, 2002; Bezier et al., 2009). Chez les Braconidae
et les Ichneumonidae, quatre (Cheloninae, Microgastrinae, Cardiochilinae et Miracinae)
et deux (Campoleginae et Banchinae) sous-familles, respectivement, ont été identifiées
comme contenant des guêpes porteuses de PDV (Stoltz et al, 1995a). Bien que les virus
associés aux quatre sous-familles de Braconidae semblent avoir un ancêtre commun
(Bezier et al., 2009), il pourrait en être autrement des virus associés aux deux sous-
familles d’Ichneumonidae (Lapointe et al., 2007).
5
1.3.2 Cycle Vital
Le génome des PDV est intégré au génome de la guêpe hôte sous forme de provirus; la
transmission du virus à travers la population de guêpes est donc mendélienne (verticale)
(Fleming et Summers, 1986; Stoltz et al., 1986; Stoltz, 1990, Fleming & Krell, 1993).
Le cycle vital des PDV comporte deux volets (ou deux "bras"): le premier est constitué de
la réplication et de la transmission, alors que le deuxième est constitué de l’infection et de
l’expression des gènes viraux dans l’hôte Lépidoptère (Stoltz, 1993). La réplication du
génome viral est confinée à une portion spécialisée des ovaires de la guêpe, le « calice »,
lequel est situé à la jonction des ovarioles et de l’oviducte latéral. La réplication
commence au stade pupal du développement de la guêpe femelle, en réponse à des
changements dans les titres d’ecdystéroïdes. Bien que les connaissances sur le mécanisme
de réplication des PDV demeurent pour l’instant limitées, selon le scénario le plus
probable, des groupes de segments proviraux sont excisés des chromosomes de la guêpe,
puis amplifiés pour former des épisomes circulaires par un mécanisme du type « rolling
circle » (Webb, 1998 ; Marti et al, 2003). Il y a alors encapsidation dans le noyau, où les
particules virales acquièrent leur première (IV) ou unique (BV) enveloppe. Les virions
migrent alors vers la membrane cytoplasmique pour être libérées dans la lumière de
l’oviducte. Là, les virions forment la fraction particulaire du « fluide du calice » (CF),
dans lequel baignent les œufs de la guêpe (Stoltz & Vinson, 1977 ; Kroemer & Webb,
2004).
Les bracovirus sont libérés dans l’oviducte par la lyse des cellules épithéliales du calice,
alors que les ichnovirus sont libérés par exocytose. C’est ainsi que les ichnovirus
acquièrent une deuxième membrane unitaire, celle-ci étant constituée d’une portion
d’épithélium du calice (Norton et al., 1975; Stoltz & Vinson, 1977; Stoltz & Vinson,
1979; Stoltz et al., 1976).
Au moment de l’oviposition, la guêpe transmet le virus à la chenille hôte. Il n’y a pas de
réplication virale chez celle-ci, mais l’expression de gènes viraux entraîne la production
de protéines qui sont impliquées dans la protection des œufs et des larves de guêpe contre
6
la réponse immunitaire de la chenille hôte ainsi que dans la régulation développementale
de la chenille hôte (Stoltz, 1993; Stoltz & Vinson, 1977; Stoltz et al, 1986; Tanaka &
Vinson, 1991). Ainsi, c’est l’expression de gènes polydnaviraux qui permet à la guêpe de
compléter son développement larvaire, et c’est la survie de la guêpe qui permet la
transmission du génome proviral à la génération suivante.
1.3.3 Organization du genome
Bien que le génome de tous les PDV soit constitué de segments circulaires d’ADNdb, le
nombre (~25 à > 100) et la taille (~2 à 42 kb) des segments génomiques varient d’une
espèce à l’autre (Tanaka et al, 2007; Krell et al., 1982; Fleming, 1992). La taille du
génome des polydnavirus est difficile à estimer de façon précise, mais on sait qu’ils sont
typiquement de grande taille (187 à 567 kb), polymorphiques, qu’ils contiennent une
proportion importante d’ADN non-codant (70%) et qu’ils sont dépourvus de gènes
nécessaires à la réplication ou à l’élaboration des protéines structurales de la capside.
Puisque la réplication est confinée à l’ovaire de la guêpe, les gènes de rréplication ne sont
présents que dans le génome de la guêpe (i.e. ne sont pas encapsidés). D’ailleurs, une
équipe vient d’identifier, dans les génomes de guêpes porteuses, des gènes d’origine
nudivirale encodant des protéines structurales de BV (Bezier et al., 2009). Les gènes
polydnaviraux peuvent donc tous être qualifiés de gènes de virulence, i.e., qui induisent
des pathologies chez la chenille hôte (Tanaka et al., 2007).
Dans un génome polydnaviral les segments génomiques ne sont pas présents en quantités
équimolaires, ce qui entraîne des différences de dosage génique pouvant affecter le
niveau d’expression de certains gènes chez les chenilles infectées. Bien que l’expression
des gènes polydnaviraux ait été étudiée principalement chez les larves parasitées, certains
de ces gènes sont aussi exprimés chez la guêpe porteuse. On reconnait d’ailleurs trois
classes de gènes polydnaviraux: les gènes de classe I, qui sont exprimés chez la guêpe
durant la réplication du virus, ceux de classe II, qui sont exprimés chez l’hôte parasité, et
ceux de classe III, qui sont exprimés à la fois chez la guêpe et chez son hôte lépidoptère
(Theilmann & Summers, 1988; Kroemer & Webb, 2004). Les guêpes « infectées » (ou
7
« porteuses ») étant asymptomatiques, on comprend que les gènes de la classe II, dont
l’expression est responsable des effets pathologiques observés chez la chenille hôte, aient
reçu plus d’attention que ceux des autres classes (Kroemer & Webb, 2004). Il faut
cependant noter que les gènes de virulences identifiés chez les BV et les IV sont, pour la
majorité, distincts les uns des autres.
1.3.4 Bracovirus
Les virions des bracovirus sont constitués de nucléocapsides cylindriques de diamètre
uniforme mais de longueur variable. Les virions sont composés d’une ou de plusieurs
nucléocapsides, enveloppées par une membrane unitaire simple. Des analyses ont montré
que chaque nucléocapside contient un seul segment génomique, et que la longueur de la
nucléocapside est vraisemblablement proportionnelle à la taille du segment génomique
qu’elle contient (Albrecht et al., 1994; Beck et al., 2007).
Chez les PDV de façon générale, les gènes se sont diversifiés en familles, et le génome
d’un virus contient typiquement plusieurs familles de gènes. Pour les BV, on en a recensé
dix: EP-1, egf, glc, HP, PTP, cyst, BV-like et Rec-like, crp (ou Cys) et ank. Seules ces
deux dernières familles sont communes aux IV et aux BV (Kroemer & Webb, 2004).
Certaines de ces familles contiennent des gènes qui codent pour des protéines affichant
des similitudes significatives à d’autres protéines eucaryotiques déjà caractérisées. C’est
le cas, par exemple, des protéines Egf-motif du BV de Microplitis demolitor (MdBV). Ces
gènes génèrent des transcrits épissés qui codent pour des protéines homologues aux
facteurs de croissance épidermique, lesquels sont riches en cystéines (Strand et al., 1997;
Trudeau et al., 2000). Cette similitude a permis de formuler des hypothèses quant à leur
fonction et de les évaluer.
8
1.3.5 Ichnovirus
Sur la base des connaissances actuelles, les génomes d’IV comportent plus de 20
segments génomiques dont la taille individuelle varie entre 2 et 28 kb. La taille totale du
génome est estimée à 250-300 kb. Les nucléocapsides d’ichnovirus de guêpes
campoplégines sont de forme lenticulaire et de taille relativement uniforme (~85 nm x
330 nm), et sont individuellement enveloppés de deux membranes unitaires (Stoltz, 1993;
Stoltz et al, 1995a ; Webb, 1998). Chaque nucléocapside est de taille suffisante pour
contenir le génome complet, bien que cette hypothèse n’ait pas encore été évaluée
expérimentalement. Les nucléocapsides d’ichnovirus de guêpes banchines sont de taille
plus petite et de longueur plus variable, et peuvent être enveloppés individuellement ou
en groupes (Lapointe et al., 2007).
Comme chez les BV, on reconnait plusieurs familles de gènes chez les IV de guêpes
campoplégines: Cys, rep, ank, inx, PRRP, TrV, et N. De façon étonnante, les familles de
gènes des IV de guêpes banchines s’apparentent davantage à celles des BV (pour plus de
détails, voir Lapointe et al., 2007). Les fonctions des gènes de certaines familles sont
connues (ou on a une bonne idée de ce qu’elles semblent être) en raison de la similitude
des protéines encodées à d’autres protéines eucaryotiques déjà caractérisées. C’est le cas,
par exemple, des ankyrines (ank), des innexines (inx) et des protéines Cys-motif (Cys) ;
toutes ces protéines semblent être impliquées dans la dépression du système immunitaire
de l’hôte (Kroemer & Webb, 2004). Par contre, d’autres ne présentent aucune similitude
à des protéines connues ou n’affichent aucun motif reconnaissable. C’est le cas, par
exemples, des protéines des familles TrV et rep. Les gènes ichnoviraux rep (repeat
element protein) sont ainsi nommés parce qu’ils contiennent des motifs d’éléments
répétés imparfaits de ~540 bp (Theilmann & Summers, 1988). Ils représentent la famille
de gènes ichnoviraux la plus hautement conservée et la mieux représentée (50% des
gènes assignés) chez les quatre espèces étudiées (Tanaka et al. 2007; Volkoff et al. 2002;
Galibert et al. 2006). Des études antérieures suggèrent qu’ils encodent des protéines non-
sécrétées de fonction inconnue (Tanaka et al, 2007).
9
1.4 La guêpe Tranosema rostrale, un parasitoïde de la TBE
Parmi les parasitoïdes qui attaquent communément la TBE dans la région de Québec, on
compte la guêpe Tranosema rostrale (Brischke) (Hymenoptera : Ichneumonidae :
Campopleginae). Il s’agit d’un endoparasitoïde solitaire capable de pondre dans tous les
stades post-diapausants de son hôte, avec une préférence pour les stades 3 à 5 (Cusson et
al., 1998b).
1.4.1 Le polydnavirus de Tranosema rostrale (TrIV)
La guêpe ichneumone T. rostrale pond ses œufs dans la cavité abdominale de son hôte
principal, la TBE. Au moment de la ponte, la guêpe femelle injecte dans son hôte une
dose de polydnavirus, lequel est connu sous le nom de Tranosema rostrale ichnovirus
(TrIV). Contrairement à d’autres IVs caractérisés à ce jour, TrIV ne semble pas jouer un
rôle important dans la suppression de la réponse immunitaire cellulaire de l’hôte.
Toutefois, il inhibe très fortement la métamorphose (Doucet et Cusson, 1996a, b). Dans
l’hôte parasité, les gènes viraux sont exprimés, ce qui mène à des changements qui
permettent aux œufs et larves de guêpe d’achever leur développement (Doucet et Cusson,
1998 a, b). Le parasitisme débute à la fin mai dans la région de Québec et le
développement post-embryonnaire comprend trois stades larvaires qui durent environ 14
jours à 20°C. Au premier stade larvaire, les larves se nourrissent des tissus de l’hôte
(Cusson et al, 1998a). À la fin du troisième stade, les larves de T. rostrale quittent leur
hôte et tissent un cocon dans lequel elles entreprennent la pupaison et la métamorphose.
La guêpe adulte émerge du cocon au bout de 9 à 10 jours; en forêt, cela correspond à la
fin juin-début juillet. Quelques jours après l’émergence, les adultes sont prêts pour la
reproduction et on croit qu’une ou deux autres générations additionnelles se produisent au
cours du reste de l’été sur des hôtes autres que la TBE (Fig. 1-2) (Cusson et al., 1998a).
Plus de 80% du génome de TrIV a été séquencé et sa taille totale est estimée à environ
250 kb. L’analyse du génome de TrIV indique la présence de représentants de chacune
10
des familles connues de gènes d’ichnovirus. Le génome de TrIV contient aussi une
famille, TrV, qui semble lui être unique (Tanaka et al., 2007).
œuf
larve
Polydnavirus
pupe dans
adulte
ponte
Pup s
c
e dan
ocon
Figure 1-2 Représentation schématisée du cycle vital de Tranosema rostrale (Laforge, 1999).
Le génome de TrIV contient au moins 17 cadres de lecture ouverts (« open reading
frames » ou ORF) encodant des protéines rep; les gènes sont situés sur 10 segments
génomiques différents (Tanaka et al., 2007). Tel que mentionné ci-dessus, la fonction de
ces gènes est inconnue. Parce qu’ils représentent la famille de gènes ichnoviraux la plus
hautement conservée et la mieux représentée chez les quatre espèces étudiées, on peut
supposer que leur fonction au cours du parasitisme est d’une d’importance fondamentale.
1.5 Objectifs du projet
Cette étude a d’abord été entreprise dans le but d’explorer les fonctions possibles des
gènes rep chez les deux hôtes de TrIV, la chenille de TBE parasitée et la guêpe T.
rostrale. Dans un premier temps, j’ai réalisé une étude en q-RT-PCR pour quantifier les
transcrits des 17 gènes rep de TrIV chez des larves de TBE parasitées par T. rostrale ou
injectées du virus TrIV, ainsi que dans des tissus spécifiques de larves parasitées et des
ovaires de guêpes. En réalisant cette étude, j’espérais que les patrons de transcription
11
observés fournissent des indices sur la fonction possible des gènes rep. Ces analyses sont
présentées au Chapitre II.
Au Chapitre III, je compare l’expression des gènes rep à celle de plusieurs autres gènes
de TrIV identifiés lors de l’annotation du génome (Tanaka et al., 2007). À cette fin, j’ai
d’abord construit une banque d’ADNc en utilisant de l’ARN extrait de chenilles
infectées. En utilisant des amorces spécifiques pour chaque ORF, j’ai tenté d’amplifier
chaque gène par PCR à partir de la banque d’ADNc. Les amplicons ont alors été clonés
pour séquençage; dans les cas de gènes épissés, cette approche a permis de déterminer si
les jonctions d’épissage avaient été prédites correctement. En complément, j’ai évalué les
niveaux de transcrits pour les mêmes ORF dans des larves de TBE parasitées ou injectées
de virus ainsi que dans des ovaires guêpe, par qPCR. Cette étude, a permis de comparer
l’importance relative de chaque famille de gènes en termes de niveaux d’expression.
La conclusion générale, présentée au Chapitre IV, aborde des thèmes qui n’ont pu faire
l’objet d’un traitement approfondi dans les deux chapitres précédents. J’y explore aussi
quelques unes des façons dont la recherche sur les familles de gènes de PDV pourrait
mener à la mise au point de nouveaux outils de lutte contre les ravageurs.
A l’Annexe A, je présente le travail que j’ai entrepris dans le but d’évaluer, par analyse
«microarray», l’impact de la sur-expression d’un gène rep, dans des cellules de TBE, sur
la modulation de l’expression des gènes de TBE. L’objectif de ce travail était d’identifier
les voix métaboliques affectées par les gènes rep, ce qui pourrait fournir d’autres indices
sur leurs fonctions. Au moment de compléter la rédaction du présent mémoire, l’analyse
microarray n’avait pas encore été menée; ainsi, l’Annexe A décrit la procédure utilisée
pour la sur-expression d’un gène rep dans des cellules de TBE en culture. Les Annexes B
et C, quant à elles, contiennent des données supplémentaires relatives aux articles
reproduits dans les Chapitres II et III, respectivement.
12
1.6 Références
1. Albrecht, A., Wyler, T., Pfister-Wilhelm, R., Heiniger, P., Hurt, E., Gruber, A.,
Schumperli, D. & Lanzrein, B., (1994) Polydnavirus of the parasitic wasp
Chelonus inanitus (Braconidae): characterization, genome organization and time
point of replication. J. Gen. Virol. 75, 3353-3363.
2. Armstrong, J.A. & Ives, W.G.H. (1995). Introduction. Insectes forestiers
ravageurs au Canada. Armstrong J.A. et Ives, W.G.H., Eds. Ressources naturelles
Canada, Ottawa.
3. Asgari, S. (2007). Endoparasitoid venom proteins as modulators of host immunity
and development. In Rivers, D. and Yoder, J. (Ed.), Recent Advances in the
Biochemistry, Toxicity, and Mode of Action of Parasitic Wasp Venoms (pp. 57-
73) India: Research Signpost.
4. Beck, M. H., Inman, R. B. & Strand, M. R. (2007). Microplitis demolitor
bracovirus genome segments vary in abundance and are individually packaged in
virions. Virology. 359, 179-189.
5. Bézier, A., Annaheim, M., Herbinière, J., et al. (2009). Polydnaviruses of
braconid wasps derive from an ancestral nudivirus. Science. 323, 926 – 930.
6. Coulson, R., Witter, J. (1984). Forest entomology, ecology, and management.
New York: John Wiley. 669 pp.
7. Cusson, M., Barron, J.R., Goilet, H., Régnière, J. & Doucet, D. (1998a). Biology
and status of Tranosema rostrale (Hymenoptera: Ichneumonidae), a parasitoid of
the eastern spruce budworm (Lepidoptera: Tortricidae). Ann. Entomol. Soc. Am.
91, 87-93.
8. Cusson, M., Lucarotti, C., Stoltz, D., Krell, P. & Doucet, D. (1998b). A
polydnavirus from the spruce budworm parasitoid, Tranosema rostrale
(Ichneumonidae). J. Invertebr. Pathol. 72, 50-56.
13
9. Dajoz, R. (2000). Insects and Forests, the Role and Diversity of Insects in the
Forest Environment. Intercept Ltd, New York.
10. Doucet D, Cusson M. (1996a). Alteration of developmental rate and growth of
Choristoneura fumiferana parasitized by Tranosema rostrale: role of the calyx
fluid. Entomol. Exp. Appl. 81, 21-30.
11. Doucet D, Cusson M. (1996b). Role of calyx fluid in alterations of immunity in
Choristoneura fumiferana larvae parasitized by Tranosema rostrale. Comp.
Biochem. Physiol. 114, 311-317.
12. Fleming, J.G.W. (1992). Polydnaviruses: mutualists and pathogens. Annu. Rev.
Entomol. 37, 401-425.
13. Fleming, J.G.W & Krell, P.J. (1993). Polydnavirus organization. In parasites and
pathogens of insects (Edited by Beckage N.E., Thampson, S.N. and Federici, B.
A.), Vol, 2, 189-225.
14. Fleming J.G.W. & Summers M.D. (1986). Campoletis sonorensis endoparasitic
wasps contain forms of C. sonorensis virus DNA suggestive of integrated and
extrachromosomal polydnavirus DNAs. J. Virol. 57, 552-562.
15. Galibert, L., Devauchelle, G., Cousserans, F., Rocher, J., Cérutti, P., Barat-
Houari, M., Fournier, P. & Volkoff, A. N. (2006). Members of the Hyposoter
didymator Ichnovirus repeat element gene family are differentially expressed in
Spodoptera frugiperda. J. Virol. 3, 48.
16. Gullan, P.J. & Cranston, P.S. (2000). The insects: An outline of entomology,
second edition. Blackwell Science Ltd, Eds., USA.
17. Hajek, A.E. (2004). Natural enemies: an introduction to biological control.
Cambridge University Press. Cambridge, UK.
14
18. Krell P.J., Summers M.D. & Vinson S.B. (1982). Virus with a multipartite
superhelical genome from the inchneumonid parasitoid, Campoletis sonorensis. J.
Virol. 43, 859-870.
19. Kroemer, J. A. & Webb, B. A. (2004). Polydnavirus genes and genomes:
emerging gene families and new insights into polydnavirus replication. Annu.
Rev. Entomol. 49, 431-456.
20. Lacey, L.A., Frutos R., Kaya H.K. & Vail, P. (2001). Insect pathogens as
biological control agents: Do they have a future? Biol. Control. 21, 230-248.
21. Laforge, M. (1999). Expression des gènes du polydnavirus de Tranosema rostrale
chez La tordeuse des bourgeons de L’épinette, Choristoneura fumiferana.
Mémoire de maîtrise, Faculté des études supérieures de l’Université Laval.
22. Lapointe, R., Tanaka K., Barney, W. E., Whitfield, J. B., Banks, J. C, Béliveau,
C., Stoltz, D., Webb, B. A., and Cusson M. (2007). Genomic and Morphological
Features of a Banchine Polydnavirus: Comparison with Bracoviruses and
Ichnoviruses. J. Virol. 81, 6491-6501.
23. Marti, D., Grossniklaus-Burgin, C., Wyder, S., Wyler, T. & Lanzrein, B. (2003).
Ovary development and polydnavirus morphogenesis in the parasitic wasp
Chelonus inanitus. I. Ovary morphogenesis, amplification of viral DNA and
ecdysteroid titres. J. Gen. Virol. 84, 1141–1150.
24. Norton, W.N., Vinson, S.B. & Stoltz, D.B. (1975). Nuclear secretory particles
associated with the calyx cells of the inchneumonid parasitoid Campoletis
sonorensis (Cameron). Cell Tissue. Res. 162, 195-208.
25. Stoltz, D.B., Beckage, N.E., Blissard, G.W., Fleming, J.G.W., Krell, P.J.,
Theilmann, D.A., Summers, M.D. & Webb, B.A. (1995a). Family Polydnaviridae.
Virus Taxonomy. Murphy, F.A., Fauquet, C.M., Bishop, D.H.L., Ghabrial, S.A.,
Jarvis, A.W., Martelli, G.P., Mayo, M.A. & Summers, M.D., Eds. Springer-
Verlag, New York.
15
26. Stoltz, D., Shen, X.-R., Boggis, C. & Sisson, G. (1995b). Molecular diagnosis of
Kashmir bee virus infection. J. Apic Res. 34, 153–160.
27. Stoltz, D. B. (1993). The polydnavirus life cycle. In Parasites and Pathogens of
Insects, 1, 80-101. Edited by N. Beckage, S. N. Thompson & B. A. Federici. San
Diego, CA: Academic Press.
28. Stoltz, D.B. (1990). Evidence for chromosomal transmission of polydnavirus
genomes. Can. J. Microbiol. 36, 538-543.
29. Stoltz, D. B., Guzo, D. & Cook, D. (1986). Studies on polydnavirus transmission.
Virology. 155, 120-131.
30. Stoltz, D.B. and Vinson S.B. (1979). Viruses and parasitism in insects. Adv. Virus
Res. 24, 125-171.
31. Stoltz, D.B., & Vinson, S.B. (1977). Baculovirus-like particles in the reproductive
tracts of female parasitoid wasps. II. The genus Apanteles. Can. J. Microbiol. 23,
28-37.
32. Stoltz, D.B., Vinson, S.B. & MacKinnon E.A. (1976). Baculovirus-like particles
in the reproductive tracts of female parasitoid wasps. Can. J. Microbiol. 22, 1013-
1023.
33. Strand, M.R., Witherell, R.A. and Trudeau, D. (1997). Two Microplitis demolitor
polydnavirus mRNAs expressed in hemocytes of pseudoplusia includens contain
a common cysteine-rich domain. J. Virol. 71, 2146-2156.
34. Tanaka, K., Lapointe, R., Barney, W. E., Makkay, A. M., Stoltz, D., Cusson, M. &
Webb, B. A. (2007). Shared and species-specific features among ichnovirus
genomes. Virology. 363, 26-35.
35. Tanaka, T. and Vinson, S.B. (1991). Depression of prothoracic gland activity of
Heliothis virescens by venom and calyx fluids from the parasitoid, Cardiochiles
nigriceps. J. Insect. Physiol. 37, 139–144.
16
17
36. Theilmann, D. A. & Summers, M. D. (1988). Identification and comparison of
Campoletis sonorensis virus transcripts expressed from four genomic segments in
the insect hosts Campoletis sonorensis and Heliothis virescens. Virology. 167,
329-341.
37. Trudeau, D., Witherell, R.A., Strand, M.R. (2000). Characterization of two novel
Microplitis demolitor polydnavirus mRNAs expressed in Pseudoplusia includens
haemocytes. J. Gen. Virol. 81, 3049– 3058
38. Turnbull M, Webb B. (2002). Perspectives on polydnavirus origines and
evolution. Adv. Virus Res. 58, 203-54.
39. Webb, B.A. (1998). Polydnavirus biology, genome structure, and evolution. In
Insect Viruses. Miller, L.K. & Ball, L.A., Eds. Plenum Publishing Corporation,
New York.
40. Whitfield, J.B. (2002). Estimating the age of the polydnavirus/braconid wasp
symbiosis. PNAS. 99, 7508-7513.
41. Volkoff, A. N., Béliveau, C., Rocher, J., Hilgarth, R., Levasseur, A., Duonor-
Cérutti, M., Cusson, M. & Webb, B. A. (2002). Evidence for a conserved
polydnavirus gene family: ichnovirus homologs of the CsIV repeat element genes.
Virology. 300, 316-331.
CHAPITRE 2
Tranosema rostrale ichnovirus repeat element
genes display distinct transcriptional patterns in
caterpillar and wasp hosts1
2.1 Summary
The endoparasitic wasp Tranosema rostrale transmits an ichnovirus (IV) to its
lepidopteran host, Choristoneura fumiferana, during parasitization. As shown for other
IVs, the segmented dsDNA genome of the T. rostrale virus (TrIV) features several multi-
gene families, including the repeat element (rep) family, whose products display no
known similarity to non-IV proteins, except for a homolog encoded by the genome of the
Helicoverpa armigera granulovirus; their functions remain unknown. This study applied
linear regression of efficiency analysis to the real-time PCR quantification of transcript
abundance for all 17 TrIV rep open reading frames (ORFs), in parasitized and virus-
injected C. fumiferana larvae, as well as in T. rostrale ovaries and head-thorax
complexes. Although transcripts were detected for most rep ORFs in infected caterpillars,
1 This chapter appeared in the June 2009 issue of Journal of General Virology. Rasoolizadeh, A., Béliveau C., Stewart
D., Cloutier C., & Cusson M. (2009). Tranosema rostrale ichnovirus repeat element genes display distinct
transcriptional patterns in caterpillar and wasp hosts. J. Gen. Virol. 90 (6), 1505-1514.
18
two of them clearly outnumbered the others in whole larvae, with a tendency for levels to
drop over time after infection. The genome segments bearing the three most highly
expressed rep genes in parasitized caterpillars were present in higher proportions than
other rep-bearing genome segments in TrIV DNA, suggesting a possible role for gene
dosage in the regulation of transcription level. TrIV rep genes also showed important
differences in the relative abundance of their transcripts in specific tissues (cuticular
epithelium, fat body, haemocytes, and midgut), implying tissue-specific roles for
individual members of this gene family. Significantly, no rep transcripts were detected in
T. rostrale head-thorax complexes whereas some were abundant in ovaries. There, the
transcriptional pattern was completely different from that observed in infected
caterpillars, suggesting that some rep genes have wasp-specific functions.
2.2 Résumé
La guêpe endoparasitoïde Tranosema rostrale transmet un ichnovirus (“TrIV") à son hôte
lépidoptère, Choristoneura fumiferana, au moment de la ponte. TrIV possède un génome
segmenté à ADN double-brin circulaire, lequel contient des gènes appartenant à plusieurs
familles, dont la famille repeat element (rep). Les produits de ces gènes n’ont pas
d’homologues connus à l’extérieur des ichnovirus, à l'exception de protéines encodées
par le génome du granulovirus d’Helicoverpa armigera; leurs fonctions demeurent
inconnues. La présente étude a appliqué la méthode LRE à l’analyse RT-PCR en temps
réel (qPCR) pour quantifier l'abondance des transcrits de 17 gènes rep de TrIV chez des
larves de C. fumiferana parasitées par T. rostrale ou injectées du virus, ainsi que dans les
ovaires et le complexe tête-thorax de T. rostrale. Alors que des transcrits ont été détectés
pour la majorité des gènes rep dans des chenilles infectées, deux d'entre eux avaient des
transcrits beaucoup plus abondants que ceux des autres gènes rep dans des larves
infectées, avec une tendance à la baisse des niveaux au fil du temps après l'infection. Les
segments génomiques portant les trois gènes rep qui étaient exprimés le plus fortement
dans les chenilles parasitées étaient présents, dans l'ADN de TrIV, en proportions plus
élevées que les autres segments génomiques portant des gènes rep, ce qui suggère un rôle
possible pour le dosage des gènes dans la régulation du niveau de transcription.
19
L’abondance relative des transcripts de chaque gène rep de TrIV s’est avérée variable
parmi quatre tissus larvaires de C. fumiferana (épithélium cuticulaire, corps gras,
hémocytes et intestin moyen), ce qui suggère des rôles distincts ou la spécialisation de
ces gènes à l’égard des différents tissus. Bien qu’aucun transcrit de gène rep n’ait été
détecté dans le complexe tête-thorax de T. rostrale, certains étaient abondants dans les
ovaires. Là, le patron de transcription était complètement différent de celui observé chez
des chenilles infectées, ce qui suggère que certains gènes rep ont des fonctions
spécifiques à la guêpe.
2.3 Introduction
Hymenopteran endoparasitoids deposit their eggs within the haemocoele of arthropods,
most of which are insects (Eggleton & Belshaw, 1993). To protect their eggs from
detection by the host immune system and to provide an appropriate developmental and
physiological milieu for survival of their immature progeny within the host, female wasps
typically inject their eggs along with various materials capable of disguising the egg
surface and/or altering host physiology. For example some members of the families
Ichneumonidae and Braconidae transmit, to their caterpillar hosts, a virus that is essential
for survival of the immature wasp within the parasitized insect (reviewed in Stoltz, 1993).
These viruses, known as polydnaviruses (PDVs), feature a segmented, circular dsDNA
genome, with individual genome segments varying in size and genetic content. A copy of
the viral genome is present as a provirus within the wasp’s chromosomes, thus providing
a mechanism for the vertical transmission of PDVs within parasitoid populations. Viral
replication is restricted to the calyx region of the wasp ovary, from which virions are
released into the lumen of lateral oviducts. There, they form the particulate fraction of the
"calyx fluid" (CF). During oviposition a female wasp injects one or more eggs, along
with CF and other secreted proteins and venom, into the lepidopteran host. Although no
viral replication occurs in parasitized caterpillar, expression of PDV genes causes
developmental and immune dysfunctions that protect the egg and wasp larvae from
encapsulation by host hemocytes and/or lead to retardation or arrest of host
20
metamorphosis, thus providing more time for the wasp larva to complete its development
in advance of host pupation (reviewed in Kroemer & Webb, 2004; Stoltz, 1993).
PDV genes are divided into three large categories based on whether they are expressed in
the carrier wasp (class I), the infected caterpillar (class II) or both (class III; Theilmann &
Summers, 1988). Because of their potentially major significance in the success of
parasitism, class II genes have been studied more extensively than those of the other two
groups. A number of these genes encode proteins displaying motifs or structural and
sequence features observed in previously characterized eukaryotic proteins. Based on
these similarities, it has been possible to generate and test hypotheses about their likely
functions. Such an approach has led to proposed functions for various PDV genes (e.g.,
the vankyrins; Falabella et al., 2007; Kroemer & Webb, 2005; Thoetkiattikul et al.,
2005).
Other PDV genes, however, display no known similarity to other eukaryotic or viral
(non-PDV) genes, rendering their functional analysis more difficult. Such is the case of
the repeat element (rep) gene family, the largest gene family identified to date in the
genus Ichnovirus (PDVs associated with ichneumonid wasps). These genes consist of
imperfectly conserved repeats of ~540-bp arranged either singly or in direct tandem
arrays (Theilmann & Summers, 1987). Members of the rep gene family encode non-
secreted proteins that are conserved among several ichnovirus species (Tanaka et al.,
2007; Volkoff et al., 2002; Webb et al., 2006). Expression of rep genes has been detected
in both parasitoids and their parasitized hosts (Galibert et al., 2006; Theilmann &
Summers, 1988). The Tranosema rostrale ichnovirus (TrIV) genome contains at least 17
different ORFs identified as belonging to the rep gene family; they are located on 10
different genome segments (Tanaka et al., 2007). In an earlier study, two TrIV rep genes
(TrFrep1 and TrFrep2) were shown to be expressed from TrIV genome segment F
(Volkoff et al., 2002; this genome segment has been renamed F1 and the two rep genes it
contains are now referred to as F1-1 and F1-2; Tanaka et al., 2007). As a first step
towards elucidating the function(s) of these gene products, we initiated a study of the
temporal and tissue-specific transcription of all known and putative TrIV rep genes. A
similar study of 10 rep genes from the ichnovirus of Hyposoter dydimator (HdIV) has
21
revealed important differences in gene-specific transcript abundance, but minor
differences in host and tissue specificity (Galibert et al., 2006). Using a recently
developed and powerful qPCR approach (Rutledge and Stewart, 2008a, b), the present
study examines transcriptional patterns in the host Choristoneura fumiferana, either
naturally parasitized by T. rostrale or injected with its CF, as well as in the wasp’s
ovaries and head-thorax complexes. We also examine the possible effect of gene dosage
(i.e. relative genome segment abundance) on rep gene transcription. Finally, we present
new bioinformatics analyses conducted with the intent of detecting rep homologs among
more recent GenBank entries.
2.4 Material and methods
2.4.1 RNA and DNA extraction
Within 24 h after the moult to the last (6th) instar, C. fumiferana larvae were either
parasitized once by T. rostrale or injected with 0.5 female-equivalent (FE) of T. rostrale
calyx fluid (CF), as described (Doucet & Cusson, 1996 a, b). For each sampling point [1,
3 and 5 d post-parasitization (p.p.) or post-injection (p.i.)], total RNA was extracted and
pooled from 3-5 whole C. fumiferana larvae, using the TRIZOL reagent (Invitrogen),
according to the manufacturer’s instructions (Béliveau et al., 2000). RNA was also
extracted from fat body (FB), cuticular epithelium (CE), midgut (MG) and haemocytes
(HC) obtained from a pool of 3-5 larvae 48 h after parasitization. In addition, total RNA
was extracted and pooled from five ovary pairs dissected from post-emergence 5-10 day-
old T. rostrale females, using the QIAshredder and RNeasy Mini Kit (Qiagen), according
to the manufacturer’s instructions. The head-thorax complexes of the same five females
were also subjected to total RNA extraction using the TRIZOL reagent.
TrIV DNA was extracted from the CF of 16 T. rostrale female wasps as described (Stoltz
et al., 1986). The DNA was first ethanol-precipitated and then resuspended in 100 μl TE,
pH 7.6.
22
2.4.2 Reverse transcription and qPCR
To remove DNA contaminants from RNA extracts, 500 ng of total RNA was treated with
2 U amplification-grade DNase I (Invitrogen) for 15 min at 25°C. We ran controls with
no reverse transcriptase for the four most highly transcribed ORFs and detected no
significant amplification, indicating the absence of genomic DNA contamination in the
extracts. RNA (500 ng) from parasitized and CF-injected C. fumiferana larvae, as well as
from T. rostrale head-thorax complexes, and 200 ng RNA from ovarian tissue was
reverse-transcribed using 0.5 µg of an oligo(dT) primer and 200 U Superscript II RNase
H- reverse transcriptase (Invitrogen). The reaction was carried out in 1x PCR buffer, with
0.5 mM of each dNTP and 40 U of RNAguard ribonuclease inhibitor (Amersham
Biosciences), at 42˚C for 50 min.
For qPCR analysis, four primers were initially designed for each rep gene, using diverse
regions among aligned rep nucleotide sequences. These four primer pairs were used to
assess primer performance and quantitative precision. Initial amplification tests were
conducted on reverse-transcribed RNA obtained from parasitized C. fumiferana larvae. A
single primer pair was then selected for each rep gene (see Supplementary data in
Annexe B), based upon high amplification efficiency and lack of non-specific
amplification products, and used for the analysis of the remaining samples.
PCR amplifications were carried out on aliquots of individual RT reactions containing
cDNA in amounts equivalent to 2.5 ng RNA, except for ovarian samples, which
contained amounts of cDNA equivalent to 1 ng RNA. Four replicate amplification
reactions containing 500 nM of each primer were conducted for each sample, using an
MX3000P spectrofluorometric thermal cycler (Stratagene) and QuantiTectTM SYBR
Green PCR Kit (Qiagen), initiated with a 15-min incubation at 95˚C, followed by a
cycling regime of 95˚C, 10 s and 65˚C, 2 min. Each run was completed with a melting
curve analysis to confirm the specificity of amplification and absence of primer dimers.
Amplification efficiency was determined for each amplification reaction using LRE
(“linear regression of efficiency”) analysis, and the number of target molecules calculated
using lambda genomic DNA as a quantitative standard (Rutledge & Stewart, 2008a, b).
23
LRE is a powerful methodology recently developed for modeling real-time qPCR
amplification. It provides absolute target amounts without the need to produce standard
curves and can generate absolute accuracies of < ±25%, while displaying single molecule
sensitivity.
To assess the proportion, within a TrIV DNA extract, of each rep gene-bearing genome
segment, the same qPCR approach was applied directly to 0.01 ng of TrIV DNA, using
one of the primer pairs designed for transcript quantification for each genome segment
(see Supplementary data in Annexe B).
To evaluate the accuracy of the measurements made here using LRE analysis, we applied
the “limiting dilution assay” (LDA; Wang & Spadoro, 1998) approach to three of our
samples, and compared the estimates obtained with each method. Briefly, based on
values determined by LRE, samples were diluted so that each of 20 replicate aliquots
would contain ~1 copy of cDNA or genomic DNA. As dictated by Poisson distribution, a
large proportion of aliquots will not contain a target molecule, and will fail to produce an
amplification profile. The average number of molecules per aliquot (Nav) can be
calculated using the equation:
total
nilLnNav
where nil is the number of amplification reactions failing to produce an amplification
profile and total is the total number of reactions [see Rutledge & Stewart, 2008b for
additional details about LDA]. Multiplication of Nav by the dilution factor provides the
LDA estimate.
2.4.3 Bioinformatics
To explore the possibility that sequences recently deposited in GenBank may be
homologous to ichnoviral rep genes, all TrIV rep proteins were submitted to a Blastp
24
analysis. Alignments of amino acid sequences were performed with CLUSTAL-X
(Thompson et al., 1997) using default settings.
2.5 Results and Discussion
2.5.1 Critical assessment of the LRE methodology
To assess the reliability of the qPCR estimates made in this study using the LRE
approach, target quantities in three of our samples were determined using both LRE and
LDA analysis. The LDA method generated estimates that were congruent with those
obtained by LRE analysis, for one DNA and two RNA samples (Table 2-1), confirming
the accuracy of the LRE methodology. In addition, amplification efficiencies were high
and uniform across all 17 rep genes, in all treatment groups, and across all 10 TrIV
genome segments, with maximal amplification efficiencies (Emax; see Rutledge & Stewart
2008a,b) of 101.3 ± 1.7% and 101.5 ± 1.5% (mean ± SD) for transcript and genome
segment abundance, respectively. Thus, in assessing transcript levels for large multi-gene
families such as those found in PDVs or for measuring the relative abundance of many
PDV genome segments, application of the LRE approach to qPCR determinations
provides unprecedented accuracy, and substantially improves analytical throughput over
methods requiring the production of standard curves for each DNA examined.
Table 2-1 Critical assessment of the accuracy of LRE-based qPCR determinations (Rutledge and Stewart, 2008a,b) by comparison with estimates obtained by application of the “limiting dilution assay” (LDA) method (Wang and Spadoro, 1998). Three example runs are shown here, two for transcript levels and one for viral DNA
(“Sample id”). Nil: number of amplification reactions failing to produce an amplification profile; Nav, mean number of molecules per aliquot (see Material and Methods for details). The LRE values reported here for transcripts (first two) are the copy number/2.5 ng of total RNA, while the value for C166 genomic DNA is the number of genome segments/0.01 ng of DNA (i.e., the concentrations at which the LRE measurements were made).
Sample id LRE values Dilution factor Nil Nav LDA values
F1.1, 3-d.p.p. 40,297 40,000 7 1.05 41,993
F1.1, 3-d.p.i. 137,822 140,000 8 0.92 128,281
C166 DNA 19,338 20,000 6 1.20 24,079
25
2.5.2 Transcript abundance in parasitized larvae
TrIV rep genes displayed important differences in gene-specific, time-dependent and
tissue-specific levels of transcripts in naturally parasitized last-stadium C. fumiferana
larvae. In whole caterpillars, transcripts were detected for almost all genes examined, but
transcript abundance was generally low [< 550 transcripts/ng total RNA] except for F1-1
(~16,000 at 3 days p.p.) and, to a lesser extent, F1-2 (~2,200 at 1 days p.p.; Fig 2-1).
Whether these differences in transcript abundance among rep genes are indicative of their
relative importance in the subjugation of C. fumiferana hosts is not clear, but the strong
predominance of F1-1 transcripts suggests that the product of this gene plays a vital role
in the success of parasitism.
Levels of rep gene transcripts were not stable during the course of parasitism and tended
to decrease by > 50% between the first (day 1) and last (day 5) sampling points p.p.,
although three genes (most notably F1-1) displayed higher levels of transcripts at 3 d p.p.
than at the other two sampling times (Fig 2-1). A temporal pattern of expression similar
to that observed here for F1-1 was reported earlier for another TrIV gene, TrV1, in
parasitized C. fumiferana larvae (Béliveau et al., 2000). Differences in temporal patterns
of expression among viral genes, in a given host, have been observed for other PDVs,
including examples where maximal transcript levels were seen several days after
oviposition (e.g., Ibrahim et al., 2007). Although such differences suggest that individual
PDV gene products may target specific phases of parasitism, the observed transcriptional
patterns may be dictated, at least in part, by the stability of the viral genome segments
from which transcripts are generated, a variable that could differ considerably according
to whether or not the developing wasp larva feeds on infected tissues supporting viral
gene expression (Beck et al., 2007).
26
Figure 2-1 Transcript levels of 17 TrIV rep genes in naturally parasitized C. fumiferana 6th instar larvae, as
determined by quantitative real-time RT-PCR using total RNA extracted from whole caterpillars, 1, 3 and 5
days post-parasitization (p.p.). Larvae were parasitized within 24 h after the molt to the 6th (last) stadium. Actual
transcript numbers are provided above each bar for values 50. Each value presented here is the mean of four technical
replicates carried out on an RNA extract obtained from a pool of 3-5 parasitized larvae. Error bars: SD.
In our investigation of tissue-specific transcription at 2 d p.p., the overall gene-specific
pattern of transcript abundance (Fig 2-2) was similar to that observed in whole larvae
(Fig 2-1), but with some notable exceptions. For example, in the four tissues examined,
F1-2 displayed lower proportions of transcripts relative to F1-1 than in whole larvae,
while the opposite trend was observed for F3-2. This suggests that the tissues supporting
high levels of F1-2 transcription were not sampled in the present study, whereas some of
the sampled tissues were enriched for F3-2 transcripts. More significantly, TrIV rep
genes exhibited important differences in their tissue specificity: whereas F1-1 transcripts
were most abundant in C. fumiferana cuticular epithelium and fat body, corroborating
earlier assessments made by northern blot analysis (Volkoff et al., 2002), the transcripts
of several other genes were at higher levels in haemocytes (B2-2, C7-2, F3-2) or the
midgut (C4-2, D5-2, D6-1 , F1-2) than in the other three tissues (Fig 2-2). These results
are in contrast with those obtained by Galibert et al. (2006), who found that the fat body
and cuticular epithelium of parasitized Spodoptera littoralis hosts had the highest levels
of HdIV rep transcripts for all 10 rep ORFs examined, followed by nervous tissue, which
was not investigated in the present study. It remains to be seen whether the observed
27
trend in HdIV rep gene expression was influenced by the choice of rep ORFs that were
studied, as we now know that the HdIV genome contains many additional rep genes (A.-
N. Volkoff, personal communication). Thus, this apparent difference between the two
biological systems could be due to a gene sampling bias.
Figure 2-2 Transcript levels of 17 TrIV rep genes in naturally parasitized 6th instar larvae, as determined by
quantitative real-time RT-PCR using total RNA extracted from four different tissues: FB, fat body; CE,
cuticular epithelium; HC, haemocytes; MG, midgut. The larvae were parasitized within 24 h after the molt to the 6th
(last) stadium, and the RNA extracted from individual tissues 2 days after parasitization. Each value presented here is
the mean of four technical replicates carried out on an RNA extract obtained from a pool of 3-5 parasitized larvae.
Error bars: SD.
Tissue-specific differences in polydnavirus gene transcript abundance in parasitized hosts
have also been observed for ichnovirus ank genes (Kroemer & Webb, 2005) and
bracovirus PTP genes (Gundersen-Rindal & Pedroni, 2006; Provost et al. 2004). Such
tissue-specific expression suggests that the diversity of genes within a given PDV gene
family may be associated with the existence of tissue-specific roles for different family
members in the caterpillar hosts, or that some of these related gene products, while
having the same function, are more effective in one tissue than in another. Irrespective of
its functional significance, tissue-specific variation in transcript levels implies that there
exist tissue-specific host factors modulating the transcription of specific rep genes.
28
2.5.3 Transcript abundance in CF-injected larvae
The TrIV rep transcript levels observed in CF-injected larvae (Fig 2-3) displayed gene-
specific and time-dependent differences similar to those observed for parasitized whole
larvae (Fig 2-1), with the exception that absolute transcript levels were generally much
higher than those observed at equivalent sampling times in parasitized larvae, particularly
1 d after treatment (> 85 times higher in the case of F1-1), indicating that the virus dose
contained in 0.5 FE of CF is much higher than that injected by a female wasp during
natural parasitization. As a point of comparison, the dose of virus injected by the wasp
Microplitis demolitor into its host has been estimated to be between 0.04 and 0.005 FE of
CF per ovipositional event (Beck et al., 2007).
Figure 2-3 Transcript levels of 17 TrIV rep genes in 6th instar larvae injected with 0.5 FE of T. rostrale calyx
fluid, as determined by quantitative real-time RT-PCR using total RNA extracted from whole caterpillars, 1, 3
and 5 d post-injection (p.i.). Larvae were injected within 24 h after the molt to the 6th (last) stadium. Actual transcript
numbers are provided above each bar for values < 2,000. Each value presented here is the mean of four technical
replicates carried out on an RNA extract obtained from a pool of 3-5 injected larvae. Error bars: SD.
29
Another difference between patterns found for parasitized and CF-injected larvae was the
rise seen in F1-1 transcript abundance on 3 d p.p., an increase that was not observed in
injected caterpillars, although absolute levels of F1-1 transcripts were higher in the latter
than in the former group, at all three sampling points. With few exceptions, transcript
levels decreased substantially from day 1 to days 3 and 5 p.i., suggesting that the
unusually high inoculum injected in larvae may have triggered, in the host, faster
clearance or breakdown of some viral DNA than in parasitized caterpillars. The present
qPCR findings for F1-1 (= TrFrep1) are in agreement with an earlier assessment made by
northern blot analysis which showed F1-1 to be transcribed at much higher levels in CF-
injected larvae than in parasitized caterpillars (Volkoff et al., 2002).
2.5.4 Transcript abundance in wasp ovary and head-thorax complexes
The pattern of TrIV rep gene transcription in T. rostrale ovaries was markedly different
from that seen in naturally parasitized or CF-injected C. fumiferana larvae. Whereas F1-1
and F1-2 were the most highly expressed rep genes in infected caterpillars (Figs 2-1, 2-2
and 2-3), transcripts generated from these two genes displayed low abundance in wasp
ovaries compared with other genes such as C166-1, the transcript levels of which were by
far the highest (Fig 2-4).
Interestingly, the C3-1 gene, whose transcription was barely detectable in infected
caterpillars (Figs 2-1, 2-2 and 2-3), was the second most highly transcribed gene in wasp
ovaries. In addition, the transcript levels of C3-2, C7-2, D5-2 and F3-2, which were
modest in infected C. fumiferana larvae (Figs 2-1, 2-2 and 2-3), varied between ~5,000
and 10,000 per ng total RNA in wasp ovaries (Fig 2-4). In comparison, all TrIV rep
genes had undetectable or very low transcript levels in wasp head-thorax complexes (Fig
2-4).
30
Figure 2-4 Transcript levels of 17 TrIV rep genes in T. rostrale ovaries and head-thorax complexes, as
determined by quantitative real-time RT-PCR. Total RNA was extracted from five ovary pairs dissected from post-
emergence 5-10 day-old T. rostrale females and from the head-thorax complexes of the same females. Each value
presented here is the mean of four technical replicates carried out on each RNA extract. Actual transcript numbers are
provided above each bar for values < 500. Error bars: SD.
Using northern blot analysis, Theilmann and Summers (1988) provided the first report on
the transcription of CsIV rep genes in C. sonorensis female reproductive tissues. These
authors observed that some rep genes were transcribed exclusively in the parasitized host
while others produced transcripts only in wasp ovaries or in both hosts. The quantitative
transcriptional data provided here for 17 TrIV rep genes in both parasitized hosts and
wasp ovaries are in agreement with that earlier finding. The distinct transcriptional
patterns of rep genes in T. rostrale ovaries (Fig 2-4) and parasitized or CF-injected larvae
(Figs 2-1, 2-2 and 2-3) suggest that individual rep genes may play either wasp- or
caterpillar-specific roles. In contrast, HdIV rep1 was the most highly expressed rep gene
in both infected caterpillar hosts and wasp ovaries (Galibert et al., 2006), suggesting that
the host-specific expression reported here may not apply to all ichnoviruses. With respect
to TrIV, the observation that some rep genes may be expressed only in the wasp (e.g.,
C3-1) raises the questions as to (i) why such genes are found in a packaged virus meant
to be delivered to the lepidopteran host and (ii) whether there are additional, unpackaged
31
rep genes in the T. rostrale genome, expressed only in wasp ovaries. Of course, the
possibility exists that some of the TrIV rep genes that were found to be weakly expressed
in parasitized C. fumiferana larvae would be expressed strongly in other lepidopteran
hosts (e.g., C. rosaceana; Cusson et al., 1998) or tissues not sampled yet, including genes
that were found here to be expressed only in the ovary. Additionally, it is not quite clear
whether rep genes that are expressed in the wasp ovary are transcribed from episomal or
chromosomal DNA, or both. Interestingly, none of the rep genes that were found to be
expressed in T. rostrale ovaries were transcribed at significant levels in the other wasp
tissues examined (Fig 2-4), thus suggesting an ovary-specific role for those that are
transcribed in that tissue. Given that rep gene products are not predicted to be secreted,
rep proteins expressed in wasp ovaries are not expected to be released in the lumen of the
oviduct for subsequent injection into the caterpillar during parasitization. For this reason,
their expression in the ovary suggests that they could play a role in virus replication, a
hypothesis that could be tested by following developmental changes in ovarian rep
transcript abundance in pupae, the stage at which virus replication begins (Marti et al.,
2003; Webb & Summers 1992).
2.5.5 Gene dosage
In earlier work examining the relationship between the abundance of PDV gene
transcripts and the proportion of the genome segments bearing these genes within the
packaged viral genome, no clear correlation between the two variables was observed
(Beck et al., 2007; Galibert et al., 2006). Here, the three most highly expressed TrIV rep
genes in parasitized caterpillars, F1-1, F1-2 and C166-1 (Fig 2-1), were found to be
borne by the two most abundant TrIV genome segments (Fig 2-5), suggesting that gene
dosage, in this particular instance, may have some impact on transcript abundance.
Yet, when all TrIV rep genes were considered, we observed no significant correlation
between transcript levels and the proportion of the originating genome segments. Clearly,
factors other than, or in addition to, gene dosage affect transcript levels, including
possible differences in promoter strength, the presence or absence of host factors that
32
may affect the transcription of individual rep genes and/or differences in mRNA stability.
For example, there were important differences in the abundance of F1-1 and F1-2
transcripts, which are generated from genes present on the same genome segment.
Integration of genome segment F1 into the lepidopteran host genomic DNA could also be
a factor resulting in the enhancement of F1-1 and F1-2 transcription. Although the
integration of genome segment F1 has not been demonstrated in the parasitized host, it
clearly occurs in infected C. fumiferana CF-124T cells in culture (Doucet et al., 2007).
Such an integrational event would permit sustained expression of the integrated genes
when titers of episomal DNA go down. The question of whether other rep-containing
genome segments undergo integration into C. fumiferana genomic DNA remains to be
examined.
Figure 2-5 Assessment of genome segment abundance within the TrIV packaged genome, as determined by
quantitative real-time PCR using viral DNA as template. The same primer pairs used for transcript quantification
were used to quantify genome segments. C166 and C289 are contigs associated with genome segments that have not
been cloned and that remain partially sequenced (Tanaka et al., 2007). Error bars: SD.
33
2.5.6 Comparison of TrIV rep proteins and identification of non-polydnaviral rep homologs
A ClustalX alignment of all 17 deduced TrIV rep proteins revealed regions that are well
conserved across all members of this family, including five cysteine residues that are
present in all proteins except C7-2; the latter lacks the second and third cysteines, and its
N terminus is substantially truncated relative to the other TrIV rep proteins (Fig 2-6). The
most conserved region is observed in the vicinity of the fifth cysteine residue (Fig 2-6),
comprising a segment of ~18 amino acids that also appears well conserved among rep
proteins from other ichnoviruses, including those of Hyposoter fugitivus (HfIV) and
HdIV (Fig 2-7). A blastp search using all TrIV rep proteins as query sequences revealed
the existence of two putative rep homologs in the granulovirus of Helicoverpa armigera
(HearGV), the genome of which has recently been sequenced and annotated (Harrison &
Popham, 2008). One of these two proteins, hear76, has only 70 amino acid residues and
displays a modest level of similarity to ichnoviral rep proteins (e.g., blastp expect value
of 0.36 for similarity to TrIV F3-1); however, the other predicted protein, hear75, has 171
amino acid residues, contains 4 of the 5 conserved cysteine residues referred to above,
and shows significant similarity to many ichnoviral rep proteins, most notably within the
aforementioned highly conserved region (Fig. 2-7).
Blastp expect values for similarity between hear75 and ichnoviral rep proteins varied
between 6e-09 and 3e-05 for HfIV-D3-2 and TrIV-F3-1, respectively. No rep homologs
have been detected in the other baculovirus genomes sequenced to date; thus, their
presence in HearGV may well be the result of lateral gene transfer from an ichnovirus
genome (Harrison & Popham, 2008).
As observed in earlier analyses of rep proteins, no conserved domains were detected in
any of the 17 TrIV representatives of this family, with the exception of F1-2, in which a
PIWI-like domain was detected in the region comprised between residues 60 and 150, but
with a low (0.001) expect value. The same protein was also found to display a modest
level of similarity to a bacterial transposase (accession number: ABM04822) within its C
terminus, an interesting observation given that TrIV genome segment F1 has been shown
34
to spontaneously integrate into the genome of C. fumiferana cells in culture, through an
unidentified mechanism (Doucet et al., 2007).
Although the new bioinformatics analyses performed here provided few new insights into
the function(s) of rep genes, the presence of rep homologs in the recently sequenced
genome of a granulovirus could eventually provide an indirect means of assessing their
role through the production of a HearGV rep knock-out, followed by an assessment of
this genetic alteration on viral replication or other aspects of the infection cycle.
Deployment of this strategy, however, would require the prior development of an
efficient in vitro system for HearGV.
In summary, the present study suggests that the very high level of diversification seen
within the ichnoviral rep gene family may have evolved in response to the necessity to
fine-tune the function(s) and/or effectiveness of rep proteins for expression in different
hosts and tissues. Given that rep genes encode proteins that are not secreted and that
some of them are expressed at relatively high levels in wasp ovaries without any overt
pathological consequence, the possibility exists that their function has more to do with
cell homeostasis (in IV- or GV-infected lepidopteran cells or in ovarian wasp cells
supporting viral replication) than virulence. Some PDV-encoded proteins are secreted
and display deleterious effects on other cells (e.g., Béliveau et al., 2003); because PDVs
do not replicate in the lepidopteran host, sustained viral gene expression for the duration
of immature parasitoid development is predicted to require a mechanism preventing
infected cells from being negatively affected by secreted PDV proteins and/or
suppressing breakdown of viral DNA and transcripts by host cells. Some Campoletis
sonorensis ichnovirus (CsIV) ank gene products appear to have such a function given that
they have been shown to delay lysis of baculovirus-infected cells (Fath-Goodin et al.,
2006). We are currently examining the effect of TrIV rep gene expression on C.
fumiferana host cell gene expression, with the aim of identifying the pathway(s) targeted
by rep proteins.
35
Figure 2-6 ClustalX alignment of all known and predicted TrIV rep family proteins. Black arrows indicate the
positions of conserved cysteine residues. Asterisks (*), double dots (:) and single dots (.) above letters in the
alignments denote identical residues, and conserved and semi-conserved substitutions, respectively. GenBank accession
numbers: C7-1, BAF45598; C7-2, BAF45599; D5-1, BAF45610; D5-2, BAF45611; C289-1, BAF45769; C3-2,
BAF45588; F3-2, BAF45626; F3-3, BAF45627; F3-1, BAF73402; C4-1, BAF45589; C4-2, BAF45590; B2-2,
BAF45579; C3-1, BAF45585; D6-1, BAF45614; F1-1, AAN32723; F1-2, ACJ72220; C166-1, BAF45767.
36
Figure 2-7 ClustalX alignment of selected ichnoviral rep proteins from TrIV, HfIV, and HdIV, as well as a rep-
like protein from the granulovirus HearGV. Black arrows indicate the positions of conserved cysteine residues; the
grey arrow points to the third conserved cysteine residue, which is replaced by an alanine in the HearGV rep-like
protein. Asterisks (*), double dots (:) and single dots (.) above letters in the alignments denote identical residues, and
conserved and semi-conserved substitutions, respectively. GenBank accession numbers: HfIV-D3-2, BAF45718; HfIV-
D10-2, BAF45741; TrIV-F3-1, BAF73402; HdIV-rep5, AAR89177; HearGV-hear75, ABY47766.
Acknowledgements
The authors thank AN Volkoff for fruitful discussions about the work of her group on
HdIV rep genes and D Stoltz for helpful comments on an earlier version of the
manuscript. This research was supported by grants from the Canadian Forest Service
(CFS) and a Discovery grant from the Natural Sciences and Engineering Research
Council of Canada to MC.
37
2.6 References
1. Beck, M. H., Inman, R. B. & Strand, M. R. (2007). Microplitis demolitor
bracovirus genome segments vary in abundance and are individually packaged in
virions. Virology. 359, 179-189.
2. Béliveau, C., Laforge, M., Cusson, M. & Bellemare, G. (2000). Expression of a
Tranosema rostrale polydnavirus gene in the spruce budworm, Choristoneura
fumiferana. J. Gen. Virol. 81, 1871-1880.
3. Béliveau, C., Levasseur, A., Stoltz, D. & Cusson, M. (2003). Three related TrIV
genes: comparative sequence analysis and expression in host larvae and Cf-124T
cells. J Insect Physiol 49, 501-511.
4. Cusson, M., Barron, J. R., Goulet, H., Régnière, J. & Doucet, D. (1998). Biology
and status of Tranosema rostrale (Hymenoptera: Ichneumonidae), a parasitoid of
the eastern spruce budworm (Lepidoptera: Tortricidae). Ann. Entomol. Soc. Am.
91, 87-93.
5. Doucet, D. & Cusson, M. (1996a). Alteration of developmental rate and growth of
Choristoneura fumiferana parasitized by Tranosema rostrale: role of the calyx
fluid. Entomol. Exp. Appl. 81, 21-30.
6. Doucet, D. & Cusson, M. (1996b). Role of calyx fluid in alterations of immunity
in Choristoneura fumiferana larvae parasitized by Tranosema rostrale. Comp.
Biochem. Physiol. 114A, 311-317.
7. Doucet, D., Levasseur, A., Béliveau, C., Lapointe, R., Stoltz, D. & Cusson, M.
(2007). In vitro integration of an ichnovirus genome segment into the genomic
DNA of lepidopteran cells. J. Gen. Virol. 88, 105-113.
8. Eggleton, P. & Belshaw, B. (1993). Comparisons of dipteran, hymenopteran and
coleopteran parasitoids: provisional phylogenetic explanations. Biol. J. Linn. Soc.
48, 213-226.
38
9. Falabella, P., Varricchio, P., Provost, B., Espagne, E., Ferrarese, R., Grimaldi, A.,
Eguileor, M., Fimiani, G., Ursini, M. V. & other authors (2007). Characterization
of the IκB-like gene family in polydnaviruses associated with wasps belonging to
different braconid subfamilies. J. Gen. Virol. 88, 92-104.
10. Fath-Goodin, A., Gill, T. A., Martin, S. B., & Webb, B. A. (2006). Effect of
Campoletis sonorensis ichnovirus Cys-motif proteins on Heliothis virescens larval
development. J. Insect. Physiol. 52, 576-585.
11. Galibert, L., Devauchelle, G., Cousserans, F., Rocher, J., Cérutti, P., Barat-
Houari, M., Fournier, P. & Volkoff, A. N. (2006). Members of the Hyposoter
didymator Ichnovirus repeat element gene family are differentially expressed in
Spodoptera frugiperda. J. Virol. 3, 48.
12. Gundersen-Rindal, D.E. & Pedroni, M. J. (2006). Characterization and
transcriptional analysis of protein tyrosine phosphatase genes and an ankyrin
repeat gene of the parasitoid Glyptapanteles indiensis polydnavirus in the
parasitized host. J. Gen. Virol. 87, 311-322.
13. Harrison, R. L. & Popham, H. J. R. (2008). Genomic sequence analysis of a
granulovirus isolated from the Old World bollworm, Helicoverpa armigera. Virus
Genes 36, 565-581.
14. Ibrahim, A. M., Choi, J.Y., Je, Y.H., Kim, Y. (2007). Protein tyrosine
phosphatases encoded in Cotesia plutellae bracovirus: sequence analysis,
expression profile, and a possible biological role in host immunosuppression.
Dev. Comp. Immunol. 31, 978-990.
15. Kroemer, J. A. & Webb, B. A. (2004). Polydnavirus genes and genomes:
emerging gene families and new insights into polydnavirus replication. Annu.
Rev. Entomol. 49, 431-456.
16. Kroemer, J. A. & Webb, B. A. (2005). IκB-related vankyrin genes in the
Campoletis sonorensis ichnovirus: temporal and tissue-specific patterns of
39
expression in parasitized Heliothis virescens lepidopteran hosts. J. Virol. 79,
7617-7628.
17. Marti, D., Grossniklaus-Bürgin, C., Wyder, S., Wyler, T., & Lanzrein, B. (2003).
Ovary development and polydnavirus morphogenesis in the parasitic wasp
Chelonus inanitus. I. Ovary morphogenesis, amplification of viral DNA and
ecdysteroid titres. J. Gen. Virol. 84, 1141-1150.
18. Provost, B., Varricchio, P., Arana, E., Espagne, E., Falabella, P., Huguet, E., La
Scaleia, R., Cattolico, L., Poirié, M., & other authors. (2004). Bracoviruses
contain a large multigene family coding for protein tyrosine phosphatases. J.
Virol. 78, 13090-13103.
19. Rutledge, R. G. & Stewart, D. (2008a). A kinetic-based sigmoidal model for the
polymerase chain reaction and its application to high-capacity absolute
quantitative real-time PCR. BMC Biotechnol. 8, 47.
20. Rutledge, R. G. & Stewart, D. (2008b). Critical evaluation of methods used to
determine amplification efficiency refutes the exponential character of real-time
PCR. BMC. Mol. Bio. 9, 96.
21. Stoltz, D. B. (1993). The polydnavirus life cycle. In Parasites and Pathogens of
Insects, Vol. 1, pp. 80-101. Edited by N. Beckage, S. N. Thompson & B. A.
Federici. San Diego, CA: Academic Press.
22. Stoltz, D. B., Guzo, D. & Cook, D. (1986). Studies on polydnavirus transmission.
Virology. 155, 120-131.
23. Tanaka, K., Lapointe, R., Barney, W. E., Makkay, A. M., Stoltz, D., Cusson, M.
& Webb, B. A. (2007). Shared and species-specific features among ichnovirus
genomes. Virology. 363, 26-35.
24. Theilmann, D. A. & Summers, M. D. (1987). Physical analysis of the Campoletis
sonorensis virus multipartite genome and identification of a family of tandemly
repeated elements. J. Virol. 61, 2589-2598.
40
41
25. Theilmann, D. A. & Summers, M. D. (1988). Identification and comparison of
Campoletis sonorensis virus transcripts expressed from four genomic segments in
the insect hosts Campoletis sonorensis and Heliothis virescens. Virology. 167,
329-341.
26. Thoetkiattikul, H., Beck, M. H. & Strand, M. R. (2005). Inhibitor κB-like proteins
from a polydnavirus inhibit NF-κB activation and suppress the insect immune
response. Proc. Natl. Acad. Sci.USA. 102, 11426-11431.
27. Thompson, J. D., Gibson, T. J., Plewniak, F., Jeanmougin, F. & Higgins, D. G.
(1997). The Clustal X windows interface: flexible strategies for multiple sequence
alignment aided by quality analysis tools. Nucleic. Acids. Res. 24, 4876-4882.
28. Volkoff, A. N., Béliveau, C., Rocher, J., Hilgarth, R., Levasseur, A., Duonor-
Cérutti, M., Cusson, M. & Webb, B. A. (2002). Evidence for a conserved
polydnavirus gene family: ichnovirus homologs of the CsIV repeat element genes.
Virology 300, 316-331.
29. Wang, Z. & Spadoro, J. (1998). Determination of target copy number of
quantitative standards used in PCR-based diagnostic assays. In Gene
Quantification pp. 31-43. Edited by F. Ferré. Boston: Birkhäuser.
30. Webb, B. A., Strand, M. R., Dickey, S. E., Beck, M. H., Hilgarth, R. S., Barney,
W. E., Kadash, K., Kroemer, J. A., Lindstrom, K. G. & other authors (2006).
Polydnavirus genomes reflect their dual roles as mutualists and pathogens.
Virology 347, 160-174.
31. Webb, B. A. & Summers, M. D. (1992). Stimulation of polydnavirus replication
by 20-hydroxyecdysone. Experientia 48, 1018-
CHAPITRE 3
Global transcriptional profile of Tranosema
rostrale ichnovirus genes in infected lepidopteran
hosts and wasp ovaries1
3.1 Abstract
The ichnovirus TrIV, transmitted by the endoparasitic wasp Tranosema rostrale to its
lepidopteran host during oviposition, replicates asymptomatically in wasp ovaries and
causes physiological dysfunctions in parasitized caterpillars. The need to identify
ichnoviral genes responsible for disturbances induced in lepidopteran hosts has provided
the impetus for the sequencing and annotation of ichnovirus genomes, including that of
TrIV. In the latter, 86 putative genes were identified, including 35 that could be assigned
to recognized ichnoviral gene families. With the aim of assessing the relative importance
of each TrIV gene, as inferred from its level of expression, and evaluating the accuracy of
the gene predictions made during genome annotation, the present study builds on an
earlier qPCR quantification of transcript abundance of TrIV rep ORFs, in both
lepidopteran and wasp hosts, extending it to other gene families as well as to a sample of
1 This chapter has been accepted for publication in the journal Virologica Sinica, and is to be included in a special issue on insect viruses. Rasoolizadeh A, Dallaire F, Stewart D, Beliveau C, Cusson M, Global transcriptional profile of Tranosema rostrale ichnovirus genes in infected lepidopteran hosts and wasp ovaries. Virologica Sinica in press.
42
unassigned ORFs. We show that the majority (91%) of putative ORFs assigned to known
gene families are expressed in infected larvae, while this proportion is lower (67%) for a
sample taken among the remaining ORFs. Selected members of the TrV and rep gene
families are shown to be transcribed in infected larvae at much higher levels than genes
from any other TrIV gene family, pointing to their likely involvement in host
subjugation. In wasp ovaries, the transcriptional profile is dominated by a rep gene and a
member of a newly described gene family encoding secreted proteins displaying a novel
cysteine motif, which we identified among previously unassigned ORFs.
3.2 Résumé
L’ichnovirus TrIV est transmis par la guêpe endoparasitoïde Tranosema rostrale à son
hôte lépidoptère, Choristoneura fumiferana, au moment de la ponte. TrIV se réplique de
façon asymptomatique dans les ovaires de T. rostrale et entraîne des perturbations
physiologiques chez les chenilles parasitées. La nécessité d'identifier les gènes
responsables des perturbations induites par les ichnovirus chez les hôtes lépidoptères a
donné l'impulsion initiale au séquençage et à l'annotation de trois génomes ichnoviraux, y
compris celui de TrIV. Chez ce dernier, on a identifié 86 gènes, dont 35 qui ont pu être
attribués à des familles de gènes ichnoviraux déjà connues. Dans le but d'évaluer
l'importance relative de chaque famille de gènes de TrIV, tel qu’estimée par le niveau
d'expression de chaque gène, et d'évaluer l'exactitude des prédictions géniques faites au
moment de l'annotation du génome, nous avons bonifié une étude précédente, laquelle
portait sur la quantification des transcrits des gènes rep de TrIV chez l’hôte lépidoptère et
la guêpe, en l'étendant à d'autres familles de gènes, ainsi qu’à un échantillon de gènes
non-attribués (i.e., qui n’ont pas d’homologues connus). Nous montrons que la majorité
(91%) des gènes attribués à des familles de gènes connues sont exprimés dans les larves
infectées, cette proportion étant plus faible (67%) pour un échantillon les gènes non-
attribués. Certains membres des familles TrV et rep se sont avérés être transcrits, dans les
larves infectées, à des niveaux beaucoup plus élevés que les gènes des autres familles,
suggérant un rôle important pour ces deux familles dans la subjugation de l'hôte. Dans les
ovaires de T. rostrale, le profil transcriptionnel était dominé par un gène rep ainsi que par
43
un gène d'une famille nouvellement identifiée parmi les gènes non-attribués ; ces gènes
codent pour des protéines qui sont sécrétées et qui affichent un nouveau motif cystéine.
3.3 Introduction
The complex and singular life cycle of polydnaviruses (PDVs) has fascinated biologists
ever since these unusual viral entities were first reported in the scientific literature. As
such, they have raised countless questions, many of which have been addressed through
experimental work focusing on the elucidation of their functions and origins.
PDVs are dsDNA viruses whose genome is made up of multiple circular segments. Their
replication is confined to the ovaries of some endoparasitic wasps, where viral DNA is
generated from a copy of the viral genome permanently maintained within the wasp
genome. Virions are assembled in the nuclei of ovarian calyx cells and subsequently
released into the lumen of the oviducts. They are later injected into a lepidopteran host
during the process of parasitization (i.e., egg laying); in this host, no viral replication
takes place but expression of PDV genes induces immune and developmental
disturbances that are essential to the successful completion of wasp development. For this
reason, the association of PDVs with parasitic wasps has been described as mutualistic
(14, 22).
Recent endeavors in the area of PDV genome sequencing and annotation (7, 12, 16, 23,
26) have generated a wealth of data and new hypotheses about the evolution of these
intriguing insect viruses, as well as new questions about the diversification and functions
of the new putative genes identified in their genomes.
In the three campoplegine ichnoviruses (IV) (PDVs associated with ichneumonid wasps
of the subfamily Campopleginae) whose genomes have been sequenced [Campoletis
sonorensis IV (CsIV), Hyposoter fugitivus IV (HfIV) and Tranosema rostrale IV (TrIV);
23, 26], approximately half of the predicted ORFs have been assigned to previously
described or characterized gene families, such as those encoding proteins that display
significant sequence or structural similarity to proteins found in other organisms (inx,
44
ank, and Cys-motif), while members of the remaining families were identified on the
basis of similarity to previously characterized IV transcripts (rep and TrV families) or
because of the demonstrated existence of related putative ORFs among two or more IV
genomes (N, PRRP). All other putative ORFs, which constitute the remaining half, could
not be readily assigned to specific gene families as they did not display similarity to
known proteins (“unassigned” ORFs).
Annotation of the TrIV genome revealed the presence of several gene families. The
repeat element family (rep) is the largest with 17 members, followed by the TrV family
(7 members), N family (4 members), inx family (3 members), ank family (2 members),
Cys-motif (1 member) and PRRP (1 member). The remaining putative ORFs (59%) could
not be assigned to any known family (23).
In earlier studies, we assessed the transcription of selected TrIV genes from the rep
(TrFrep1; 25) and TrV (TrV1, TrV2 and TrV4; 1, 2, 5) families in the lepidopteran host
Choristoneura fumiferana by Northern blot analysis. More recently, we conducted a
detailed qPCR analysis of the abundance of all 17 TrIV rep transcripts, in both
lepidopteran and wasp hosts (19). This study indicated that two TrIV rep genes, F1-1 and
F1-2 (= TrFrep1 and TrFrep2), are expressed at much higher levels than all other
members of this family in infected C. fumiferana larvae. In addition, the rep
transcriptional profile seen in T. rostrale ovaries was found to be markedly different from
that observed in infected caterpillars.
For the present study, we wanted to extend the latter qPCR analysis to other putative
ORFs identified during annotation of the TrIV genome, so as to assess the accuracy of
our gene predictions and to generate a global transcriptional profile for a large sample of
TrIV genes across all known families and among unassigned genes. Here, we show that a
high proportion of genes identified during annotation are expressed in either the
caterpillar or wasp (ovaries) host, but that some members of the TrV and rep families are
expressed at much higher levels in infected caterpillars than genes from any other TrIV
gene family examined, suggesting that selected members of these two families play a
critical role in host subjugation. Similarly, the transcripts generated by another rep gene
45
and a previously unassigned gene clearly outnumber all other TrIV transcripts in wasp
ovaries. This previously unassigned gene is shown to belong to a new family of four
genes encoding secreted proteins expressed almost exclusively in wasp ovaries and
displaying a novel cysteine motif.
3.4 Materials and Methods
3.4.1 RNA extraction
Choristoneura fumiferana larvae were either parasitized by T. rostrale within 24 h after
the molt to the last instar or injected with 0.5 female equivalents (FE) of calyx fluid (CF),
as described (9, 10). Total RNA was extracted from five larvae of each group 3 d post-
parasitization (p.p.) or post-injection (p.i.), using TRIZOL reagent (Invitrogen),
according to the manufacturer’s instructions (1). In addition, total RNA was extracted and
pooled from five ovary pairs dissected from post-emergence 5-10 day-old T. rostrale
females, using the QIAshredder and RNeasy Mini Kit (Qiagen), according to the
manufacturer’s instructions.
3.4.2 cDNA library construction
A cDNA library was constructed as described (19) using RNA extracted from CF-
injected C. fumiferana larvae. Briefly, 3 µg of total RNA was reverse-transcribed using
an oligo-dT primer with the following sequence: TTTTGTACAAGC (T)16, followed by
synthesis of the second cDNA strand and ligation of an adaptor; the latter was used for
amplification of the cDNA using an adaptor-specific primer (ASP; 5´-
CTAATACGACTCACTATAGGGC-3´) in conjunction with the oligo dT primer. PCR
amplification was performed using 0.1 µM of primers, 0.3 mM of each dNTP and 1.5 U
of Taq platinum High Fidelity (Invitrogen) in 1x PCR High Fidelity buffer (Invitrogen),
46
containing MgSO4 (2 mM). The conditions consisted of a first heating step at 94ºC for 2
min, and then 20 cycles of 94ºC, 30 s; 55ºC, 1 min; 68ºC, 5 min.
3.4.3 Bioinformatics analyses
To determine whether some of the TrIV ORFs that had not been assigned to a known
gene family (23) could form new families, we conducted local blast (Blastp) searches
against a TrIV unassigned ORF data base, followed by a multiple amino acid sequence
alignment performed by ClustalW2, subsequently adjusted manually for one of the
identified families. For amino acid composition analysis and signal peptide predictions,
we used ProtParam3 and SignalP4, respectively. Disulfide bond predictions were made
using the Scratch Protein Predictor5.
3.4.4 Amplification of ORF-specific cDNAs from the cDNA library
To determine which of the putative ORFs identified in the genome of TrIV were
expressed in TrIV-infected larvae, we first conducted PCR amplifications of predicted
TrIV ORFs from the above cDNA library. Primers were designed within the coding
sequence of each putative ORF (Supplemental Data in Annexe C Table C-1). Two µl of a
25x dilution of the cDNA library was used for PCR amplification, with 0.25 µM of each
primer and 0.2 mM of each dNTP, in 1x PCR buffer. After a hot start at 94ºC for 3 min,
PCR was carried out by addition of 2 U of Tag DNA polymerase at 80ºC. The rest of the
cycling conditions were as follows: 30 cycles of 94ºC, 45 s; 48ºC, 45 s; 72ºC, 1 min; and
a final extension step at 72ºC for 5 min. The amplification products were then cloned into
pGEM-T easy vector (Promega) according to the manufacturer’s instructions and
subjected to sequence analysis.
2 http://www.ebi.ac.uk/Tools/clustalw2/index.html 3 http://www.expasy.ch/tools/protparam.html 4 http://www.cbs.dtu.dk/services/SignalP/ 5 http://www.ics.uci.edu/~baldig/scratch/
47
3.4.5 Reverse transcription and quantitative real-time PCR (qPCR)
To remove DNA contaminants from RNA extracts, 500 ng of total RNA was treated with
2 U amplification-grade DNase I (Invitrogen) for 15 min at 25°C. We ran no-RT controls
for the four most highly transcribed ORFs and detected no significant amplification,
pointing to the virtual absence of genomic DNA contamination in the extracts. 500 ng
RNA from parasitized and CF-injected C. fumiferana larvae, and 200 ng RNA from
ovarian tissue was reverse-transcribed using 0.5 µg of an oligo(dT) primer and 200 U
Superscript II RNase H- reverse transcriptase (Invitrogen). The reaction was carried out
in 1x PCR buffer, with 0.5 mM of each dNTP and 40 U of RNAguard ribonuclease
inhibitor (Amersham Biosciences), at 42˚C for 50 min.
For qPCR analysis, four primers were initially designed for each TrIV gene, using
diverse regions among aligned nucleotide sequences. These four primer pairs were used
to assess primer performance and quantitative precision. Initial amplification tests were
conducted on reverse-transcribed RNA obtained from parasitized C. fumiferana larvae. A
single primer pair was then selected for each gene (see Supplemental Data in Annexe C
Table 2), based upon high amplification efficiency and lack of non-specific amplification
products, and used for the analysis of the remaining samples.
PCR amplifications were carried out on aliquots of individual RT reactions containing
cDNA in amounts equivalent to 2.5 ng RNA, except for ovarian samples, which
contained amounts of cDNA equivalent to 1 ng RNA. Four replicate amplification
reactions containing 500 nM of each primer were conducted for each sample, using an
MX3000P spectrofluorometric thermal cycler (Stratagene) and QuantiTect TM SYBR
Green PCR Kit (Qiagen), initiated with a 15-min incubation at 95˚C, followed by a
cycling regime of 95˚C, 10 s and 65˚C, 2 min. Each run was completed with a melting
curve analysis to confirm the specificity of amplification and absence of primer dimers.
Amplification efficiency was determined for each amplification reaction using LRE
(“linear regression of efficiency”) analysis, and the number of target molecules calculated
using lambda genomic DNA as a quantitative standard (20, 21; see 19 for details).
48
3.5 Results
3.5.1 Detection of TrIV transcripts in infected larvae
As a first step towards determining which of the known and putative TrIV genes are
expressed in infected C. fumiferana hosts, we conducted ORF-specific PCR
amplifications from a cDNA library constructed using RNA from TrIV-injected C.
fumiferana last-instars, 3 d p.i. Using this approach, transcripts were detected for 77% of
all assigned TrIV ORFs, while only 42% for the 12 unassigned ORFs that we sampled
generated amplification products (Table 3-1). These proportions increased to 91% and
67%, respectively, when the presence of gene-specific transcripts was assessed using the
more sensitive qPCR-LRE approach (Table 3-1). Thus, the vast majority of TrIV genes
assigned to specific families during genome annotation were found to be expressed in
TrIV-infected C. fumiferana larvae; for unassigned genes, this proportion was lower,
based on the present sample. Furthermore, as indicated in the quantitative analyses
presented below, some TrIV genes were found to be expressed almost exclusively in T.
rostrale ovaries.
49
Table 3-1 Overall assessment of the expression (detected or not; + or ) of known and predicted TrIV ORFs in
TrIV-infected C. fumiferana larvae. The list of genes includes all those assigned to known IV gene families and 12 of
51 predicted ORFs that could not originally be assigned to a family (23)6
Gene family id ORF id Alter. name PCR1 qPCR1
B2-1
+ +
C3-1
+
C3-2
+ +
C4-1
+ +
C4-2
+
C7-1
+
C7-2
+ +
C166 Rep166 + +
C289 +
D5-1 + +
D5-2 +
D6-1 + +
F1-1 TrFrep1 + +
F1-2 TrFrep2 + +
F3-1 + +
F3-2 + +
Rep
F3-3 + +
C1-1 Ank 1 + +
Ankyrin C1-2 Ank 2 + +
Cys-motif C111-1 Cys + +
6 Two approaches were used to make this assessment: (i) PCR amplification of gene-specific cDNAs from a library constructed from
6th instar larvae, 3 d after injection (p.i.) of 0.5 FE of T. rostrale calyx fluid, and (ii) qPCR transcript quantification using total RNA obtained from similar larvae at 3 d p.i.; a given gene was considered as expressed if we detected ≥ 4 transcripts/ng total RNA. This threshold was chosen on the basis of results obtained for “no-RT” controls (RNA samples for which the reverse transcription step was omitted), where the median value was 4 copies (presumably contaminating genomic DNA). See Figs. 1, 3, 4 and 5 for quantitative data.
50
C6-1 Inx 1
D4-1 Inx 2 + +
Innexin
E1-2 Inx 3 + +
B1-1 N 1 + +
D7-1 N 2 + +
F2-1 N 3 + + N family
F2-2 N 4 + +
PRRP F1-6 PRRP + +
G2-1 TrV 1 + +
G3-1 TrV 2 + +
G2-2 TrV 3 + +
TrV 4 + +
G3-2 TrV 5
D1-2 TrV 6
TrV
C107 TrV 7 + +
A1-1 + +
C3-1
C3-3
C111-2
C116-2 OSSP 3 + +
C289-2 +
G5-1 OSSP 2 + +
G5-2
G5-3 OSSP 4 + +
G5-4 OSSP 1 + +
F2-3 B 1 +
Unassigned ORFs
F2-4 B 2 +
51
3.5.2 Transcript abundance of TrIV ank, inx, Cys-motif, PRRP and N genes
Although none of the 11 TrIV genes identified as belonging to the ank, inx, Cys-motif,
PRRP and N families displayed very high levels of transcripts in either infected C.
fumiferana hosts or T. rostrale ovaries ( 3,000 transcripts/ng total RNA), six of them
had more abundant transcripts in wasp ovaries than in parasitized caterpillars, including
two ank, two inx and two N genes (Fig. 3-1).
Figure 3-1 qPCR determination of transcript levels of 11 TrIV putative genes (23), distributed among five gene
families, in C. fumiferana 6th instar larvae, 3 d following natural parasitization by T. rostrale (3 d p.p.) or
injection of 0.5 FE T. rostrale calyx fluid (3 d p.i.), as well as in T. rostrale adult ovaries. Larvae were parasitized or
injected within 24 h after the moult to the 6th instar. For each measurement, total RNA was extracted and pooled from 5
larvae or 5 ovary pairs dissected from 5-10 day-old females. Actual transcript numbers are provided above each bar for
values < 100. Each value presented here is the mean of four technical replicates carried out on each RNA extract. Error
bars: SD.
With the exception of the C6-1 and D4-1 inx genes, this inter-host difference was less
pronounced when the comparison was made with transcript levels measured in virus-
52
injected caterpillars, presumably as a result of the supra-physiological viral dose present
in 0.5 FE of calyx fluid (19). Interestingly, the only member of the Cys-motif family
identified in the TrIV genome was expressed at very low levels (< 200 transcripts/ng total
RNA) in both infected caterpillars and wasp ovaries, while transcript abundance for the
single TrIV representative (F1-6) of the PRRP gene family (23) was moderate (~700-
3000 transcripts/ng total RNA) in the three samples examined (Fig. 3-1).
3.5.3 Transcript abundance of TrIV “unassigned” genes
Prior to generating estimates of transcript abundance for a sample of genes among the 51
unassigned TrIV ORFs identified earlier (23), we wanted to determine whether some of
these genes formed families; given that PDV genes tend to fall within families of related
coding regions, we reasoned that putative ORFs that had clear relatives within the TrIV
genome were more likely than orphan ORFs to be real genes (i.e., transcribed DNA).
Local Blastp analyses led to the identification of three small groups of related proteins
encoded by unassigned ORFs (Fig 3-2). The first of these groups contains four members,
all of which display a novel C-terminal cysteine motif. The longer G5.1 protein has two
copies of the Cx7Cx3Cx3Cx7Cx3Cx3Cx7C motif, which is identical to that seen in the
C166.2 protein. A variant of the latter motif (Cx6Cx3Cx3Cx3Cx3Cx7Cx3Cx3Cx3Cx3-
4Cx7C) is observed in the G5.3 and G5.4 proteins, with 10 out of the 11 cysteine residues
predicted to form disulphide bonds. A putative signal peptide cleavage site was identified
in all four proteins, which are therefore predicted to be secreted (Fig 3-2A). A Blastp
analysis indicated that these proteins are unique to TrIV. Two other pairs of ORFs were
found to be either highly (F2.3, F2.4 and Fig. 3-2B) or moderately (F1.4 and D6.3; Fig 3-
2C) related.
Thus, to obtain a preliminary assessment of the transcriptional activity of TrIV
unassigned genes, we measured transcript levels for six ORFs randomly selected among
those that were considered orphans and for six others that appeared to belong to a gene
family (i.e., those presented in Fig 3-2A and 3-2B). Interestingly, five of the six orphan
ORFs had barely detectable transcripts, whether in infected hosts or in wasp ovaries,
53
while the remaining orphan gene had low but detectable quantities of transcripts in wasp
ovaries (~500 copies/ng total RNA). In contrast, the four members of the family shown in
Fig 3-2A displayed moderate levels of transcripts (~2,000-12,000 copies/ng total RNA)
in wasp ovaries, while being expressed at very low levels in infected caterpillars (Fig 3-
3). For this reason, these proteins are here assigned to a new TrIV gene family,
designated “Ovary-Specific Secreted Proteins” (OSSPs). The other two related proteins
examined were also expressed almost exclusively in wasp ovaries, but at lower levels
than those measured for OSSPs.
Figure 3-2 ClustalW alignment of amino acid sequences deduced from selected TrIV unassigned ORFs that were
found to form groups of two or more related proteins. A) Four related proteins displaying a novel C-terminal
cysteine motif (cysteine residues are shown as white letters against black background). The arrow indicates the position
of the putative signal peptide cleavage site. B) Two very similar proteins encoded by unassigned ORFs found on
genome segment F2. This group is here designated “unassigned family B”. C) Two proteins encoded by unassigned
ORFs and displaying modest similarity. For B) and C), identical residues are shown as white letters against dark gray
background, while similar residues are shown as black letters against light gray background.
54
Figure 3-3 qPCR determination of transcript levels of 12 TrIV putative ORFs selected among 51 unassigned
ORFs (23), in C. fumiferana 6th instar larvae, 3 d following natural parasitization by T. rostrale (3 d p.p.) or
injection of 0.5 FE T. rostrale calyx fluid (3 d p.i.), as well as in T. rostrale adult ovaries. Putative genes are here
clustered according to whether they are orphan or belong to a family (“OSSP” and “unassigned family B”; see caption
of Fig. 2). For each measurement, total RNA was extracted and pooled from 5 larvae or 5 ovary pairs dissected from 5-
10 day-old females. Larvae were parasitized or injected within 24 h after the molt to the 6th instar. Actual mean
transcript numbers are provided above each bar for values < 100. Each value presented here is the mean of four
technical replicates carried out on each RNA extract. Error bars: SD.
3.5.4 Comparison of transcript abundance across all TrIV gene families
To estimate the relative importance of each gene family with respect to the abundance of
their transcripts in infected caterpillars and wasp ovaries, we selected, for each family,
the gene for which the highest level of transcripts had been measured in TrIV-injected C.
fumiferana last-instar larvae, 3 d p.i., or in adult wasp ovaries (Figs 3-4 and 3-5). In
infected caterpillars, TrV family, which encodes a secreted protein, was by far the most
highly transcribed TrIV7 gene, with nearly 300,000 copies/ng total RNA (Fig 3-4). The
rep family came second in this ranking, with the F1-1 gene (TrFrep1) producing ~52,000
transcripts/ng total RNA. In comparison, ank-2, PRRP and inx-3 generated transcript
quantities varying between ~1,000 and 3,000 copies, while all others produced < 1,000
copies /ng total RNA (Fig 3-4). 7 TrV1 from TrV gene family
55
Figure 3-4 Comparison of transcript abundance among selected representatives of all known TrIV gene families,
in C. fumiferana 6th instar larvae, 3 d following injection of 0.5 FE T. rostrale calyx fluid (3 d p.i.). Larvae were
injected within 24 h after the molt to the 6th instar. For each family, we show the value obtained for the most highly
transcribed gene in infected caterpillars. For each qPCR measurement, total RNA was extracted and pooled from 5
larvae. Actual transcript numbers are provided above each bar for values < 50,000. Each value presented here is the
mean of four technical replicates carried out on each RNA extract. Error bars: SD. Data for TrFrep1 are from
Rasoolizadeh et al. (19).
Figure 3-5 Comparison of transcript abundance among selected representatives of all known TrIV gene families,
in adult T. rostrale ovaries. For each family, we show the value obtained for the most highly transcribed gene in wasp
ovaries. For each qPCR measurement, total RNA was extracted and pooled from 5 ovary pairs dissected from 5-10 day-
old females. Actual mean transcript numbers are provided above each bar for values < 10,000. Each value presented
here is the mean of four technical replicates carried out on each RNA extract. Error bars: SD. Data for rep166 are from
Rasoolizadeh et al. (19).
56
In wasp ovaries, a rep gene (C166.1 or rep166) dominated the transcriptional profile,
with nearly 90,000 copies/ng total RNA, followed by OSSP1, which had ~12,000 copies
(Fig 3-5). For all other genes, transcript abundance was ≤ 1,000 copies/ng total RNA,
except for ank-2, which generated ~2,800 copies (Fig 3-5).
3.5.5 Accuracy of splicing junction predictions
In the course of annotating the TrIV genome, seven genes were identified as being
spliced (Cys-motif, TrV1, TrV2, TrV3, TrV4, TrV5 and TrV6), all of which are predicted
to encode secreted proteins (23). The splicing junctions of three of these, TrV1, TrV2, and
TrV4 had been confirmed in earlier studies (1, 2). Here, we attempted the cDNA cloning
and sequencing of the remaining four genes to determine if they were indeed spliced and
whether the splicing junctions had been predicted correctly. We were not able to amplify
TrV5 and TrV6 from our cDNA library or by qPCR (Table 3-1), suggesting that these two
very small putative ORFs (they encode proteins of 74 and 56 amino acid residues,
respectively) may well be pseudogenes. However, we were able to clone the cDNAs of
the Cys-motif and TrV3 genes, both of which were confirmed to contain two exons and
one intron, although the length of the first exon had been incorrectly predicted in both
cases (Table 3-2); corrections have now been made to the appropriate GenBank entries.
Table 3-2 Differences between predicted and observed splicing junctions for two TrIV spliced genes, TrV3 and a
Cys-motif gene. The values presented here are nucleotide ranges encompassing each exon (reverse complement) on
their respective genome segments (G2 and c111). For both genes, differences between predicted and observed junctions
were at the level of exon 1 (bold letters).
Gene id Exon 1 Exon 2
Predicted Expressed Predicted Expressed Accession number
TrV3 3543..3785 3537..3785 3201..3233 3201..3233 AB291160 Cys-motif 1622..1774 1667..1774 1190..1408 1190..1408 AB291215
57
3.6 Discussion
Transcriptional analysis often constitutes a first step towards identifying the function of a
gene. The present study, along with an earlier one focusing on rep genes (19), provides a
global assessment of transcript abundance, in both infected lepidopteran hosts and carrier
wasp ovaries, for more than half of the genes identified in the genome of the ichnovirus
TrIV (23). As such, this analysis makes it possible to evaluate the likely importance of
genes within each of the known ichnovirus gene families, as may be inferred from their
observed levels of expression.
The quantitative data presented in Fig 3-4 confirm earlier assessments made by Northern
analysis (1, 2, 5) to the effect that TrV1 is, by far, the most highly expressed TrIV gene in
infected C. fumiferana larvae, with transcript levels almost six times higher than those of
the most highly expressed rep gene, TrFrep1. In comparison, genes from all other
families are expressed at levels >15 times lower than those of TrFrep1 (Fig 3-4). These
results suggest that genes from the TrV and rep families, and more specifically TrV1 and
TrFrep1, encode products that are likely to be required for induction of developmental
arrest, which is the principal physiological perturbation observed in TrIV-infected C.
fumiferana hosts (9, 10).
The Cys-motif gene family (8) has ten representatives in the CsIV genome (26), some of
which are abundantly expressed in parasitized Heliothis virescens larvae (3, 4). In this
host, their protein products appear to play a role in both immune suppression (6, 17) and
developmental disturbances (13). In comparison, we detected only one member of this
family in the TrIV genome (23), and its expression was here observed to be very low in
the three samples we examined (Fig 3-1). These results support our earlier hypothesis
(23) that Cys-motif genes may no longer be required by T. rostrale to achieve successful
parasitism, inasmuch as TrIV has little or no impact on the cellular immune response of
C. fumiferana hosts (9, 10). However, it has been noted earlier that Cys-motif and TrV
genes appear to have a common ancestor (1), but that TrV proteins lack the characteristic
cysteine motif (C…C…CC…C…C) of CsIV Cys-motif gene products, which may be
58
essential to achieve host immune dysfunction, while it may not be required for induction
of developmental arrest.
The only other ichnovirus gene family that has been extensively examined with respect to
transcript abundance is the ank (or vank) family in CsIV (15). Although transcript levels
of the seven known CsIV ank genes were not compared to those of other CsIV genes, all
but one were readily detectable by Northern blot analysis of RNAs extracted from
parasitized H. virescens larvae, and two of the protein products could be detected by
either Western blot analysis or immunofluorescence assays (15). In addition, using an rq-
RT-PCR strategy, transcripts of all seven genes could be quantified in parasitized larvae,
and transcripts could also be detected at low levels in female wasps (15). In the present
study, the two known TrIV ank genes were expressed at higher levels in wasp ovaries
than in parasitized C. fumiferana hosts at 3 d p.p. (Fig 3-1), but transcript abundance was
below 3,000 copies/ng total RNA in both hosts. Our sampling time may not have been
optimal for the detection of TrIV ank transcripts in C. fumiferana, although CsIV ank
mRNA levels were typically maximal at 3 d p.p. in parasitized H. virescens larvae (15).
In addition, the higher transcript levels observed in female wasps, compared to
parasitized caterpillars, may be due, at least in part, to the fact that we limited our
analyses to wasp ovaries, thereby generating an RNA sample enriched in TrIV
transcripts, as the ovaries appear to be the only tissue supporting significant TrIV gene
transcription in the T. rostrale host (19). Nonetheless, the data presented here suggest that
TrIV ank genes play a limited role in altering C. fumiferana host physiology.
It has been known for many years that some ichnovirus genes are expressed in the
reproductive tract of female wasp carriers (4, 24), although the functional significance of
such expression has not been elucidated. As reported earlier (19) one of the 17 TrIV rep
genes, rep166 (C166.1), was transcribed at relatively high levels in T. rostrale ovaries,
while transcript abundance of TrIV genes associated with other ichnovirus families
identified prior to the present study, including the TrV family, was much lower (Fig 3-5).
However, transcript levels of OSSP1, one of the four members of a novel TrIV gene
family (Fig 3-2), were sufficiently high (~12,000 copies/ng total RNA) to make us
consider the possible role of this protein in the biology of T. rostrale. Since OSSPs are
59
predicted to be secreted, they could accumulate in the lumen of the oviduct prior to being
injected into the lepidopteran host during oviposition. Their C-terminal cysteine motif is
clearly distinct from that of ichnovirus Cys-motif proteins, but the disulfide bonds they
are predicted to form should ensure their stability until injection in the lepidopteran host,
in which they could play a role in host regulation before TrIV gene expression begins.
Unlike OSSP1, rep166 is not a secreted protein, and is therefore not predicted to
accumulate in the ovarian fluid. For this reason, we have suggested that it may play a role
in virus replication (19). Hypotheses regarding the roles of these two proteins are
currently being addressed experimentally.
In addition to generating a global profile of TrIV gene transcription in infected C.
fumiferana larvae, the present study provides an assessment of gene predictions made
during annotation of the TrIV genome (23). Overall, these predictions were accurate,
particularly in the case of ORFs that could be assigned to known ichnovirus gene families
(Table 3-1), although small errors were made in identifying the splicing junctions of two
genes (Table 3-2). With respect to “unassigned” ORFs, our predictions appear to have
been somewhat less accurate, particularly for “orphan” putative genes, although this
conclusion is based on a relatively small sample of genes. It should also be pointed out
that the few genes that escaped detection in the present study could well be expressed in
other lepidopteran hosts of T. rostrale.
Acknowledgements
This research was supported by grants from the Canadian Forest Service (CFS) and a
Discovery grant from the Natural Sciences and Engineering Research Council of Canada
to MC.
60
3.7 References
1. Béliveau C, Laforge M, Cusson M, Bellemare G. (2000). Expression of a
Tranosema rostrale polydnavirus gene in the spruce budworm, Choristoneura
fumiferana. J. Gen. Virol. 81, 1871-1880
2. Béliveau C, Levasseur A, Stoltz D, Cusson M. (2003). Three related TrIV
ichnovirus genes: comparative sequence analysis, and expression in host larvae
and Cf-124T cells. J. Insect. Physiol. 49, 501-511.
3. Blissard G W, Smith O P, Summers M D. (1987). Two related viral genes are
located on a single superhelical DNA segment of the multipartite Campoletis
sonorensis virus genome. Virology. 160, 120-134.
4. Blissard G W, Theilmann D A, Summers M D. (1989). Segment W of Campoletis
sonorensis virus: Expression, gene products, and organization. Virology. 169, 78-
89.
5. Cusson M, Béliveau C, Laforge M, Bellemare G, Levasseur A, Stoltz D. (2001).
Hormonal alterations and molecular mechanisms underlying the induction of host
developmental arrest by endoparasitic wasps, In: Endocrine Interactions of
Parasites and Pathogens. (J.P. Edwards and R.J. Weaver, eds). BIOS Scientific
Publishers, Oxford, 111-121.
6. Cui L, Soldevila A, Webb B W. (1998). Expression and hémocytes-targeting of a
Campoletis sonorensis polydnavirus cysteine-rich gene in Heliothis virescens
larvae. Arch. Insect. Biochem. Physiol. 36, 251-271.
7. Desjardins C A, Gundersen-Rindal D E, Hostetler J B, Tallon L J, Fadrosh D W,
Fuester R W, Pedroni M J, Haas B J, Schatz M C, Jones K M, Crabtree J,
Forberger H, Nene V. (2008). Comparative genomics of mutualistic viruses of
Glyptapanteles parasitic wasps. Genome. Biol. 9,183.
61
8. Dib-Hajj S D, Webb B A, Summers M D. (1993). Structure and evolutionary
implications of a cysteine-rich Campoletis sonorensis polydnavirus gene family.
Proc. Natl, Acad. Sci. USA. 90, 3765-3769.
9. Doucet D, Cusson M. (1996a). Alteration of developmental rate and growth of
Choristoneura fumiferana parasitized by Tranosema rostrale: role of the calyx
fluid. Entomol. Exp. Appl. 81, 21-30.
10. Doucet D, Cusson M. (1996b). Role of calyx fluid in alterations of immunity in
Choristoneura fumiferana larvae parasitized by Tranosema rostrale. Comp.
Biochem. Physiol. 114, 311-317.
11. Einerwold J, Jaseja M, Hapner K, Webb b, Copié V. (2001). Solution structure of
the carboxyl-terminal cysteine-rich domain of the VHv1.1 polydnaviral gene
product: comparison with other cysteine knot structural folds. Biochemistry. 40,
14404-14412.
12. Espagne E, Dupuy D, Huguet E, Cattolico L, Provost B, Martins N, Poirie M,
Periquet G, Drezen J M. (2004). Genome sequence of a polydnavirus: insights
into symbiotic virus evolution. Science. 306, 286-289.
13. Fath-Goodin A, Gill T A, Martin S B, Webb BA. (2006). Effect of Campoletis
sonorensis ichnovirus cys-motif proteins on Heliothis virescens larval
development. J. Insect. Physiol. 52, 576-585.
14. Kroemer J A, Webb B A. (2004). Polydnavirus genes and genomes: emerging
gene families and new insights into polydnavirus replication. Annu. Rev.
Entomol. 49, 431-456.
15. Kroemer J A, Webb B A. (2005). Iκβ-related vankyrins genes in the Campoletis
sonorensis Ichnovirus: temporal and tissue-specific patterns of expression in
parasitized Heliothis virescens lepidopteran hosts. Virology. 79, 7617-7628.
16. Lapointe R, Tanaka K, Barney W, Whitfield J, Banks J, Béliveau C, Stoltz D,
Webb B A, Cusson M. ( 2007). Genomic and morphological features of a
62
banchine polydnavirus: a comparison with bracoviruses and ichnoviruses. J.
Virol. 81, 6491-6501.
17. Li X, Webb B A. (1994). Apparent functional role for cysteine-rich polydnavirus
protein in suppression of insect cellular immune response. Virology. 68, 7482-
7489
18. Matz M V. (2000). Amplification of representative cDNA samples from
microscopic amounts of invertebrate tissue to search for new genes. In: Green
Fluorescent Protein: Applications and protocols (Hicks, B.W., E.d.), 1-21,
Humana Press Inc., Totowa, NJ.
19. Rasoolizadeh A, Béliveau C, Stewart D, Cloutier C, Cusson M. (2009).
Tranosema rostrale ichnovirus repeat element genes display distinct
transcriptional patterns in caterpillar and wasp hosts. J. Gen. Virol. 90: 1505 -
1514
20. Rutledge R G, Stewart D. (2008a). A kinetic-based sigmoidal model for the
polymerase chain reaction and its application to high-capacity absolute
quantitative real-time PCR. BMC. Biotechnol. 8, 47.
21. Rutledge R G, Stewart D. (2008b). Critical evaluation of methods used to
determine amplification efficiency refutes the exponential character of real-time
PCR. BMC Mol. Biol. 9, 96.
22. Stoltz D B. (1993). The polydnavirus life cycle. In Parasites and Pathogens of
Insects. 1, 80-101. Edited by N. Beckage, S. N. Thompson & B. A. Federici. San
Diego, CA: Academic Press.
23. Tanaka K, Lapointe R, Barney W, Makkay A, Stoltz D, Cusson M. Webb B A.
(2007). Shared and species-specific features among ichnovirus genomes.
Virology. 363, 26-35.
24. Theilmann D A, Summers M D. (1988). Identification and comparison of
Campoletis sonorensis virus transcripts expressed from four genomic segments in
63
64
the insect hosts Campoletis sonorensis and Heliothis virescens. Virology. 167,
329-341.
25. Volkoff A N, Béliveau C, Rocher J, Hilgarth R, Levasseur A, Duonor-Cérutti M,
Cusson M, Webb B A. (2002). Evidence for a conserved polydnavirus gene
family: ichnovirus homologs of the CsIV repeat element genes. Virology. 300,
316-331.
26. Webb B A, Strand M R, Dickey S E, Beck M H, Hilgarth R S, Barney W E,
Kadash K, Kroemer J A, Lindstrom K G. (2006). Polydnavirus genomes reflect
their dual roles as mutualists and pathogens. Virology. 347, 160-174.
CHAPITRE 4 Conclusion
Les résultats des analyses transcriptionnelles présentées dans ce mémoire suggèrent que
l’identification des gènes réalisée au moment de l’annotation du génome de TrIV (Tanaka
et al., 2007) était, dans l’ensemble, assez juste. En effet, il s’avère que la plupart des
gènes identifiés sont exprimés, soit chez des larves de C. fumiferana parasitées par T.
rostrale ou injectées du virus TrIV, ou dans les ovaires de la guêpe, mais à des niveaux
qui varient considérablement. À ma connaissance, cette étude est la première à générer un
profil d'expression, par qPCR, pour l’ensemble des gènes d’un polydnavirus, à la fois
chez l’hôte infecté et dans l’ovaire de la guêpe porteuse.
Pour la réalisation des analyses transcriptionnelles qui sont présentées ici, j'ai utilisé, pour
chaque temps d’échantillonnage, un seul échantillon biologique. Cet échantillon
représente un pool d'ARN obtenu de plusieurs individus, lequel j’ai divisé en quatre
aliquots. C’est à partir de ces aliquots que j'ai fait des évaluations séparées des niveaux
de transcrits. Cette forme de réplication, connue sous le nom de "réplication technique",
estime la variabilité associée à la technique de quantification (sources de variation
possibles: appareils, réactifs, expérimentateur, etc), par opposition à la variation
biologique inter-individuelle.
En raison de la faible quantité de transcrits associés à certains des gènes étudiés, chez les
larves ou les guêpes, et également en raison du temps limité pour compléter le travail, le
choix a été fait de mettre en commun les ARN de plusieurs insectes et de renoncer à la
réplication biologique, où deux ou plusieurs réplicats biologiques sont obtenus. Bien que
65
des comparaisons entre des mesures faites à partir de pools d’ARN n’auraient pas fourni
d'information sur la variation inter-individuelle, de telles comparaisons auraient donné
des informations supplémentaires sur la répétabilité de l'ensemble de la procédure de
quantification. Ainsi, dans des études futures sur la transcription des gènes de TrIV, il
vaudrait la peine d’investir les ressources nécessaires pour que de tels réplicats soient
obtenus.
Deux familles des gènes de l’ichnovirus TrIV, TrV et rep, se sont avérées être les plus
importantes du point de vue de l’abondance des transcrits de certains de leurs membres
chez des chenilles parasitées. Bien que des transcrits aient été détectés pour presque tous
les gènes étudiés dans l’un ou l’autre des deux hôtes, les niveaux élevés observés pour
certains membres des familles TrV et rep suggèrent que ces deux familles de gènes jouent
des rôles cruciaux dans le succès du parasitisme de C. fumiferana par T. rostrale.
Parmi les membres de la famille rep, TrFrep1 s’est avéré être beaucoup plus fortement
exprimé que les autres gènes rep, et ses transcripts étaient plus abondants dans
l’épithélium cuticulaire et le corps gras de l’hôte que dans les deux autres tissus
examinés. Toutefois, des différences ont été observées dans l'abondance relative des
transcrits de chaque gène rep dans les quatre tissus à l’étude, ce qui suggère l'existence de
rôles spécifiques pour différents gènes rep dans ces tissus au cours du parasitisme.
Dans les ovaires de T. rostrale, le profil d'expression des gènes rep s’est avéré clairement
différent de celui observé dans les chenilles infectées. Alors que TrFrep1 était le gène rep
le plus fortement exprimé chez les larves de C. fumiferana infectées, ses transcrits étaient
à des niveaux très faibles dans l’ovaire de T. rostrale, alors que les transcrits d'un autre
gène rep, C166-1, étaient présents à des niveaux très élevés dans ce tissu. Ces différents
patrons de transcription des gènes rep entre les ovaires de la guêpe et chez la chenille
hôte suggèrent que certains gènes rep pourraient jouer des rôles spécifiques à la guêpe
alors que d’autres seraient spécifiques à la chenille. Comme la réplication ichnovirale ne
se produit que dans les ovaires de la guêpe porteuse, il semble plausible que les gènes rep
qui y sont exprimés soient impliqués dans la réplication du génome viral, bien que cette
hypothèse reste à vérifier.
66
Dans l'évaluation de l'expression d'autres gènes de TrIV, y compris ceux des familles inx,
ank, Cys-motif, PRRP, N et TrV, des transcrits ont été détectés pour la plupart des gènes
étudiés chez des larves infectées, mais, à l'exception de TrV1, ces niveaux se sont avérés
beaucoup plus faibles que ceux mesurés pour TrFrep1. Cette observation soulève la
question à savoir si ces gènes, comme ceux de la famille rep qui sont transcrits à des
niveaux très faibles, jouent un rôle important au cours du parasitisme de C. fumiferana
par T. rostrale et, si non, pourquoi leur présence dans le génome de TrIV est nécessaire.
Toutefois, il faut souligner ici que l'expression de ces gènes chez C. fumiferana a été
évaluée à un seul temps d’échantillonnage (3 jours après l'infection) et qu'ils pourraient
être exprimés plus fortement à d'autres moments après la ponte ou chez des chenilles
appartenant à d'autres espèces hôtes.
Parce que les segments génomiques des polydnavirus ne sont pas présents en quantités
équimolaires dans le génome viral, l'abondance relative de chaque segment pourrait avoir
un impact sur le niveau d'expression des gènes qu’ils portent, particulièrement dans la
chenille hôte, où le virus ne se réplique pas. Dans les analyses présentées au Chapitre 2,
les gènes rep exprimés le plus fortement chez des chenilles infectées, TrFrep1, TrFrep2
et C166-1, sont portés par les deux segments génomiques les plus abondants, parmi les
dix segments de TrIV qui contiennent des gènes rep, soit F1 et C166, ce qui suggère un
impact possible de l’abondance relative des segments génomiques sur l'expression des
gènes qu’ils portent. Toutefois, il n'y avait pas de corrélation évidente entre les niveaux
de transcrits et l'abondance des segments génomiques pour les autres gènes rep. Ainsi, il
semble que d'autres facteurs, en plus de l'abondance relative des segments génomiques,
soient impliqués dans le contrôle des niveaux d’expression de ces gènes, dont la force du
promoteur, la stabilité des segments génomiques et des transcrits, ainsi que l'intégration
possible de segments génomiques ichnoviraux au génome de l'hôte (Doucet et al., 2007).
Dans le cadre d’analyses locales de type Blastp, où chaque cadre de lecture ouvert
(« ORF ») non-assigné (à une famille de gènes connue) a été utilisé pour interroger la
base de données des séquences ORF non-assignées du génome de TrIV, trois groupes
d’ORF apparentés ont été identifiés. L’un d’entre eux est constitué de quatre membres
affichant un motif cystéine ainsi qu’un peptide signal. Fait intéressant, ces gènes
67
semblent être exprimés presqu’exclusivement dans les ovaires de la guêpe. Sur la base de
ces deux observations, il a été prédit que ces protéines sont sécrétées dans la lumière des
oviductes latéraux ; c’est pour cette raison qu’elles ont été nommées « Ovary-Specific
Secreted Proteins (OSSP). On peut envisager que les ponts disulfure formés entre les
résidus cystéine des protéines ont pour effet d’accroître leur stabilité et leur longévité
suivant leur injection présumée dans l'hôte lépidoptère. Leur fonction réelle dans le
contexte du parasitisme demeure inconnue, mais l'hypothèse selon laquelle elles sont
injectées dans l’hôte pendant la ponte pourrait être évaluée à l'aide de méthodes
immunologiques. Dans l'hôte lépidoptère, les OSSP pourraient contribuer à limiter
l’encapsulation des œufs de guêpes dans la chenille hôte et/ou lancer le processus menant
à l'arrêt du développement de la chenille hôte avant que ne débute l'expression des gènes
de TrIV à partir des virions injectés. Dans une première étape visant à évaluer cette
hypothèse, des interactions possibles entre les OSSP et les protéines hôtes pourraient être
étudiées en utilisant des approches telles que l’analyse par GST-pull-down, suivie par
l'identification des protéines impliquées dans cette interaction. Une fois ces protéines
identifiées, des hypothèses testables quant à la fonction des OSSP pourraient être
développées et évaluées. De plus, l'impact des résidus cystéine sur la structure de la
protéine et sa stabilité pourrait être évalué par modélisation moléculaire et mutagenèse
dirigée.
Puisque parmi les membres de la famille rep de TrIV, TrFrep1 est celui qui est exprimé
le plus fortement chez des chenilles parasitées, une étude visant l’identification de la
fonction de ce gène a été entreprise. Cette étude fait appel à l’approche microarray. Tel
que mentionné dans les sections précédentes, les gènes rep codent pour des protéines
non-sécrétées, et certains sont exprimés presqu’exclusivement dans les chenilles hôtes,
alors que d'autres sont spécifiques à l’ovaire de guêpe. L’arrêt du développement de
l’hôte et la suppression de sa réponse immunitaire cellulaire sont les deux effets
principaux attribués aux polydnavirus au cours du parasitisme. Toutefois, contrairement à
d'autres polydnavirus caractérisés par d'autres équipes de recherche au cours des
dernières années, TrIV ne semble pas jouer un rôle important dans l’inhibition active de
la réponse immunitaire cellulaire de l’hôte, bien qu’il entraîne des perturbations
prononcées de sa métamorphose (Cusson et al., 2000). Ainsi, dans nos tentatives visant à
68
identifier la fonction des gènes rep, le gène TrFrep1 a été exprimé dans des cellules de C.
fumiferana en culture (CF-203), avec l'intention d'évaluer les effets de sa sur-expression
sur l’expression des gènes des cellules hôtes ; ces analyses devient être complétées dans
les mois suivant le dépôt final du présent mémoire. Si la protéine TrFrep1 module
l'expression de gènes chez l'hôte, l'identification de ces gènes par l’analyse microarray
permettra d'identifier les sentiers métaboliques dans lesquels les gènes modulés sont
impliqués. Sur la base de cette information, nous devrions être en mesure de formuler des
hypothèses testables quant à leur rôle potentiel dans le succès du parasitisme par T.
rostrale.
L'étude de l'expression des gènes de TrIV chez des chenilles de C. fumiferana parasitées
par T. rostrale, ainsi que dans l’ovaire de la guêpe, est une méthode parmi d'autres pour
entreprendre l’élucidation des stratégies utilisées par ce virus pour perturber la régulation
hormonale et l’initiation de la métamorphose chez les hôtes parasités. Lorsque les
fonctions des gènes principaux auront été identifiées, certains pourraient s'avérer utiles
dans le développement de nouveaux agents de lutte biologique pour la répression des
populations de C. fumiferana dans les forêts canadiennes. Étant donné que l'infection par
TrIV nécessite que le virus soit injecté dans une chenille par une guêpe, ce virus ne
pourrait être utilisé comme ingrédient actif d’un insecticide viral, pour lequel l'infection
par voie orale doit être possible. Toutefois, certains gènes de TrIV pourraient être utilisés
pour modifier génétiquement des baculovirus insecticides, que ce soit pour améliorer leur
efficacité ou leur spectre d'hôtes. Certains gènes de TrIV pourraient aussi être utilisés
pour le génie génétique des arbres hôtes, afin d'accroître leur résistance aux défoliateurs
(Gill et al., 2006).
69
70
4.1 Références
1. Doucet, D., Levasseur, A., Béliveau, C., Lapointe, R., Stoltz, D. & Cusson, M.
(2007). In vitro integration of an ichnovirus genome segment into the genomic
DNA of lepidopteran cells. J. Gen. Virol. 88, 105-113.
2. Cusson, M., Laforge, M., Miller, D., Cloutier, C. & Stoltz, D. (2000).Functional
significance of parasitism-induced suppression of juvenile hormone esterase
activity in developmentally delayed Choristoneura fumiferana larvae. Gen.
Comp. Endocr. 117, 343-354.
3. Gill TA, Fath-Goodin A, Maiti II, Webb VA. (2006). Potential uses of Cys-motif
and other polydnavirus genes in biotechnology. Adv. Virus. Res. 68, 393–426.
4. Tanaka K, Lapointe R, Barney W, Makkay A, Stoltz D, Cusson M. Webb B A.
(2007). Shared and species-specific features among ichnovirus genomes.
Virology. 363, 26-35.
ANNEXE A Effect of TrIV rep gene expression on host gene transcription, as determined by microarray analysis
A.1 Introduction
In the course of assessing the transcription patterns of Tranosema rostrale ichnovirus
(TrIV) genes in infected Choristoneura fumiferana larvae, we observed that some
members of the TrV and rep gene families were the most highly transcribed genes in
infected larvae (Rasoolizadeh et al., 2009 a, b). These two gene families show no
similarity to other eukaryotic or viral (non-PDV) genes, and their functions during
parasitism have yet to be identified (Theilmann & Summers, 1987; Tanaka et al., 2007).
The rep gene family is the largest family within the TrIV genome, with 17 ORFs. These
genes consist of imperfectly conserved repeats of ~540-bp, and encode non-secreted
proteins (Theilmann & Summers, 1987). Among the TrIV rep family members, one gene,
TrFrep1, is expressed much more abundantly in parasitized larvae than all other members
of this family (Rasoolizadeh et al., 2009 a), suggesting that it likely plays an important
role in the course of parasitism. In an effort to identify the function of rep genes in TrIV-
infected C. fumiferana larvae, we undertook a study of the effect of rep gene expression
on host gene transcription, using microarray analysis. Here, we transfected C. fumiferana
CF-203 cells (Sohi et al., 1993) with either an empty expression vector or a vector
containing the TrFrep1 coding region. Total RNA was then extracted from the CF-203
cells 24 and 48 h following transfection, with the intent of using it to assess modulation
of host gene expression through microarray analysis. At the time of writing this appendix,
71
the latter analysis had not yet been completed, but I here report on vector construction
and TrFrep1 transcript quantification after transfection.
A.2 Material and methods
The TrFrep1 coding region was amplified by PCR using the following primers:
5´ CGTTTCCATGGGCATTATCATTATCATCGGGT 3´) and
5´ TTTTAGCACAGCGGCCGCACA 3´ (NcoI and NotI restriction sites are underlined).
PCR amplification was performed using 0.25 µM of each primer, 0.2 mM of each dNTP,
in 1x PCR buffer. After a hot start at 94°C for 3 min, PCR was carried out by addition of
2 U of Taq DNA polymerase at 80°C. The rest of the cycling conditions were as follows:
30 cycles of 94°C, 45 s; 48°C, 45 s; 72°C, 1 min; and a final extension step at 72°C for 5
min. PCR products were cloned into pGEM-T Easy (Promega) vector and sequenced.
Subsequently, the fragment was subcloned into the GFP-PE38 lepidopteran expression
vector (a gift of D. Theilmann, AAFC, Summerland, B.C.) using the two aforementioned
restriction enzymes, effectively replacing the GFP insert (Fig. 1). A C. fumiferana cell
line (CF-203) was transfected with the expression vector carrying TrFrep1, as well as
with the empty vector as a control. Cells were seeded into six-well plates and grown to
60-70% confluence and transfected with 3 µg DNA/well using the ExGEN500
transfection reagent (Fermentas, ON, Canada) as described in the manufacturer’s
protocol. Twenty-four and 48 h following transfection, total RNA was extracted using
TRIZOL reagent (Invitrogen) according to the manufacturer’s instructions. To verify the
expression of TrFrep1 in transfected cells, we quantified its transcripts using the q-PCR-
LRE approach of Rutledge and Stewart (2008 a, b) and the set of primers designed for
this gene in a previous study (Rasoolizadeh et al. 2009a).
72
A.3 Results
q-PCR analyses revealed high levels (~60,000-75,000 copies/ng RNA) of TrFrep1
transcripts in cells transfected with the TrFrep1-EP38, and a virtual absence of transcripts
in those transfected with the empty vector (Table 1). Each value shown here is the mean
of three biological replicates.
Table A. 1 Mean number of transcripts (± SD) in CF203 cells, one day and two days after transfection with the
TrFrep1-PE38 vector or the empty PE38 vector.
Mean No. of transcripts / ng total RNA ± SD
Days after transfection TrFrep1-PE38 Empty PE38
1 73,095 ± 18513 3 ± 0 2 59,058 ± 13245 0 ± 0
The correct GFP -PE38 construct621 6 bp
IE2
GFP
PE38 5'
PE38 3'
Transcription start site
Figure A. 1 The TrFrep1 coding region cloned into the PE38 lepidopteran expression vector using two
restriction enzymes (NcoI and NotI), replacing the GFP insert.
73
A.4 Discussion
The present data indicate that transfection of C. fumiferana CF-203 cells with an
expression vector carrying the TrFrep1 coding region generated high levels of TrFrep1
transcripts in those cells, while these transcripts were absent from cells transfected with
the empty vector. These RNA samples are therefore ideally suited for a microarray
analysis of the modulation of host gene expression by TrFrep1.
Among all 17 TrIV rep genes, TrFrep1 was shown earlier to have the most abundant
transcripts in parasitized C. fumiferana larvae, suggesting that it plays an important role
in the success of parasitism by T. rostrale (Rasoolizadeh et al., 2009a). If TrFrep1
expression modulates host gene expression, it should be possible to identify, using
microarray analysis, the metabolic pathway(s) in which the modulated genes are
involved. On the basis of this information, we should be able to generate testable
hypotheses about the proteins with which the TrFrep1 protein interacts and therefore
identify the function(s) of rep genes. Thus, the RNAs that were extracted from
transfected cells will now be used for the production of labeled cDNAs and hybridization
on a C. fumiferana DNA chip containing ~5000 genes. This analysis will be performed in
the laboratory of a collaborator of the Canadian Forest Service in Sault Ste. Marie.
Acknowledgments
I thank Daniel Doucet and Tim Ladd (Great Lakes Forestry Centre, Sault Ste. Marie) for
the transfection of CF-203 cells, and Catherine Béliveau (Laurentian Forestry Centre,
Quebec City) for guidance in cloning the TrFrep1 coding region in the GFP-EP38 vector.
74
75
A.5 References
1. Rasoolizadeh, A., Béliveau C., Stewart D., Cloutier C., & Cusson M. (2009a).
Tranosema rostrale ichnovirus repeat element genes display distinct
transcriptional patterns in caterpillar and wasp hosts. J. Gen. Virol. 90, 1505-1514
2. Rasoolizadeh, A., Dallaire, F., Stewart, D., Béliveau, C & Cusson, M. (2009b).
Global transcriptional profile of Tranosema rostrale ichnovirus genes in infected
lepidopteran hosts and wasp ovaries. J. Virologica Sinica, in press.
3. Rutledge, R. G. & Stewart, D. (2008a). A kinetic-based sigmoidal model for the
polymerase chain reaction and its application to high-capacity absolute
quantitative real time PCR. BMC. Biotechnol. 8, 47.
4. Rutledge, R. G. & Stewart, D. (2008b). Critical evaluation of methods used to
determine amplification efficiency refutes the exponential character of real-time
PCR. BMC. Mol. Biol. 9, 96.
5. Sohi, S. S., Lalouette, W., MacDonald, J. A., Gringorten, J. L., & Budau, C. B.
(1993). Establishment of continuous midgut cell lines of spruce budworm
(Lepidoptera: Tortricidae) [abstract I-1001]. In Vitro Cell Dev. Biol. 29A (3).
6. Tanaka, K., Lapointe, R., Barney, W. E., Makkay, A. M., Stoltz, D., Cusson, M.
&Webb, B. A. (2007). Shared and species-specific features among ichnovirus
genomes. Virology. 363, 26-35.
7. Theilmann, D. A. & Summers, M. D. (1987). Physical analysis of the Campoletis
sonorensis virus multipartite genome and identification of a family of tandemly
repeated elements. J. Virol. 61, 2589-2598.
ANNEXE B
Supplementary data for chapter 2:
Tranosema rostrale ichnovirus repeat element genes display distinct transcriptional patterns in caterpillar and wasp hosts
Table B-1 List of primer pairs used for q-PCR quantification of 17 TrIV rep transcripts and 10 rep gene-bearing TrIV genome segments. For quantification of genome segments harboring more than one rep gene, the single primer pair used is identified (*). For rep gene id, we used the name of the genome segment (e.g. C3), followed by the ORF number (e.g. C3-2). C166 and C289 denote ORFs that are on contigs 166 and 289 (i.e., partial sequences of an unidentified genome segment).
rep gene id 5´ 3´primer sequence Orientation
CTC ATC TGA ATA CGA TAA GAC AGC TCG TAC TCC Reverse B2-2
CTC TAG CGA CAG CGA ACA GAC GAC T Forward
GGT ATA AGC GCC ATT GTT CGG CCA T Reverse C3-1*
CTG TGA ACA TGC GCC GAG CAT G Forward
GCA GAT CAA AGT ATT CTC CAG AAT TTT CAA CCA AGT TTC Reverse C3-2
CGA TTT GCT TCC TGC CCT TGT CAT CT Forward
GCA CGC TCA TGT TGC GAA AAT GAA TTG TT Reverse C4-1*
TGC AAT TAC GGA CAC TTC CAT CAT TAT TGC TAT CTA C Forward
GGA GAA GTG ATG ACG GAG AAG TGG TAA GAA A Reverse C4-2
TCA CCT GCT AAA CAA AGA CGG GCA AC Forward
CAA CAG AAT CGC AGG TTC CAA ATA ATT GCC T Reverse C7-1*
CCT GTT CCA CGA CGG TGA AGA GTT TGA TA Forward
76
GC CCG TCT GAA AGT GAA CAA TAT CAC A Reverse C7-2
CCT TCA GTG GAC GAG TGC GGA AAT Forward
AGA ATC GCT GGT TCC AGA TAA CGG AGC Reverse C166-1
CTC CTG TGG AAA GGA CAG CCC AGA TA Forward
AGA TAA CAC ACG CAT TCG GCG TAT TGA AAG Reverse C289-1
CCG CGT TCT CAT CAA CAC GGA CTC Forward
GCA CAG AAG GAA TCA GGT AAT ATT TCA ACC AGT ATC T Reverse D5-1*
CCT GCC AAT GTT ACC GGA TGA ACG T Forward
GA ATT TGT CCA TCG CTG ACG CGT C Reverse D5-2
CC CTG GAG AAC AGA AGA AGT TTT CAT CAA TTC Forward
AAT TTG CAT AAC TGC CCA CTG TAT AAT AAA AGT CCA Reverse D6-1
CCA TTA TTG TGC CTT GCA CCT TGG GTC Forward
TGT AAC AGA ATC GCA CGT TCC AGG TAT AAC TTG Reverse F1-1*
ATC CTG CTC TTG TCA CTA CAA TAT CCC GG Forward
CCT AGT GGG ACA TTG CAC GGC A Reverse F1-2
ATC ACT ATT GTG CAA CGC ACG TTG AGT C Forward
GGA GAC GAA TCG AGT TAG CCA GGT AAC GAT T Reverse F3-1*
ACA ACG GGC GAG GTA GTG AGA TAA TTG TTG Forward
GCA CGA TCG AGG TAC TCA AGA CAA TGT CC Reverse F3-2
CGA CGA GCA ATG TGG TGA AAA ATT TGT GAG G Forward
TGA ATC GAG TTG ACC AGG CAT AGG GTG Reverse F3-3
GGC GAG GTG GTG AAA GAT TTG TTG CA Forward
77
ANNEXE C
Supplementary data for chapter 3:
Global transcriptional profile of Tranosema rostrale ichnovirus genes in infected lepidopteran hosts and wasp ovaries
Table C-1 Oligonucleotide sequence and orientation of primers designed for PCR amplification of TrIV putative ORFs from a cDNA library.
Gene id 5´ 3´ primer sequence Orientation Accession number
ACGTCGCGAATACTCTCAAC Forward rep-B2
ATCCGGTATTGATTCTCTCATCTG Reverse
AB291141
ATGCTGGAATATAATGCCACGC Forward rep-C3-1
TTCGGCCATGAGGTCATTG Reverse AB291143
ATCACGGTGCACGTTCAT Forward rep-C3-2
TTGAAGAGTAATCCACCGCA Reverse AB291143
ATGCAGCTCTGTCTCCTTC Forward rep-C4-1
GCGTACTTGCACTGTCGA Reverse AB291144
TTCGATCCGTCAAGACCAG Forward rep-C4-2
TCATAGCTGCACGCTCATG Reverse AB291144
AATATCGCTGCTGCCGTC Forward rep-C7-1
TGCAACAGAATCGCAGGT Reverse AB291147
TGAAGCCTTCAGTGGACG Forward rep-C7-2
GACATGCTGTTGACCATCGA Reverse AB291148
GCATCAGGAGCTTCGCTAAT Forward rep-C166
CAGTTATCAACATCGGTGCG Reverse AB291213
ATGTGTCGACGCCACAGT Forward rep-C289
ACAGATAACACACGCATTCG Reverse AB291214
CCAATAACGTTGCCGCTG Forward rep-D5-1
CAGTATCTAACGTGTACCGAGC Reverse AB291153
78
CCAATAACGTTGCCGCTG Forward rep-D5-2
TGTAAGCTTCGATACGCTTGTG Reverse AB291153
ATGGGAGACGCACGTCTT Forward rep-D6
ACGAGCGTACTTCAGCCA Reverse AB291154
ATGATGTCACCGCAGAAC Forward rep-F1-1
TGTAGTGACAAGAGCAGGATG Reverse AF421353
ATGGATAATTGTAAGTTGGGC Forward rep-F1-2
GAACACAGACGATAGGAACGA Reverse AF421353
CCGGYAGATRTAATTCTYYACATGG Forward rep-F3
RCATGTGTCGACGGAAGG Reverse AB291158
ATGGAAMTTTCCRAAATTGMAGAACT Forward Ankyrin family
TAGGCTCCYTCGKYGTCA Reverse AY940454 *
ATGTCTCGGACAATGAAACTT Forward Cys-motif protein
ACTGTTCGCCAAACGGA Reverse AB291215
CTTYCGTYTGCATTACAAAWTMACAG Forward Innexin family
CAATCWCCRATSYGWAGCTTGT Reverse
AB291146 *
AB291152 AB291156
CMKATKTTSAACMAGCTGCAR Forward N family
CACWGATGAGATATCGAGAATTYACAC Reverse
AB291140 *
AB291155 AB291157
ATGGTTCATATTCTGCGGTCA Forward PRRP protein
TCAATACTTCGGTCTTTCTTGTTG Reverse AF421353
ATCGGCGTCAATGTCTCC Forward TrV3
TGCAGATGACAATCCGTAGAATG Reverse AB291160
ATGAACATGACGTGGGTCAT Forward TrV5
GTAGCAGCCAGAACAATACCT Reverse AB291161
CGCAGTGCAAACTTGTCAG Forward TrV6
GGGACAGTGAAGGGTGATATT Reverse AB291149
TCGTCGCAGTGGTAATGG Forward TrV7
GGTAGCTCCAATACTGGCT Reverse AB291164
TCACGAGTCAGCATACGAG Forward A1-unassigned
CCTCTTGGTTGCAGGTGT Reverse AB291138
GCGATGCAAGTAGCCAGT Forward C3-1-unassigned
ACCGAGCATATCATCACCG Reverse AB291143
GTATAAGCGCCATTGTTCGG Forward C3-2-uassigned
ATTCGGAGGGATCTCCTATCC Reverse AB291143
TGCATACCATGTGGCAGG Forward C166-unassigned
GGAATACATCTGGCTGCA Reverse AB291213
AGCTATGAGGTTCGAGCTA Forward C289-unassigned
CACACGCATTCGGCGTAT Reverse AB291214
ACGCACGGAATATTGTAGCG Forward C111-unassigned
CGGCATGACTTCGTGACT Reverse AB291215
G5 1 unassignedATGAATCTTTTTTGGGTTGC Forward
AB291163
79
TTATTTGCATCCATTTCCAAC Reverse
TTTCCAGCCAGAGCTTCGACGGA Forward G5.2 unassigned
TGGTATAGCATTTCGCTCGATC Reverse AB291163
GAGCTTCTCTGGATTATGA Forward G5.3-unassigned
TTTACCGTAATGTGACATGG Reverse AB291163
GAAGCTTTCCTGGATTATCA Forward G5.4-unassigned
TTACCGTAATGTGACAGGT Reverse AB291163
TCTTGTCTGCAGACAGAT Forward F2.3 unassigned
GTATATAAAGGGCTGGCTC Reverse AB291157
ACCCGATGGACTTACTAT Forward F2.4 unassigned
GGGGTATATAAGCGCTAATCT Reverse AB291157
* Because of the high level of within-family nucleotide identities, only one set of primers
could be designed for each of these families. The PCR products, which formed distinct
bands on agarose gels, were analysed and sequenced individually.
80
Table C-2 Oligonucleotide sequence and orientation of primers designed for quantitative real time RT-PCR (qPCR) amplification of TrIV putative ORFs. Note: for primers used for rep genes, see Annexe B.
Gene id 5´ 3´ primer sequence Orientation Accession number
TGGTCGTCACCGCATCTCATCGTG Forward
A1-unassigned AATCCTCTTGGTTGCAGGTGTGAAACTT Reverse
AB291138
CATTATGAGATTTCGATGCGACTGCACAGT Forward
C3-1-unassigned GGTATGTGTGTCTGTTTGACACTGCGTT Reverse
AB291143
CGTGCTCCCAACAATAATGGTGAAAGTGG Forward
C3-2-uassigned TTAGACAGCCTAAAACCCATATTCGGAGG Reverse
AB291143
CTGAATGCAGACGCAGCCCTCG Forward
C166-unassigned GATCGGAACGTTTCCTCCGGGAATACAT Reverse
AB291213
TCATCAACACGGACTCTTTGCTACCTGT Forward
C289-unassigned TAAAGACTTTGAGGGAGCTTCACCACC Reverse
AB291214
TCACGGTCACTCATTGTTCGTAAAGAGC Forward
C111-unassigned ACTTCGTGACTTGCCGAGCTGAAC Reverse
AB291215
CTTCTACGGCCGATGTTTGACAATGTTGG Forward
G5.1-unassigned CAATTTGCGCGACAGGTGGCCATA Reverse
AB291163
CTGTGATAAAATAAAGGCCAGGTGCCAAG Forward
G5.2-unassigned GGTGGTAATTGGGTATAACACATGCCTGGA Reverse
AB291163
TCTCAACGCTGTGATAAAATAAAGGCCAGG Forward
G5.3-unassigned GTGGTAATTGGGTATAACACATGCCTGGAC Reverse
AB291163
ACGCTGTGGTAGAATGAAGGCCGAA Forward
G5.4-unassigned GTAATCCGGCATCGCAATAAATGTCTCCAC Reverse
AB291163
GCATCGTCACGATACCCGGTATACAAGT Forward
F2.3-unassigned GCACTCGGGTATATAAAGGGCTGGCTC Reverse
AB291157
TCGCCATGATACCCGGTATACGAGA Forward
F2.4-unassigned CGCTGCGGGGTATATAAGCGCTAATCT Reverse
AB291157
GGATCGACCCACCATTCCATGCTATA Forward
C2-ankyrin-1 GCCTACACAACCACAATGCAAGATCGC Reverse
AB291142
ACTACAAATAAAAAACTACAGTGGTGAGTTTCCCA Forward
C2-ankyrin-2 GCCGTCTGTCGAGCATAATTTCTCACATTC Reverse
AB291142
81
82
GGATTCTATCAAGCCCTGCTGCCAAG Forward
Cys-motif protein GCCAAACGGAATCCTATATTCACGACGC Reverse
AB291215
AGATTTTATGGGTTTCGGTCAAACAATATGAATACTGC Forward
C6-innexin CGGGATTCTAAATTTACTCACTCAAATCAGGGTTA Reverse
AB291146
CCTCAATCAGATTCTACAGTTTTCGATCATCGTGC Forward
E1-innexin CACTGTTGAAACGCTGAGCGATACGAA Reverse
AB291156
CAATTAGGGTTTACGAGTTTCGGTCATCGAGT Forward
D4-innexin CGCAAAGCATAGAAAGTGGTTTCAAACATGACG Reverse
AB291152
GCCAGACGTTAGACAATTATTGTTTGATGCTTGAC Forward
B1-N family GGGAAGTTTACTGTTGAGTGCTGGAGATGCTTTTC Reverse
AB291140
GCTTGTAAGCATGTATAACTCCGCCTCC Forward
D7-N family CGTAGAACTGCTACAGTTGGTGAATCGC Reverse
AB291155
GTACCTTCGGGATCGCTTGCTGTAAGA Forward
F2-N family 1 AGTTGATAAAATGTCTGTTGTAATGCGTTCGCTAG Reverse
AB291157
Top Related