Transcriptional Activation of the Human Leptin Gene in ... · 6/25/2002 · 4 INTRODUCTION...
Transcript of Transcriptional Activation of the Human Leptin Gene in ... · 6/25/2002 · 4 INTRODUCTION...
REVISED MANUSCRIPT
Transcriptional Activation of the Human Leptin Gene in Response
to Hypoxia: Involvement of Hypoxia-Inducible Factor 1
Grazia Ambrosini*, Anjali K. Nath�, M. Rocío Sierra-Honigmann¶
and Jaime Flores-Riveros*�
*Department of Molecular Biology, Institute for Diabetes Discovery, Branford, CT 06405
�Department of Pathology, Yale University School of Medicine, New Haven, CT 06520
¶Division of Plastic Surgery, University of Southern California and Cedars Sinai Medical
Center, Los Angeles, CA 90048
�To whom correspondence should be addressed:
Jaime Flores-Riveros, Ph.D. Department of Molecular Biology Institute for Diabetes Discovery 23 Business Park Drive Branford, CT 06405 Telephone (203) 315-5982 FAX (203) 315-4001 E-mail: [email protected]
Copyright 2002 by The American Society for Biochemistry and Molecular Biology, Inc.
JBC Papers in Press. Published on June 25, 2002 as Manuscript M205172200 by guest on N
ovember 29, 2020
http://ww
w.jbc.org/
Dow
nloaded from
2
Running Title: Induction of Leptin Gene Expression by Hypoxia and HIF1
by guest on Novem
ber 29, 2020http://w
ww
.jbc.org/D
ownloaded from
3
SUMMARY
Besides a major role in energy homeostasis, leptin is emerging as a pleiotropic cytokine
with multiple physiological effector functions. The recently discovered proangiogenic activity of
leptin suggested the hypothesis that its production might be regulated by hypoxia like other
angiogenic factors. To examine this proposal, expression of leptin protein and mRNA was
measured and found to be markedly upregulated in response to ambient or chemical hypoxia
(upon exposure to desferrioxamine or cobalt chloride), an effect that requires intact RNA
synthesis suggesting a transcriptional mechanism. Transient transfection of cultured cells with
deletion constructs of the leptin gene promoter linked to a reporter gene revealed a functional
hypoxia response element (HRE) located at position �116 within the proximal upstream region.
This putative HRE harbors a characteristic 5�-RCGTG-3� core motif, a hallmark of hypoxia-
sensitive genes and recognized by the hypoxia inducible factor 1 (HIF1), which consists of a
HIF1α/HIFβ heterodimer. Constructs harboring this �116/HRE supported reporter gene
expression in response to hypoxia, but not when mutated. Expression of HIF1α cDNA in
normoxic cells mimicked hypoxia-induced reporter gene expression in cells cotransfected with
the wild type leptin �116/HRE construct, but not with the mutant. Gel shift assays with a 32P-
labeled leptin promoter �116/HRE probe and nuclear extracts from hypoxia-treated cells
indicated binding of the HIF1α/β heterodimer, which was blocked with an excess of unlabeled �
116/HRE probe or a HIF1-binding probe from the erythropoietin gene enhancer. Taken together,
these observations demonstrate that the leptin gene is actively engaged by hypoxia through a
transcriptional pathway commonly utilized by hypoxia-sensitive genes.
by guest on Novem
ber 29, 2020http://w
ww
.jbc.org/D
ownloaded from
4
INTRODUCTION
Physiological mechanisms that ensure an appropriate level of oxygen (O2) delivery to
tissues have evolved in complex multicellular organisms. Virtually all cells are capable of
sensing changes in O2 tension (pO2) and respond adaptively when the O2 demand exceeds
supply, a condition referred to as hypoxia (1). Hypoxia can develop as a result of ischemia due
to hypoperfusion, either as a pathological condition or as a transient physiological event (1).
Under chronic conditions of hypoxia, typical adaptation responses generally include changes in
the expression of genes encoding molecules that facilitate O2 delivery, or by activating metabolic
pathways that do not require O2, thus maintaining energy homeostasis when O2 availability is
limited (1,2). For example, hypobaric hypoxia leads to a classical response characterized by
increased red blood cell mass formation following induction of the erythropoietin (Epo)1 gene,
whose expression is markedly elevated under these conditions (3,4). In addition, the vasodilators
nitric oxide and carbon monoxide are generated by the catalytic activity of inducible nitric oxide
(iNOS) and heme oxygenase-1 (HO-1), respectively; expression of the genes encoding these
enzymes is readily induced following a reduction in pO2 (5,6). Likewise, upregulation of the
vascular endothelial growth factor (VEGF) gene occurs in response to local vascular hypoxia,
which leads to vigorous angiogenesis and vasodilation, such as in tumors (7,8) or during the
healing of wounds (9). Finally, the hypoxia-induced metabolic shift from oxidative
phosphorylation to glycolysis as the main source of ATP serves to illustrate another classic
homeostatic mechanism in response to O2 deprivation (10). Hence, increased expression of
GLUT1 glucose transporter (11), or glycolytic enzymes such as aldolase A (12), enolase 1 (12),
lactate dehydrogenase A (12,13) and phosphoglycerate kinase 1 (14), rapidly ensues following
hypoxia to facilitate this metabolic adaptation.
by guest on Novem
ber 29, 2020http://w
ww
.jbc.org/D
ownloaded from
5
Underlying the changes in expression of these erythropoietic, vasoactive or enzymatic
molecules are regulatory mechanisms that modulate transcription of the corresponding genes, as
well as the rate of mRNA degradation (15,16). A crucial component in the induction of hypoxia-
regulated genes is the transcription factor hypoxia-inducible factor 1 (HIF1), which activates
transcription by binding to a specific cis-acting regulatory sequence referred to as hypoxia
response element (HRE), a hallmark of hypoxia-sensitive target genes (2,17,18). The HIF1
protein complex consists of a heterodimer composed of HIF1α and HIF1β subunits (17,18).
Each of these subunits contains basic-helix-loop-helix (bHLH) motifs and other functional
domains required for DNA binding, protein heterodimerization and transactivation of target
genes (2,15,16). The HIF1α subunit, an 826-amino acid protein of 93 kDa, is a member of the
PAS protein family by virtue of its homology to Drosophila melanogaster genes encoding the
period (Per) and single-minded (Sim) transcription factors, and to the mammalian
arylhydrocarbon receptor nuclear translocator protein (ARNT), which is now recognized to be
the HIF1β subunit (17). The HIF1β/ARNT subunit can also heterodimerize with the
arylhydrocarbon receptor (AHR) forming HIF1β/AHR complexes, which mediate the
transcriptional xenobiotic response (19). However, under conditions of hypoxia, it is the
HIF1α/β heterodimer that is translocated to the nucleus where it binds to HREs in target genes,
thereby causing activation of transcription (15,16). The HRE consists of the pentanucleotide
core consensus sequence 5�-RCGTG-3�, which can be located in the 5�- or 3�-flanking regions,
as well as within the introns of hypoxia-inducible genes (16).
We have recently reported that the hormone leptin exhibits robust angiogenic activity
when assayed by in vitro and in vivo experiments (20). This unexpected biological activity of
leptin is in contrast with the prevailing view of its function, which portrays leptin as a key
by guest on Novem
ber 29, 2020http://w
ww
.jbc.org/D
ownloaded from
6
regulator of body weight primarily through its extensively documented CNS-mediated effects on
food intake and energy expenditure (21). However, a more complex scheme of leptin action has
subsequently emerged involving other peripheral physiological systems in addition to central
regulation of appetite and body weight (21,22). Consistent with an important role in
angiogenesis, it is conceivable that leptin expression might also be modulated by physiological
cues that typically regulate angiogenic factors. Therefore, we wanted to investigate the
hypothesis that expression of the leptin gene is induced by hypoxia through transcriptional
machinery and mechanisms commonly used by genes encoding products involved in
angiogenesis or oxygen homeostasis.
Here we show that leptin expression is markedly upregulated in response to hypoxia, an
event that requires intact RNA synthesis. We examine the activity of the leptin gene promoter
linked to a reporter gene in transiently transfected cells and demonstrate the existence of a
functional HRE, which is required for hypoxic induction and is transactivated by HIF1α. We
also show that the HIF1α/β heterodimer binds to this leptin promoter HRE upon exposure to
hypoxia, and demonstrate that HRE mutations that disable HIF1α/β binding eliminate leptin
promoter activation. Taken together, these observations demonstrate that the leptin gene is
actively engaged by hypoxia through mechanisms that are common to other hypoxia-inducible
genes, consistent with the concept of leptin as a bona fide angiogenic factor.
by guest on Novem
ber 29, 2020http://w
ww
.jbc.org/D
ownloaded from
7
EXPERIMENTAL PROCEDURES
Materials � The monoclonal antibodies against human cell-specific markers (fibroblast, CD31,
cytokeratin 1, muscle-specific actin) used for immunostaining and verification of fibroblastic
character were purchased from Dako Ltd. (Cambridgeshire, UK). Fetal bovine serum, cell
culture media (RPMI) and reagents were from Gibco/Invitrogen (Carlsbad, CA).
Radioimmunoassay kits for detection of human leptin were obtained from Linco Research, Inc.
(St. Louis, MO). The pCR2.1/TA vector for direct cloning of PCR products was purchased from
Invitrogen (Carlsbad, CA), and the pGL3-Basic vector for promoter/luciferase plasmid
construction was from Promega (Madison, WI). The unique site-elimination (U.S.E.)
mutagenesis kit, Hybond-N+ nylon membranes, horseradish peroxidase-conjugated goat anti-
mouse IgG, enhanced chemiluminescence (ECL) kits and high performance ECL film
(Hyperfilm) were all purchased from Amersham Pharmacia Biotech (Piscataway, NJ). The TRI-
Reagent for preparing RNA was obtained from Molecular Research Center (Cincinnati, OH).
The pSVβGal reporter vector was from Clontech (Palo Alto, CA) and the reporter lysis buffer
and β-galactosidase chemiluminescence assay kit were purchased from Promega (Madison, WI).
The HIF1α cDNA expression vector was obtained from Novus Biologicals (Littleton, CO) and
the anti-HIF1α and anti-HIF1β antibodies were from BD Transduction Laboratories (Franklin
Lakes, NJ). CoCl2 and desferrioxamine (DFO) were purchased from Sigma Chemical Co. (St.
Louis, MO). Polyvinylidene difluoride (PVDF) membranes were from BioRad (Hercules, CA).
The isotopes [α-32P]dCTP (3,000 Ci/mmole) and [γ-32P]ATP (6,000 Ci/mmole) were obtained
from New England Nuclear (Boston, MA).
Fibroblast Isolation and Cell Culture � For initial experiments, human skin dermal fibroblasts
(hSDF) were isolated from explants of human dermis cut into 5-mm3 pieces and covered with
by guest on Novem
ber 29, 2020http://w
ww
.jbc.org/D
ownloaded from
8
RPMI culture medium, supplemented with 20% fetal bovine serum, 200 units/ml penicillin and
200 µg/ml streptomycin, until fibroblasts began to migrate out of the explants. Residual explants
were then removed and freshly isolated cells were propagated in RPMI medium containing 20%
fetal bovine serum, 2 mM L-glutamine, 50 units/ml penicillin and 50 µg/ml streptomycin sulfate.
For studies of endogenous leptin expression, cells were kept at low passage (never exceeding 4)
and grown to reach 70-80% confluency. Only freshly isolated cells were grown (never from a
frozen stock). The fibroblastic character of the cells isolated was verified by positive stain
reaction with anti-human fibroblast (clone 5B5), and negative stain with anti-human CD31
(clone JC/70A), cytokeratin 1 (clone 34βB4), or muscle specific actin (clone HHF35). For other
experiments involving hSDF, normal human dermal fibroblasts were purchased from Clonetics
(San Diego, CA) and cultured in fibroblast growth medium (FGM) supplemented with 10% fetal
bovine serum, insulin and human FGF-B (Clonetics), following manufacturer�s instructions.
Only cells from passage 3-12 were used in this study. For some experiments, HeLa cells (ATCC
CCL-2) were maintained in DMEM supplemented with 10% fetal bovine serum, penicillin, and
streptomycin sulfate.
For experiments requiring ambient hypoxia conditions, cells were incubated in a 5% CO2
humidified atmosphere connected to a source of nitrogen. Oxygen level was adjusted by mixing
in a balanced tension of N2 through a gas inlet valve controlled by a model 110 Proox
programmable oxygen sensor (Reming Bioinstruments, Redfield, NY), set to either 21% O2 for
normoxia or the indicated levels of oxygen (5% to 0.5%) for hypoxia. For experiments requiring
chemical hypoxia, cells were incubated in the presence of 150 mM CoCl2 or 100 mM
desferrioxamine (DFO) for the indicated periods of time.
by guest on Novem
ber 29, 2020http://w
ww
.jbc.org/D
ownloaded from
9
Measurement of Leptin Levels in Conditioned Medium � Culture medium from subconfluent
monolayers of fibroblasts exposed to the indicated levels of oxygen (hypoxia or normoxia) was
collected and immediately stored at �80°C until further use. The concentration of leptin was
measured using a radioimmunoassay kit for human leptin, essentially following the
manufacturer�s instructions. Duplicate samples were serially diluted 2-fold falling within the
sensitivity range of the assay kit (0.05-10 ng/ml), using human recombinant leptin as a
calibration standard.
RT/PCR and Northern Blot analysis � Fibroblasts exposed to normoxic or hypoxic conditions
were harvested and total cellular RNA was extracted by a modified acid-guanidinium
thiocyanate-phenol-chloroform method (TRI-Reagent). Reverse transcription and PCR
amplification of the full-length leptin-coding region in the mRNA transcript [(23); Genbank
Accession No. U43653] was conducted using the Titan One Tube RT/PCR Kit (Roche) in the
presence of 0.5 µg of total RNA, a forward primer (5�-CCATCCTGGGAAGGAAAATG-3�) and
a reverse primer (5�-CCCTTAACGTAGTCCTTGCAG-3�). The resulting PCR products were
loaded onto a 1% agarose gel and visualized by ethidium bromide staining. A hybridization
probe for human leptin was generated by RT/PCR using 1 µg of total RNA prepared from human
adipose tissue and the same primers mentioned above. The resulting 526-bp RT/PCR product
was ligated directly into a pCR2.1/TA vector, and presence of the insert was then verified by
automated DNA sequencing, using the fluorescently-labeled dideoxynucleotide chain
termination method (24). For probe preparation, the cDNA insert was excised by digestion with
EcoRI, gel-purified and then radiolabeled with [α-32P]dCTP using a random primer labeling kit
(Stratagene, La Jolla, CA).
by guest on Novem
ber 29, 2020http://w
ww
.jbc.org/D
ownloaded from
10
For Northern blot analysis, equal amounts of fibroblast total RNA (13 µg/lane) were
electrophoresed on 1% agarose/formaldehyde gels and transferred to nylon membranes (Hybond-
N+). Hybridization was performed in 5X SSC, 10X Denhardt's, 1% SDS, for 16 hr at 60°C.
Membranes were washed twice in 2X SSC, 1% SDS for 30 min at 60°C and once in 0.2X SSC at
22°C before exposure to autoradiography.
Promoter/Reporter Plasmids and Transient Transfections � A genomic DNA fragment of the
human leptin gene (23) containing approximately 2.9 kb of 5�-flanking region was prepared by
PCR amplification of human DNA using the primers: 5'-AAGGATGGAGAGGCCCTAGTG-3'
(forward) and 5'-CTTGCAACCGTTGGCGCTGCG-3' (reverse). A 2.9-kb PCR amplicon
product was obtained and cloned into a pCR2.1/TA vector. The insert in the resulting construct
was then isolated and fully verified by automated DNA sequencing. From this construct, a series
of 5�-nested deletion mutants were generated by restriction-enzyme digestion with HindII, NsiI,
ScaI, StuI, SacII and XhoI, which cleave respectively at positions �2643, �2041, �1687, �983, �
375 and �172, preceding the start site of transcription. Each fragment was subcloned upstream
of the firefly luciferase reporter gene in a pGL3-Basic vector and designated accordingly. For
creating the p(�63)/LUC deletion construct, PCR amplification of the 2.9-kb human genomic
DNA fragment was conducted in the presence of primers spanning the region between �63 to
+28. The forward primer 5'-AATCGctcgagCGGGGCAGTTGCGCAAGTTG-3' and the reverse
primer 5'-ACTGaagcttGCAACCGTTGGCGCTGCG-3' were used, where each primer is
designed to contain a 5�-overhang restriction site (lowercase underlined), XhoI for the forward
primer and HindIII for the reverse primer, thus allowing for directional insertion of the amplified
product into pGL3-Basic vector. PCR reactions were conducted for 30 cycles in a total volume
of 50 µl using a program consisting of denaturation at 94°C for 30 sec, annealing at 52°C for 30
by guest on Novem
ber 29, 2020http://w
ww
.jbc.org/D
ownloaded from
11
sec, and extension at 72°C for 1 min, using a GeneAmp PCR System 9700 thermocycler
(Applied Biosystems, San Jose, CA). Mutations of the �116/HRE were introduced into the p(�
172)/LUC by the unique site elimination method (25), using the mutagenic oligonucleotide 5�-
GCAGCCGCCCGGtAtGTCGCTACCCTGAGG-3�, thus replacing C by T within the �116/HRE
core motif (lowercase underlined). The sequence of the resulting construct was verified by
automated DNA sequencing.
Plasmids were transfected into cultured hSDF by lipofection using the FuGENE 6 reagent
(Roche Molecular Biochemicals), according to the manufacturer�s instructions. Fibroblasts were
seeded in 24-well plates at a density of 6 x 104 cells per well and transfected with 0.6 µg of each
reporter plasmid. Transfection efficiencies were normalized by cotransfection with 0.1 µg of
pSVβGal reporter gene. Twenty-four hours following transfection, cells were incubated under
normoxic or hypoxic conditions for the times indicated (generally 12-16 hr), and total lysates
prepared from each well into 0.2 ml of Reporter Lysis Buffer (Promega, Madison, WI). Cell
extracts were analyzed for luciferase and β-galactosidase activity using a chemiluminescence
assay kit and read in a model 1450-024 multi-well plate luminometer (PerkinElmer Life Science,
Boston, MA). For some experiments, 0.6 µg of a HIF1α cDNA expression plasmid were
cotransfected with the indicated leptin promoter/reporter plasmids and cell lysates prepared and
processed for reporter gene expression activity as described above.
Electrophoretic Mobility Shift Assays (EMSA) � Nuclear extracts were prepared essentially as
described (26). Briefly, cells were harvested, collected by centrifugation and exposed to a
hypotonic buffered solution (10 mM Hepes pH 7.9, 10 mM KCl, 0.1 mM EDTA, 0.1 mM
EGTA, 1 mM DTT and a protease inhibitor cocktail). Nuclei were recovered by centrifugation
and extracted for one hour with a high-salt buffer (20 mM Hepes pH 7.9, 0.4 M NaCl, 1 mM
by guest on Novem
ber 29, 2020http://w
ww
.jbc.org/D
ownloaded from
12
EDTA, 1 mM EGTA, 1 mM DTT, 5% glycerol and a protease inhibitor cocktail). The resulting
extracts were collected after centrifugation of nuclei, snap-frozen and kept at �70ºC until used.
The EMSA double-stranded probes were based on the sequence of the human leptin gene
promoter contained in p(�172)/LUC, which harbors the proximal HRE at �116 in a reverse
orientation toward the 5�end of the insert. Specifically, the sequence of the EMSA probes used
were: 5�-GCCGCCCGGCACGTCGCTACCCTG-3� for the wild type (LepHRE), and 5�-
GCAGCCGCCCGGtAtGTCGCTACCCTGAGG-3� for the mutant (LepHRE-mut), where the
sequence corresponds to the sense strand and mutations are shown in lowercase and underlined.
For some experiments, a 21-bp double-stranded oligonucleotide probe based on the 3�-enhancer
of the Epo gene (27), which contains a HIF1-binding HRE site, was used and had the sequence
5�-GCCCTACGTGCTGCCTCGCAT-3�. The annealed, double-stranded leptin promoter probes
were labeled with [γ-32P]ATP using T4 polynucleotide kinase (28), and the resulting radiolabeled
probes were then purified on NucTrap columns (Stratagene, La Jolla, CA). Binding reactions
were carried out in a total volume of 20 µl containing 4 µg of nuclear extract protein, 20 mM
Tris-HCl pH 7.5, 50 mM KCl, 1 mM MgCl2, 0.5 mM EDTA, 5 mM DTT, 5% glycerol (v/v) and
250 ng of poly(dI/dC). After preincubation for 5 min at room temperature, radiolabeled probe
(50,000 cpm, 1 ng) was added and the incubation continued for 15 min. For gel supershift
assays, 1 µg of anti-HIF1α antibody alone or in combination with 1 µg of anti-ARNT (HIF1β)
antibody was added to the complete binding reaction mixtures, and the incubation continued for
60 min at room temperature. For competition experiments, 10- to 100-fold molar excess of the
indicated unlabeled probes were preincubated with nuclear extract and poly(dI/dC) prior to
addition of 32P-labeled probe. The DNA/protein complexes were then resolved by
electrophoresis onto 5% nondenaturing polyacrylamide gels with 0.5 % TBE buffer (45 mM Tris
by guest on Novem
ber 29, 2020http://w
ww
.jbc.org/D
ownloaded from
13
pH 8.3, 45 mM boric acid, 1 mM EDTA). Gels were dried and radioactivity was detected by
bioimaging using a Cyclone Phosphorimaging System and the OPTIQUANT software package
(Packard Instruments Co., Downersgrove, IL).
Immunoblot Analysis � Nuclear extracts were prepared from normoxia or hypoxia-treated cells
and proteins resolved on a SDS-PAGE gel (10 µg/lane), and then transferred onto PVDF
membranes. Membranes were blocked with 5% nonfat dry milk in TBST (10 mM Tris/HCl pH
8, 0.15 M NaCl, 0.05% Tween 20), and incubated at 4°C overnight with 1 µg/ml of anti-HIF1α
or anti-HIF1β antibodies. Blots were washed and incubated with HRP-conjugated goat anti-
mouse IgG for 60 min at room temperature. Immune complexes were detected by ECL,
followed by exposure to high performance chemiluminescence film (Hyperfilm).
by guest on Novem
ber 29, 2020http://w
ww
.jbc.org/D
ownloaded from
14
RESULTS
Rationale for the use of fibroblasts in leptin expression studies. A large body of experimental
evidence has been collected showing that adipocytes represent the major source of leptin,
although additional, non-adipocyte sites of leptin synthesis have also been uncovered more
recently, including placenta, skeletal muscle, stomach fundic mucosa and mammary epithelium
(21,22). In the course of independent studies on the role of angiogenesis in wound healing, the
discovery was made that skin dermal fibroblast-like cells actively express leptin upon inflicting
incisional, full-thickness skin wounds in mice, an observation supported by
immunohistochemical, in situ hybridization and quantitative RT/PCR data2. Although the
possible significance of this observation is beyond the scope of the present manuscript, we
surmised that dermal fibroblasts might actively engage in leptin synthesis in response to the
hypoxia conditions known to develop in the wound environment, most likely as a result of
hypoperfusion ischemia (29,30). Therefore, human skin dermal fibroblasts (hSDF) were
primarily used throughout the experiments described herein as a non-adipocyte cellular system
with which to study possible regulation of leptin expression by hypoxia. However, for certain
experiments, HeLa cells were also utilized as a convenient source of nuclear proteins for
verification of gel shift assay results (see below).
Induction of leptin expression by hypoxia. To determine if the expression of leptin might be
regulated in response to a reduction in O2 tension, freshly prepared hSDF in culture were
exposed to an atmosphere of normoxia (21% oxygen), or the indicated levels of hypoxia (5%
oxygen or less) for 48 hours. The quantity of leptin secreted into the culture medium was then
determined by radioimmunoassay using antibodies specific for human leptin (see Experimental
Procedures). As shown in Figure 1, exposure of dermal fibroblasts to escalating levels of
by guest on Novem
ber 29, 2020http://w
ww
.jbc.org/D
ownloaded from
15
hypoxia (from 5% to 0.5% oxygen) leads to a marked increase in the amount of leptin produced
and secreted by these cells into the culture medium. For example, exposure of fibroblasts to
hypoxia at 1% O2 gives rise to an increase in the level of immunoreactive leptin in the culture
medium by >8-fold, from <0.05 ng/ml (undetectable) to 0.4 ng/ml (see Fig. 1). In addition,
expression of leptin was also assessed by Northern blot analysis using total cellular RNA
prepared at various times of hypoxia. After size-fractionation of RNA by agarose/formaldehyde
gel electrophoresis, RNA was transferred to nylon membranes, hybridized to a 32P-labeled
human leptin cDNA probe and exposed to autoradiography. As illustrated in Figure 2A, hypoxic
treatment of fibroblasts causes a rapid induction in leptin mRNA, already detectable after 2 hours
of hypoxia and apparently reaching completion after 12 hours. Importantly, this hypoxia-
induced upregulation in leptin mRNA requires ongoing RNA synthesis, as the effect is abolished
by treatment of fibroblasts with actinomycin D prior to a short hypoxic exposure for 2 hours, as
shown in Figure 2B. Thus, expression of leptin is vigorously induced in response to hypoxia in
skin dermal fibroblasts. Since this upregulation requires an intact RNA synthesis machinery, it
appears that the effect depends on active transcription (most likely of the leptin gene) as a
prerequisite for full hypoxia-induced leptin expression.
Given the crucial role of HIF1α in the transcriptional activation of target genes in
response to hypoxia, experiments were conducted to determine if expression of this protein
might be increased in hSDF upon exposure to reduced O2 tension. As expected, hypoxia results
in markedly elevated levels of HIF1α detected by immunoblot analysis of nuclear extracts from
treated fibroblasts (Figure 2C). In contrast, expression of HIF1β was not affected by this
treatment (Fig. 2C, right panel). Acute upregulation of HIF1α is a well-known effect of hypoxia
in other systems and it primarily reflects a drastic reduction in the degradation rate of the protein
by guest on Novem
ber 29, 2020http://w
ww
.jbc.org/D
ownloaded from
16
by the proteosomal pathway (16,31,32). Furthermore, chemical hypoxia produced by treatment
of hSDF with cobalt chloride (CoCl2) or desferrioxamine (DFO) under conditions of normal
atmospheric O2 tension also results in dramatic induction of HIF1α, an effect which is
indistinguishable from that observed upon ambient hypoxia (Figure 2C, left & middle panels).
These findings are consistent with classical observations indicating that cobaltous ions and iron
chelators mimic the stabilization effect of hypoxia upon HIF1α, suggesting the involvement of a
specific ferroprotein oxygen sensor in this process (33-36). As expected, cells exposed to
chemical hypoxia also exhibit notable induction of leptin expression as demonstrated by
detection of a 526-bp RT/PCR product originating specifically from leptin mRNA present in
hypoxic cells, but not in untreated cells (Figure 2D). Taken together, these results suggested that
HIF1α might be an important mediator of the induction of leptin expression observed in hSDF
exposed to hypoxia.
Transcriptional activation of the leptin gene promoter by hypoxia. To test directly the
hypothesis that hypoxia causes a transcriptional activation of the leptin gene, a fragment of
human genomic DNA encompassing approximately 2.9-kb of 5�-flanking sequence (23) was
subcloned upstream of a luciferase reporter gene. Inspection of the nucleotide sequence within
this region revealed the existence of multiple 5�-RCGTG-3� core motif HREs, putatively
identified as potential HIF1-binding sites. The relative position and orientation of these elements
is indicated at the top of Figure 3, in reference to specific restriction enzyme digestion sites that
were used to create truncations of the promoter region, thereby producing a series of nested
deletion constructs (Fig. 3). Thus, a battery of 7 different constructs was produced from
positions �2912 (full length fragment), �2643 (HindII), �2041 (NsiI), �1687 (ScaI), �983 (StuI),
�375 (SacII) and �172 (XhoI), all extending 28-bp past the start site of transcription. An
by guest on Novem
ber 29, 2020http://w
ww
.jbc.org/D
ownloaded from
17
additional construct consisting of a fragment from �63 to +28 was generated by PCR
amplification employing appropriate flanking primers (see Experimental Procedures) to create
p(�63)/LUC, which bears the shortest segment of 5�-flanking region. Each of these leptin
promoter luciferase plasmids was transiently transfected into hSDF that were subsequently
subjected to chemical hypoxia (or not) for a period of 16 hours3. Total soluble cell extracts were
prepared and the level of luciferase activity was then examined by chemiluminescence. As
shown in Figure 3, it is evident that exposure to hypoxia results in a significant increase in the
activity of luciferase measured in extracts derived from cells transfected with any of the
promoter/reporter constructs, except for that containing the shortest segment of upstream
sequence, i.e. p(�63)/LUC (see Fig. 3). Thus, regulatory element(s) presumably residing in the
intervening region comprised between positions �2912 (full-length promoter construct) and �63
seem to be capable of supporting an approximately 2.5-fold induction of reporter gene activity in
response to hypoxia. Since this effect is no longer present in cells transfected with p(�63)/LUC,
it would appear that a putative regulatory element required for hypoxia-induced reporter gene
expression resides in a short segment of 91-bp, located between positions �172 and �63.
However, this conclusion must be interpreted with caution given the short distance to the start
site of transcription in p(�63)/LUC, which may fail to adequately support basal transcription as
indicated by a level of reporter activity indistinguishable from that achieved with a promoterless
luciferase construct (Fig. 3). Therefore, an alternative approach involving the use of site-specific
mutants of p(�172)/LUC was used to assess the existence and functional significance of putative
HRE elements within this short segment (�172 to �63) of the leptin gene promoter.
Identification of a functional HRE in the proximal promoter region of the leptin gene. To
determine if a functional HRE exists within the leptin proximal promoter segment represented in
by guest on Novem
ber 29, 2020http://w
ww
.jbc.org/D
ownloaded from
18
p(�172)/LUC, specific point mutations were introduced into the core sequence of the putative
HRE site contained in this construct (see Experimental Procedures). Fibroblasts were transiently
transfected with either the wild type or mutant promoter/reporter construct and then kept under
normoxia or exposed to chemical hypoxia by treatment with cobalt chloride (CoCl2) or
desferrioxamine (DFO). As shown in Figure 4, whereas the wild type p(�172)/LUCHRE
construct supports hypoxic induction of luciferase activity by 2.5 to 3-fold, this activation is
markedly abrogated when the mutant construct �i.e. p(�172)/LUCHRE-mut� is transfected. While
it is evident that treatment with either CoCl2 or DFO effectively mimics hypoxic induction of
luciferase reporter gene expression, this activation does not occur when the HRE mutant
construct is used (Fig. 4, left panel). Thus, it appears that hypoxic transcriptional induction of
the leptin promoter requires an intact HRE located between �116 and �121. Site-specific
mutations introduced into the core sequence of this motif block hypoxic induction, presumably
as a result of failure of HIF1α to bind to the mutated HRE site (see below).
To determine if HIF1α is capable of directly transactivating reporter gene expression
through the proximal HRE site, transient cotransfection experiments were performed under
normoxic conditions. As illustrated in Figure 4 (right panel), transfection of the HIF1α cDNA
results in significant transactivation of luciferase activity when cells are cotransfected with the
wild type p(�172)/LUCHRE construct, but not with the mutant p(�172)/LUCHRE-mut plasmid. This
result supports the notion that HIF1α, operating through an intact HRE motif in the proximal
upstream region, is a transactivator of the leptin gene promoter.
Binding of the HIF1 complex to the –116/HRE site in the proximal promoter region. To
determine if the proximal HRE site at �116 is capable of interacting with a HIF1α/β
heterodimeric complex, electrophoretic migration shift assay (EMSA) experiments were
by guest on Novem
ber 29, 2020http://w
ww
.jbc.org/D
ownloaded from
19
conducted. Cells exposed to normoxia or hypoxia were harvested, lysed and nuclear extracts
prepared and incubated with a 32P-labeled double-stranded 24-mer probe based on the sequence
of the leptin promoter region between �127 and �105, which contains the �116/HRE (see
Experimental Procedures). The resulting DNA/protein complexes were then resolved by non-
denaturing gel electrophoresis and visualized after exposure to autoradiography. As shown in
Figure 5A, hypoxia causes the appearance of a distinct complex with a retarded electrophoretic
migration that appears as a single band (lane 2). This complex can be completely eliminated by
competition with an excess of the homologous oligonucleotide (lanes 3-5), but not with a probe
in which the �116/HRE has been mutated (lanes 6-8). Importantly, another probe based on the
HRE motif present in the Epo gene enhancer (27), which is known to interact with HIF1 (37), is
also an effective competitor (Epo; lanes 9-11). For comparison, nuclear extracts prepared from
HeLa cells exposed to ambient hypoxia for 16 hr were used for equivalent EMSA experiments,
yielding virtually identical results (Fig. 4B). Thus, other cells known to undergo an equivalent
induction of HIF1α protein in response to hypoxia (i.e. HeLa) also support formation of the same
DNA/protein complexes when using a leptin promoter probe containing the �116/HRE site.
To verify that the hypoxia-inducible EMSA band corresponds to a HIF1 complex, gel
supershift experiments were conducted using specific polyclonal antibodies directed against
HIF1α or HIF1β. As shown in Figure 6A, both anti-HIF1α and anti-HIF1β antibodies are
capable of producing a conspicuous supershift band (lanes 3 and 4), accompanied by complete
disappearance of the original EMSA band observed under hypoxic conditions (lane 2).
Furthermore, addition of both antibodies results in a highly retarded complex exhibiting a slower
mobility than that achieved by each antibody alone (lane 5). In contrast, the use of an irrelevant
antibody does not alter the mobility of the hypoxia-induced EMSA band (compare lanes 2 and
by guest on Novem
ber 29, 2020http://w
ww
.jbc.org/D
ownloaded from
20
6). Again, for comparison purposes, nuclear extracts from HeLa cells exposed to hypoxia were
used in the same manner as hSDF extracts with identical qualitative results, although the relative
abundance of the complexes is not equivalent (Fig. 6B). Taken together, these findings indicate
that hypoxia induces activation of the leptin gene promoter as a result, at least in part, of
recruitment and binding of an intact heterodimeric HIF1α/β complex to the �116/HRE site
within the proximal promoter region of the leptin gene4.
by guest on Novem
ber 29, 2020http://w
ww
.jbc.org/D
ownloaded from
21
DISCUSSION
In this report, we show for the first time that the leptin gene is transcriptionally activated
in response to hypoxia through a mechanism that involves binding of the heterodimeric HIF1α/β
complex to a functional HRE site located within the proximal promoter region. There are several
key observations leading to this conclusion. First, exposure of human skin dermal fibroblasts in
culture to a hypoxic environment causes a marked increase in the level of immunoreactive leptin
secreted in the conditioned medium. This elevation is accompanied by a corresponding increase
in the cellular content of leptin mRNA, an effect that requires intact RNA synthesis. Second,
nested deletion analysis of the 5�-upstream region uncovers at least one functional HRE site
located at �116 that is required for a full transcriptional response to hypoxia, and which carries a
5�-RCGTG-3� core consensus sequence. Third, treatment with CoCl2 or DFO under normoxic
conditions, agents that are commonly used to mimic induction of hypoxia-responsive genes
through stabilization effects on HIF1α, leads to activation of reporter gene expression driven by
p(�172)/LUCHRE, which contains the proximal HRE at �116; site-specific mutations introduced
into this HRE disable hypoxic induction. Fourth, cotransfection with a cDNA encoding HIF1α
transactivates reporter gene expression from p(�172)/LUCHRE under normoxia conditions, but
not when the HRE mutant p(�172)/LUCHRE-mut construct is used. Finally, EMSA experiments
employing nuclear extracts from cells exposed to hypoxia show that both HIF1α and HIF1β bind
as a heterodimer to the intact �116 HRE locus, but not when it has been mutated. Furthermore, a
HIF1-binding probe (based on the sequence of the HRE site of the Epo gene enhancer), blocks
binding of HIF1 to the �116/HRE. Taken together, these observations indicate that transcription
of the leptin gene is stimulated by hypoxia through a mechanism that involves binding of the
HIF1α/β complex to the proximal HRE site located at �116 within the leptin gene promoter.
by guest on Novem
ber 29, 2020http://w
ww
.jbc.org/D
ownloaded from
22
Our recent discovery (20) [and also by others (38)] of the novel proangiogenic activity of
leptin primarily led us to investigate whether its expression might be regulated by hypoxia in a
similar fashion to many other angiogenic factors. In this regard, previous studies had shown that
leptin is produced in placental trophoblasts (39) and its circulating levels are increased in women
with severe preeclampsia (40), an acute hypertensive condition associated with diminished
uteroplacental blood flow and placental hypoxia. Furthermore, the human choriocarcinoma cell
line BeWo produces leptin in culture and its rate of secretion is also augmented upon exposure to
hypoxia (41), although the pathophysiologic significance of placental production of leptin is
unknown at present. Efforts to understand the basis for transcriptional regulation of leptin gene
expression in placenta have revealed upstream nuclear protein-binding, cis-acting elements
between �1885 and �1830 that support differential expression in placental trophoblasts, but not
in adipocytes (41). Close inspection of the sequence within this segment reveals two sets of
direct repeats, where the 3�-half region may provide binding sites for nuclear proteins as
mutations introduced in this region cause loss of promoter activity (41). An independent study
confirmed expression of leptin in choriocarcinoma cell lines, including JEG-3 and JAR cells, as
well as the existence of the aforementioned upstream placental enhancer whose activity is
required for leptin expression in placental cells, but not in adipocytes or HeLa cells (42). Thus,
although these studies generally illustrate mechanisms that regulate expression of the leptin gene
in non-adipocytes (i.e. placental trophoblastic cells), they do not address whether hypoxia per se
alters the rate of transcription of the leptin gene.
In a more recent study, a multifold promoter activation in response to hypoxia was shown
by using deletion mutants of the 5�-flanking region of the leptin gene linked to a reporter gene,
spanning a region between �2.38 kb to �0.17 kb (43). It is noteworthy the claim in that report
by guest on Novem
ber 29, 2020http://w
ww
.jbc.org/D
ownloaded from
23
that hypoxic induction appears to be more significant when longer constructs extending up to �
1.87 kb of upstream region are used, leading the authors to speculate whether this effect might be
mediated by HIF1 binding (43). This hypothesis, although not proven directly, finds support in
the existence of a putative 5�-RCGTG-3� HRE with a distal location at �1832 [and contained
within our p(�2041)/LUC construct], which is almost identical to the HIF1-binding HRE present
in the 3'-flanking region enhancer of the human Epo gene. However, since a significant level of
hypoxic induction still remains with shorter promoter/reporter constructs, it is not immediately
obvious which element(s) could be involved. This is particularly the case considering that there
are at least 7 other putative HREs downstream from the �1832 HRE site (see Fig. 3), as well as
other functional motifs that have been shown to participate in activation of hypoxia-regulated
genes (see below). Our results show that the relative stimulation caused by hypoxia is not
significantly different between p(�2041)/LUC (which contains the upstream HRE site at �1832)
and p(�1687)/LUC (which does not); furthermore, site-specific mutations that disable binding of
HIF1 to this �1832/HRE do not prevent hypoxic induction (results not shown). Since an
equivalent level of relative hypoxia-driven promoter activation is observed with p(�172)/LUC, it
is apparent that additional, more proximally located cis-acting elements are also involved in this
response.
The proximal promoter region of the human leptin gene contains a number of putative
binding motifs for transcription factors, some of which have been demonstrated to play an
important functional role in the regulation of basal or tissue-specific (adipose) expression of the
gene. As shown in Figure 7, the first 172-bp of upstream sequence includes the HRE at �116
and two neighboring GC boxes (at �99 and �94), flanked by two juxtaposed putative motifs for
binding of the AP-2 (activator protein-2) factor. Further downstream, a palindromic
by guest on Novem
ber 29, 2020http://w
ww
.jbc.org/D
ownloaded from
24
CCAAT/enhancer binding protein (C/EBP) response element is located at �47 followed by a
TATA-like box and an additional GC-box immediately downstream, preceding the start site of
transcription (Fig. 7). A number of studies have established that C/EBPα, which is an
indispensable transcriptional activator of adipocyte genes during preadipocyte differentiation,
also functions as a transactivator of the leptin gene promoter by binding to the proximal C/EBP
response element located at �47 (44-47). In addition, analysis of the leptin promoter using
clustered point mutants introduced at key sites confirmed not only an obligatory requirement for
an intact C/EBP response element, but also revealed an important role for the GC-box centered at
�99 and the TATA-box element in maintaining a high level of transcriptional activity in
transfected rat adipocytes (47). It is of interest to note that a C/EBP consensus site in the
promoter of the IL-6 gene serves as the binding site for C/EBPβ and acts as a hypoxia-sensitive
enhancer in endothelial cells or lung vasculature through a mechanism that does not involve
HIF1 (48). These findings have been verified in the context of transgenic mice bearing
transgenes in which an intact or mutant C/EBP site (also referred to as NF-IL-6 site) was linked
to a LacZ reporter gene and expression assessed following exposure to hypoxia (49). Likewise,
Sp1 and Sp3 transcription factors binding in a mutually competitive fashion to a promoter GC-
rich element downstream from a GATAA site have been implicated in the hypoxic induction of
pyruvate kinase-M and β-enolase genes in muscle (50). Thus, although additional mechanisms
for transcriptional activation of hypoxia-sensitive genes exist besides the HIF1-mediated
pathway, our results indicate that site-specific mutations into the �116/HRE are sufficient to
prevent binding of HIF1α/β and to completely block the hypoxic or CoCl2/DFO-induced
activation of the leptin promoter, thereby implicating HIF1 as a major effector in this response.
by guest on Novem
ber 29, 2020http://w
ww
.jbc.org/D
ownloaded from
25
A growing list of sites of leptin production (and its receptor) by cells other than
adipocytes is consistent with an increasingly recognized role for leptin as a pleitotropic molecule
vastly involved not only in energy homeostasis, but also in reproductive function, hematopoiesis,
immune regulation, angiogenesis and wound healing (21,22). We (20), and others (38),
previously demonstrated that leptin acts as a potent angiogenic factor on endothelial cells in vitro
and in vivo, possibly serving distinct purposes in the various tissues in which it is produced. For
example, in adipose tissue, leptin might behave as a locally active paracrine angiogenic factor
that maintains an appropriate balance between blood supply and fat depot size (20). Leptin
produced in placental trophoblasts may act in concert with other placental angiogenic factors to
regulate placental vascularization and transplacental exchange (51). During wound healing,
leptin production may be required for supporting angiogenesis2, which is necessary for
granulation tissue formation (52), or perhaps for additional functions including keratinogenesis
(53,54) or local production of angiogenic cytokines such as VEGF, FGF-2 and TGFβ (9,55,56).
One commonality among all these different scenarios in which leptin is produced may be the
establishment of a hypoxic environment that necessitates the appropriate underlying machinery
to provide an attendant adaptation physiological response. The findings reported herein are
consistent with the angiogenic character of leptin whose modulation by hypoxia is thus common
to other angiogenic factors. Although mechanisms other than HIF1-mediated promoter
activation exist to upregulate expression of hypoxia-sensitive genes, binding of the HIF1α/β
complex to the leptin promoter constitutes at least one important component. Further studies
will be necessary to evaluate the possibility that hypoxia may also modulate the stability of leptin
mRNA, as well as the role of HREs and additional promoter elements in hypoxia-induced leptin
gene transcription in other cells.
by guest on Novem
ber 29, 2020http://w
ww
.jbc.org/D
ownloaded from
26
REFERENCES
1. Gleadle, J. M., and Ratcliffe, P. J. (1998) Mol Med Today 4(3), 122-9.
2. Semenza, G. L. (2000) J Appl Physiol 88(4), 1474-80.
3. Faura, J., Ramos, J., Reynafarje, C., English, E., Finne, P., and Finch, C. A. (1969) Blood
33(5), 668-76.
4. Ratcliffe, P. J. (1993) Kidney Int 44(4), 887-904.
5. Lee, P. J., Jiang, B. H., Chin, B. Y., Iyer, N. V., Alam, J., Semenza, G. L., and Choi, A.
M. (1997) J Biol Chem 272(9), 5375-81.
6. Melillo, G., Musso, T., Sica, A., Taylor, L. S., Cox, G. W., and Varesio, L. (1995) J Exp
Med 182(6), 1683-93.
7. Kim, K. J., Li, B., Winer, J., Armanini, M., Gillett, N., Phillips, H. S., and Ferrara, N.
(1993) Nature 362(6423), 841-4.
8. Shweiki, D., Neeman, M., Itin, A., and Keshet, E. (1995) Proc Natl Acad Sci U S A
92(3), 768-72.
9. Nissen, N. N., Polverini, P. J., Koch, A. E., Volin, M. V., Gamelli, R. L., and DiPietro, L.
A. (1998) Am J Pathol 152(6), 1445-52.
10. Robin, E. D., Murphy, B. J., and Theodore, J. (1984) J Cell Physiol 118(3), 287-90.
11. Ebert, B. L., Firth, J. D., and Ratcliffe, P. J. (1995) J Biol Chem 270(49), 29083-9.
12. Semenza, G. L., Jiang, B. H., Leung, S. W., Passantino, R., Concordet, J. P., Maire, P.,
and Giallongo, A. (1996) J Biol Chem 271(51), 32529-37.
13. Firth, J. D., Ebert, B. L., and Ratcliffe, P. J. (1995) J Biol Chem 270(36), 21021-7.
14. Firth, J. D., Ebert, B. L., Pugh, C. W., and Ratcliffe, P. J. (1994) Proc Natl Acad Sci U S
A 91(14), 6496-500.
by guest on Novem
ber 29, 2020http://w
ww
.jbc.org/D
ownloaded from
27
15. Semenza, G. L., Agani, F., Iyer, N., Jiang, B. H., Leung, S., Wiener, C., and Yu, A.
(1998) Chest 114(1 Suppl), 40S-45S.
16. Semenza, G. L. (2001) Curr Opin Cell Biol 13(2), 167-71.
17. Wang, G. L., Jiang, B. H., Rue, E. A., and Semenza, G. L. (1995) Proc Natl Acad Sci U S
A 92(12), 5510-4.
18. Wang, G. L., and Semenza, G. L. (1995) J Biol Chem 270(3), 1230-7.
19. Hankinson, O. (1995) Annu Rev Pharmacol Toxicol 35, 307-40
20. Sierra-Honigmann, M. R., Nath, A. K., Murakami, C., Garcia-Cardena, G.,
Papapetropoulos, A., Sessa, W. C., Madge, L. A., Schechner, J. S., Schwabb, M. B.,
Polverini, P. J., and Flores-Riveros, J. R. (1998) Science 281(5383), 1683-6.
21. Ahima, R. S., and Flier, J. S. (2000) Annu Rev Physiol 62, 413-37
22. Fantuzzi, G., and Faggioni, R. (2000) J Leukoc Biol 68(4), 437-46.
23. Gong, D. W., Bi, S., Pratley, R. E., and Weintraub, B. D. (1996) J Biol Chem 271(8),
3971-4.
24. Sanger, F., Nicklen, S., and Coulson, A. R. (1977) Proc Natl Acad Sci U S A 74(12),
5463-7.
25. Deng, W. P., and Nickoloff, J. A. (1992) Anal Biochem 200(1), 81-8.
26. Semenza, G. L., and Wang, G. L. (1992) Mol Cell Biol 12(12), 5447-54.
27. Beck, I., Ramirez, S., Weinmann, R., and Caro, J. (1991) J Biol Chem 266(24), 15563-6.
28. Chaconas, G., and van de Sande, J. H. (1980) Methods Enzymol 65(1), 75-85
29. Chang, N., Goodson, W. H., 3rd, Gottrup, F., and Hunt, T. K. (1983) Ann Surg 197(4),
470-8.
by guest on Novem
ber 29, 2020http://w
ww
.jbc.org/D
ownloaded from
28
30. Jonsson, K., Jensen, J. A., Goodson, W. H., 3rd, Scheuenstuhl, H., West, J., Hopf, H. W.,
and Hunt, T. K. (1991) Ann Surg 214(5), 605-13.
31. Mahon, P. C., Hirota, K., and Semenza, G. L. (2001) Genes Dev 15(20), 2675-86.
32. Sutter, C. H., Laughner, E., and Semenza, G. L. (2000) Proc Natl Acad Sci U S A 97(9),
4748-53.
33. Goldberg, M. A., Dunning, S. P., and Bunn, H. F. (1988) Science 242(4884), 1412-5.
34. Wang, G. L., and Semenza, G. L. (1993) Blood 82(12), 3610-5.
35. Semenza, G. L. (1999) Annu Rev Cell Dev Biol 15, 551-78
36. Semenza, G. L. (1999) Cell 98(3), 281-4.
37. Salceda, S., and Caro, J. (1997) J Biol Chem 272(36), 22642-7.
38. Bouloumie, A., Drexler, H. C., Lafontan, M., and Busse, R. (1998) Circ Res 83(10),
1059-66.
39. Masuzaki, H., Ogawa, Y., Sagawa, N., Hosoda, K., Matsumoto, T., Mise, H., Nishimura,
H., Yoshimasa, Y., Tanaka, I., Mori, T., and Nakao, K. (1997) Nat Med 3(9), 1029-33.
40. Mise, H., Sagawa, N., Matsumoto, T., Yura, S., Nanno, H., Itoh, H., Mori, T., Masuzaki,
H., Hosoda, K., Ogawa, Y., and Nakao, K. (1998) J Clin Endocrinol Metab 83(9), 3225-
9.
41. Ebihara, K., Ogawa, Y., Isse, N., Mori, K., Tamura, N., Masuzaki, H., Kohno, K., Yura,
S., Hosoda, K., Sagawa, N., and Nakao, K. (1997) Biochem Biophys Res Commun
241(3), 658-63.
42. Bi, S., Gavrilova, O., Gong, D. W., Mason, M. M., and Reitman, M. (1997) J Biol Chem
272(48), 30583-8.
by guest on Novem
ber 29, 2020http://w
ww
.jbc.org/D
ownloaded from
29
43. Grosfeld, A., Turban, S., Andre, J., Cauzac, M., Challier, J. C., Hauguel-de Mouzon, S.,
and Guerre-Millo, M. (2001) FEBS Lett 502(3), 122-6.
44. Hwang, C. S., Mandrup, S., MacDougald, O. A., Geiman, D. E., and Lane, M. D. (1996)
Proc Natl Acad Sci U S A 93(2), 873-7.
45. He, Y., Chen, H., Quon, M. J., and Reitman, M. (1995) J Biol Chem 270(48), 28887-91.
46. de la Brousse, F. C., Shan, B., and Chen, J. L. (1996) Proc Natl Acad Sci U S A 93(9),
4096-101.
47. Mason, M. M., He, Y., Chen, H., Quon, M. J., and Reitman, M. (1998) Endocrinology
139(3), 1013-22.
48. Yan, S. F., Tritto, I., Pinsky, D., Liao, H., Huang, J., Fuller, G., Brett, J., May, L., and
Stern, D. (1995) J Biol Chem 270(19), 11463-71.
49. Yan, S. F., Zou, Y. S., Mendelsohn, M., Gao, Y., Naka, Y., Du Yan, S., Pinsky, D., and
Stern, D. (1997) J Biol Chem 272(7), 4287-94.
50. Discher, D. J., Bishopric, N. H., Wu, X., Peterson, C. A., and Webster, K. A. (1998) J
Biol Chem 273(40), 26087-93.
51. Reynolds, L. P., and Redmer, D. A. (2001) Biol Reprod 64(4), 1033-40.
52. Tonnesen, M. G., Feng, X., and Clark, R. A. (2000) J Investig Dermatol Symp Proc 5(1),
40-6.
53. Frank, S., Stallmeyer, B., Kampfer, H., Kolb, N., and Pfeilschifter, J. (2000) J Clin Invest
106(4), 501-9.
54. Stallmeyer, B., Kampfer, H., Podda, M., Kaufmann, R., Pfeilschifter, J., and Frank, S.
(2001) J Invest Dermatol 117(1), 98-105.
by guest on Novem
ber 29, 2020http://w
ww
.jbc.org/D
ownloaded from
30
55. Nissen, N. N., Polverini, P. J., Gamelli, R. L., and DiPietro, L. A. (1996) Surgery 119(4),
457-65.
56. Hom, D. B., and Maisel, R. H. (1992) Ann Otol Rhinol Laryngol 101(4), 349-54.
by guest on Novem
ber 29, 2020http://w
ww
.jbc.org/D
ownloaded from
31
FOOTNOTES
1The abbreviations used are: HIF1, hypoxia-inducible factor 1; HRE, hypoxia response element;
hSDF, human skin dermal fibroblasts; ARNT, arylhydrocarbon receptor nuclear translocator;
Epo, erythropoietin; bHLH, basic-helix-loop-helix; C/EBP, CCAAT/enhancer binding protein;
EMSA, electrophoretic mobility shift assay; VEGF, vascular endothelial growth factor; DFO,
desferrioxamine; USF, upstream stimulatory factor; FGF, fibroblast growth factor; TGFβ,
transforming growth factor β; IL-6, interleukin-6; LacZ, β-galactosidase.
2Sierra-Honigmann, M.R., Nath, A.K., Murad, A., work in progress.
3Although initial experiments attempted to assess the activity of these promoter/reporter
constructs in transiently transfected hSDF exposed to ambient hypoxia, cellular viability was
significantly compromised upon reduction of O2 tension in the cell culture incubator, but not
under conditions of chemical hypoxia. Therefore, treatment with CoCl2 or DFO was adopted as
an equivalent hypoxic maneuver with respect to induction of both HIF1α and leptin expression in
hSDF, as demonstrated by the experiments shown in Fig. 2 and studies extensively reported in
the literature.
4It would appear that a transcriptional response alone is insufficient to account for the robust
level of leptin expression observed upon exposure of fibroblasts to hypoxia. Whereas hypoxia-
induced leptin promoter activation reveals a 3-fold induction at best, it is evident that the
magnitude of the increase in the level of secreted leptin, or leptin mRNA induction, occurs to a
by guest on Novem
ber 29, 2020http://w
ww
.jbc.org/D
ownloaded from
32
much higher extent (Figs. 1 and 2). Nonetheless, we propose that the transcriptional activation
of the leptin promoter described herein contributes in part to the hypoxic response.
by guest on Novem
ber 29, 2020http://w
ww
.jbc.org/D
ownloaded from
33
FIGURE LEGENDS
FIGURE 1. Induction of Leptin Secretion by Hypoxia. Primary cultures of freshly prepared
hSDF were grown to near confluency and then maintained under normoxia conditions (21% O2),
or exposed to the indicated levels of hypoxia (5% to 0.5%) for 48 hr. Conditioned culture
medium was then collected and the content of leptin was determined by radioimmunoassay (see
Experimental Procedures). The concentration of leptin in medium from control cells (N) under
normoxia was consistently below detection levels (<0.05 ng/ml). Data (mean ± S.E.M.) are from
3 independent experiments.
FIGURE 2. Effect of Hypoxia upon Expression of Leptin and HIF1 Proteins. A. Cultured
hSDF were kept under normoxia (N) or exposed to a 1% O2 hypoxia environment for the times
indicated, and then total RNA was prepared and fractionated by agarose gel electrophoresis.
After capillary transfer to nylon membranes, the blots were hybridized with a 32P-labeled, full-
length human leptin cDNA probe, washed and exposed to autoradiography. For comparison, the
relative migration of leptin mRNA present in human adipocytes (Ad) is shown on the right panel.
The ethidium bromide-staining pattern is shown in the lower panel to verify equal loading of
RNA samples in each lane. B. Cells were cultured and left intact or treated with 5 µg/ml of
actinomycin D for 2 hr prior to exposure to either a normoxia (N), or 1% O2 hypoxia
environment for 2 additional hours. RNA was then prepared and processed as described above
for panel A. Hyp, cells exposed to hypoxia only; Hyp + Act D, cells pre-treated with
actinomycin D and then exposed to hypoxia. C. Cells maintained in normoxia (N), or exposed to
either 1% O2 ambient hypoxia (N2) or chemical hypoxia with CoCl2 or DFO for 16 hr were
collected and total soluble nuclear extracts were then prepared as described in Experimental
by guest on Novem
ber 29, 2020http://w
ww
.jbc.org/D
ownloaded from
34
Procedures. Proteins were resolved by SDS-PAGE, transferred to PVDF membranes and
developed for immunoblot analysis using antibodies against HIF1α (left & middle panels) or
HIF1β (right panel). For comparison, extracts from HeLa cells exposed to hypoxia (Hyp) or not
(N) were analyzed by immunoblotting with respect to their content of HIF1α using the
appropriate antibodies (middle panel). D. Cells were kept under normoxia (N) or exposed to
ambient (N2) or chemical hypoxia with the indicated agent (CoCl2 or DFO) for 16 hr, and then
total RNA was prepared and subjected to RT/PCR as described in Experimental Procedures.
PCR products were resolved by agarose gel electrophoresis and visualized by ethidium bromide
staining. The arrow indicates the position of the expected 526-bp band from amplification of the
leptin mRNA transcript with respect to molecular weight markers on the left.
FIGURE 3. Deletion Analysis of the 5�-Flanking Region of the Leptin Gene and Effect of
Hypoxia upon Reporter Gene Expression. A 2.9-kb fragment of the 5�-flanking region of the
leptin gene was subcloned upstream of a luciferase reporter gene as described in Experimental
Procedures. The location and orientation of putative HRE sites defined by the core sequence 5�-
RCGTG-3� is indicated at the top by the arrows. The restriction enzyme digestion sites indicated
were used to produce 5�-nested deletion mutants, giving rise to the constructs shown and
designated by the length of 5�-flanking region that they contain [the shortest construct, p(�
63)/LUC, was generated by PCR amplification of the appropriate genomic region (see text)].
Each of these promoter/reporter constructs was transiently transfected into cultured hSDF and
subsequently exposed to chemical hypoxia with DFO (or not) for 16 hr. Total soluble extracts
were then prepared and the level of luciferase activity was determined by chemiluminescence.
by guest on Novem
ber 29, 2020http://w
ww
.jbc.org/D
ownloaded from
35
Results (mean ± S.E.M.) are expressed relative to the activity observed with the promoterless
construct pGL3-Basic and they represent data from 3 independent experiments.
FIGURE 4. Effect of HRE Site-Specific Mutations within the Proximal Promoter Region
of the Leptin Gene in Response to Hypoxia. A. Cultured hSDF were transiently transfected
with either p(�172)/LUCHRE (WT) or p(�172)/LUCHRE-mut (MUT) and then kept under normoxia,
or subjected to chemical hypoxia with 150 mM CoCl2 or 100 mM DFO (as indicated) for 16 hr.
Total soluble extracts were then prepared and the level of luciferase activity determined by
chemiluminescence. Results (left panel) are expressed relative to the activity observed in cells
transfected with p(�172)/LUCHRE and kept in a normoxia environment. In parallel, cells were
transiently cotransfected with a cDNA expression vector encoding human HIF1α (or not), and
with either p(�172)/LUCHRE or p(�172)/LUCHRE-mut (as explicitly indicated) and kept under
normoxia conditions. The level of luciferase activity was then determined in soluble extracts as
described above, and the results shown on the right panel. Data from 3 independent experiments
are expressed (mean ± S.E.M.) relative to the activity found in extracts from cells transfected
with p(�172)/LUCHRE and kept under normoxia.
FIGURE 5. EMSA Analysis of the Leptin Promoter �116/HRE Site in Cells Exposed to
Hypoxia. A. Nuclear extracts prepared from hSDF kept under normoxia or exposed to hypoxia
for 16 hr were incubated with a 32P-labeled LepHRE gel shift probe. The resulting complexes
were resolved by non-denaturing gel electrophoresis and their location was revealed by
phosphorimager detection. Complexes observed in extracts from cells under normoxia (N, lane
1) or hypoxia conditions (Hyp, lanes 2-11) are indicated by the arrows. Binding reactions were
by guest on Novem
ber 29, 2020http://w
ww
.jbc.org/D
ownloaded from
36
carried out in the presence of a 10-, 50- and 100-molar excess of unlabeled homologous probe
(LepHRE, lanes 3-6), same probe with site-specific mutations within the HRE site (LepHRE-mut,
lanes 6-8), or a related probe based on the HRE site of the Epo gene enhancer (Epo, lanes 9-11;
see Experimental Procedures). B. For comparison, HeLa cells were treated and nuclear extracts
processed in an identical manner to that described for panel A. The relative position of
equivalent complexes is also indicated (N and Hyp).
FIGURE 6. Binding of the HIF1α/β Heterodimer to the Leptin Promoter �116/HRE Site in
Response to Hypoxia. A. Nuclear extracts prepared from hSDF under normoxia or hypoxia for
16 hr were incubated with a 32P-labeled LepHRE probe, and the resulting DNA/protein complexes
were resolved by non-denaturing gel electrophoresis and their location was revealed by
phosphorimager detection (see Fig. 5). Where indicated, the binding reactions were
supplemented with 1 µg of an antibody against HIF1α (α-HIF1α, lane 3), HIF1β (α-HIF1β, lane
4), HIF1α plus HIF1β (α-HIF1α plus α-HIF1β, lane 5), or alkaline phosphatase (α-AP, lane 6).
The relative position of complexes detected in cells kept under normoxia (N, lane 1), exposed to
hypoxia (Hyp, lanes 2-6), or exposed to hypoxia and supershifted (S-shift, lanes 3-4) by the
various antibodies are indicated by the symbols and arrows on the left. B. For comparison, HeLa
cells were treated and nuclear extracts processed in an identical manner to that described for
panel A. The relative position of equivalent complexes is also indicated (N, Hyp and S-shift).
FIGURE 7. The Proximal Promoter Region of the Human Leptin Gene. The 5�-flanking
region of the human leptin gene showing the nucleotide sequence of the first 172-bp upstream of
the transcription start site (bent arrow) is depicted, indicating the relative position of various
by guest on Novem
ber 29, 2020http://w
ww
.jbc.org/D
ownloaded from
37
putative binding elements, which are boxed. The hypoxia-sensitive HRE at �116 is shown
together with the two G residues that were mutated (dots). The relative orientation of the HRE
and the AP-2 sites is denoted by the arrows above their respective boxes. The sequence shown
here was from Ref. (23), Genbank Accession No. U43653.
by guest on Novem
ber 29, 2020http://w
ww
.jbc.org/D
ownloaded from
0.25
0.50
0.75
N(21% O2)
Hypoxia (%O2)
5% 1% 0.5%
[Lep
tin] (
ng/m
l)
<0.05
FIGURE 1
by guest on Novem
ber 29, 2020http://w
ww
.jbc.org/D
ownloaded from
2 kb1.6 kb
1 kb
0.5 kb
N N 2 CoCl 2
DFO
526 bp
HypoxiaD
N 2 6 12 18 24
Time of hypoxia (hr)
LeptinmRNA
28S
18S
hSDF Ad
AN Hyp Hyp
+Act
D
LeptinmRNA
28S
18S
B
HIF1α HIF1β
N N 2 CoCl 2
DFO
Hypoxia
N N
hSDF HeLa hSDF
HypHyp
C
FIGURE 2
by guest on Novem
ber 29, 2020http://w
ww
.jbc.org/D
ownloaded from
LUC
Hin
d II
Nsi
I
ScaI
StuI
SacI
I
XhoI
Putative HREs (5‘-RCGTG-3’)
5 10 15Relative Luciferase Activity
NormoxiaHypoxia
FULL LENGTH: p(-2912)/LUC
p(-2643)/LUC
p(-2041)/LUC
p(-1687)/LUC
p(-983)/LUC
p(-375)/LUC
p(-172)/LUC
p(-63)/LUC
LUC
LUC
LUC
LUC
LUC
LUC
LUC
FIGURE 3
by guest on Novem
ber 29, 2020http://w
ww
.jbc.org/D
ownloaded from
FIGURE 4
1
2
3
4
NormoxiaCoCl2DFO
Luci
fera
se A
ctiv
atio
n (-f
old)
WT MUT
+HIF1α-HIF1αp(-172)/LUCHRE
WT MUT
by guest on Novem
ber 29, 2020http://w
ww
.jbc.org/D
ownloaded from
Epo
Hyp
N
1 2 3 4 5 6 7 8 9 10 11
LepHRE LepHRE-mut
NHypoxia
Hyp
N
A
B
FIGURE 5
by guest on Novem
ber 29, 2020http://w
ww
.jbc.org/D
ownloaded from
α−HIF1α
None
α−HIF1β
α−HIF1α +
αHIF1β
α−APANTIBODY
ADDED
Hyp
N
S-shift
1 2 3 4 5 6
None
NHypoxia
Hyp
N
S-shift
A
B
FIGURE 6
by guest on Novem
ber 29, 2020http://w
ww
.jbc.org/D
ownloaded from
CTCGAGGCCCCGCGAGGTGCACACTGCGGGCCCAGGGCTAGCAGCCGCCCGGCACGTCGCTAC
CCTGAGGGGCGGGGCGGGAGCTGGCGCTAGAAATGCGCCGGGGCCTGCGGGGCAGTTGCGCAA
GTTGTGATCGGGCCGCTATAAGAGGGGCGGGCAGGCATGGAGCCCCGTAGGAATCGCAGCGCC
AACGGTTGCAAG+1
AP-2
AP-2
-116/HRE
C/EBPGC GC
GCTATA-like
-109
-172
-46
GAGCTCCGGGGCGCTCCACGTGTGACGCCCGGGTCCCGATCGTCGGCGGGCCGTGCAGCGATG
GGACTCCCCGCCCCGCCCTCGACCGCGATCTTTACGCGGCCCCGGACGCCCC GCGTT
CAACACTAGCCCGGCGATATTCTCCCCGCCCGTCCGTACCTCGGGGCATCCTTAGCGTCGCGG
TTGCCAACGTTC
FIGURE 7
by guest on Novem
ber 29, 2020http://w
ww
.jbc.org/D
ownloaded from
Grazia Ambrosini, Anjali K. Nath, M. Rocio Sierra-Honigmann and Jaime Flores-RiverosInvolvement of hypoxia-inducible factor 1
Transcriptional activation of the human leptin gene in response to hypoxia:
published online June 25, 2002J. Biol. Chem.
10.1074/jbc.M205172200Access the most updated version of this article at doi:
Alerts:
When a correction for this article is posted•
When this article is cited•
to choose from all of JBC's e-mail alertsClick here
by guest on Novem
ber 29, 2020http://w
ww
.jbc.org/D
ownloaded from