Tumor Suppressor NF2 Blocks Cellular Migration by Inhibiting Ectodomain … · Oncogenes and Tumor...

Oncogenes and Tumor Suppressors

Tumor Suppressor NF2 Blocks Cellular Migrationby Inhibiting Ectodomain Cleavage of CD44Monika Hartmann1, Liseth M. Parra1,2, Anne Ruschel1, Sandra B€ohme1, Yong Li1,Helen Morrison1, Andreas Herrlich2, and Peter Herrlich1

Abstract

Ectodomain cleavage (shedding) of transmembrane proteinsby metalloproteases (MMP) generates numerous essential sig-naling molecules, but its regulation is not totally understood.CD44, a cleaved transmembrane glycoprotein, exerts both anti-proliferative or tumor-promoting functions, but whether pro-teolysis is required for this is not certain. CD44-mediatedcontact inhibition and cellular proliferation are regulated bycounteracting CD44 C-terminal interacting proteins, the tumorsuppressor protein merlin (NF2) and ERM proteins (ezrin,radixin, moesin). We show here that activation or overexpres-sion of constitutively active merlin or downregulation of ERMsinhibited 12-O-tetradecanoylphorbol-13-acetate (TPA)-induced[as well as serum, hepatocyte growth factor (HGF), or platelet-derived growth factor (PDGF)] CD44 cleavage by the metallo-protease ADAM10, whereas overexpressed ERM proteinspromoted cleavage. Merlin- and ERM-modulated Ras or Racactivity was not required for this function. However, latrunculin(an actin-disrupting toxin) or an ezrin mutant which is unable

to link CD44 to actin, inhibited CD44 cleavage, identifying acytoskeletal C-terminal link as essential for induced CD44cleavage. Cellular migration, an important tumor property,depended on CD44 and its cleavage and was inhibited bymerlin. These data reveal a novel function of merlin and suggestthat CD44 cleavage products play a tumor-promoting role.Neuregulin, an EGF ligand released by ADAM17 from its pro-form NRG1, is predominantly involved in regulating cellulardifferentiation. In contrast to CD44, release of neuregulin fromits pro-form was not regulated by merlin or ERM proteins.Disruption of the actin cytoskeleton however, also inhibitedNRG1 cleavage. This current study presents one of the firstexamples of substrate-selective cleavage regulation.

Implications: Investigating transmembrane protein cleavage andtheir regulatory pathways have provided new molecular insightinto their important role in cancer formation and possible treat-ment. Mol Cancer Res; 13(5); 879–90. �2015 AACR.

IntroductionThe ubiquitously expressed surface glycoprotein CD44 is

involved in a number of cellular functions not all of which areunderstood in molecular terms. Its role in cell-cycle control hasobtained most attention and it seems mechanistically best under-stood. Depending on extracellular ligands, intracellular partnerproteins, and/or the inclusion of alternatively spliced exonsequences,CD44canact as a tumor suppressorandmediate contactinhibition or can act alternatively as a tumor promoter and metas-tasis inducer. Binding of high-molecular-weight hyaluronan causes

cell-cycle arrest and tumor suppression (1–3). To achieve cell-cyclearrest, the tumor suppressor protein merlin (neurofibromatosistype 2; NF2) is recruited to the cytoplasmic tail of CD44, a locationfromwhich it inhibits Ras- and Rac-dependent signaling (1, 4). Onthe other hand, CD44 can counteract the tumor suppressor p53. Inorder for p53 to act as a tumor suppressor, CD44 expression needsto be downregulated (5). In addition, CD44 acts as coreceptor forreceptor tyrosine kinases, themost prominent example being c-Metwhichdependson thepresenceofaCD44splice variant comprisingexonv6 (6). This second functionofCD44promotes tumor growthand metastasis formation (7–9).

The tumor suppressor protein merlin (NF2), like CD44, isubiquitously expressed in mammals. Mice carrying one mutatednf2 allele are at risk of developing several types of tumors (10).Merlin is kept inactive in proliferating cells but is activated bydephosphorylation of 2 serines upon cell–cell contact and/orhyaluronan binding (ref. 2 and unpublished data). Dephosphor-ylation is regulated by a signal transduction pathway emergingfromcell–cell and/orhyaluronan–cell contact and involves all ERMproteins in addition to merlin. Interestingly, while merlin is acti-vated by this process, the ERM proteins are inactivated (11–13).Several typesof analyseshave led toproposals onhowmerlin couldact as a tumor suppressor, for example, by inhibiting mitogenicsignaling, activating the Hippo pathway, and/or promoting theestablishment of adherens junctions (reviewed by ref. 14).

Several years ago, it was discovered that CD44—like numerousother transmembrane proteins—is subject to ectodomain cleavageby metalloprotease activity (15, 16), now identified as ADAM10 (a

1Leibniz Institute for Age Research, Fritz Lipmann Institute, Jena, Ger-many. 2Harvard Institutes of Medicine, Renal Division, Brigham andWomen's Hospital, Harvard Medical School, Boston, Massachusetts.

Note: Supplementary data for this article are available at Molecular CancerResearch Online (http://mcr.aacrjournals.org/).

Current address for Y. Li: Anhui University School of Life Sciences, Hefei, China.

M. Hartmann and L.M. Parra shared first authorship andA. Herrlich andP. Herrlichshared senior authorship.

CorrespondingAuthors: Peter Herrlich, Fritz Lipmann Institute, Leibniz Institutefor Age Research, Beutenbergstr. 11, Jena 07745, Germany. Phone:493641656257; Fax: 4903641656351; E-mail: [email protected]; andAndreas Herrlich, Harvard Institutes of Health, Renal Division, Brigham andWomen's Hospital, Boston, MA, E-mail: [email protected]

doi: 10.1158/1541-7786.MCR-15-0020-T

�2015 American Association for Cancer Research.

MolecularCancerResearch

www.aacrjournals.org 879

on February 18, 2021. © 2015 American Association for Cancer Research. mcr.aacrjournals.org Downloaded from

Published OnlineFirst February 4, 2015; DOI: 10.1158/1541-7786.MCR-15-0020-T

http://mcr.aacrjournals.org/

disintegrin andmetalloprotease 10; refs. 17–19). This is followedbyg-secretase–dependent release of the cytoplasmic tail, which pro-motes the expression of proliferation-promoting genes in the nucle-us. Given the tumor-suppressive role of hyaluronan-bound CD44,ectodomain cleavage would abolish this function. We thereforeinvestigated how ectodomain cleavage of CD44might be regulated.

We report here that it is the tumor suppressor protein merlinitself that prevents CD44 cleavage, supporting the notion thatproteolytic processing of CD44 promotes tumor growth and thehypothesis that naturally occurringNf2mutants that are prone tomalignancies may fail to inhibit CD44 ectodomain cleavage andthereby its tumor-promoting role. This cleavage regulation isspecific to CD44, as we show that NRG1, the pro-form of theEGF ligandneuregulin, anADAM17 substrate andmajor regulatorof cellular differentiation, is cleaved upon stimulation but is notregulated by merlin or ERM.

Materials and MethodsReagents

DNA oligonucleotides (MetabionGmbH); 12-O-tetradecanoyl-phorbol-13-acetate (TPA), DAPT, latrunculin B, and batimastat(BB94; Calbiochem); PD98059 (Cell Signaling Technology);angiotensin II (ARIAD Pharmaceuticals, Inc.), 4-OH tamoxifen,EGF, FGF (Sigma); hepatocyte growth factor (HGF) and platelet-derived growth factor (PDGF; R&DSystems); andCK-548 (Tocris).

AntibodiesAnti-FLAG (M2 and SIG1-25; Sigma) and phosphospecific

antibodies against ezrin (Thr567)/radixin (Thr564)/moesin(Thr558) and p44/42 MAPK (Thr202/Tyr204; Cell SignalingTechnology); ADAM10 (735–749; Calbiochemor R&D Systems);ezrin (3C12; Thermo Fisher Scientific); ezrin (C-15), moesin (C-15), radixin (C-15), c-Myc (9E10), HA (F-7), NF2 (C-19; C-18; B-12), ERK 1 (K-23), NRG antibody (C-20), and actin (I-19; SantaCruz Biotechnology Inc.); CD44 (IM7, Becton Dickinson); anda-tubulin (Abcam). Antibodies directed against humanCD44: foran N-terminal epitope H-CAM F4 (Santa Cruz) and for a C-terminal epitope ARP61023-P050 (Aviva Systems Biology). Rab-bit polyclonal antibody recognizing the N-terminus of APP wasprovided by Christoph Kaether (http://www.imb-jena.de/"; FritzLipmann Institute - Leibniz Institute for Age Research, Jena,Germany). All secondary antibodies were from Dako.

PlasmidsThe sequence encoding the standard isoform of rat CD44 was

subcloned into the NotI/XbaI sites of pFLAG-myc-CMV-21. CD44mutants were generated by site-directed mutagenesis. The primersare listed in Table 1. Plasmids encoding mouse pro-neuregulin-1(NRG1) have been described (20). FLAG-tagged NRG1 was sub-cloned into EcoRI and XhoI restriction sites of pFLAG-myc-CMV-21(Sigma). Sequences encoding tagged CD44 were subcloned frompFLAG-myc-CMV-21 vector into the EcoRI site of the pCDH-CMV-MCS.Bsdviral vector. All constructswere verifiedbysequencing. Forstable downregulation of NF2, we used the viral vector pLV-H1-GIPZ (provided by Cui Yan and Helen Morrison, Jena, Germany).

siRNA sequencessiRNA SMARTpools, cocktail of 4 siRNAs and control "Non-

TARGETplus Pool" were from Thermo Scientific Dharmacon.Other siRNA oligonucleotides were from Applied Biosystems/Ambion. The sequences of the siRNA oligonucleotides are listedin Table 2. For downregulation of ERM proteins, a mixture ofoligonucleotides targeting ezrin, radixin, and moesin was used.

Definition of growth conditionsLow cell density (exponential growth)¼ density recorded at 36

hours after seedingof 1.25�104 cells per cm2 (NIH3T3)or 3.65�104 cells per cm2 (RPM-MC). High cell density (confluent growthcondition) ¼ density recorded at 36 hours after seeding of 3.5 �104 cells per cm2 (NIH3T3 cells) or 10� 104 cells per cm2 (RPM-MC cells).

Inhibition of cleavage conditionsMetalloprotease activity was blocked with 5 mmol/L batimastat

(BB94; Calbiochem) 15minutes before TPA stimulation. g-Secre-tase activity was blocked by 5 mmol/L DAPT (Sigma) or by 10mmol/L compound E (Enzo).

Cell migration assays—scratch wound assayWe isolated mouse embryonic fibroblasts from mice with

cd44flox/flox [cd44fl/fl; GT(Rosa)26-CRE (B6/129)] and immortal-ized these by downregulation of p19ARF.Cd44 gene deletion wasachieved by treatmentwith tamoxifen. Scratchwound assayswereperformed in triplicates in 6-well plates at high cell density (1.5�105 cells per well). Twenty-four hours after seeding, cells wereserum-starved for another 24 hours. Scratches were introducedwith a 200-mLpipette tip and cultureswere resuppliedwith serum-containing medium. Where indicated, cleavage was inhibited byadding 5 mmol/L batimastat. Scratches were imaged at 10, 24, and36 hours after scratching. Wound areas were quantified usingPhotoshop and ImageJ software.

Statistical analysisIntensity of immunoblot bands was quantified using ImageJ

and Image Lab (BioRad) software. All values on histograms arereported as mean � SD. P < 0.05 (Student t test) was consideredsignificant.

Table 1. Primers used for mutagenesis

Site-directed mutagenesis Forward primer 50–30 Reverse primer 50–30

CD44 KR-Mt CAGTAGGGCAGCGTGTGGGCAGGCGGCGGCGCTGGTGATC GATCACCAGCGCCGCCGCCTGCCCACACGCTGCCCTACTGCD44DICD GCATTGCTGTCAACTGAAGGAGAAGGTG CACCTTCTCCTTCAGTTGACAGCAATGCCD44Dstalk GTGATGGCACCTGGCTTATCATC GATGATAAGCCAGGTGCCATCAC

Table 2. siRNA oligonucleotides

TargetGenBankaccession no.

Sense strandsequence: 50-. . .-30

Human ADAM10 NM_001110 GCUAAUGGCUGGAUUUAUUGGACAAACUUAACAACAAUCCCAAAGUCUCUCACAUUAGCAAGGGAAGGAAUAUGUA

Luciferase (control) CGUACGCGGAAUACUUCGATTHuman ezrin NM_003379 AACCCCAAAGAUUGGCUUUCCHuman radixin NM_002903 AAGCAGUUGGAAAGGGCACAAHuman moesin NM_002444 AGAUCGAGGAACAGACUAAGA

Hartmann et al.

Mol Cancer Res; 13(5) May 2015 Molecular Cancer Research880




See Supplementary Data for Cell lines, transfections, TCA-DOCprecipitations, coimmunoprecipitation, generation of celllysates and analysis

ResultsIncreased cell density inhibits ectodomain cleavage of CD44

As has been reported previously, CD44 is subject to the metal-loprotease ADAM10-dependent ectodomain cleavage and subse-quent release of the cytoplasmic CD44 C-terminus by g-secretase(17–19). Aiming at understanding the regulation of CD44 ecto-domain cleavage, we introduced expression constructs encodingdoubly tagged (N- and C- terminal tags) CD44 proteins intoNIH3T3, CD44�/� MEFs, RPM-MC, or MDA-MB-231 cells andexamined their proteolytic processing. The N-terminus of CD44carried a FLAG tag, the C-terminus, a c-myc motif. RPM-MChumanmelanoma cells, as well as CD44�/�MEFs, do not expressendogenous CD44, which simplified detection of the transfectedmolecule, permitted to introduce CD44 mutants, and allowed toanalyze signaling pathways independently of endogenous CD44.In NIH3T3 and MDA-MD-231 cells, we also investigated thecleavage of endogenous CD44. NRG1 was similarly tagged byN-terminal FLAG and C-terminal myc tag. CD44 and NRG1cleavage was induced by TPA, a phorbol ester that mimics dia-cylglycerol and activates most protein kinase C (PKC) isoforms.Cleavage could also be induced by serum factors, by HGF andPDGF, and, if cells carried the appropriate G-protein–coupledreceptor, by angiotensin II. In most experiments, g-secretaseactivity was blocked using the g-secretase inhibitor, DAPT, toquantitate only the products of the first processing event, ADAM-dependent ectodomain cleavage. Omission of DAPT did notsignificantly alter our principal results on regulation, but causedfurther processing of the C-terminal ADAM-dependent cleavageproduct (Supplementary Fig. S1). It is important to note that inour analysis of CD44 and NRG1 cleavage, we ensured that wefocused exclusively on processing of the substrates after theirproper insertion into the plasma membrane. To ascertain this,we carried out experiments very shortly after cell surface biotiny-lation, showing that biotinylated ectodomains, solCD44E andneuregulin, are indeed released into the supernatant (Supplemen-tary Fig. S2), suggesting cleavage of substrates already present onthe cell surface. However, the effect of transport regulation oncleavage has not been examined here.

Figure 1A demonstrates the basic cleavage reaction: Transfectedfull-length CD44 molecule (CD44fl) is detected by antibodiesdirected against the C-terminal myc tag, and the cleaved-offsoluble ectodomain (solCD44E) is recognized by anti-FLAGantibodies. As expected, vector-transfected control RPM-MC cellsshowed no staining (V). In the absence of the cleavage stimulus(�TPA), there was relatively little spontaneous release ofsolCD44E, but cleavage was strongly enhanced after treatmentwith TPA (Fig. 1A). Both spontaneous and induced cleavageswereblocked by batimastat, an inhibitor of ADAM protease activity.DAPT had no major effect on the result of ADAM-dependentcleavage regulation (Fig. 1B, see also control experiments inSupplementary Fig. S1).

Because CD44 regulates contact inhibition of cells, we won-dered whether its cleavage regulation was dependent on celldensity. While spontaneous cleavage was reduced only slightly,TPA-induced cleavagewasmarkedly diminishedby increasing celldensity from 5� 105 to 9� 105 cells per well of a 6-well plate (for

quantitation. see the column diagram of 3 independentexperiments; Fig. 1C). From previous reports, it has beenknown that high cell density causes dephosphorylation of bothmerlin and its counterplayers, the ezrin–moesin–radixin (ERM)proteins, by the same protein phosphatase-1 isoenzyme (2).Dephosphorylation of ERM proteins deactivates them whereasit activates merlin. In turn, phosphorylation of both ERMproteins and merlin depends on protein kinase activity duringthe exponential growth of cells (21–23). While little phospho-ERM could be detected in the absence of a stimulus (left 3 lanesin Fig. 1C), ERM proteins were strongly phosphorylated uponTPA treatment of cells (compare lanes 1 and 4, Fig. 1C). Asexpected, phosphorylation of ERM proteins declined withincreasing cell density, coinciding with decreased CD44 cleav-age (lanes 5 and 6, Fig. 1C). Merlin dephosphorylation followsexactly that of the ERM proteins (data not shown and Supple-mentary Fig. S3A).

The tumor suppressor protein merlin inhibits ectodomaincleavage of CD44

To investigate whether dephosphorylation of ERM proteinsand reduced CD44 ectodomain cleavage with increasing celldensity was not simply coincidental, we tested the effect of over-expression of merlin or of ERM mutants (see below) on CD44-induced cleavage in RPM-MC cells. To this end, we first examinedthe effect of a constitutively active merlin mutant (NF2-S518A),which does not require dephosphorylation. These experimentswere done under low cell density conditions atwhich endogenousmerlin is phosphorylated and inactive, and activated ERM pro-teins drive proliferation. TPA induced solCD44E release in theabsence of transfectedmerlin (Fig. 2A; compare lanes 1 and 4,WB:FLAG). However, expression of the singly mutated active merlin(NF2-S518A) was sufficient to inhibit solCD44E release in RPM-MC cells (Fig. 2A; compare lanes 2 and 5, WB: FLAG; also seecolumn diagram of quantification of 3 independent experi-ments), whereas the phospho-mimicking mutant S518D had noeffect (see also similar data obtained in NIH3T3 cells, Supple-mentary Fig. S4). Cleavage of the ADAM17 substrate neuregulin(NRG1) in the same cells was not inhibited (Fig. 2B). Quantita-tionshavebeen compiled as columndiagram inFig. 2A/B'.We cantherefore conclude that the tumor suppressor merlin specificallyinhibits CD44 cleavage by ADAM10 and that merlin does notinterfere with a common signaling pathway addressing ADAMcleavage in general.

We had previously shown that contact inhibition requires thebinding of dephosphorylated active merlin to the C-terminusof CD44 via a membrane-proximal basic amino acid sequence,known as the KR motif (Supplementary Fig. S3B; initiallydescribed as an ezrin-binding site; ref. 1). We therefore fol-lowed the idea that cleavage regulation of CD44 might alsorequire merlin binding to the C-terminus. To investigate this,we compared cleavage of wild-type CD44 and the CD44mutant with a complete deletion of the intracellular domain,ICD (CD44DICD). First, we made sure, by confocal microscopyand immunostaining, that the deletion mutant was properlyinserted into the plasma membrane (data not shown). Second,we confirmed that it was still processed by ADAM10 (as isCD44 wt). Release of solCD44E from CD44DICD was blockedby siRNA-dependent downregulation of ADAM10 (Fig. 3A,compare lanes 1 and 2) or by addition of the ADAM inhibitorbatimastat (Fig. 3A, lane 1 vs. 3).

Merlin/NF2 Blocks Ectodomain Cleavage of CD44

www.aacrjournals.org Mol Cancer Res; 13(5) May 2015 881




We then compared the action of merlin mutants on cleavage offull-length CD44 (WtCD44; first six lanes, Fig. 3B) and of CD44with deletion of the ICD (CD44DICD; lanes 7–12, Fig. 3B; see alsothe top column diagram and the loading scheme in Supplemen-tary Fig. S7) as well as on cleavage of the noncleaved mutantCD44-KR-Mt (bottom column diagram, Fig. 3B). Indeed, absenceof the entire CD44 intracellular domain as well asmutation of theKR motif prevented the inhibitory effect of merlin on cleavage.The topmost first panel in Fig. 3B, shows the level of endogenous(inactive) merlin and of the transfectedmerlinmutants. The thirdpanel shows detection of the released solCD44E and the fourthpanel the full-length molecules (both detected with anti-FLAGantibodies). As already shown in Fig. 2, constitutively active NF2-S518A, but not NF2-S518D, inhibited full-length CD44 cleavage(lanes 5 and 6, Fig. 3B). Interestingly, total absence of thecytoplasmic tail of CD44 caused significant spontaneous ectodo-main cleavage (lane 7, Fig. 3B), suggesting that the ICD sup-pressed spontaneous cleavage and was required for TPA-induced

regulation. However, TPA was still able to increase cleavage tosome extent (compare lanes 7 and 10, Fig. 3B; also see Discus-sion). Both spontaneous and induced solCD44E release from theCD44DICD mutant was resistant to inhibition by constitutivelyactive merlin NF2-S518A (compare lanes 8 and 11, Fig. 3B). Notethat NF2-S518D had little to no effect on this release (lanes 9 and12, Fig. 3B). A quantitation of 3 independent experiments withCD44DICD is shown in the top column diagram. Strong cleavagecoincidedwith the appearance of several solCD44Ebands (Fig. 3AandB).Weassume that thismight bedue to thepresence of severalADAM10 cleavage sites on CD44. The CD44KR-Mt mutant wasbarely inducible by TPA and not inhibited by merlin (see bottomcolumn diagram in Fig. 3B), as one would expect because themutation destroys the merlin-binding site. For comparison,another ADAM substrate, the amyloid precursor protein, APP, isshown in the second panel of Fig. 3B. TPA induced cleavage ofbothCD44 and of APP (compare lanes 1 and 4, Fig. 3B); however,cleavage of the ADAM17 substrate APPwas not affected bymerlin

Figure 1.Cell density–dependent regulation of CD44 ectodomain cleavage. A, TPA induced ADAM-dependent ectodomain cleavage of CD44. The CD44-negative cell lineRPM-MC was transfected with a doubly tagged expression construct of standard isoform of wild-type CD44 (CD44s). V, vector control. All samples weretreated with g-secretase inhibitor DAPT (5 mmol/L). Batimastat (5 mmol/L) was added as indicated. The cells were kept in logarithmic growth condition. Full-lengthCD44 (CD44fl) was detected by an antibody recognizing the C-terminal myc tag. The cleaved ectodomain (solCD44E) was detected in culture supernatantsafter TCA-DOC (see Supplementary Materials and Methods) precipitation by an antibody against the N-terminal FLAG tag. Treatment of the cells with 100 ng/mLphorbol ester (TPA) induced detectable cleavage within 15 minutes and led to accumulation of solCD44E in 3 to 4 hours. Here, TPA treatment was for3 hours. Actin served as loading control. The cleavage is inhibited by the metalloprotease inhibitor batimastat. B, TPA induced ADAM-dependent ectodomaincleavage of CD44 in the absence of g-secretase inhibition (no DAPT). C, high cell density inhibits ectodomain cleavage of CD44. RPM-MC cells transfected withtagged CD44 as in Awere seeded into 6-well plates at different densities, as indicated. Cellswere treatedwith 100 ng/mL TPA for 4 hours. The amount of cell lysatesloaded on the gel was normalized to actin levels. CD44 cleavage was detected by the release of CD44DE (membrane-bound cleavage product lacking theectodomain) andby c-Myc immunoblot in cell lysates. TPA-induced generation of themembrane-bound cleavage product (CD44DE)was diminishedwith increasingcell density. At the same time, merlin (not shown) and the ERM proteins were dephosphorylated (middle). The 62-kDa band (�) likely represents endogenousc-Myc; the 40-kDa band (�) is unspecific. Representative blots are shown. The intensity of immunoblot bands was quantified with ImageJ. Histogramsshow mean values of relative level of cleavage � SD from 3 independent experiments (�� , P ¼ 0.000924 for 5 � 105 vs. 7 � 105 and P ¼ 0.000211 for 5 � 105

vs. 9 � 105). Levels of phospho-ERM proteins relative to that at the density of 5 � 105 are indicated within the immunoblot.

Hartmann et al.





(compare lanes 5, 6 and 11, 12, Fig. 3B). Also, cleavage of theADAM10 substrate c-Met was merlin-resistant (data not shown).Consistent with this neither APP nor c-Met does, to our knowl-edge, carry a KR motif in its C-terminus.

Our results using the CD44 ICD deletion and the KR-Mtmutant suggest that merlin interaction with the ICD of CD44 isnecessary for its cleavage regulating function. Importantly,CD44 was coprecipitated with merlin only if its ICD was intact(Fig. 3C). Mutation of the KR motif abolished merlin interac-tion (Supplementary Fig. S3B), identical to the ICD deletion(Fig. 3C). Similarly, the absence of merlin regulation on neur-egulin release (Fig. 2B) and the resistance of APP, c-Met, andNRG1 cleavage to regulation by merlin further strengthensthe idea of substrate-specific regulation of ectodomain cleavageand confirms our assertion that merlin exerts a direct specificeffect on CD44 and its cleavage, rather than interfering witha cleavage regulatory signaling pathway common to these3 substrates.

The action of ERM proteins and the mechanism of merlin-dependent inhibition of CD44 ectodomain cleavage

CD44 C-terminally bound merlin mediates contact inhibitionpredominantly by blocking Ras and Rac activity. This is counter-acted by ERM proteins, which promote Ras and Rac activation.

Awell-studiedmechanismhas shown that Ras is activated by ERMproteins interacting with both Ras and the guanine nucleotideexchange factor and activator of Ras, son of sevenless (SOS;ref. 24). Because active merlin inhibits CD44 ectodomain cleav-age, we were wondering whether its Ras inhibitory action wasrequired for this effect and in turnwhether cleavage required ERMprotein–dependent Ras activation.

Upon downregulation of all 3 ERM proteins using siRNA, TPA-induced cleavage was indeed significantly reduced [detected bythe reduced release of solCD44E (N-terminal FLAG tag) andof themembrane-bound cleavage product CD44DE (C-terminal c-myctag); Fig. 4A]. Neuregulin release, however, was not affected bydownregulation of ERMs (Fig. 4B). If the ERM-induced Rasactivation was required for CD44 cleavage, a constitutively activeRas pathway should bypass ERM protein requirement and causeconstitutive cleavage. We thus turned on the Ras pathway bytransfecting an ERM-independent dominant-active SOS (DA-SOS, tagged with HA to visualize its expression; ref. 25; calledSOS-F in ref. 26) and compared its effect on cleavage in controlcells (empty vector, V), cells expressing CD44 full length(WtCD44), and cells carrying CD44 with a mutant KR domain(CD44 KR-MT), the motif required for interaction of CD44 withmerlin and ERM proteins (see above; ref. 1). In control cellslacking CD44 expression (empty vector control lanes 1–4

Figure 2.The tumor suppressor merlin (NF2) downregulates CD44 ectodomain cleavage. A, RPM-MC cells were cotransfected with tagged CD44 (as in Fig. 1) and merlinmutant expression constructs (or vector control, "V"). The cells were kept at low cell density so that endogenous merlin is not activated. Therefore, thevector control lanes show TPA-induced cleavage (lanes 1 and 4) similarly to Fig. 1A. The action of merlin can however be determined by introducing a mutant thatmimics dephosphorylation. The dephosphorylation-mimicking merlin mutant NFS518A (constructs as described in ref. 46) inhibited CD44 cleavage (shownfor the released solCD44E and the residual membrane-bound fragment CD44DE; compare lanes 2 and 5). The phospho-merlin mimicking inactive mutant NFS518Ddid not affect the cleavage induction (lanes 3 and 6). Because of the similar migration of merlin and CD44, these 2 proteins were detected on separategels, and respectively 2 subsequent loading controls are shown. B, corresponding experiment as in (A) shows the result for another ADAM substrate, the neuregulinprecursor NRG1. Merlin-dependent inhibition was specific for CD44, as NRG1 was not affected. The histograms in A/B0 show mean values of relative level ofcleavage �SD from 3 independent experiments (�� , P ¼ 0.000337).






in Fig. 4C; see also the experimental setup table in SupplementaryFig. S7), DA-SOS caused phosphorylation of a downstream targetof Ras, Erk, to the same degree, as did TPA stimulation (Fig. 4C,compare lanes 2 and 3). DA-SOS in the presence of TPA furtherenhanced phospho-Erk (Fig. 4C, lane 4), which might beexplained, although does not prove, by their different mechan-isms of action: DA-SOS activates Ras, whereas TPA acts down-stream of Ras, adding to the activation of the pathway. DA-SOSdid neither enhance spontaneous (Fig. 4C, lane 6) nor TPA-induced (Fig. 4C, lane 8) release of WtCD44 ectodomain(solCD44E). Cleavage of mutant CD44 KR-Mt barely respondedto TPA treatment (Fig. 4C, compare lanes 9 and 11) and this blockcould not be overcomebyDA-SOS (lanes 10 and 12). The column

diagram shows a quantitation of 3 independent experiments.Finally, an inhibitor of MEK, a downstream effector of Ras,blocked Erk phosphorylation but did not affect CD44 cleavage(Fig. 5A). We therefore conclude that CD44 cleavage is indepen-dent of an active Ras–Erk signaling pathway.

Given that the SOS-Ras activating function of ERMproteinswasnot required for CD44 ectodomain cleavage, we explored otherputative options. To this end, we exploited transfections withezrin mutants. Overexpression of ezrin mutants should competeout endogenous ERM proteins. This is possible because in ourcultured cells, all 3 ERMproteins are redundantwith respect to Rasactivation and this redundancy can be overcome by overexpres-sion of an active mutant of one of the ERMs. We therefore tested

Figure 3.The cleavage repression by merlin is substrate-specific and requires the intracellular domain (ICD) of CD44. A, complete deletion mutant of the CD44 ICDwas transfected into RPM-MC cells. Immunostaining showed proper insertion into the plasma membrane (not shown). The cells were treated with TPA for3 hours. Cleavage (lane 1)was absent upon downregulation of ADAM10 (lane 2; see reduced expression of theADAM10precursor A10P) or treatmentwith batimastat(lane 3). C, control siRNA. B, cleavage of CD44DICD is resistant to merlin inhibition. CD44 wild-type or CD44 lacking the ICD, both tagged with N-terminalFLAG, were cotransfected with plasmids encoding merlin mutants (or vector) as in Fig. 2. solCD44E is detected by anti-FLAG. In the same cells, the cleavageof endogenous amyloid precursor protein, APP, was determined by immunoblot using an ectodomain-specific antibody recognizing released solAPPE. CD44cleavage was quantitated from 3 independent experiments as shown in the column diagram (�� , P ¼ 0.000870). The full-length molecules of WtCD44 andCD44DICD show the size difference only in 6% gel. The ICD deletion mutant generated significant amounts of solCD44E in the presence or absence of TPA. Thisindicates that the ICD represses cleavage and is needed for regulated processing. Mutation of the KR motif of the ICD prevents induced cleavage and waslike the ICD deletion, resistant to merlin (NF2, see column diagrams). C, we had shown in the past that activated merlin exerts its function upon binding to a basicamino acid stretch in the membrane proximal part of the cytoplasmic domain of CD44. Indeed, merlin coprecipitates CD44 only in the presence of the cytoplasmictail (experiment shown was done in NIH3T3 cells). The KR mutant does not interact with merlin (Supplementary Fig. S3B).

Hartmann et al.





whether overexpressed ezrin mutants could reveal the function ofERM proteins that was required for CD44 cleavage. Figure 5Bshows the effect of overexpressed ezrin wt or ezrin mutants. In theabsence of TPA stimulation, we detected no CD44 cleavageirrespective of transfected ezrin constructs (as detected by cleavageproduct CD44DE; lanes 1–5; Fig. 5B). TPA-induced cleavage isshown in lanes 6 to 10. Neither wild-type ezrin (Fig. 5B, comparelanes 6 and 7) nor a phospho-mimicking mutant T567D (Fig. 5B,lane 8) affected CD44 cleavage, suggesting that endogenous ERMproteins are so abundant that additional transfected ezrin con-structs made no difference. Somewhat surprisingly, however, the"inactive" ezrin T567A mutant inhibited CD44 cleavage (Fig. 5B,lane 9) suggesting that it competed with the endogenous ERMproteins for a cleavage regulatory component.

A possible lead toward this putative component and thecleavage regulatory function of ezrin was generated by the effectof the ezrin mutant R579A which cannot interact with F-actin(27). This mutant inhibited CD44 cleavage (Fig. 5B, lane 10),highlighting the possible need for an actin link to achieve CD44cleavage. Interestingly, in respect to its inability to bind to actin,ezrin R579A mimics the cleavage inhibitory merlin whose C-terminus also cannot interact with F-actin (28, 29). These obser-vations propose that disrupting F-actin would exert a similarinhibitory effect. We tested this assumption by adding an increas-ing amount of latrunculin, an inhibitor known to block actinpolymerization (30). Short-term treatment (30 minutes) of thecells with 0.75 to 1.0 mg/mLof latrunculin indeed inhibited CD44cleavage (Fig. 5C). This result made us wonder whether a link tothe actin cytoskeleton were specific for the ERM-dependent sub-strate CD44. This was not the case: NRG1 cleavage depended alsoon an intact actin cytoskeleton (Fig. 5D).

Physiologic stimuli induce ectodomain cleavage in differentnormal and cancer cells

TPA mimics a signaling process that is activated by numerousphysiologic stimuli. Therefore, such stimuli should also result inectodomain cleavage. This is indeed the case: in HEK293T cellsthat stably overexpress the angiotensin receptor (HEKNE in Fig.5D), angiotensin II strongly induced neuregulin release. In thetriple-negative breast cancer cell line MDA-MB-231, we were ableto induce either endogenous or transfected CD44 cleavage byserum (see below in Fig. 7B and C), HGF, PDGF, LPA and,moderately, by FGF and EGF (Fig. 6A and B). MDA-MB-231 cellswere also responsive to TPA. TPA- or HGF-induced cleavage ofendogenous CD44 or overexpressed CD44 was inhibited byexpression of constitutively active merlin (S518A; Fig. 6B). CD44cleavage was also induced in MEF cells (see below: Fig. 7A). Weconclude that the pathway regulating CD44 cleavage is addressedby many extracellular stimuli.

CD44 cleavage is required for cellular migrationAccording to our data, CD44 cleavage is a property of prolif-

erating cells. This property as well as its blockade by the tumorsuppressor NF2 (contact inhibition) should also be relevant forthe control of cancer cells. We therefore explored whether CD44cleavage was needed for cancer-relevant cellular phenotypes relat-ed to their proliferative capabilities: mobility and migration. Tothis end, we subjected MEF and MDA-MB-231 cells grown inconfluentmonolayers to scratch assays andmeasured their abilityto close the scratch wound. After plating and scratching, cells weresupplied with FCS that contains factors like LPA that we haveshown to induce ectodomain cleavage. Using MEFs from micewith floxed cd44 alleles, we could compare cells expressing

Figure 4.ERMproteins promote CD44 cleavage.A, downregulationofall 3 ERMproteinsreduce CD44 cleavage. RPM-MC cellswere transfected as in Fig. 1A. Cellswere grown at low density. Theexpression of ERM proteins wasdownregulated in about 98% of thecells by a mixture of siRNAs targetingall 3 members of the ERM proteinfamily, ezrin, radixin, and moesin(nontargeting siRNA "C" was used ascontrol). Downregulation of ERMproteins inhibited ectodomaincleavage of CD44. B, NRG1 cleavage isresistant to downregulation of ERMproteins. Setup of the experiment as inA, except that double-tagged NRG1was transfected as cleavage substrate.C, constitutive activation of the Raspathway does not stimulate CD44cleavage. Overexpression of an HA-tagged dominant active SOS mutant(DA-SOS, 24) that is permanentlymembrane-associated, activatesRas—as detected by phosphorylatedErk—independently of the presence ofERM proteins and TPA treatment.Histogram shows mean values ofrelative level of solCD44E � SD from3 independent experiments (Wt: V vs.DA-SOS, P ¼ 0.53955; KR-Mt: V vs.DA-SOS, P ¼ 0.932614).






CD44 with CD44-null cells (after CRE-dependent excision) andwe also could substitute the cells with CD44 mutants. Supple-mentary Figure S6 shows photographic examples of the originalscratch assay. The left picture of each condition tested shows thescratch at time 0 and the original cell number as indicated in thesquare. The right picture of each condition tested shows the samescratch wound after 24 hours and the percentage of the woundarea still open. Quantitation of 3 experiments has been compiledin Fig. 7A. Treatment with the ADAM inhibitor batimastat strong-ly inhibited wound closure of migration-competent cells. CD44plus cells (cd44fl/fl) repaired the scratch wound efficiently(remaining wound area 21% after 24 hours, Supplementary Fig.S6, panel 1, and Fig. 7A). Downregulation of merlin (NF2) bystably integrated shRNA enhanced the migration (0% wound

remaining, Supplementary Fig. S6, panel 2, >2% in the quanti-tation of Fig. 7A). There was almost no wound closure by CD44-null cells (CD44�/� after CRE induction, see SupplementaryMaterials and Methods and Supplementary Fig. S5). In thesecells, NF2 was also downregulated (Supplementary Fig. S6, panel3, and Fig. 7A). Although cd44�/�:nf2þ/þ was not obtained, thedata suggest thatNF2 did not address a pathway other thanCD44.However, re-introducing CD44wt partly re-establishedmigration(remaining wound area 30% after 24 hours in the absence ofmerlin, Supplementary Fig. S6, panel 4, and Fig. 7A). This partialrescue might be explained by the fact that CD44wt cDNA over-expression does not generate certain splice variants of CD44 thatwould be expressed under physiologic conditions but are missingin CD44�/� cells. Most importantly, stable transfection of the

Figure 5.Mechanism of ERM protein–dependent CD44 cleavage. A, inhibition of the Ras pathway does not affect CD44 cleavage. NIH3T3 cells were seeded in 6-wellplates at low cell density. The cells were transfected as in Fig. 1A. Cells were pretreated with increasing concentrations of MEK1 inhibitor (PD98059) for30minutes and afterward stimulatedwith 100 ng/mL TPA for 4 hours. The effect of PD98059was confirmed by its inhibition of Erk phosphorylation. Inhibition of theMEK-ERK pathway had no effect on CD44 cleavage. B, effect of overexpressed ezrin mutants on CD44 cleavage. RPM-MC cells were cotransfected withplasmids encoding N-terminal FLAG and C-terminal HA-tagged CD44 and plasmids encoding myc-tagged ezrin mutants (described in ref. 46): T567A (inactive),T567D (active), R579A (not interacting with F-actin) and treated as in Fig. 1A. Overexpressed mutant ezrins compete with endogenous ERM proteins forcleavage-relevant interactions. C, block of actin polymerization inhibits CD44 cleavage. RPM-MC cells were transfected with a plasmid encoding wild-type CD44and treated with DAPT as in Fig. 1A. To block actin polymerization (F-actin), latrunculin B was added at the concentrations indicated. Thirty minutes afteraddition of latrunculin B, cells were stimulated with 100 ng/mL TPA for 30 minutes. D, neuregulin release is inhibited by interference with F-actin. HEKNEwt cells (HEK293T-AT1R þpB-Flag-NRG1-EGFP) were pretreated with a vehicle control (DMSO) or with the Arp2/3 inhibitor CK-548 in increasing concentrations(0–15 mmol/L) alone or before angiotensin II (1 nmol/L) stimulation. NRG1 cleavage was detected by immunoblotting using NRG1 antibodies. Angiotensin IIwas able to induce NRG1 cleavage in the absence (lane 2) but not in the presence of CK-548 (lanes 6–8).

Hartmann et al.





noncleavable mutant CD44-KR-Mt as well as of a CD44 mutantthat lacks the stalk region including the ADAM cleavage site couldnot rescue the wound-healing deficiency of CD44-null MEFs(Supplementary Fig. S6, panels 5 and 6, and Fig. 7A). Theseresults clearly indicate that CD44 cleavage is required for a cancerrelevant phenotype, cellular migration and that this function isnegatively controlled by merlin.

MDA-MB-231 cells closed the scratch wound faster than MEFs.At 24 hours after scratching, woundswere totally closed (note thatwoundareanormalized to the0 timepoint; Fig. 7B). Expressionofactive merlin (NF2S518A) inhibited wound healing. Inactivemerlin (NF2S518D) had less effect (Fig. 7B and C). Interestingly,spontaneous migration was enhanced and the inhibition bymerlin rescued by expression of solCD44E (Fig. 7C) suggestinga role of CD44 ectodomain cleavage in migration.

DiscussionThe activity state of bothmerlin and ERMproteins is controlled

by signaling pathways that address specific protein kinases (e.g.,PAK) and phosphatases (e.g., PP1). A hyaluronan–CD44–depen-dent signaling pathway (or cell–cell contact) favors dephosphor-ylation of ERM proteins and merlin, deactivating ERM proteinsand activating merlin, thus establishing tumor suppression capa-bilities. Growth factor stimulation, in turn, activates ERMproteinsand inactivates merlin, favoring growth and tumor development.In this context, our results on CD44 cleavage inhibition bymerlinpermit the following conclusions:* When activated by a cell density–dependent signaling

pathway, merlin prevents CD44 ectodomain cleavage,coinciding with and preserving contact inhibition of cells.

* Regulation by merlin represents an example of substrate-selective cleavage regulation. NRG1 and APP, in our cellsstudied, are subject to substrate-specific regulation differentfrom CD44.

* CD44 cleavage appears to serve a tumor-promoting process byenhancing proliferation/migration of cells, including cancercells.

TPA-induced CD44 shedding from the cell surface is regu-lated by ERM proteins and merlin, in contrast to other ADAMsubstrates, such as NRG1, c-Met, and APP. Interestingly, inneural cells, purinergic P2�7 receptor–induced APP cleavagerequired ERM proteins (31). Rather than direct interaction ofthe APP ICD with ERM proteins, this event required down-stream signaling induced by ERM proteins. However, ERMactivation was not always associated with the induction of APPshedding. Nerve growth factor (NGF) and benzoylbenzoyl ATPtriggered ERM phosphorylation, but only the latter led to APPshedding (31). Apparently, signaling pathways can diverge afterERM activation. Similar to our results with CD44, TPA-inducedL-selectin shedding in lymphocytes was regulated by directinteraction of ERM proteins with a proximal basic amino acidregion in the cytoplasmic domain of L-selectin (32). Theimportant conclusion from these reports is that substrates arespecifically selected for cleavage.

Does thismeanwe candisregard other formsof regulation?Notat all. Regulation of ADAM activity has been widely studied (33–36). As example, we have seen ADAM activation by TPA in one ofour experiments, where despite constitutive cleavage of the ICD-less CD44, TPA was still able to increase cleavage to some extent(compare lanes 7 and 10, Fig. 3B). However, CD44 is, in addition,specifically selected for cleavage on the substrate level.

0

0.2

0.4

0.6

0.8

1

1.2

V S518A S518D

Rel

ativ

e le

vels

of

CD

44DE

Rel

ativ

e le

vels

of

CD

44DE

A

B

Myc-tagged transfected CD44 wt

Endogenous CD44

MDA-MB-231

Control

+HGF–TPA

+TPA

Myc-tagged transfected CD44 wt

0

0.2

0.4

0.6

0.8

1

1.2

1.4

1.6

Control TPA EGF PDGF FGF LPA

0

0.2

0.4

0.6

0.8

1

1.2

V S518A S518D

Rel

ativ

e le

vels

of

CD

44DE

Wt CD44

Figure 6.Induction of CD44 cleavage byphysiologic stimuli in the breastcancer cell MDA-MB-231. A, growthfactor–dependent cleavageinduction. MDA-MB-231 cells weretransfected with the double-taggedCD44 construct as in Fig. 1A. B, merlininhibits TPA- or HGF-induced CD44cleavage in MDA-MB-231 cells. Left,detection of cleavage of endogenousCD44 expression using human CD44specific antibodies. Right, cells hadbeen transfected with tagged CD44.A and B, cells were treated for 1 hourwith 50 ng/mL of growth factors or100 nmol/L TPA.






Importantly, regulation of ectodomain cleavage by a tumorsuppressor protein has not been observed previously. It suggeststhat CD44 cleavage serves a tumor-promoting function. Thisnotion is further strengthened by the documentation that CD44cleavage participates substantially in the regulation of cellularmigration.Migration is inhibited bymerlin and can be rescued bysoluble CD44 ectodomain (Fig. 7). A role of CD44 in cellularmigration has been observed previously (15, 17, 37–42). Forinstance, CD44 promoted invasion of glial cell tumor cells by itsability to bind hyaluronan (37). CD44 mediated migration ofpancreatic cancer cells in conjunction withMT1-MMP (38). It hasbeen suggested that cleavage is involved by the fact that inhibitionof metalloproteases reduced migration (15); conversely, coex-pression ofmetalloproteasewithCD44 enhancedmigration (42).We have described elsewhere that CD44 homodimerization is aprecondition for ectodomain cleavage (M. Hartmann and collea-gues; submitted for publication). Expectedly, ligation by anti-CD44 antibodies induced metalloprotease-dependent CD44

ectodomain release and migration in the aggressive tumor cellline U251MG (17, 41). Ligation-induced cleavage and migrationwas counteracted by expression of a dominant-negative Racmutant (17, 41), suggesting that Rac signaling preceded cleavage.Our results are compatible with these data. Merlin action oncleavage did, however, not need to interfere with Ras/Rac (seebelow). Expression of soluble CD44 ectodomain, however, pre-vented cleavage (M. Hartmann and colleagues; submitted forpublication) which seems to contradict our finding that expres-sion of soluble CD44 enhanced migration. We have no straight-forward explanation for this observation. Further analyses will beneeded. The influence on migration may depend on the substra-tum the cells are placed on, the time course of adhesion/de-adhesion and on adhesion molecules other than CD44.

The cleavage-promoting role of ERM proteins matches theiroverexpression in tumors (43–45). However, we ruled out thatERM-induced cleavage regulation requires their activation of theRas and Rac pathway by demonstrating that an ERM-independent

MDA-MB-231B

0

–/–

–/–

–/– –/–

1020304050607080

% W

ou

nd

gap

rem

ain

ing

******

**

A

MEFs

0

20

40

60

80

100

V NF2A NF2D

% W

ou

nd

gap

rem

ain

ing

After 24 h

0

20

40

60

80

100

V NF2A NF2D

% W

ou

nd

gap

rem

ain

ing

After 36 h

Control

+Batimastat

0

20

40

60

80

100

V NF2A NF2D

% W

ou

nd

gap

rem

ain

ing

After 12 h

+solCD44E

Control

+solCD44E

Control

+solCD44E

Control

MDA-MB-231C

0%

10%

20%

30%

40%

50%

60%

10 24 48

% W

ou

nd

gap

rem

ain

ing

Hours after scratching

NF2S518A

Control

NF2S518D

Figure 7.Merlin inhibits cellular migration through block of CD44 cleavage. A, quantitation of 3 series of scratch assays using immortalized MEFs from mice withfloxed cd44 alleles (Cd44fl/fl; GT(Rosa)26-CRE (B6/129) and derivatives of these cells. Examples of the original photographs are shown in Supplementary Fig. S6.Cd44fl/fl cells express the endogenous CD44. Cd44fl/fl/shNF2, same cells with stable downregulation of merlin. After CRE-induced disruption of the cd44alleles (cd44�/�), the cells were infected with viral constructs encoding CD44 wt or the noncleavable mutants: CD44-KR-Mt and CD44stalk-del. SupplementaryFigure S5 shows the levels of merlin and CD44 in the analyzed MEFs lines. B and C, scratch assays using MDA-MB-231 cells. The cells were infected by lentiviralmerlin constructs where indicated. C, rescue of cleavage-dependent migration by expression of the soluble CD44 ectodomain. To resolve the time coursebetter, the temperature was reduced to 30�C.

Hartmann et al.





constitutive activation of Ras did not influence CD44 cleavage.Ezrinmutants defective in activating guaninenucleotide exchangefactors, for example, R579A or T567A prevented induced cleavage(Fig. 5B and data not shown). On the basis of the dominant-negative effect of the ezrin actin-link mutant R579A and ourresults using actin-disrupting latrunculin, we hypothesize that aCD44 F-actin link plays a role in the induction of its proteolysis.We have shown previously that short-term treatment with latrun-culin causes only highly specific pathway disruptions (46). Whatthe F-actin link might contribute is currently speculative. Does itsupport the assembly of CD44 and its protease ADAM10 in theplane of the plasma membrane? Interestingly, neuregulin releasewas also sensitive to an actin poison. We do however not knowwhether and how NRG1 is linked to F-actin.

Another intriguing observation has been reported: the induc-tion of CD44 cleavage by treating cells with hyaluronate oligo-saccharides (16). Low-molecular-weight hyaluronan does notcause activation of merlin whereas high-molecular-weight hya-luronan does (1, 3). We assume that the oligosaccharides activatecleavage-inducing signaling pathways in a CD44-independentmanner (47). The oligosaccharides induce metalloproteaseexpression in the absence of CD44 (47). Also, the hyaluronatereceptor TLR-4 (48) may cause the phenotype observed.

How does merlin interfere with CD44 cleavage? If ERM-induced Ras activity is not needed for cleavage regulation, onecould assume that merlin also does not act through its Ras-inhibiting function. Our merlin mutant data indeed prove thisto be correct. Ras inhibition by merlin requires that the protein isdephosphorylated at position S518 (ref. 2 andunpublished data).Dephosphorylation of S518 does not suffice for tumor suppres-sion (but is followed by a second dephosphorylation at S272upon cell–cell contact; unpublished data). However, the merlin-mutant NF2-S518A used in our studies, mimicking the singledephosphorylation, sufficed to inhibit CD44 cleavage. BecauseS272 dephosphorylation does not occur in growing cells (unpub-lished data), our data indicate that full tumor suppressor activityof merlin, and thus Ras pathway blockade was not required forinhibition of CD44 cleavage. How then does merlin act? Merlindoes not carry a C-terminal F-actin–binding domain. Thus, byreplacing ERMproteins on theCD44C-terminus, it likely disruptsthe link to the actin cytoskeleton. We consider this a plausiblemechanism.

In the end, it is likely that ERM phosphorylation is needed topromote cleavage. Structural studies of moesin showed thatphosphorylation releases an inhibitory interaction of its C- andN-terminus (39). In this context, it is puzzling that inactive ezrinT567A exerts a dominant-negative effect on cleavage. Interesting-ly, a corresponding inactive moesin mutant, T558A, inhibits theformation of microvilli-like structures (40), suggesting that ezrin

T567A could still compete with a cleavage-relevant interactionpartner.

We leave a few questions open that we cannot answer at thispoint. Only a fraction of CD44 is subjected to induced (orspontaneous) cleavage (see also Fig. 1 in ref. 46). One does notneed to demand complete cleavage because the reaction is togenerate highly active components, particularly evident in therelease of growth factors. Mechanistically, partial cleavage indi-cates, however, that in addition to the ICDmodification, anothercondition must be met to induce proteolysis. Possibly, thiscondition is fulfilled if the CD44 ICD is deleted. Then no regu-lation is required and cleavage becomes constitutive (Fig. 3B).Another open and highly interesting question concerns the role ofCD44 cleavage in vivo, particularly in cancer. One might expectthat tumors shed CD44 ectodomain at an increased rate and viathis mechanism not only generate CD44 ICD, which drives theexpression of proliferation-inducing genes in the nucleus, but alsothat cleavage products of the CD44 ectodomain might exertadditional defined roles in cancer.

Disclosure of Potential Conflicts of InterestNo potential conflicts of interest were disclosed.

Authors' ContributionsConception and design: M. Hartmann, A. Herrlich, P. HerrlichDevelopment of methodology: M. Hartmann, Y. Li, H. MorrisonAcquisition of data (provided animals, acquired and managed patients,provided facilities, etc.): M. Hartmann, L.M. Parra, A. Ruschel, S. B€ohmeAnalysis and interpretation of data (e.g., statistical analysis, biostatistics,computational analysis):M.Hartmann, L.M. Parra, A. Ruschel, Y. Li, P.HerrlichWriting, review, and/or revision of the manuscript:M. Hartmann, L.M. Parra,A. Herrlich, P. HerrlichAdministrative, technical, or material support (i.e., reporting or organizingdata, constructing databases): L.M. Parra, S. B€ohmeStudy supervision: P. Herrlich, H. Morrison, A. HerrlichOther (figure design): P. Herrlich, L.M. Parra

AcknowledgmentsThe authors thank the administrative staff of the institute for help, their

technicians, laboratory manager Birgit Pavelka, Christoph Kaether for advise onAPP and for providing reagents.

Grant SupportThis study was supported by the Leibniz Institute for Age Research and the

Jungstiftung (fellowship to M. Hartmann). A. Herrlich was supported byNIDDK R00DK077731, M. Hartmann by a fellowship of the Jung Foundation,and P. Herrlich by DFGHE551.

The costs of publication of this articlewere defrayed inpart by the payment ofpage charges. This article must therefore be hereby marked advertisement inaccordance with 18 U.S.C. Section 1734 solely to indicate this fact.

Received January 13, 2015; accepted January 16, 2015; publishedOnlineFirstFebruary 4, 2015.

References1. Morrison H, Sherman LS, Legg J, Banine F, Isacke C, Haipek CA, et al. The

NF2 tumor suppressor gene product, merlin, mediates contact inhibitionof growth through interactions with CD44. Genes Dev 2001;15:968–80.

2. Jin H, Sperka T, Herrlich P, Morrison H. Tumorigenic transformation byCPI-17 through inhibition of a merlin phosphatase. Nature 2006;442:576–9.

3. Tian X, Azpurua J, Hine C, Vaidya A, Myakishev-RempelM, Ablaeva J, et al.High-molecular-mass hyaluronan mediates the cancer resistance of thenaked mole rat. Nature 2013;499:346–9.

4. Morrison H, Sperka T, Manent J, Giovannini M, Ponta H, Herrlich P.Merlin/neurofibromatosis type 2 suppresses growth by inhibiting theactivation of Ras and Rac. Cancer Res 2007;67:520–7.

5. Godar S, Ince TA, Bell GW, Feldser D, Donaher JL, Bergh J, et al. Growth-inhibitory and tumor- suppressive functions of p53 depend on its repres-sion of CD44 expression. Cell 2008;134:62–73.

6. Orian-Rousseau V, Chen L, Sleeman JP, Herrlich P, Ponta H. CD44 isrequired for two consecutive steps in HGF/c-Met signaling. Genes Dev2002;16:3074–86.






7. TodaroM, Gaggianesi M, Catalano V, Benfante A, Iovino F, Biffoni M, et al.CD44v6 is a marker of constitutive and reprogrammed cancer stem cellsdriving colon cancer metastasis. Cell Stem Cell 2014;14:342–56.

8. G€unthert U, HofmannM, RudyW, Reber S, Z€oller M, Haussmann I, et al. Anew variant of glycoprotein CD44 confers metastatic potential to ratcarcinoma cells. Cell 1991;65:13–24.

9. Matzke A, Herrlich P, Ponta H, Orian-Rousseau V. A five-amino-acidpeptide blocks Met- and Ron-dependent cell migration. Cancer Res 2005;65:6105–10.

10. McClatchey AI, Saotome I, Mercer K, Crowley D, Gusella JF, Bronson RT,et al. Mice heterozygous for a mutation at the Nf2 tumor suppressor locusdevelop a range of highlymetastatic tumors. GenesDev 1998;12:1121–33.

11. Fehon RG, McClatchey AI, Bretscher A. Organizing the cell cortex: the roleof ERM proteins. Nat Rev Mol Cell Biol 2010;11:276–87.

12. Bretscher A, Edwards K, Fehon RG. ERM proteins andmerlin: integrators atthe cell cortex. Nat Rev Mol Cell Biol 2002;3:586–99.

13. Iveti�c A, Ridley AJ. Ezrin/radixin/moesin proteins and Rho GTPase signal-ling in leucocytes. Immunology 2004;112:165–76.

14. Li W, Cooper J, Karajannis MA, Giancotti FG. Merlin: a tumour suppressorwith functions at the cell cortex and in the nucleus. EMBO Rep 2012;13:204–15.

15. Okamoto I, Kawano Y, Tsuiki H, Sasaki J, Nakao M, Matsumoto M, et al.CD44 cleavage induced by amembrane-associatedmetalloprotease plays acritical role in tumor cell migration. Oncogene 1999;18:1435–46.

16. Sugahara KN, Murai T, Nishinakamura H, Kawashima H, Saya H,Miyasaka M. Hyaluronan oligosaccharides induce CD44 cleavage andpromote cell migration in CD44-expressing tumor cells. J Biol Chem2003;278:32259–65.

17. Murai T, Miyazaki Y, Nishinakamura H, Sugahara KN, Miyauchi T, Sako Y,et al. Engagement of CD44 promotes Rac activation and CD44 cleavageduring tumor cell migration. J Biol Chem 2004;279:4541–50.

18. Anderegg U, Eichenberg T, Parthaune T, Haiduk C, Saalbach A, Milkova L,et al. ADAM10 is the constitutive functional sheddase of CD44 in humanmelanoma cells. J Invest Dermatol 2009;129:1471–82.

19. Stamenkovic I, Yu Q. Shedding light on proteolytic cleavage of CD44: theresponsible sheddase and functional significance of shedding. J InvestDermatol 2009;129:1321–4.

20. Herrlich A, Klinman E, Fu J, Sadegh C, Lodish H. Ectodomain cleavage ofthe EGF ligands HB-EGF, neuregulin1-beta, and TGF-alpha is specificallytriggered by different stimuli and involves different PKC isoenzymes.FASEB J 2008;22:4281–95.

21. Shaw RJ, Paez JG, Curto M, Yaktine A, Pruitt WM, Saotome I, et al. The Nf2tumor suppressor, merlin, functions in Rac-dependent signaling. Dev Cell2001;1:63–72.

22. Kissil JL, JohnsonKC, EckmanMS, Jacks T.Merlin phosphorylation byp21-activated kinase 2 and effects of phosphorylation on merlin localization.J Biol Chem 2002;277:10394–9.

23. Xiao G-H, Beeser A, Chernoff J, Testa JR. p21-activated kinase links Rac/Cdc42 signaling to merlin. J Biol Chem 2002;277:883–6.

24. Geißler KJ, JungMJ, Riecken LB, Sperka T, Cui Y, Schacke S, et al. Regulationof Son of sevenless by the membrane-actin linker protein ezrin. Proc NatlAcad Sci U S A 2013;110:20587–92.

25. Aronheim A, Engelberg D, Li N, al-Alawi N, Schlessinger J, Karin M.Membrane targeting of the nucleotide exchange factor Sos is sufficient foractivating the Ras signaling pathway. Cell 1994;78:949–61.

26. Sibilia M, Fleischmann A, Behrens A, Stingl L, Carroll J, Watt FM, et al. TheEGF receptor provides an essential survival signal for SOS-dependent skintumor development. Cell 2000;102:211–20.

27. Saleh HS, Merkel U, Geißler KJ, Sperka T, Sechi A, Breithaupt C, et al.Properties of an ezrin mutant defective in F-actin binding. J Mol Biol2009;385:1015–31.

28. Xu HM, Gutmann DH. Merlin differentially associates with the microtu-bule and actin cytoskeleton. J Neurosci Res 1998;51:403–15.

29. Lallemand D, Saint-Amaux AL, Giovannini M. Tumor-suppression func-tions of merlin are independent of its role as an organizer of the actincytoskeleton in Schwann cells. J Cell Sci 2009;122:4141–9.

30. Morton WM, Ayscough KR, McLaughlin PJ. Latrunculin alters the actin-monomer subunit interface to prevent polymerization. Nat Cell Biol2000;2:376–8.

31. Darmellah A, Rayah A, Auger R, Cuif M-H, Prigent M, ArpinM, et al. Ezrin/radixin/moesin are required for the purinergic P2 � 7 receptor (P2 � 7R)-dependent processing of the amyloid precursor protein. J Biol Chem2012;287:34583–95.

32. Iveti�c A, Florey O, Deka J, Haskard DO, Ager A, Ridley AJ. Mutagenesis ofthe ezrin-radixin-moesin binding domain of L-selectin tail affects shed-ding, microvillar positioning, and leukocyte tethering. J Biol Chem2004;279:33263–72.

33. Díaz-Rodríguez E, Montero JC, Esparís-Ogando A, Yuste L, Pandiella A.Extracellular signal-regulated kinase phosphorylates tumor necrosis factoralpha-converting enzyme at threonine 735: a potential role in regulatedshedding. Mol Biol Cell 2002;13:2031–44.

34. XuP,DerynckR.Direct activationof TACE-mediated ectodomain sheddingby p38 MAP kinase regulates EGF receptor-dependent cell proliferation.Mol Cell 2010;37:551–66.

35. Le Gall SM, Maretzky T, Issuree PDA, Niu X-D, Reiss K, Saftig P, et al.ADAM17 is regulated by a rapid and reversible mechanism that controlsaccess to its catalytic site. J Cell Sci 2010;123:3913–22.

36. Adrain C, Zettl M, Christova Y, TaylorN, FreemanM. Tumor necrosis factorsignaling requires iRhom2 to promote trafficking and activation of TACE.Science (New York, NY) 2012;335:225–8.

37. JiangW,ZhangY, KaneKT,CollinsMA, SimeoneDM,Pasca diMaglianoM,et al. CD44 regulates pancreatic cancer invasion through MT1-MMP. MolCancer Res 2015;13:9–15.

38. Kim Y, Kumar S. CD44-mediated adhesion to hyaluronic acid contri-butes to mechanosensing and invasive motility. Mol Cancer Res 2014;12:1416–29.

39. Pearson MA, Reczek D, Bretscher A, Karplus PA. Structure of the ERMproteinmoesin reveals the FERMdomain foldmasked by an extended actinbinding tail domain. Cell 2000;101:259–70.

40. Oshiro N, Fukata Y, Kaibuchi K. Phosphorylation of moesin by rho-associated kinase (Rho-kinase) plays a crucial role in the formation ofmicrovilli-like structures. J Biol Chem 1998;273:34663–6.

41. Schulz A, Geißler KJ, Kumar S, Leichsenring G, Morrison H, Baader SL.Merlin inhibits neurite outgrowth in the CNS. J Neurosci 2010;30:10177–86.

42. Kajita M, Itoh Y, Chiba T,Mori H, Okada A, KinohH, et al. Membrane-type1 matrix metalloproteinase cleaves CD44 and promotes cell migration.J Cell Biol 2001;153:893–904.

43. Wang G, Mao W, Zheng S. MicroRNA-183 regulates Ezrin expression inlung cancer cells. FEBS Lett 2008;582:3663–8.

44. Saito S, Yamamoto H, Mukaisho K-i, Sato S, Higo T, Hattori T, et al.Mechanisms underlying cancer progression caused by ezrin overexpressionin tongue squamous cell carcinoma. PLoS One 2013;8:e54881.

45. Yu Y, Khan J, Khanna C, Helman L, Meltzer PS, Merlino G. Expressionprofiling identifies the cytoskeletal organizer ezrin and the develop-mental homeoprotein Six-1 as key metastatic regulators. Nat Med 2004;10:175–81.

46. Sperka T, Geißler KJ,Merkel U, Scholl I, Rubio I, Herrlich P, et al. Activationof Ras requires the ERM-dependent link of actin to the plasma membrane.PLoS One 2011;6:e27511.

47. Fieber C, Baumann P, Vallon R, Termeer C, Simon JC, Hofmann M, et al.Hyaluronan-oligosaccharide-induced transcription of metalloproteases.J Cell Sci 2004;117:359–67.

48. Taylor KR, Trowbridge JM, Rudisill JA, Termeer CC, Simon JC, Gallo RL.Hyaluronan fragments stimulate endothelial recognition of injury throughTLR4. J Biol Chem 2004;279:17079–84.


Hartmann et al.




2015;13:879-890. Published OnlineFirst February 4, 2015.Mol Cancer Res Monika Hartmann, Liseth M. Parra, Anne Ruschel, et al. Ectodomain Cleavage of CD44Tumor Suppressor NF2 Blocks Cellular Migration by Inhibiting

Updated version

10.1158/1541-7786.MCR-15-0020-Tdoi:

Access the most recent version of this article at:

Material

Supplementary

http://mcr.aacrjournals.org/content/suppl/2015/02/05/1541-7786.MCR-15-0020-T.DC1

Access the most recent supplemental material at:

Cited articles

http://mcr.aacrjournals.org/content/13/5/879.full#ref-list-1

This article cites 48 articles, 23 of which you can access for free at:

Citing articles

http://mcr.aacrjournals.org/content/13/5/879.full#related-urls

This article has been cited by 3 HighWire-hosted articles. Access the articles at:

E-mail alerts related to this article or journal.Sign up to receive free email-alerts

Subscriptions

Reprints and

[email protected]

To order reprints of this article or to subscribe to the journal, contact the AACR Publications Department at

Permissions

Rightslink site. Click on "Request Permissions" which will take you to the Copyright Clearance Center's (CCC)

.http://mcr.aacrjournals.org/content/13/5/879To request permission to re-use all or part of this article, use this link



http://mcr.aacrjournals.org/lookup/doi/10.1158/1541-7786.MCR-15-0020-T

http://mcr.aacrjournals.org/content/suppl/2015/02/05/1541-7786.MCR-15-0020-T.DC1

http://mcr.aacrjournals.org/content/13/5/879.full#ref-list-1

http://mcr.aacrjournals.org/content/13/5/879.full#related-urls

http://mcr.aacrjournals.org/cgi/alerts

mailto:[email protected]

http://mcr.aacrjournals.org/content/13/5/879


Tumor Suppressor NF2 Blocks Cellular Migration by Inhibiting Ectodomain … · Oncogenes and Tumor...

Documents

Transcript of Tumor Suppressor NF2 Blocks Cellular Migration by Inhibiting Ectodomain … · Oncogenes and Tumor...