%NVUEDEL OBTENTIONDU %0$5035 %&- 6/7&345² … · %nvuedel obtentiondu %0$503"5 %&- 6/7&345²...

Institut National des Sciences Appliquées de Toulouse (INSA Toulouse)

Sciences Ecologiques, Vétérinaires, Agronomiques et Bioingénieries (SEVAB)

Etude de la structure des fructanes d'Agave tequilana et de nouvellesfructanases d'origine microbienne

lundi 21 novembre 2011Javier ARRIZON

Ingénieries microbienne et enzymatique

Dr Benoît Colonna-Ceccaldi (Centre de Recherche Pernod Ricard)Dr Anne Gschaedler (Directeur de Recherche CIATEJ)

Pr Magali Remaud-Simeon (Professeur, INSA Toulouse) Présidente du jury

Pr Marie-Pascale Prud'homme, Professeur Université de CaenDr Hugues Driguez, Directeur de Recherche CERMAV Grenoble

Pr Pierre MonsanDr Sandrine Morel

LISBP (UMR CNRS 5504, UMR INRA 792), INSA de Toulouse

1

NOM : ARRIZON Prénom : Javier.

Titre : Etude de la structure des fructanes d’Agave tequilana et de nouvelles fructanases d’origine microbienne.

Discipline ou spécialité : Ingénieries microbienne et enzymatique

Année : 2011 Lieu : INSA de Toulouse

RESUME :

Le Mexique se caractérise par la présence sur son territoire de nombreuses espèces d’agave qui peuvent être cultivées ou non. En particulier l’Agave tequilana Weber var. azul a une grande importance économique, car elle constitue la principale matière première pour l’élaboration de la tequila. Les agaves durant leur développement, qui dure plusieurs années, accumulent des réserves de sucres constitués par des fructanes.

Actuellement, l’optimisation de l’hydrolyse des fructanes d’agave est surtout importante pour l’industrie de la tequila. Elle permettra d’améliorer les rendements d’extraction des sucres. La méthode classique d’hydrolyse des fructanes est constituée principalement d’un procédé de cuisson des agaves crus. L’utilisation d’enzymes spécifiques pour réaliser ce même procédé d’hydrolyse suscite un récent intérêt industriel, parce qu’il permettrait une réduction de la consommation d’énergie. Les fructanes d’agave présentent des structures complexes, les résidus de fructose sont reliés par des liaisons osidiques de type β (2→1) et β (2→6), et la structure est fortement branchée. Il est nécessaire de comprendre les changements de structure des fructanes en fonction de l’étape de croissance des plantes, pour connaître la variabilité naturelle du substrat utilisé pour l’hydrolyse. D’autre part, il est important de découvrir de nouvelles enzymes susceptibles d’hydrolyser de manière spécifique les fructanes d’agave, et les caractériser biochimiquement, pour arriver à une meilleure connaissance de l’intéraction enzyme-substrat qui permettra le développement de nouvelles applications industrielles possibles pour les fructanes d’Agave tequilana.

Dans ce travail, la première partie est consacrée à la détermination de la composition en sucres solubles et à la caractérisation de la structure des fructanes d’Agave tequilana présents dans des plantes d’âges différents. Puis, dans la deuxième partie, la purification et la caractérisation biochimique d’une fructanase isolée d’une souche de levure Kluyveromyces marxianus obtenue à partir du procédé de fermentation du mezcal (boisson d’agave distillée) a été étudiée. L’activité de cette enzyme a été comparée à un cocktail enzymatique commercial le fructozyme®. Finalement, dans une troisième partie, des levures isolées de la fermentation de différents types de mezcal ont été criblées et ont permis la sélection de souches capables de dégrader spécifiquement les fructanes d’Agave

2

______________________________________________________________________

MOTS-CLES :

Agave tequilana, fructanes d’agave, tequila, mezcal, fructanases, fructan exo-hydrolases, fructan endo-hydrolases, fructosyltransferases.

_____________________________________________________________________

Ecole doctorale : SEVAB (Sciences Ecologiques, Vétérinaires, Agronomiques et Bioingénieries).

Laboratoire : Ingénierie des Systèmes Biologiques et des procédés UMR 5504, UMR 792.

3

Last Name : ARRIZON First name : Javier.

Title : Study of Agave tequilana fructans structure and new fructanases from microbial origin

Specialty : Enzymatic and microbial engineering

Supervisor : Pr. Pierre Monsan

Year : 2011 Place : INSA de Toulouse

SUMMARY :

Mexico has a high diversity of Agave plants, which could be cultivated or not. The most economically important is Agave tequilana Weber var. azul, because it is the raw material for the tequila elaboration process. As agaves grow, they accumulate reserve sugars as fructans.

Actually, optimizing the A. tequilana fructans hydrolysis, in order to increase the sugar yield, is important to the tequila industry. Traditionally, agaves are cooked to hydrolyze the fructans. However, using enzymes for hydrolysis may reduce energy consumption and increase sugar yields.The fructans of A. tequilana have a complex structure, composed of fructose chains with β (2→1) and β (2→6) linkages with branching points. It is important to understand how the structure of these molecules changes as a function of plant growth, in order to know the natural variability of the substrate that must be hydrolysed. It is also necessary to find new enzymes for the efficient hydrolysis of A. tequilana fructans, and to characterize them biochemically for a better understanding of the enzyme-substrate interaction.

The present work has three parts that focuses separately on each of these needs: First, characterizing the water soluble carbohydrates and the structure of the A. tequilana fructans as a function of the plant’s growth (age). Second, purifying and biochemically characterizing a fructanase from Kluyveromyces marxianus yeast isolated from the fermentation of mezcal, and comparing it to a commercial cocktail (Fructozyme®). Third, a screening of enzymes from yeasts used to ferment mezcal, in order to determine their ability to hydrolyze A. tequilana fructans.

4

KEYWORDS :

Agave tequilana, fructanes d’agave, tequila, mezcal, fructanases, fructan exo-hydrolases, fructan endo-hydrolases, fructosyltransferases.

Doctorate School : SEVAB (Ecological, Veterinary and Agronomic Sciences and Bioengineering

Laboratory : Laboratory for Biosystems and Chemical Engineering UMR 5504 CNRS/INSA, UMR 792 INRA/INSA.

5

Remerciements

Para comenzar a mis padres Mariana Gaviño y Mariano Arrizon , aun cuando no están ya en este mundo, se que desde aluna parte me acompañan, les agradezco por haberme dado la vida, por haber luchado por mi, por enseñarme a continuar en esta vida caotica siempre hacia adelante, con animo y determinación a pesar de las adversidades.

Gracias a mi familia (Miguel, Beto, Linda, Lola, Celia, Eva, Pedro y Lili , así como sus respectivos conyugues, hijos e hijas) por estar al tanto de mi todo el tiempo que estuve en Francia.

A Francisco por estar conmigo en las buenas y en las malas, por ser mi compañero a lo largo de estos 8 años, por haberme hecho vivir momentos agradables aquí y en Francia. Sin este apoyo, las cosas hubieran sido más difíciles, muchas gracias corazón.

Anne llego el momento de agradecerte, lo voy a hacer en francés, creo que es más cercano a ti. Merci Anne, d’abord pour partager ton amitié, je sais que n’était pas facile être chef et amie à même temps, merci pour m’aider à faire la collaboration avec l’INSA d’une manière désintéressée, avec le seul intérêt de continuer la science sur cette sujet important pour nous au Mexique « Le monde des agaves ».

Je remercie Etienne Waleckx , pour m’avoir fait connaître la culture française, pour tous les bons moments que l’on a partagés ensemble au Mexique et en France.

Je voudrais remercier Pierre Monsan , de m’avoir accepté dans son laboratoire, bien que très occupé tout le temps, merci pour tous les échanges scientifiques que l’on a pu avoir et merci également de m’avoir permis de réaliser une partie de mon travail de thèse au LISBP à Toulouse.

Sandrine , merci beaucoup pour tout, pour partager ta connaissance, ton amitié, ton aide dans les démarches administratives, pour m’avoir aidé à rendre mon séjour très agréable à Toulouse. Merci surtout pour ta patience.

Merci Geraldine d’avoir partagé avec moi ton amitié et ton amabilité, pour m’avoir enseigné la préparation des crêpes, pour m’avoir fait découvrir la France, pour m’avoir accompagné aux festivals du cinéma à Toulouse, pour des bons moments en Italie. Merci Sameh de m’avoir fait partager ta culture, ton amitié, pour ton aide avec quelques manips, pour tes moqueries sur mon français aussi. Merci Iris Marcos pour avoir partagé tes expériences, pour nos discussions sur l’Espagne et l’Amérique Latine, pour ton aide efficace sur la recherche d’informations. Merci Lena pour m’avoir ouvert ta maison, pour votre amitié et pour votre aide, jamais je n’oublierai ton aide et ton soutien lorsque ma mère était très malade. Merci Sophie Bozonnet, Fernando, René, Claudine, Alain Marty et Hélène , pour tous les bons moments que nous avons partagés en France, pour votre amitié aussi. Merci Magali et Gaby pour tous les bons moments que nous avons partagés, pour vos connaissances et votre expérience académique. Merci Letien pour ton amitié et pour ces quelques week-ends passés au labo. Merci Ann pour ton amitié et nos voyages dans le sud de la France et en Thaïlande aussi. Merci Beau et Tuk . Merci Mike pour ton amitié avec moi. Je voudrais également remercier toutes les personnes du laboratoire avec qui j’ai eu l’occasion de partager un café et qui ont permis que mon séjour en France soit très agréable.

Muchas gracias Vero, Cesar, Abril, José y toda la comunidad Mexicana permanente y flotante de Toulouse, que me hizo pasar buenos momentos en Francia y fuera de ella también. Les agradezco su amistad, compañía, paciencia y consejos.

Muchas gracias a mis amigos y compañeros de trabajo en CIATEJ, de alguna forma me apoyaron para estar en Francia, con sus consejos, buenos deseos y buena vibra, gracias Coco, Eugenia, Gina, Ikuri, Kari, Lorena, Abel Ortega, Marisela, Diana, Enrique, Jorge, Juan Carlos, Manuel Rodríguez y Rodolfo.

Gracias a Rogelio Prado y José Luis Flores por ayudarme a soportar la tesis dentro del proyecto FRUCSAGAR de SAGARPA. Gracias a CONACYT por darme el apoyo de la beca para continuar en Francia el segundo año.

Merci à la France pour m’avoir fait découvrir une grande et riche culture, sa grande conscience politique. Merci à la vie et à la nature pour nous donner ces plantes merveilleuses que sont les Agaves , merci aux levures qui sont mon sujet de recherche et de travail.

6

BREVETS

1- Proceso de Producción y Aplicación de las enzimas fructanasas obtenidas de levaduras Kluyveromyces marxianus en la hidrólisis de fructanos ramificados de plantas Agavaceas, gramíneas y/o pastos.

Arrizon J ., Morel S., Monsan P., Gschaedler A., Sandoval G.

Demande de brevet en cours-CIATEJ Mx/a/2011/003876.

PUBLICATIONS

1- Comparison of the Water-Soluble Carbohydrate composition and fructan structures of Agave tequilana plants of different ages .

Arrizon J ., Morel S., Gschaedler A. and Monsan P. Food Chemistry, 2010, 122, 123-130.

2- Purification and substrate specificities of a fructanase from Kluyveromyces marxianus isolated from the fermentation process of Mezcal.

Arrizon J ., Morel S., Gschaedler A. and Monsan P. Bioresource Technology, 2011, 102, 3298-3303.

3- Fructanase and transfructosylating activity of Non- Saccharomyces yeasts isolated from fermenting musts of Mezcal.

Arrizon J ., Morel S., Gschaedler A., Monsan P. Soumis Bioresource Technology.

COMMUNICATION ORALE

1- Screening of fructan hydrolytic capacity and transfructosylating activity of yeasts isolated from different fermenting musts of an Agave beverage (Mezcal). Arrizon J ., Nuñez K., Morel S., Gschaedler A., Prado R., Monsan P.

28th Internacional Specialized Symposium on Yeasts, Bangkok, Thailand (2010).

7

COMMUNICATIONS PAR AFFICHE

1- Yeast fructanase screening for Agave tequilana fructan hydrolysis for prebiotics and fructose syrup elaboration.

Arrizon J ., Morel S., Gschaedler A., Monsan P.

27th International Specialized Symposium on Yeasts, Paris, 26-29 August 2009.

2- Technological potential for prebiotics and fructose syrup elaboration from A. tequilana fructans with an exo-inulinase from Kluyveromyces marxianus.

Arrizon J ., Morel S., Gschaedler A., Monsan P.

4th Symposium on Biocatalysis for the Food and Drink Industries, Toulouse, 11-14 April 2010.

8

Sommaire

9

SOMMAIRE………………………………………………………………………………………9

INTRODUCTION.......………………………………………………………………………….15

CHAPITRE I: ÉTUDE BIBLIOGRAPHIQUE ………………………………………………..19

Partie I: Les fructanes dans le monde végétal…………………………………………..19

A. Structure des fructanes ………………………………………………………….19

A.1. Structure des principaux types de fructanes……………………………….19

A.2. Synthèse et dégradation des fructanes chez les végétaux………………21

A.2.1 Synthèse des fructanes………………………………………………...21

A.2.2 Dégradation des fructanes…….………………………………….........23

A.3. Principales fonctions des fructanes chez les plantes…...………………..23

B. Les fructanes d’agave …………………………………………………………….25

B.1. Description botanique d’Agave tequilana Weber var. azul…..………….25

B.2. Structure moléculaire des fructanes d’Agave tequilana…....……………27

B.3. Synthèse des fructanes d’Agave………...…………………………………28

B.4. Applications des fructanes d’Agave………….……………………….........29

B.4.1. Les fructanes d’agave et l’industrie de la tequila…………….........29

B.4.2. Autres applications……………………………………………….........31

Partie II: Hydrolyse et synthèse enzymatique des fructanes …………………………32

A. Glycoside-hydrolases ……………………………………………………………32

A.1. Principales sources microbiennes de fructanases………………………33

A.2. Mécanisme catalytique………………………………...……………………34

A.3. Applications industrielles……………………………..…………………….35

B. Fructosyltransférases ……………………………………………………………36

B.1. Principales sources microbiennes………………………………………….36

B.2. Mécanisme catalytique……………….………………………………………37

B.3. Applications industrielles…………………………………………………….39

10

Partie III: Procédés d’élaboration des boissons d’ Agave : source de nouvelles fructanases et fructosyltransférases ……....…………………………………………...41

A. Boissons produites au Mexique à partir d’agave ………………………......41

A.1. Boissons non distillées………………………………………………............41

A.2. Boissons distillées…………………………………………………….. …….44

B. Perspectives biotechnologiques …..…………...……...………………………49

References bibliographiques ……………………………………………………...51

CHAPITRE II: CARACTÉRISATION DE LA COMPOSITION DES SUCRES SOLUBLES ET DES STRUCTURES DES FRUCTANES D’Agave tequilana EN FONCTION DE L’ÂGE DE LA PLANTE …………………………………………………….64

A. Summary ………………...…………………...……………………………………65

B. Introduction ……………………………………...………………………………..65

C. Results and discussion …………………………………………………............67

C.1. Morphology, total and free sugars contents of A. tequilana plants at different ages…………………………………………………………………........67

C.2. Profile of water soluble carbohydrates obtained by HPLC, HPAEC-PAD and LC-MS for A. tequilana plants of different ages…………………………..69

C.3. MALDI-TOF-MS analysis of fructans in A. tequilana plants of different age………………………………………………………………………………......72

C.4. Linkages analysis by GC-MS of A. tequilana fructans in plants of different ages……………………………………………………………………....74

D. Conclusion ………………………………………………………………………...77

E. Experimental section ....................................................................................77

E.1. Standard material……………………………………………………………..77

E.2. Plant material……………….……………………...…………………............77

E.3. Total and free sugars quantification…………………...……………….…..78

E.4. High performance liquid chromatography…………………………............78

E.5. Liquid chromatography-mass spectrometry (LC-MS)… ………..………..79

11

E.6. High performance anion exchange chromatography (HPAEC- PAD)..………………………………………………………………………………..79

E.7. MALDI-TOF-MS analysis…………………………………………………….79

E.8. Glycosyl-linkage analysis…………………………………………………….80

F. References ………………….................................................................................81

CHAPITRE III: PURIFICATION ET CARACTÉRISATION D’UNE FRUCTANASE DE Kluyveromyces marxianus SPÉCIFIQUE DES FRUCTANES D’Agave tequilana ET COMPARAISON À UNE ENZYME COMMERCIALE …………………………..….86

A. Summary …...………………………………………………………………………87

B. Introduction ………………………………………………………………………..88

C. Results and discussion …………………………………………………............89

C.1. Enzyme purification and partial molecular characterization of the fructanase…………………………………………………………………………...89

C.2. Biochemical characterization………………………………………………..90

C.2.1. Effect of pH and temperature on enzymatic activity on different substrates……………………………………………………...........................90

C.2.2. Effect of substrate concentration on the enzymatic activity…………93

C.3. Enzymatic hydrolysis profile on different substrates………………………94

C.3.1. Comparison of enzymatic activity between the fructanase and Fructozyme® on different substrates………………………………………….94

C.3.2. Comparison of product hydrolysis between the fructanase and Fructozyme® on different substrates by HPLC and HPAEC-PAD.………..95

C.4. Effect of ions in the hydrolysis of A. tequilana fructans…………………..97

D. Conclusion ………………………………………………………………………….97

E. Experimental section ……………………………………………………………...98

E.1. Yeast strain and chemicals…………………………………………………..98

E.2. Enzyme production..…….…………………………………………................98

E.3. Enzyme purification…………………………………………………………...98

E.4. Activity assays…………………………………………………………………99

12

E.5. Determination of optimal temperature, pH and thermal stability on different substrate……………………………………………………………………………100

E.6. Effect of substrates concentration on fructanase activity….…................100

E.7. Comparison of enzymatic hydrolysis of different substrates by the fructanase and Fructozyme®……………………………………………………..100

E.8. Quantification of hydrolysis products by high performance liquid chromatography…………………………………………………………………... 100

E.9. Hydrolysis profile evolution determined by high performance anionic exchange chromatography with pulsed amperometric detection (HPAEC-PAD)……………………………………………………….………………………..101

E.10. Effect of ions on A. tequilana fructans hydrolysis..……………………...101

F. References ..........................................................................................................101

CHAPITRE IV : CRIBLAGE DE L’ACTIVITÉ ENZYMATIQUE FRUCTANASE ET TRANSFRUCTOSYLASE DE LEVURES NON- Saccharomyces ISOLÉES DES DIFFÉRENTES FERMENTATIONS DU MEZCAL ……………………………………….106

A. Summary ………………………………………………………………………….107

B. Introduction ………………………………………………………………………108

C. Results and discussion ………………………………………………………...109

C.1. Screening of growth on solid medium with ATF, inulin and levan as carbonsources…………..………………………………………………………...109

C.2. Screening of fructanase activity induced in liquid medium with inulin and ATF…………………………………………………………………………………112

C.3. Characterization of fructanase production in selected yeast strains…..115

C.4. Screening of transfructosylase activityat different sucrose concentrations……………………………………………………………………..116

C.5. Transfructosylation reaction improvement in selected yeast strains………………………………………………………………………………118

D. Conclusion ………………………………………………………………………...121

E. Experimental section …………………………………………………………….121

E.1. Yeast strain and chemicals…………………………………………………121

E.2. Solid medium…....…………………………………………………………...122

13

E.3. Evaluation of growth on solid media………………………………………122

E.4. Preparation of an aqueous induction medium for fructanase activity………………………………………………………………………………122

E.5. Preparation of enzymatic extracts…………………………………………122

E.6. Evaluation of fructanase activity…………………………………………...122

E.7. Characterization of fructanase production for ATF degradation with selected yeasts……………………………………………………………………123

E.8. Fructosyltransferase activity screening…………………….....................123

E.9. Experimental design for improving the transfructosylation yield…………………………………………………........………………………..123

F. References ....................................................................................................124

CONCLUSION ET PERSPECTIVES………………………..……………………………..130

ANNEXE……………………………………………………………………………………….134

TABLE DES ILLUSTRATIONS ……………………………………………………………..142

ABRÉVIATIONS …………………… ..……..………………………………………………145

14

INTRODUCTION

Introduction

15

L’industrie de la Tequila est traditionnellement importante au Mexique. Elle constitue une activité industrielle importante pour l’économie de l’ouest du pays. Durant ces quinze dernières années, cette industrie a connu une croissance exceptionnelle, qui a été possible grâce à une augmentation de la capacité de production. Par conséquent, l’amélioration des procédés d’élaboration de la tequila est nécessaire pour optimiser les systèmes de production. Ceci justifie le développement des nouvelles technologies appliquées au procédé de production de la tequila.

La méthode traditionnelle d’élaboration de la tequila est constituée des étapes suivantes: (i) culture et récolte des agaves, (ii) cuisson des agaves, (iii) extraction des sucres fermentescibles, (iv) fermentation et (v) distillation, chacune de ces étapes représentant une ou des opportunités d’amélioration.

Durant le développement des plantes d’Agave tequilana Weber var. azul qui dure entre 6 et 10 ans, les plantes accumulent des sucres, principalement des polymères de fructose (fructanes), constituant la principale source de sucres fermentescibles pour la production de la tequila. Ces polymères de fructose ont une structure complexe avec des chaînes de fructose de tailles variables, comprenant des liaisons O-glycosidiques en β (2→1) et en β (2→6).

Au cours de la deuxième étape de cuisson des agaves, les fructanes sont hydrolysés lors de la cuisson. Cette étape est réalisée traditionnelement dans des fours ou des autoclaves. Avec ce type de procédé de cuisson l’hydrolyse n’est pas toujours complète et certaines entreprises utilisent une hydrolyse acide additionnelle pour augmenter la récupération des sucres (en particulier des miels de cuisson) et améliorer les rendements de production.

Ces dernières années l’industrie de la tequila a incorporé de nouvelles méthodes d’extraction des sucres avec l’utilisation de diffuseurs qui réalisent l’extraction et une hydrolyse partielle des fructanes (inférieure à 10%) par lixiviation par de l’eau chauffée à 80°C et injectée à contre-courant de l’agave crue r éduite en cossettes.

Ces procédés d’hydrolyse traditionnelle et moderne qui impliquent des procédés de chauffage demandent de grande quantité d’énergie. Une option pour diminuer la consommation d’énergie serait l’utilisation d’enzymes qui hydrolysent les fructanes à des températures plus faibles et dans des conditions beaucoup plus sûres. Muñoz-Gutierrez et al (2009) ont caractérisé différentes β-fructosidases pour l’hydrolyse de fructanes microbiens et végétaux, comme l’inuline de chicorée et les fructanes d’Agave tequilana. Ávila-Fernández et al (2009) ont montré que des enzymes commerciales

Introduction

16

comme le Fructozyme® ont une affinité moindre pour les fructanes d’agave que pour l’inuline.

Malgré cette spécificité diminuée du Fructozyme® pour les fructanes d’Agave tequilana, Waleckx et al (2011) ont montré que l’utilisation de Fructozyme® augmente le rendement de récupération des sucres obtenus dans les miels de cuisson. Ce travail de recherche a été réalisé à la demande d’une entreprise de production de tequila pour augmenter la récupération des sucres fermentescibles, en évitant l’addition d’acides avec une diminution de la consommation d’énergie.

Dérivées des résultats de ce travail, de nouvelles opportunités de recherche ont été détectées, en particulier avoir une meilleure connaissance des processus d’hydrolyse des fructanes d’Agave tequilana.

Tout d’abord, du fait de la complexité de la composition des fructanes d’Agave tequilana il est important de connaître les changements de structure de ces molécules pendant le développement de la plante. De la même façon, il est important de trouver de nouvelles enzymes plus spécifiques de ce type de molécules et de les comparer avec des enzymes commerciales pour déterminer leur potentiel d’application dans l’industrie de la tequila. Ces enzymes peuvent être utiles non seulement pour optimiser le procédé d’élaboration de la tequila, mais également pour développer de nouveaux procédés comme la production de fructanes à courtes chaînes (prébiotiques) par l’hydrolyse partielle des fructanes d’Agave tequilana.

Normalement, les enzymes qui présentent la capacité d’hydrolyser les fructanes peuvent également réaliser la réaction inverse, c'est-à-dire la synthèse de fructanes à courtes chaînes par réaction dans un milieu présentant une haute concentration de saccharose. Dans ce cas, il est intéressant d’étudier la capacité de transfructosylation de ces enzymes.

Dans ce contexte, le développement de ce travail de thèse comprend quatre grands chapitres. Le premier correspond à une étude bibliographique pour introduire le lecteur aux principaux concepts nécessaires pour connaître la relation entre les fructanes d’Agave tequilana et les enzymes impliquées dans leur hydrolyse. Cette première partie souligne l’importance générale des fructanes dans les plantes, les particularités de la structure des fructanes d’Agave tequilana, la relation entre les fructanes d’Agave tequilana et l’industrie de la tequila. Dans la deuxième partie du chapitre I, les principales enzymes impliquées dans l’hydrolyse et la synthèse des fructanes sont décrites, ainsi que leurs principales sources microbiennes et les quelques procédés industriels qui impliquent l’utilisation de ce type d’enzymes. La troisième partie du

Introduction

17

chapitre I présente une description des autres procédés d’élaboration des boissons d’agave (distillées ou non), en particulier l’étape de fermentation qui est une source potentielle de nouvelles fructanases.

Le deuxième chapitre de la thèse est consacré à la caractérisation des changements de composition et de structure des fructanes pendant le développement des plantes d’Agave tequilana pour connaître la variabilité des fructanes en fonction de l’âge de récolte des plantes.

Le troisième chapitre de la thèse décrit la purification et la caractérisation biochimique d’une enzyme produite par une souche de Kluyveromyces marxianus isolée d’un procédé de fermentation de mezcal (boisson d’agave distillée), et sa comparaison avec un cocktail enzymatique commercial (Fructozyme®).

Le dernier chapitre de la thèse est consacré à un criblage de l’activité enzymatique fructanase et transfructosylase de levures isolées de différents moûts durant la fermentation du Mezcal de Oaxaca, pour tenter de trouver de nouvelles sources microbiennes de fructanases.

18

Chapitre I: Étude Bibliographique.

Chapitre I: Étude Bibliographique

19

Chapitre I: Etude bibliographique

Partie I : Les fructanes dans le monde végétal

Les fructanes sont des polymères de fructose construits autour d’une molécule de saccharose. Environ 15% des plantes supérieures en contiennent, où ils jouent différents rôles en fonction de la plante considérée. Parmi les plantes contenant des fructanes, on peut citer le blé (Triticum sp), l’orge (Hordeum vulgare), l’avoine (Avena sativa), le ray-grass (Lolium sp), la chicorée (Cichorium intybus), l’oignon (Allium cepa), le dahlia (Dahlia variabilis), la tulipe (Tulipa gesneriana).

A. Structure des fructanes

A.1 Structure des principaux types de fructanes

Les quatre principaux types de fructanes sont présentés dans la Figure 1.

• Les fructanes de type inuline (Fig. 1a) se caractérisent principalement par leur forme linéaire, ils contiennent des résidus fructosyles liés par des liaisons O-glycosidiques en β (2→1) avec une molécule de saccharose qui se trouve en position terminale. Les inulines sont présentes principalement chez les dicotylédones et plus particulièrement dans la famille des Asteraceae (Van Laere et Van den Ende 2002; Ritsema et Smeekens 2003).

• Les fructanes de type lévane (Fig. 1b) contiennent des résidus fructosyles liés par des liaisons O-glycosidiques en β (2→6) et se présentent toujours sous forme linéaire. Comme dans le cas des inulines, les lévanes présentent une molécule de glucose en bout de chaîne (saccharose). Ils sont surtout présents dans les plantes de type herbacées de la famille des Poacées, comme par exemple Dactylis glomerata (Bonnett et al 1997; Ritsema et Smeekens 2003).

• Les fructanes de type néoséries diffèrent des deux premiers types par le fait que le résidu glucosyle est en position interne et les résidus fructosyles sont liés au carbone 1 et au carbone 6 du résidu glucosyle. Les inulines de type néoséries (Fig. 1c) possèdent des liaisons en β (2→1) entre les résidus fructosyles. Les lévanes néoséries (Fig. 1d) possèdent des liaisons en β (2→6) entre les résidus fructosyles. L’avoine contient ces deux types de molécules, les levanes néoséries étant les plus abondantes (Livingston et al 1993). Les inulines néoséries sont présentes dans des plantes de la famille des Liliaceae, comme l’asperge ou l’oignon (Shiomi 1989), ou encore dans la famille des graminées (actuellement connues sous le nom de Poacées) (Ritsema et Smeekens 2003).


20

• Le dernier groupe, celui des fructanes mixtes ou fructanes branchés (Fig. 1e), présentent des structures beaucoup plus complexes. Dans ce cas, les deux types de liaisons peuvent être présents dans une même molécule. Ils peuvent présenter ou non le glucose interne typique des néoséries. Les fructanes d’agaves appartiennent à ce dernier groupe (Lopez et al 2003).

Qu’ils soient linéaires ou ramifiés, les fructanes végétaux ont des tailles variables comprises entre 3 et 60 résidus. Ces tailles sont exprimées en degré de polymérisation (DP). Il s’agit du nombre d’unités glycosyles composant le polymère.

CH2

OHO

HOOH

CH2OH

O CH2OH

CH2

O

O CH2OH

CH2 O

O CH2OH

CH2OH O

n

1

2

6

2

OHO

HOOH

CH2OH

O

CH2OHO

1

6

2

O CH2OH

CH2OHO6

2

n

(a)(b)

HO

OH HO HO

OHOH

OH

OH

HO

HO

o

OHO

HOOH

O

CH2

CH2

CH2

O1

6

2

O CH2

CH2OHO

6

2

HO HO

OHOH

O

OHO

OHCH2OH

H2C

O

HO

OHCH2OH

HOH2C

O

O CH2OH

CH2 O

O CH2OH

CH2OH O

m

2 OH

OH

HO

HO

O CH2OH

CH2OHO

2

n

HO

OH

(e)

o

OHO

HOOH

O

CH2

CH2OH

CH2

O1

6

2

6HO

OH

O

OHO

OHCH2OH

H2C

O

HO

OHCH2OH

HOH2C

O

O CH2OH

CH2 O

O CH2OH

CH2OH O

m

2 OH

OH

HO

HO

(c)

CH2

OHO

HOOH

CH2

O

CH2OHO

1

6

2

O CH2OH

CH2OHO6

2

n

(d)

HO HO

OHOH

CH2O

CH2OHO

2

O CH2OH

CH2OHO6

2

nHO HO

OHOH

Figure 1: Structure des principaux types de fructanes : inuline (a), levane (b), inuline néosérie (c), lévane néosérie (d), fructane branché (e).


21

A.2 Synthèse et dégradation des fructanes chez les végétaux

A.2.1 Synthèse des fructanes

Les fructanes végétaux sont synthétisés à partir de saccharose grâce à des enzymes qui appartiennent à la famille des fructosyltransférases (FTs). Ces enzymes sont des glycoprotéines solubles appartenant à la famille 32 des glycosides hydrolases (GH 32).

La Figure 2 représente les deux premières réactions de la synthèse d’une molécule d’inuline. La première réaction permet la synthèse du 1-kestose comme précurseur de la polymérisation. La molécule de 1-kestose est synthétisée par l’enzyme saccharose:saccharose 1-fructosyltransferase (1-SST, EC 2.4.1.99) par une réaction de transfructosylation entre deux molécules de saccharose (Figure 2a), une molécule fonctionne comme donneur de fructose et l’autre comme accepteur (Ritsema et Smeekens 2003). Ensuite pour l’élongation de la chaîne, l’enzyme fructane:fructane 1-fructosyltransférase (1-FFT, EC 2.4.1.100) utilise du 1-kestose ou du fructane ayant un degré de polymérisation supérieur comme donneur de fructose et du fructane ou du saccharose comme accepteur de fructose (Figure 2b).

Pour la synthèse des lévanes linéaires présentant des liaisons β (2→6), l’enzyme saccharose:fructane 6-fructosyltransferase (6-SFT, E.C. 2.4.1.10) permet la synthèse de 6-kestose à partir de saccharose (Figure 2c) (Sprenger et al 1995; Wei et al 2002). Ensuite, comme dans le cas précédent une enzyme du type fructane:fructane fructosyltransférase continue l’élongation des fructanes du type lévane, Ritsema et Smeekens (2003) ont proposé la présence d’une enzyme de type 6-FFT (fructane:fructane 6-fructosyltransférase), mais cette dernière n’a pas pu être isolée.


22

1-FFT

FG

(F)m

FG

(F)n

fructane m 1donneur

fructane ou saccharose n 0

accepteur

+ FG

(F)m -1

FG

(F)n+1

fructane ou saccharose

fructane

+

FG FG+ G FG

F

1-kestotriose

+

saccharose donneur

saccharose accepteur

1-SST(a)

(b)

(c) FG FG+ G

glucose fructane

+

saccharose donneur

saccharose accepteur

6-SFT(F)n

FG (F)n+1

6G-FFT

FG

F

FG

(F)n

fructane m 1donneur

fructane ou saccharose n 0

accepteur

+ FG FG

(F)n

fructane de type néosérie

+(d)

F

Figure 2: Synthèse des fructanes catalysées par les fructosyltransférases (a) la saccharose:saccharose 1-fructosyltransférase (1-SST) (EC 2.4 .1.99) (b) la fructane:fructane 1-fructosyltransférase (1-FFT) (EC 2.4 .1.100) (c) la saccharose:fructane 6-fructosyltransférase (6-SST) (EC 2.4 .1.10) (d) la fructane:fructane 6G-fructosyltransférase (6G-FTT) (EC 2.4 .1.243), Lothier et al (2006).

L’élongation des fructanes du type inuline neo-série est réalisée par l’enzyme fructane:fructane 6G-fructosyltransférase (6G-FFT, EC 2.4.1.243). Cette enzyme utilise le 1-kestose comme donneur de fructose et transfère le fructose sur le résidu glucose d’une molécule de saccharose (Figure 2d). La molécule de fructose est liée au glucose par une liaison β (2→6) et donne finalement une molécule de neokestose (Ritsema et Smeekens 2003). Ce trisaccharide est le point de départ des inulines neo-séries car des unités fructoses sont successivement ajoutées aux deux extrémités de ce trisaccharide, et l’on obtient finalement une molécule de fructane linéaire comportant une molécule de glucose interne.

≥ ≥

≥

fructane ou saccharose

n≥0 accepteur

1-kestotriose donneur


23

La synthèse des molécules plus complexes comme les fructanes branchés (Figure 3) est vraisemblablement obtenue par l’action combinée des enzymes 1-SST, 1-FFT, 6-SFT et 6G-FFT (Ritsema et Smeekens 2003).

A.2.2 Dégradation des fructanes

La dégradation des fructanes est réalisée par des enzymes de type fructane exohydrolases (FEHs, EC 3.2.1.80) (Ritsema et Smeekens 2003). Les fructanes exohydrolases sont des glycoprotéines solubles appartenant à la famille 32 des glycosides hydrolases (GH 32).

Cette réaction d’hydrolyse est réalisée à partir de l’extrémité de la chaîne et génère des monomères de fructose (Ritsema et Smeekens 2003). Une FEH avec une spécificité pour les liaisons β (2→1) entre les résidus de fructose a été décrite chez la chicorée et le blé (Van den Ende et al 2000, Van den Ende et al 2003), une autre avec une spécificité pour les liaisons β (2→6) entre les résidus de fructose a été isolée chez l’avoine (Henson et Livingston 1996). Pour la dégradation des fructanes plus complexes, l’action simultanée des deux types de FEH est nécessaire (Ritsema et Smeekens 2003).

A.3. Principales fonctions des fructanes chez les plantes

Les fructanes sont utilisés, d’une part, comme réserve d’énergie et, d’autre part, ils confèrent aux plantes qui les contiennent une protection contre certains stress environnementaux.

Comme source d’énergie les fructanes sont stockés dans des organes spécialisés comme la base des feuilles succulentes, les tubercules, ou encore les bulbes. Par exemple en Australie, un certain type de plantes (herbacées) accumulent des fructanes durant l’année pour permettre une repousse rapide des bourgeons après le passage d’incendies naturels (Tolsma et al 2007). Chez d’autres plantes, il existe une relation entre la photosynthèse pour produire les sucres comme source d’énergie et l’accumulation des fructanes. Par exemple pour la plante de yacon (Smallantus sonchifolius), la coupe des feuilles arrête la photosynthèse et active l’enzyme 1-FEH qui hydrolyse les fructanes pour obtenir des sucres comme source d’énergie (Fukai et al 1995), et après la récolte et le stockage des racines de yacon, une diminution de la taille des fructooligosaccharides est observée par l’action principalement de l’enzyme 1-FEH (Narai-Kanayama et al 2007). De même chez l’artichaut (Helianthus tuberosus L.), une période de stockage prolongée induit une diminution de la taille des fructanes (Saengthongpinit et Sajjaanantakul 2005). L’accumulation des fructanes comme source d’énergie est également liée au processus de floraison avec une modification de la


24

taille des fructanes comme il a été observé chez l’oignon (Allium cepa), chez la chicorée (Cichorium intybus L.) et Galanthus nivalis (Shiomi et al 2006; Wilson et al 2004, Orthen and Wehrmeyer 2004).

En ce qui concerne l’implication des fructanes comme agents protecteurs de certains stress environnementaux, ils sont impliqués dans les phénomènes de résistance au froid (Suzuki et Nass 1988; Livingston et al 1992; Van de Ende et Van Laere 2002; Van den Ende et al 2000; Van den Ende et al 2001; Wilson et al 2006; Livingston et al 2006), à la sécheresse (Pollock 1984; Spollen et Nelson 1994; Monti et al 2005a; Monti et al 2005b; Dias-Tagliacozzo et al 2004), à une diminution de la source d’azote (De Roover et al 2000; Ameziane et al 1997; Wan-Chun et al 2006; Van den Ende et al 2003; Wang et al 2000) ou encore à une forte salinité (Martínez-Noël et al 2006; Morcuende et al 2004; Morcuende et al 2005). Des expériences menées in vitro ont montré qu’il y avait une relation entre la capacité de synthèse des fructanes et la stabilité des couches lipidiques. Les fructanes du type lévane et inuline présentent une intéraction avec les phospholipides, et il a été mis en évidence que les fructanes protègent les lipides de la phase de transition durant la diminution de la température ou durant une phase de sècheresse (Demel et al 1998; Vereyken et al 2001; Hincha et al 2002).


25

B. Les fructanes d’agave

B.1. Description botanique d’Agave tequilana Weber var. azul

Le terme Agave est d’origine grecque « agavos » et signifie « admirable ». Linneo a décrit pour la première fois la famille Agavacea en 1753, Agave americana étant la première espèce caractérisée (Gentry 1982). Le genre Agave contient environ 200 espèces dont 75 % poussent au Mexique, qui est considéré comme le centre d’origine évolutive de la plante (Eguiarte et al 2000; García-Mendoza 2002). Les agaves en général sont des plantes herbacées, succulentes, dont les feuilles fibreuses sont organisées en spirale autour d’une pousse centrale (formation d’une rosette) et présentent généralement des épines sur le bord des feuilles (Figure 3).

Figure 3 : Plante d’Agave tequilana Weber var. azul.

Dans le cas d’Agave tequilana weber var. azul, sa reproduction est de deux types : sexuelle et asexuelle. La première avec la formation d’une inflorescence lorsque la plante atteint entre 8 -12 ans, et la deuxième par la production de rejets à la base de la plante mère (bourgeons du rhizome). Ces plantes sont séparées des plantes mères et replantées individuellement (Figure 4) (Rodriguez-Garay et al 2004).


26

Figure 4 : Plante mère d’Agave tequilana Weber var. azul et bourgeon du rhizome (a), plantation d’Agave tequilana (b).

De manière naturelle les plantes d’Agave se développent dans les régions arides et semi-arides du Mexique. Certaines espèces sont cultivées. Agave tequilana Weber var. azul est l’espèce qui présente les plus grandes surfaces de culture localisées dans une zone de dénomination d’origine, principalement dans l’état de Jalisco (Rodriguez-Garay et al 2004). Physiologiquement, les plantes d’Agave tequilana présente un métabolisme de type acide-crassulacée (CAM), lequel se caractérise par une diminution de la transpiration par l’ouverture des stomates pendant la nuit quand la température est plus basse, ce qui entraîne une diminution de l’évaporation (Santamaria et al 1995; Nobel et Linton 1997). Les principaux produits de la photosynthèse sont les fructanes (Sanchez-Marroquin et Hope 1953; Alvarez de la Cuadra 1996). Ces molécules sont principalement accumulées dans le cœur de la plante (Wang et Nobel 1998), la taille du cœur de la plante change en fonction de l’âge (Figure 5).


27

Figure 5 : Cœurs des plantes d’Agave tequilana Weber var. azul à différents âges.

B.2. Structure moléculaire des fructanes d’Agave tequilana

La première caractérisation de fructanes d’agave a été réalisée par Lopez et al (2003). La source des fructanes d’agave utilisée pour cette caractérisation correspond à des fructanes extraits du cœur d’une plante de 8 ans. L’analyse des alditols partiellement méthylés par chromatographie en phase gazeuse a montré que les fructanes d’agave sont des polyméres de fructose liées par des liaisons β (2→1) et β (2→6) présentant des départs de ramifications ainsi qu’une molécule de glucose à l’intérieur des chaînes de fructoses. Les spectres RMN 1H et 13C et l’analyse réalisée par MALDI-TOF-MS montrent une distribution des fructanes avec un degré de polymérisation (DP) compris entre 3 et 29. La figure 6 présente la structure schématique des fructanes d’agave proposée par Lopez et al (2003).

o

OHO

HOOH

O

CH2

CH2

CH2

O1

6

2

O CH2

CH2OHO

6

2

HO HO

OHOH

O

OHO

OHCH2OH

H2C

O

HO

OHCH2OH

HOH2C

O

O CH2OH

CH2 O

O CH2OH

CH2OH O

m

2 OH

OH

HO

HO

O CH2OH

CH2OHO

2

n

HO

OH

Figure 6: Structure générale des fructanes d’agave (Lopez et al, 2003).


28

B.3 Synthèse des fructanes d’Agave.

Le premier travail sur la caractérisation de la synthèse des fructanes chez la plante Agave tequilana a été réalisé par Saldaña-Oyarzábal et al (2009), avec une caractérisation de l’activité des enzymes dans des plantes d’Agave tequilana et la détermination des principaux produits des réactions enzymatiques par TLC, MALDI-TOF et HPAEC-PAD. Ces auteurs proposent que la synthèse des fructanes débute dans les feuilles de la plante avec une intéraction complexe entre les fructosyltransférases 1-SST, 1FFT et 6G-FFT à partir de saccharose. Les premiers produits de la polymérisation correspondent à des molécules linéaires de DP 3 et 4 de type inuline et neosérie, principalement 1-kestose et neokestose. L’activité de l’enzyme 6-SFT, qui est responsable de la synthèse de 6-kestose et de bifurcose n’a pas été détectée chez l’agave. Les auteurs proposent qu’une autre enzyme du type 6-FFT soit responsable de l’élongation β(2→6) des chaînes de fructane. Cette enzyme n’a pas encore été mise en évidence. La figure 7 présente la voie de synthèse des fructanes d’agave proposée par Saldaña-Oyarzábal et al (2009).

Figure 7: Voies de biosynthèse des fructanes d’agave proposées par Saldaña-Oyarzábal et al (2009): saccharose:saccharose 1-fructosyltransferase (1-SST, EC 2.4.1.99), fructane:fructane 1-fructosyltransférase (1-FFT, EC 2.4.1.100), 6-FFT (fructane:fructane 6-fructosyltransférase), saccharose:fructane 6-fructosyltransférase (6-SFT, E.C. 2.4.1.10), fructane:fructane 6G-fructosyltransférase (6G-FFT, EC 2.4.1.243). Glucose (G), Fructose (F), inuline (I), Neosérie (N).


29

B.4. Applications des fructanes d’agave

B 4.1 Les fructanes d’agave et l’industrie de la Tequila

La figure 8 montre le procédé de production de la tequila. Pendant les quinze dernières années, l’industrie de la Tequila a connu une croissance exceptionnelle. La production de Tequila a plus que doublé entre 1995 et 2005, atteignant une production de l’ordre de 209,7 millions de litres en 2005. La Chambre nationale de l'industrie de la Tequila estime qu'en 2006, 12000 agriculteurs, 11200 journaliers, et 3400 agents de terrain ont été associés à la production de l'agave (CNIT 2006).

Durant le développement des plantes d’Agave tequilana, il y a une accumulation de sucres principalement des polymères de fructose, constituant la principale source de sucres fermentescibles pour la production de la Tequila (Ávila-Fernández et al 2009). Une étape importante pour l’élaboration de la Tequila est l’hydrolyse des fructanes.

Figure 8: Schéma général du procédé de fabrication de la tequila.

Traditionnellement les fructanes sont hydrolysés lors de la cuisson des agaves, laquelle se réalise actuellement dans des fours ou des autoclaves (Cedeño et al 1995). Ce procédé génère des composés dérivés des réactions de Maillard qui sont importants pour les caractéristiques sensorielles de la tequila (Mancilla-Margalli et Lopez 2002). En général, avec ce type de procédé de cuisson l’hydrolyse n’est pas complète et certaines


30

industries utilisent une hydrolyse acide additionnelle pour augmenter la récupération des sucres et améliorer les rendements de production (Waleckx et al 2008).

Ces dernières années l’industrie de la tequila a incorporé l’utilisation de diffuseurs qui réalisent l’extraction des sucres par lixiviation avec l’eau chauffée a 80°C et injectée à contrecourant (Casas 2006).

Ces procédés d’hydrolyse traditionnelle et moderne qui impliquent une étape de chauffage demandent de grande quantité d’énergie. Une option pour diminuer la consommation d’énergie serait l’utilisation d’enzymes qui hydrolysent les fructanes à des températures plus faibles et dans des conditions beaucoup plus sûres. Par exemple, Muñoz-Gutierrez et al (2009) ont caractérisé différentes β-fructosidases pour l’hydrolyse de fructanes d’origine microbienne et végétale comme l’inuline de chicorée et les fructanes d’Agave tequilana. Ils ont montré que des enzymes commerciales comme le Fructozyme® ont une affinité moindre pour les fructanes d’agave que pour l’inuline (Muñoz-Gutierrez et al 2009).

Malgré cette spécificité diminuée du Fructozyme® pour les fructanes d’Agave tequilana, cette enzyme a été utilisée en combinaison avec le diffuseur aux niveaux laboratoire et industriel. Dans les conditions du laboratoire, l’extraction combinée avec l’hydrolyse des fructanes à l’aide de Fructozyme, à 60°C présente 9 9.5% d’efficacité d’extraction. Par contre au niveau industriel les résultats obtenus ne sont pas concluants : l’hydrolyse réalisée en combinaison avec l’extraction au niveau du diffuseur ne fonctionne pas, l’enzyme étant vraisemblablement inactivée par la température (Ávila-Fernández et al 2009).

Waleckx et al (2011) ont montré que l’utilisation de Fructozyme® augmente le rendement de récupération des sucres obtenus dans les miels de cuisson.

Pour l’hydrolyse enzymatique des fructanes d’Agave tequilana il est également possible d’utiliser des sources d’enzymes microbiennes comme les fructanases produites par les levures Kluyveromyces marxianus. García-Aguirre et al (2009) rapporte l’hydrolyse de fructanes d’Agave tequilana pour l’élaboration de sirop de fructose avec un extrait enzymatique de Kluyveromyces marxianus.


31

B.4.2 Autres applications

Les fructanes d’Agave tequilana, en plus d’être la principale matière première pour l’industrie de la tequila, sont également une source potentielle pour l’obtention de produits différents comme des prébiotiques et de nouveaux composés dérivés de réactions d’estérification. Lopez et Urías-Silvas (2007) ont montré un effet prébiotique des fructanes obtenus à partir de différentes espèces d’Agave sur des bactéries des espèces Lactobacillus casei et Bifidobacterium breve. De la même façon, Gomez et al (2010) ont démontré une augmentation de la production d’acides organiques et de la population cellulaire des bactéries bifidobacteria et lactobacilli évaluées in vitro avec les fructanes d’Agave tequilana. Cette activité prébiotique est comparable à d’autres sources commerciales de prébiotiques obtenus à partir d’inuline de chicorée. Urías-Silvas et al (2008) ont montré que des rats alimentés avec un régime contenant des fructanes d’Agave tequilana présentent une diminution de leur poids corporel. Une expérience combinant fructanes d’Agave tequilana et Raftilose P95 augmente la production du peptide-1 type glucagon (GLP-1), lequel est responsable de la régulation de l’appétit.

Ces différents travaux démontrent qu’il existe d’intéressantes perspectives industrielles pour les fructanes d’agave en tant que prébiotiques.

Une autre étude récente (Minjarez-Ibañez et al 2010) démontre que les fructanes d’agave sont capables d’activer l’expression de la β-défensine-2, considérée comme une molécule importante dans la régulation du système immunitaire.

Une autre alternative possible est l’utilisation de fructanes modifiés par acétylation pour obtenir des transporteurs de composés pharmaceutiques qui soient délivrés directement dans le colon avec un effet prébiotique additionnel (Starbird et al 2007).

Le nombre de travaux réalisés sur les fructanes d’agave est encore relativement limité, mais leur structure particulière avec la présence de branchements présente d’intéressantes propriétés qu’il convient d’étudier en détail. Ces nouvelles applications ouvrent des perspectives intéressantes pour les producteurs d’agave de la région qui étaient jusqu’alors totalement dépendants de l’industrie de la tequila seule utilisateur des agaves produites.


32

Partie II : Hydrolyse et synthèse enzymatique de fructanes

A. Glycoside hydrolases.

Les glycoside hydrolases (EC 3.2.1.x) sont des enzymes qui catalysent l’hydrolyse des liaisons O- et S- glycosidiques des glycosides, produisant un sucre hemiacetal ou hemicetal avec son aglycone correspondant comme le montre la figure 9.

O

OR+ H2O

O

OH

+ ROH

Glycoside-hydrolase

Figure 9: Réaction générale des enzymes de type glycoside hydrolase.

En fonction du site d’hydrolyse, les glycoside hydrolases sont classifiées dans le groupe des exo ou des endo-hydrolases (Figure 10).

OO

OO

OO

O

Endo-hydrolase

Exo-hydrolase

OOR

O

Figure 10: Sites de coupure des exo et endo-hydrolases.

Les exo et endo-inulinases (E.C. 3.2.1.80 et E.C. 3.2.1.7 respectivement) et les exo et endo-levanases (E.C.3.2.1.64 et E.C. 3.2.1.65 respectivement) appartiennent à la famile des glycoside hydrolases. Elles sont responsables de l’hydrolyse des fructanes et sont également nommées fructanases.

Selon la classification CAZy qui est basée sur des homologies structurales et mécanistiques, les fructanases appartiennent à la famille GH 32 des Glycosides hydrolases. (http://cazy.org/Home.html).

Les fructanases industrielles proviennent principalement de microorganismes et sont décrites dans la section suivante.


33

A.1. Principales sources microbienne de fructanases.

Un grand nombre de microorganismes produisant des fructanases ont été décrit. Chez les champignons on peut citer : Chrysosporium pannorum, Fusarium oxysporum, Panaeolus papillonaceus, Scytalidium acidophilum et différentes types d’Aspergillus comme A. niger, A. ficuum, A. oryzae, A. versicolor, A. awamori, A. fumigatus et Alternaria alternata (Fr.) Keissler, Penicillium sp TN-88, et Penicillium purpurogenum.

Chez les levures: Kluyveromyces marxianus var. bulgaricus, Kluyveromyces sp Y-85. Kluyveromyces cicerisporus, Kluyveromyces fragilis, Cryptococcus aureus G7a, Pichia guilliermondii, Streptomyces sp GNDU 1.

Et finalement chez les bactéries : Xanthomonas oryzae, Geobacillus stearothermophilus, Bacillus stearothermophilus, Thermotoga maritima, Arthrobacter sp S37, Clostridium acetobutylicum, Bifidobacterium longum, Bacillus licheniformis, Bacillus polyxyma MGL21, Bacillus subtilis, Bacillus sp. Snu7, Pseudomonas mucidolens (Singh et Gill 2006; Chi et al 2009).

En ce qui concerne les caractéristiques générales de ces enzymes produites par des microorganismes, on peut mentionner que le gène qui les code présente une taille avoisinant les 1500 pb, que les minéraux affectent leur activité et dans la majorité des cas la température optimale oscille entre 50° et 60 °C (Singh et Gill 2006; Chi et al 2009). Il y a quelques enzymes thermostables comme l’enzyme de Thermotoga maritima (90 °C).

La grande majorité des enzymes produites au niveau industriel sont des exo-hydrolases. Elles sont obtenues à partir de champignons (Aspergillus) ou de levures (Kluyveromyces) en utilisant l’inuline comme inducteur de production. La majorité des enzymes de type endo-hydrolases sont produites par les champignons et quelques bactéries (Singh et Gill 2006; Chi et al 2009).


34

A. 2. Mécanisme catalytique.

Le mécanisme moléculaire de la réaction d’hydrolyse des glycoside hydrolases est décrit dans la figure 11 avec l’exemple de l’exo-inulinase d’Aspergillus awamari (Nagem et al 2004) .

Au cours d’une première étape, le nucléophile attaque le carbone C2 du résidu fructosyl terminal. Un intermédiaire covalent de type fructosyl-enzyme est formé et une molécule d’aglycone est libérée dans le milieu.

Lors de la seconde étape, le résidu acide/base déprotoné joue le rôle de base pour activer une molécule d’eau venant attaquer l’intermédiaire fructosyl enzyme. La liaison fructosyl-enzyme intermédiaire se rompt et libère la molécule de fructose.

O O

H

Proton donor Glu 241

CH2OH

ORHOH2C

HO

OHO

O-O

Nucléophile Asp 41

O O-


CH2OHHOH2C

HO

OHO

OO

Nucléophile Asp 41

+ R-OH

O O-


CH2OHHOH2C

HO

OHO

OO

Nucléophile Asp 41

H

O H

O OH


OHHOH2C

HO

OHO

O

CH2OH

Nucléophile Asp 41

-O

Figure 11 : Schéma du mécanisme catalytique de l’exo-inulinase d’Aspergillus awamori (Nagem et al

2004).


35

L’exo-inulinase d’Aspergillus awamori a été cristallisée et la reconnaissance du substrat caractérisée. Deux acides aminés, l’acide aspartique 41 et l’acide glutamique 214 du site actif de la protéine fonctionnent comme le nucléophile et le catalyseur acide/base respectivement (Nagem et al 2004). Pour la majorité des glycoside-hydrolases, les acides aminés glutamique et aspartique sont communément trouvées au niveau du site actif.

A.3. Applications industrielles

L’hydrolyse des polysaccharides par les glycoside-hydrolases à d’importantes applications. Par exemple, il est possible d’obtenir un sirop de fructose à partir d’amidon par l’action combinée d’une α-amylase, d’une amyloglucosidase et d’une glucose-isomérase (Gong et al 2007).

Dans le cas des fructanases, il y a deux applications industrielles importantes, l’hydrolyse des fructanes pour la production de sirops de fructose et l’hydrolyse des fructanes pour l’obtention de fructooligosaccharides à courtes chaînes (FOS) ayant une fonction prébiotique.

Un rendement supérieur à 84 % dans un système batch a été obtenu pour la production d’un sirop riche en fructose avec une exo-inulinase de K. marxianus à partir d’inuline de chicorée pure et d’inulinase d’A. racemosus (Singh et al 2007). D’autres enzymes, de K. marxianus, ont été immobilisées pour réaliser une hydrolyse continue d’inuline avec un rendement d’hydrolyse supérieur à 85 % (Barranco-Florido et al 2001). D’autres systèmes d’inulinases immobilisés (inulinases de K. marxianus) ont permis une production continue de sirop de fructose à partir de saccharose avec un rendement supérieur à 58 % (de Paula et al 2008).

Les enzymes produites par les champignons sont également utilisées pour la production de sirops de fructose. Par exemple, des inulinases immobilisées d’A. niger présentent un rendement d’hydrolyse de 100% en utilisant de l’inuline de Dahlia comme substrat (Nakamura et al 1995).

Les systèmes d’hydrolyse des fructanes ont été couplés aux procédés de fermentation pour obtenir une production simultanée d’éthanol. Par exemple, la fermentation simultanée d’extraits d’artichaud avec une combinaison des microorganismes Kluyveromyces fragilis, Saccharomyces cerevisiae et Zymomonas mobilis produit une concentration élevée d’éthanol (12 % v/v) (Szambelan et al 2004). Saccharification et fermentation simultanées ont été utilisées avec Aspergillus niger et S. cerevisiae avec 20.1 % (v/v) de rendement à partir d’inuline d’artichaud (Nakamura et al 1996).


36

Des endo-inulinases sont normalement utilisées pour la production de FOS à partir de fructanes. Par exemple, la production de FOS à partir d’une endo-inulinase d’Aspergillus ficuum a été réalisée avec du 1-kestose comme principal produit de la réaction (Kim et al 1999). Un rendement de 75.6 % a été obtenu avec une endo-inulinase de Pseudomonas sp, les FOS produits présentant des DP compris entre 3 et 7 (Kim et al 1997). L’endo-inulinase du Penicillium sp. TN-88 hydrolyse l’inuline avec 70 % de rendement et l’inulotriose est le principal produit de la réaction (Nakamura et al 1997).

B. Fructosyltransférases.

Les enzymes microbiennes du type fructosyl-transférases sont les polymérases responsables de la biosynthèse des fructanes. Structurellement, ces enzymes partagent le domaine catalytique des glycoside-hydrolases de la famille 68 (Velázquez-Hernández et al 2009, Monsan et Ouarné 2009). Biochimiquement, elles transfèrent une molécule de fructose d’un saccharose à une autre molécule de saccharose pour faire la synthèse des FOS par une réaction de transfructosylation.

B.1. Principales sources microbiennes

Les sources microbiennes des fructosyl-transférases sont normalement les bactéries et les champignons. Chez les bactéries les especes décrites comme productrices de ces enzymes sont : Bacillus subtilis, B. macerans, B. megaterium, Paenibacillus polymyxa, Erwinia amylovora, Gluconacetobacter diazotrophicus, Lactobacillus sanfranciscensis, Leuconostoc mesenteroides, L. reuteri, L. citreum, Pseudomonas s. phaseolicola, Rahnella aquatilis, Zymomonas mobilis, Streptococcus mutans, S. salivarius, Actinomyces viscosus.

Chez les champignons : Aspergillus aculeatus, A. foetidus, A. sydowii, A. niger, A. japonicus, A. japonicum, A. oryzae, Aerobasidium pullulans, Penicillium citricum, P. citrinum, P. purpurogenum, Sporutrichum thermophile.

Chez les levures seules Xanthophyllomyces dendrorhous, Rhodotorula sp., R. gracilis, Kluyveromyces marxianus et Schwanniomyces occidentalis ont été décrites comme productrices de fructosyl-transférases (Maiorano et al 2008; Monsan et Ouarné 2009; Santos et Maugeri 2007; Alvarado et Maugeri 2007; Velázquez-Hernández et al 2009).

La majorité des fructosyl-transférases microbiennes fonctionnent à une température comprise entre 30 et 67 °C, un pH compris entre 5, 5 et 7,0 et le principal substrat utilisé pour la synthèse est le saccharose. La concentration utilisée varie de 10 à 600 g/l (Maiorano et al 2008; Velázquez-Hernández et al 2009).


37

B.2. Mécanisme catalytique.

Les fructosyl-transférases appartiennent à la famille des glycoside-hydrolases, elles catalysent la synthèse des FOS. Ces enzymes utilisent un mécanisme qui passe par la formation d’un intermédiaire glycosyl-enzyme comme il a été décrit antérieurement (Monsan et Ouarné 2009). D’après Velázquez-Hernández et al (2009), généralement les fructosyl-transférases microbiennes transfèrent un groupe fructosyle à une molécule acceptrice.

Les réactions catalysées par les fructosyl-transférases microbiennes à partir de saccharose peuvent produire différents FOS en fonction du carbone lié au groupe fructofuranosyle transféré (Velázquez-Hernández et al 2009), comme décrit dans la Figure 12. Si le groupe fructose d’une molécule de saccharose est transféré sur le carbone 1 d’un groupe fructose d’une autre molécule de saccharose, l’enzyme produira du 1-kestose (Figure 12a). S’il est transféré sur le carbone 6 d’un groupe glucose l’enzyme produira du néokestose (Figure 12b). Finalement s’il est transféré sur le carbone 6 d’un groupe fructose, l’enzyme produira du 6-kestose (Figure 12c). Après une première réaction de transfructosylation la réaction peut continuer pour donner des FOS de DP 4 et 5.


38

OHO

HOOH

O

OH

CH2OH

O

HOH

H1 2

OHO

HOOH

O

OH

CH2OH

O

HOH

H1 2

+

OHO

HOOH

O

OH

CH2OH

OH

O

H

CH2OH

OH

H

1

2

6

2

OH

OHO

HOOH

O

O

CH2OH

O1

6

2

HO

6

OHOHO

OHO

OH

CH2

O1

6

2

HO

OCH2OH

HO

HO

6

2

1-kestose

Neokestose

6-kestose

Fructosyltransférase microbienne

(a)

(b)

(c)

OH

HO

OH

OH

OH

HO

HO

HO

HO

HO

OH

HOHO

HO

CH2OH

OH

H2

OH

OH

OH

Figure 12 : Principaux produits obtenus par réaction de transfructosylation entre deux molécules de saccharose.

Pour la modélisation mathématique, sur la base des différents comportements cinétiques étudiés pour la synthèse des FOS des fructosyl-transférases de Aureobasidium pullulans (Jung et al 1989), Aspergillus niger (Ouarné et Guibert 1995) et Rhodotorula spp (Alvarado et Maugeri 2007) un modèle cinétique a été proposé. Ce modèle cinétique peut être utilisé pour les fructosyl-transférases microbiennes (Figure 13). Ce modèle prend en compte l’inhibition par le glucose (Figure 14) et la diminution de la capacité de synthèse par réactions d’hydrolyse (Figure 15).


39

Figure 13: Modèle de la synthèse des FOS basé sur les comportements observés pour les fructosyl-transférases microbiennes d’Aureobasidium pullulans, Aspergillus niger et Rhodotorula spp. Glucose (G) et fructose (F) d’après Monsan et Ouarné (2009).

Figure 14: Modèle de l’inhibition de la synthèse des FOS par le glucose. Glucose (G) et fructose (F) d’après Monsan et Ouarné (2009).

Figure 15: Modèle de l’hydrolyse de FOS. Glucose (G) et fructose (F) d’après Monsan et Ouarné (2009).

Ces modèles montrent que la concentration de glucose, fructose et l’hydrolyse des FOS doivent être considères pour le control du procédé de la synthèse des produites à partir de saccharose.

B.3. Applications industrielles.

La production industrielle de FOS peut être réalisée avec ou sans immobilisation enzymatique, ou avec une immobilisation cellulaire. Un diagramme de production proposé par Monsan et Ouarné (2009) est présenté dans la Figure 16. La première étape est la production des enzymes : actuellement, des fructosyl-transférases sont obtenues au niveau industriel à partir d’Aspergillus niger, A. japonicus et Aureobasidium pullulans. Pour la production des enzymes différents types de cultures sont utilisés : culture submergée avec oxygénation, culture en lit fluidisé, ou culture en milieu semi-solide. En général, le saccharose est l’inducteur de la production des enzymes (Monsan et Ouarné 2009).


40

Normalement la concentration en saccharose employée comme substrat pour la synthèse de FOS est de 55 °Brix, la source de sacch arose est normalement de grade alimentaire, mais pour la production des FOS utilisés en tant qu’additif alimentaire pour les animaux des mélasses peuvent être utilisées (Monsan et Ouarné 2009). Shin et al (2004) ont obtenu 166 g/l de FOS à partir de 360 g/l de sucres de mélasses.

Aspergillus oryzae a été cultivé dans un système de type batch pour la production de FOS. La réaction a été réalisée à partir de saccharose à une concentration comprise entre 55 et 70°Brix durant 25 heures à 55 °C, et un rendement de 53% de conversion du saccharose en FOS a été obtenu (Sangeetha et al 2005).

La production continue de FOS est possible avec l’immobilisation cellulaire dans de l’alginate de calcium pour les champignons A. pullulans et A. niger. Pour l’immobilisation enzymatique de la fructosyl-transférase d’A. pullulans, une résine anionique de type styrène-divinylbenzène avec des alkyl-amines comme groupes fonctionnels a été employée par Yun et Song (1999). Kono et al (1994) ont immobilisé une fructosyl-transférase sur différent supports, le meilleur étant une résine anionique avec 63-100 % d’activité relative. L’enzyme commerciale Pectinex ultra SP-L a été immobilisée sur le support Eupergit C. Dans ce cas, une activité relative de 96 % de synthèse a été conservée durant 20 jours sans observer aucune diminution (Aslan et Tanriseven 2005).


41

Figure 16 : Procédé enzymatique industriel de production des FOS d’après Monsan et Ouarné (2009).

Partie III : Procédés d’élaboration des boissons d’Agave : source de nouvelles fructanases et fructosyltransférases.

Au Mexique, l’utilisation des agaves pour l’élaboration de boissons est une tradition ancestrale qui date de bien avant l’arrivée des Espagnols. La consommation de boissons à base d’Agave a eu une grande importance religieuse pour les différents groupes indigènes du Mexique, qui subsiste encore aujourd’hui dans certaines régions (Bruman 2000). Il y a une grande diversité de plantes d’Agave dans les différentes régions du Mexique, surtout dans les zones arides et semi-arides du territoire Mexicain (García-Mendoza 1998). Ces plantes accumulent une grande quantité de sucres tels que les fructanes. Ces fructanes sont hydrolysés pour obtenir un moût riche en fructose qui après fermentation permet l’élaboration des différentes boissons traditionnelles. Le microbiote associé aux fermentations traditionnelles d’Agave est très riche et varié et il constitue une nouvelle source de microorganismes (Lappe et al 2008).


42

A. Boissons produites au Mexique à partir d’agave.

Les boissons obtenues à partir de l’agave peuvent être divisées en deux grands groupes : les boissons non distillées et les boissons distillées.

A.1. Boissons non distillées

Le pulque est certainement la plus ancienne boisson alcoolique du Mexique (< 6 % v/v d’éthanol). C’est une boisson préhispanique obtenue après fermentation spontanée du jus sucré récolté dans une cavité creusée au centre de différentes espèces d’agaves. Les aztèques ont classé le pulque en quatre types principaux, metoctli (vin d’Agave), iztacoctli (vin blanc), teoctli (vin cérémonielle), poliuhquioctli (vin décomposé). La boisson était consommée principalement lors des cérémonies religieuses des aztèques (Lappe et al 2008). Après la conquête espagnole, la consommation de pulque a perdu sa signification religieuse et elle s’est transformée en une boisson populaire consommée dans les faubourgs pauvres de la ville de Mexico (Gobierno del Estado de Hidalgo, Museo de las artes populares, 1988). Mis à part la concentration d’éthanol, le pulque est une source d’acides aminés essentiels, de vitamines et de neurotransmetteurs (Ramírez et al 2004; Ortiz-Basurto et al 2008). La mauvaise prononciation du mot poliuhquioctli en espagnol a donné le nom populaire de pulque à la boisson (Lappe et al 2008).

Le pulque connaît actuellement un regain d’intérêt : il est produit principalement par des entreprises de taille moyenne qui ont commencé à l’exporter aux Etats Unis (Lappe et al 2008). Généralement, le pulque est obtenu à partir de trois espèces d’Agave : A. salmiana, A. atrovirens et A. mapisaga qui proviennent des régions arides et semi-arides de l’altiplano mexicain (García-Mendoza 1998).

Les plantes d’Agave âgées de 8 à 10 ans sont utilisées parce qu’elles présentent une concentration en sucres élevée. La première étape du procédé consiste à couper quelques feuilles situées au centre de la plante, puis à creuser une cavité au cœur de l’agave. Un jus sucré (7-14 % p/v) connu sous le nom d’aguamiel s’accumule. Le jus est récolté une ou deux fois par jour et la récolte peut durer entre 90 et 120 jours avant que la plante ne meure (García-Mendoza 1998). Le jus est ensuite placé dans une citerne où la fermentation a lieu : elle peut être spontanée ou inoculée avec une flore pré-sélectionnée. La durée de la fermentation dépend de la qualité de la composition du jus, de la qualité de l’inoculum, du microbiote initial présent dans le jus à fermenter, de la saison et des variations de température (Lappe et al 2008).


43

Le microbiote associé à la fermentation du pulque est très divers et complexe, avec des levures et des bactéries comme principaux microorganismes. Durant la fermentation naturelle, il y a différentes étapes dans la dynamique microbienne :

• 1. Croissance des bactéries lactiques appartenant aux genres Leuconostoc, Lactobacillus

• 2. Développement de levures (Non-Saccharomyces et Saccharomyces), ainsi que de Zymomonas mobilis ssp. mobilis qui transforment les sucres en éthanol et autres composés volatils

• 3. Croissance de bactéries productrices de dextrane (Leuconostoc spp)

• 4. Croissance de bactéries productrices d’acide acétique (Acetobacter spp),

• 5. Croissance de microorganismes responsables de la putréfaction des aliments.

Dans les différentes études sur la caractérisation du microbiote du pulque, de nombreux microorganismes ont été identifiés, ils sont présentés dans le tableau 1 (Lappe et Ulloa 1993; Estrada-Godina et al 2001; Escalante et al 2004; Escalante et al 2008).

A.2. Boissons distillées.

La tequila est sans conteste la boisson dérivée de l’agave la plus connue au Mexique et au niveau international. En plus de la tequila, il existe toute une série de boissons distillées obtenues avec différentes espèces d’Agave parmi lesquelles on peut citer la raicilla, le sotol, la bacanora et différents types de mezcal. La principale différence entre ces boissons est l’espèce d’agave utilisée comme matière première et la région de production (Table 2). Actuellement, exception faite de la raicilla et du mezcal de Michoacán, toutes ces boissons distillées ont une appellation d’origine contrôlée (Lappe et al 2008).

Ces boissons ont comme caractéristique commune un procédé artisanal de production qui est composé des étapes suivantes (Figure 17) :

• Récolte des plantes d’agave qui peuvent être cultivées ou récoltées directement dans la nature,

• Cuisson des cœurs d’agave dans des fours rudimentaires

• Pressage des agaves cuits pour en extraire le jus sucré

• Fermentation du moût


44

• Distillation.

Figure 17: Procédé artisanal de production de mezcal de Oaxaca à partir d’Agave angustifolia.


45

Table 1 : Caractérisation du microbiote du pulque d’après Lappe et Ulloa (1993), Estrada-Godina et al (2001), Escalante et al (2004), Escalante et al (2008).

Agave utilisé Bactéries Levures

Agave atrovirens

Agave mapisaga

Agave salmiana

Acetobacter aceti, A. aceti spp xylinus, A. malorum, A. pomorium

Acinetobacter radioresistens

Bacillus simplex, B. subtilis

Cellulomonas sp

Enterobacter spp

Erwinia rhapontici

Escherichia sp

Flavobacterium johnsoniae

Gluconobacter oxydans

Hafnia alvei

Kokuria rosea

Lactobacillus spp, delbrueckii,. vermiforme, brevis, plantarum, acidophilus, kefir, acetotolerants.,. hilgardii

Leuconostoc pseudomesenteroides,mesenteroides spp. dextranicum, mesenteroides spp. mesenteroides, citreum, kimchi

Microbacterium arborescens.

Macrococcus caseolyticus

M. luteus

Sarcina spp

Zymomonas mobilis spp. mobilis

Candida spp

Candida parapsilosis

Clavispora lusitaniae

Cryptococcus spp.

Debaromyces carsonii

Geotrichum candidum

Hanseniaspora uvarum

Kluyveromyces marxianus

Kluyveromyces lactis

Pichia membranifaciens

Pichia guilliermondii

Pichia spp

Pichia fermentans

Rhodotorula sp

Rhodotorula mucilaginosa

Torulaspora delbrueckii

Saccharomyces cerevisiae

Saccharomyces bayanus

Saccharomyces paradoxus

Saccharomyces pastorianus


46

Table 2: Espèces d’agave utilisées et régions de production des différentes boissons distillées du Mexique d’après Lappe et al (2008) et Narváez-Zapata et al (2010).

Boisson Espèces d’agave Régions de production

Tequila Agave tequilana Centre-ouest et nord-est du Mexique (Jalisco, Nayarit, Michoacán, Tamaulipas, Guanajuato).

Mezcal de San Luis Potosi A. salmiana Centre-nord du Mexique (San Luis Potosí)

Mezcal de Tamaulipas A. salmiana Nord-est du Mexique (Tamaulipas)

Mezcal de Zacatecas A. tequilana et A. salmiana.

Centre-nord du Mexique (Zacatecas)

Mezcal de Michoacán A.cupreata, A. inaequides.

Centre-ouest du Mexique (Michoacán)

Mezcal de Oaxaca A. angustifolia, A. americana var. oaxaquencis, A. karwinskii, A. marmorata, A. potatorum, A. rhodacanta.

Sud du Mexique (Oaxaca)

Mezcal de Durango A. duranguensis Centre-nord du Mexique (Durango)

Mezcal de Guerrero A. cupreata Sud du Mexique (Guerrero)

Mezcal de Yucatan A. fourcroydes Sud-est du Mexique (Yucatan)

Raicilla A. angustifolia, A. inaequidens, A. maximiliana.

Centre-ouest du Mexique (Jalisco)

Bacanora A. angustifolia Nord-ouest du Mexique (Sonora)

La récolte des agaves est réalisée de façon différente suivant la zone de production. Par exemple, pour le mezcal de Zacatecas et de Oaxaca, les agaves sont cultivées, par contre, pour le mezcal de San Luis Potosi, de Durango et de Guerrero, les agaves sont prélevés directement dans leur milieu naturel (Lappe et al 2008).

Une étape importante dans le procédé d’élaboration de ce type de boisson est la cuisson qui a trois objectifs principaux :


47

• L’hydrolyse des fructanes pour les transformer en sucres simples (fructose principalement, glucose et saccharose)

• Le ramollissement de la structure de la piña qui facilitera l’étape suivante d’extraction des sucres

• La génération de certains composés qui participent aux caractéristiques organoleptiques du produit final (principalement composés de Maillard, Mancilla-Margalli et López 2002)

La cuisson est réalisée avec des méthodes industrielles dans le cas de la tequila, elle utilise des autoclaves et des fours en maçonnerie avec injection de vapeur

Dans le cas des différents types du mezcal, la cuisson des agaves est beaucoup plus rustique : généralement, les agaves sont cuites dans des fours creusés dans la terre et tapissés de pierres volcaniques, et chauffés par un feu de bois (figure 16). Ce procédé très rudimentaire a pour conséquence principale une cuisson hétérogène, certaines des agaves sortant totalement carbonisées et d’autres n’étant pas totalement cuites, ce qui provoque la présence dans les agaves de fructanes non hydrolysés.

Après l’étape de cuisson le jus est extrait par un procédé de broyage et de pressage. Dans le cas de la tequila des broyeurs à rouleaux cannelés adaptés de l’industrie de la canne a sucre sont utilisés ou, plus récemment, des diffuseurs. Pour les autres boissons distillées le procédé d’extraction peut être fait manuellement avec des maillets en acier ou en bois ou encore grâce à une tahona, qui est constituée d’une roue en pierre tirée par un animal pour effectuer le broyage des agaves cuits (Lappe et al 2008).

La fermentation de la tequila est réalisée dans des cuves industrielles en acier inoxydable avec ou sans contrôle de température, avec ou sans inoculation de levures présélectionnées. Normalement, seul le moût sans les fibres est fermenté. Les temps de fermentation sont relativement courts dans le cas de la tequila, entre 12 heures et 96 heures de manière générale.

Dans le cas des différents types de mezcal, raicilla et bacanora, deux types de fermentation sont possibles, seul le jus extrait peut être fermenté comme dans le cas de la tequila ou le jus avec la pulpe et les fibres d’agave. Dans ce dernier cas les temps de fermentation sont beaucoup plus longs, une fermentation peut durer jusqu'à 1 mois surtout si les conditions climatiques ne sont pas très favorables. Différents types de cuves de fermentation sont utilisées, le bois étant le matériel le plus courant (Lappe et al 2008). En général ce type de fermentation est totalement spontané, sans ajout de levures pré-sélectionnées.


48

Finalement après la fermentation le moût fermenté est distillé en alambics et colonnes de distillation pour la tequila, pour les différents types de mezcal de petits alambics sont utilisés, ils peuvent être en céramique, en brique ou en métal avec certaines parties en bois (Lappe et al 2008).

Comme pour le pulque, dans les procédés de fermentation des différentes boissons distillées d’agave le microbiote est très complexe et de nombreuses espèces de bacteries et de levures ont été identifiées (Table 3).

Table 3 : Caractérisation du microbiote de différentes boissons distillées d’agave d’après Lappe et al (2008) et Segura et al (2010).

Agave utilisé Boisson Microorganismes

Agave tequilana

Tequila

Bactéries lactiques (BAL), Candida spp, C. magnoliae, Hanseniaspora guilliermondii, H. uvarum, H. vinae, Kluyveromyces marxianus, Pichia membranifaciens, Torulaspora delbrueckii et Saccharomyces cerevisiae.

A. salmiana Mezcal de SLP BAL, Candida lusitaniae, K. marxianus, P. fermentans, S. cerevisiae.

A. angustifolia, A. americana var. oaxacencis, A. karwinskii, A. marmorata, A. potatorum, A. rhodacanta.

Mezcal de Oaxaca Aerobasidium pullulans, Candida apicola, C. boidinii, C. parapsilosis, C. zemplinina, Citeromyces matritensis, Clavispora lusitaniae,Cryptococcus albidus, Dekkera anómala, H. guilliermondii, Hanseniaspora osmophila, Issatchenkia orientalis, K. marxianus, Pichia anómala, P.galeiformis, P. membranifaciens, Pseudozyme prolífica, Rhodosporidium fluviale, Rhodotorula mucilaginosa, Schizosaccharomyces pombe, T. delbrueckii, Trigonopsis sp, Zygosaccharomyces bailli, Z. bisporus, Z. rouxii, C. spp, Hanseniaspora spp, S. cerevisiae.

A. duranguensis Mezcal de Durango K. marxianus, S. cerevisiae.

A. fourcroydes Mezcal de Yucatán Candida parapsilosis, Clavispora lusitaniae, Debaryomyces hansenii, K. marxianus, Pichia caribbica, P. guilliermondii, T. delbrueckii, S. cerevisiae.

A. salmiana Mezcal de Tamaulipas

Pediococcus parvulus, BAL, Weissella et

A. angustifolia, A. inaequidens, A. maximiliana.

Raicilla C. lusitaniae, K. marxianus, S. cerevisiae


49

B. Perspectives biotechnologiques.

Les procédés d’élaboration de boissons à partir d’agave constituent un réservoir important de souches de microorganismes pouvant présenter des propriétés technologiques intéressantes. Par exemple, les levures Kluyveromyces marxianus et Kluyveromyces spp isolées du jus d’Agave et du pulque se sont avérées être de super-productrices d’inulinases et d’autres enzymes (lactase et pectinase) capables de réaliser l’hydrolyse de l’inuline et des pectines (Espinoza et al 1992; Cruz-Guerrero et al 1995; Cruz-Guerrero et al 2006). García-Aguirre et al (2009) ont démontré que des extraits enzymatiques de levures de K. marxianus isolées du pulque étaient capables d’hydrolyser des fructanes d’agave pour l’obtention de sirops de fructose.

Lors de la fermentation du pulque, une grande diversité de souches productrices d’enzymes, comme la dextrane–saccharase de Leuconostoc mesenteroides ont été isolées (Chellapandian et al 1998). Cette enzyme est capable de synthétiser des polyméres d’unités α-D-glucopyranosyle appelés dextrane à partir de saccharose. Ces polymères comportent des liaisons de type α (1→6) et des branchements en α (1→3) entre les résidus glucosyles. Ces mêmes dextranes produits par L. mesenteroides ont été utilisées comme pellicules protectrices pour conserver des fruits tropicaux destinées à l’exportation (Gallo et al 2004).

Le microbiote du pulque présente également une activité enzymatique de type phytase. Cette activité a été évaluée in vitro dans la tortilla de maïs (produit de consommation basique au Mexique). Les résultats obtenus montrent que l’addition de pulque permet d’augmenter la concentration de phosphate dans la tortilla dans la diète mexicaine (Tovar et al 2008).

La sève d’agave employée comme matière première pour élaborer le pulque contient naturellement des enzymes endogènes de la plante. Ces enzymes sont capables d’hydrolyser les fructanes et produire des sucres réducteurs, du saccharose et des FOS (López-Munguía 2010).

Le microbiote contient également la bactérie Zymomonas mobilis qui est capable de produire de l’éthanol et des levane-saccharases. Ce même microbiote peut faire la synthèse de FOS, de dextrane, de levane et d’inuline (López-Munguía 2010).

Dans le cas des fermentations des procédés d’élaboration des boissons distillées, il a été observé que certaines levures non-Saccharomyces sont plus résistantes que les levures du vin à hautes concentrations de SO2, ainsi qu’a l’éthanol. Ces propriétés sont


50

très intéressantes et recherchées pour la fermentation alcoolique du procédé d’obtention du vin (Fiore et al 2005). Ces levures non-Saccharomyces ont aussi la capacité de produire d’autres enzymes du type β-xylosidase et β-glucosidase qui participent à la libération des terpènes liés aux mono ou diglucosides des végétaux. Ces terpènes sont des composés importants dans le domaine aromatique des vins (Fiore et al 2005).

Les levures Saccharomyces et non-Saccharomyces isolées des fermentations des boissons distillées d’agave peuvent réaliser la fermentation du jus de raisin pour obtenir du vin comme les levures isolées du raisin. Elles sont surtout performantes lorsque la fermentation est réalisée avec des concentrations en sucre élevées (Arrizon et al 2006). Dans la même étude, les auteurs ont démontré que les levures Saccharomyces provenant des procédés de fermentation des boissons dérivées de l’agave sont de meilleures productrices de 2-phényléthanol, ainsi que des alcools amyliques que les Saccharomyces d’origine vinicole. Une nouvelle fois ces souches peuvent jouer un rôle intéressant en conférant des caractéristiques aromatiques particulières.

Une autre voie intéressante de recherche est liée au stress provoqué par les composés présents dans le jus d’agave aux levures présentes dans la fermentation. Saccharomyces cerevisiae augmente la synthèse de glucanes ou de mannanes dans la membrane cellulaire lorsqu’elle est cultivée sur ce type de milieu (Aguilar-Uscanga et al 2007). En conséquence, le moût d’Agave tequilana fermenté pourrait constituer une source des polysaccharides de membrane cellulaire de levures, avec de possibles applications pharmaceutiques pour leurs propriétés de modulateurs immunologiques (Ramberg et al 2010).

A partir des déchets de la fermentation de la tequila connus sous le nom de vinasse, il est possible de produire du méthane par fermentation anaérobie avec les microorganismes des boues résiduelles des procédés de traitement de l’eau (Espinoza-Escalante et al 2009).

Une autre alternative d’application des vinasses de la tequila est la production d’ enzymes de type inulinases, xylanases, pectinases et cellulases à partir du champignon Aspergillus niger (Huitron et al 2008).

De manière générale, le procédé industriel de production de la tequila présente d’importantes opportunités pour l’application d’enzymes, par exemple Waleckx et al (2008) ont montré que l’application d’enzymes de type inulinases commerciales comme Fructozyme® augmentait le rendement d’extraction des sucres pour la fermentation de la tequila (Waleckx et al 2011).


51

Ávila-Fernández et al (2009) ont montré qu’il est possible d’hydrolyser des fructanes d’agave à une température (60 °C) inférieure à cel le des autoclaves (121 °C) avec l’application industrielle de Fructozyme®, ce qui permet une réduction de la consommation d’énergie. Mais Muñoz-Gutierrez et al (2009) a montré que le cocktail enzymatique Fructozyme® a une moins bonne spécificité enzymatique pour les fructanes d’agave que pour l’inuline.

En conséquence, la recherche de nouvelles enzymes plus spécifiques pour l’hydrolyse des fructanes d’agave est nécessaire pour améliorer le procédé de fabrication de la tequila. Cette recherche constitue l’un des objectifs de ce travail.

References Bibliographiques.

Aguilar-Uscanga, B.; Arrizon, J.; Ramírez, J.; Solis-Pacheco, J., Effect of Agave tequilana juice on cell wall polysaccharides of three Saccharomyces cerevisiae strains

from different origins. 2007. Antoine van Leeuwenhoek, 91, 151-157.

Alvarado, M.; Maugeri, F., Kinetic modeling of fructooligosaccharides synthesis using a Rhodotorula sp fructosyltransferase. 2007. J Biotechnol, 131, (2), S91-S92.

Alvarez de la C. Inf. Cien. Tecnol. 1996, 18, 44-47.

Ameziane, R.; Deleens, E.; Noctor, G.; Morot-Gaudry, J.; Limami, M., Stage of development is an important determinant in the effect of nitrate on photoassimilate (13C) partitioning in chicory (Cichorium intybus). 1997. J Exp Bot, 48, 25-33.

Arrizon, J.; Fiore, C.; Acosta, G.; Romano, P.; Gschaedler, A., Fermentation behaviour and volatile compound production by agave and grape must yeasts in high Agave

tequilana and grape must fermentations. 2006. Antoine van Leeuwenhoek, 89, 181-189.

Aslan, Y.; Tanriseven, A., Immobilization of Pectinex Ultra SP-L to produce galactooligosaccharides. 2007. Journal of Molecular Catalysis B-Enzymatic, 45, (3-4), 73-77.

Ávila-Fernández, A.; Rendón-Poujol, X.; Olvera, C.; González, F.; Capella, S.; Peña-Álvarez, A.; López-Munguía, A., Enzymatic hydrolysis of fructans in the tequila production process. 2009. J Agric Food Chem, 57, 5578-5585.


52

Barranco-Florido, E.; García-Garibay, M.; Gómez-Ruiz, L.; Azaola, A., Immobilization system of Kluyveromyces marxianus cells in barium alginate for inulin hydrolysis. 2001. Proc Biochem, 37, 513-519.

Bonnett, G.D.; Sims, I.M.; Simpson, R.J.; Cairns, A.J., Structural diversity of fructan in relation to the taxonomy of the Poaceae. 1997. New Phytol, 136, 11-17.

Bruman, H.J., Alcohol in Ancient Mexico. The University of Utah Press, 2000.

Casas, R., Between traditions and modernity: technological strategies at three tequila firms. 2006. Technol Soc, 28, (3), 407-419.

Cedeño, M., Tequila production. 1995. Crit Rev Biotechnol, 15, 1-11.

Chellapandian, M.; Larios, C.; Sánchez-González, M.; López-Munguía, A., Production and properties of a dextransucrase from Leuconostoc mesenteroides IBT-PQ isolated from “pulque”, a traditional Aztec alcoholic beverage. 1998. J Ind Microbiol Biotechnol, 21, 51-55.

Chi, Z.; Chi, Z.; Zhang, T.; Liu, G.; Yue, L., Inulinase-expressing microorganisms and applications of inulinases. 2009. Appl Microbiol Biotechnol, 82, 211-220.

Cruz-Guerrero, A.E.; García-Peña, I.; Barzana, E.; García-Garibay, M.; Gómez-Ruiz, L., Kluyveromyces marxianus CDBB-L-278: a wild inulinase hyperproducing strain. 1995. J Ferment Bioeng, 80, 159-163.

Cruz-Guerrero, A.E.; Olvera, J.L.; García-Garibay, M., Gómez-Ruiz, L., Evaluation of Kluyveromyces sp. Isolated from aguamiel (Agave sap) and pulque. 2006. World J Microbiol Biotechnol, 22, 115-117.

Demel, R.A.; Dorrepaal, E.; Ebskamp, M.J.M.; Smeekens, J.C.M.; de Kruijff, B., Fructans interact strongly with model membranes. 1998. Biochim Biophys Acta, 1375, 36-42.

De Paula, F.C.; Cazetta, M.L.; Monti, R.; Contiero, J., Sucrose hydrolysis by gelatin-immobilized inulinase from Kluyveromyces marxianus var bulgaricus. 2008. Food Chem, 111, 691-695.

De Roover, J.; Van den branden, K.; Van Laere, A.; Van den Ende, W., Drought induces fructan synthesis and 1-SST (sucrose:sucrose fructosyltransferase) in roots and leaves of chicory seedlings (Cichorium intybus L). 2000. Planta, 210, 808-814.


53

Dias-Tagliacozzo, G.M.; Itaya, N.M.; Machado de Carvalho, M.A.; Figueiredo-Ribeiro, R.C.L.; Dietrich, S.M.C., Fructans and water suppression on intact and fragmented rhizophores of Vernonia herbacea. 2004. Brazilian Archives of Biology and Technology, 47(3), 363-373.

Escalante, A.; Rodríguez, M.E.; Martínez, A.; López-Munguía, A.; Bolivar, F.; Gosset, G., Characterization of bacterial diversity in Pulque, a traditional Mexican alcoholic fermented beverage, as determined by 16S rDNA analysis. 2004. FEMS Microbiol Lett, 235, 273-279.

Escalante, A.; Giles-Gómez, M.; Hernández, G.; Córdova-Aguilar, M.S.; López-Munguía, A.; Gosset, G.; Bolívar, F., Analysis of bacterial community during the fermentation of pulque, a traditional Mexican alcoholic beverage, using a polyphasic approach. 2008. Int J Food Microbiol, 124, 126-134.

Eguiarte, L.E.; Souza, V.; Silva-Montellano, A., Evolución de la Familia Agavaceae: filogenia, biología reproductiva y genética de poblaciones. 2000. Bol Soc Bot Mex, 66, 131-150.

Espinoza-Escalante, F.M.; Pelayo-Ortiz, C.; Navarro-Corona, J.; González-García, Y.; Bories, A.; Gutiérrez-Pulido, H., Anaerobic digestión of the vinasses from the fermentation of Agave tequilana Weber to tequila: The effect of pH, temperatura and hydraulic retention time on the production of hydrogen and methane. 2009. Biomass and bioenergy, 33, 14-20.

Espinoza, P.; Bárzana, E.; García-Garibay, M.; Gómez-Ruiz, L., Evaluation of Kluyveromyces marxianus for the production of lactase simultaneously to pectinase or inulinase. 1992. Biotechnol Lett, 14, 1053-1058.

Estrada-Godina, A.R.; Cruz-Guerrero, A.E.; Lappe, P.; Ulloa, M.; García-Garibay, M.; Gómez-Ruiz, L., Isolation and identification of killer yeasts from Agave sap (aguamiel) and pulque. 2001. World J Microbiol Biotechnol, 17, 557-560.

Fiore, C.; Arrizon, J.; Gschaedler, A.; Flores, J.; Romano, P., Comparison between yeasts from grape and agave musts for traits of technological interest. 2005. World J Microbiol Biotechnol, 21, 1141-1147.

Fukai, K.; Ohno, S.; Goto, K.; Hara, Y., Seasonal growth and fluctuations of sugar content in yacon (Polymnia sonchifolia) during growth and dormancy. 1995. Jpn Soil Sci Plant Nutr, 66, 233-237.


54

Gallo, J.A.Q.; Amato, M.R.D.; Gramin, A.; Pattyn, C.; Debeaufort, F.; Voilley, A., Biopolymers used as edible coating to limit water transfer, colour degradation and aroma compound 2-pentanona lost in Mexican fruits. 2005. ACTA Horticulturae, 1-3, (682), 1709-1716.

García-Aguirre, M.; Sáenz-Álvaro, V.A.; Rodríguez-Soto, M.A.; Vicente-Magueyal, F.J.; Botello-Álvarez, E.; Jiménez-Islas, H.; Cárdenas-Manríquez, M.; Rico-Martínez, R.; Navarrete-Bolaños, J.L., Strategy for biotechnological process design applied to the enzymatic hydrolysis of Agave fructo-oligosaccharides to obtain fructose-rich syrups. 2009. J Agric Food Chem, 57, 10205-10210.

García-Mendoza, A., Con sabor a maguey: Guía de la colección nacional de Agaváceas y Nolináceas del Jardin Botánico. Instituto de Biología. Universidad Nacional Autonoma de México, 1998.

García-Mendoza, A., Distribution of Agave (Agavaceae) in Mexico. 2002. Cact Succ J, 4(74), 177-187.

Gentry, H.S., Agaves of continental North America, University of Arizona Press. USA. 1982.

Gobierno del Estado de Hidalgo y Museo Nacional de Culturas Populares, El maguey: árbol de las maravillas. Instituto Nacional Indigenista, Secretaria de Educación Pública y Dirección General de Culturas Populares, México. 1988.

Gomez, E.; Tuchy, K.M.; Gibson, G.R.; Klinder, A.; Costabile, A., In vitro evaluation of the fermentation properties and potent prebiotic activity of Agave fructans. 2010. J Appl Microbiol, 108, (6), 2114-2121.

Gong, F.; Sheng, J.; Chi, Z.M.; Li, J., Inulinase production by a marine yeast Pichia guilliermondii and inulin hydrolysis by the crude inulinase. 2007. J Indu Microbiol Biotechnol, 34, 179-185.

Henson, C.A.; Livingston, D.P., III: Purification of an oat fructan exohydrolase that preferentially hydrolyzes β(2→6) fructans. 1996. Plant Physiol, 110, 639-644.

Hincha, D.K.; Zuther, E.; Hellwege, E.M.; Heyer,A., Specific effects of fructo and gluco-oligosaccharides in the preservation of liposomes during drying. 2002. Glycobiol, 12, 103-110.

http://cazy.org/Home.html


55

Huitron, C.; Perez, R.; Sánchez, A.E.; Lappe, P.; Zavaleta, L.R., Agricultural waste from the tequila industry as substrate for the production of commercially important enzymes. 2008. J Environ Biol, 29, (1), 37-41.

Jung, K.H.; Yun, J.W.; Kang, K.R.; Lim, J.Y.; Lee, J.H., Mathematical-model for enzymatic production of fructo-oligosaccharides from sucrose. 1989. Enz Microbiol Biotechnol, 11, (8), 491-494.

Kim, D.H.; Choi, Y.J.; Song, S.K.; Yun, J.W., Production of inulooligosaccharides using endo-inulinase from a Pseudomonas sp. 1997. Biotechnol Lett, 19, 369-371.

Kim, H.S.; Lee, D.W.; Ryu, E.J.; Uhm, T.B.; Yang, M.S.; Kim, J.B.; Chae, K.S., Expression of the INU2 gene for an endoinulinase of Aspergillus ficuum in Saccharomyces cerevisiae. 1999. Biotechnol Lett, 21, 621-623.

Kono, T.; Yamaguchi, G.; Hidaka, H., US Patent 5314810. 1994.

Lappe-Oliveras, P.; Moreno-Terrazas, R.; Arrizón-Gaviño, J.; Herrera-Suárez, T.; García-Mendoza, A.; Gschaedler-Mathis, A., Yeasts associated with the production of Mexican alcoholic nondistilled and distilled Agave beverages. 2008. FEMS Yeast Res, 8, 1037-1052.

Lappe, P.; Ulloa, M., Microbiología del pulque. Alimentos fermentados indígenas de México. Universidad Nacional Autónoma de México. 1993, 75-80.

Livingston, D.P.I; Chatterton, N.J.; Harrison, P.A., Structure and quantity of fructan oligomers in oat (Avena spp.). 1993. New Phytol, 123, 725-735.

Livingston, D.P.; Marshall, H.G.; Kolb, F.L., Registration of pennline-40 winter oat germplasm. 1992, Crop Sci, 32, (6), 1512.

Livingston, D.P.; Premakumar, R.; Tallury, S.P., Carbohydrate partitioning between upper and lower regions of the crown in oat and rye during cold acclimation and freezing. 2006. Criobiol, 52, 200-208.

Lopez, M.G.; Mancilla-Margalli, N.A.: Mendoza-Diaz, G. Molecular structures of fructans from Agave tequilana Weber var. azul. 2003. J Agric Food Chem, 51, 7835-7840.

Lopez, M.G..; Urias-Silvas, J.E., Agave fructans as prebiotics. In Recent Advances in Fructooligosaccharides Research, Research Singpost, 2007, 1.


56

López-Munguía, A., The role of glycosyltransferase activities in some traditional fermented Mexican beverages. Abstracts of the 4th Symposium on Biocatalysis in the Food and Drink Industries,Toulouse, 2010.

Lothier, J, Métabolisme des fructanes chez Lolium perenne L. Identification de deux gènes codant des fructane exohydrolases (FEHs) et étude de la regulation de l’activité FEH par les sucres solubles. Université de Caen, Caen, France, 2006.

Maiorano, A.E.; Piccoli, R.M.; da Silva, E.S.; de Andrade-Rodrigues, M.F., Microbial production of fructosyltransferases for synthesis of pre-biotics. 2008. Biotechnol Lett, 30, 1867-1877.

Mancilla-Margalli, N.A.; López, M.G., Generation of Maillard compounds from inulin during the thermal processing of Agave tequilana Weber var.azul. 2002. J Agric Food Chem, 50, (4), 806-812.

Martínez-Noël, G.; Tognetti, J.; Nagaraj, V.; Wiemken, A.; Pontis, H., Calcium is essential for fructan synthesis induction mediated by sucrose in wheat. 2006. Planta, 225, 183-191.

Minjarez-Ibañez, A.; Segura-Ortega, J.; Delgado-Rizo, V.; Jave-Suarez, L.; González-Hernández, L.; Fafutis, M., Prebiotic and immunologic effects of fructans from Agave tequilana Weber. 2010. Cl Immunol, 35: S109.

Monsan, P.F.; Ouarné, F., “Oligosaccharides derived from sucrose”, in Prebiotics and Probiotics Science and Technology”, Chalarampopoulos D., Rastall R. Eds., Springer,

in press, 293-336. 2009.

Monti, A.; Amaducci, M.T.; Pritoni, G.; Venturi, G., Growth, fructan yield, and quality of chicory (Cichorium intybus L.) as related to photosynthetic capacity, harvest time, and water regime. 2005a. J exp Bot, 56, (415), 1389-1395.

Monti, A.; Amaducci, M.T.; Venturi, G., Growth response, leaf gas exchange and fructans accumulation of Jerusalem artichoke (Helianthus tuberosus L.) as affected by different water regimes. 2005b. Europ J Agronomy, 23, 136-145.

Morcuende, R.; Kostadinova, S.; Pérez, P.; Martín del Molino, I.M.; Martínez-Carrasco, R., Nitrate is a negative signal for fructan synthesis, and the fructosyltransferase-inducing trehalose inhibits nitrogen and carbon assimilation in excised barley leaves. 2004. New Phytol, 161, 749-759.


57

Morcuende, R.; Kostadinova, S.; Pérez, P.; Martínez-Carrasco, R., Fructan synthesis is inhibited by phosphate in warm-grown, but not in cold-treated, excised barley leaves. 2005. New Phytol, 168, 567-574.

Muñoz-Gutiérrez, I.; Rodríguez-Alegría, M.E.; López-Munguía, A., Kinetic behaviour and specificity of β-fructosidases in the hydrolysis of plant and microbial fructans. 2009. Process Biochemistry, 44, 891-898.

Nagem, R.A.P.; Rojas, A.L.; Golubev, A.M.; Korneeva, O.S.; Enyaskaya, E.V.; Kulminskaya, A.A.; Neustroev, K.N.; Polikarpov, I., Crystal structure of exo-inulinase from Aspergillus awamori: the enzyme fold and structural determinants of substrate recognition. 2004. J Mol Biol, 344, 471-480.

Nakamura, T.; Ogata, Y.; Hamada, S.; Ohta, K., Ethanol production from Jerusalem artichoke tubers by Aspergillus niger and Saccharomyces cerevisiae. 1996. J Fermen Bioeng, 81, 564-566.

Nakamura, T.; Ogata, Y.; Shitara, A.; Nakamura, A.; Ohta, K., Continuous production of fructose syrups from inulin by immobilized inulinase from Aspergillus niger mutant 817. 1995. J Fermen Bioeng, 80, 164-169.

Nakamura, T.; Shitara, A.; Matsuda, S.; Matsuo, T.; Suiko, M.; Ohta, K., Production, purification and properties of an endoinulinase of Penicillium sp. TN-88 that liberates inulotriose. 1997. J Fermen Bioeng, 84, 313-318.

Narai-Kanayama, A.; Tokita, N.; Aso, K., Dependence of fructooligosaccharide content on activity of fructooligosaccharide-metabolizing enzymes in yacon (Smallanthus sonchifolius) tuberosus roots during storage. 2007. J Food Sci, 72, S381-S387.

Narváez-Zapata, J.A.; Rojas-Herrera, R.A.; Rodríguez-Luna, I.C.; Larralde-Corona, C.P., Culture-independent analysis of lactic acid bacteria diversity associated with mezcal fermentation. 2010. Curr Microbiol, 61, 444-450.

Nobel, P.; Linton, M.J., Frequencies, microclimate and root properties for three codominant perennials in the northwestern Sonoran desert on north-vs south-facing slopes. 1997. Ann Bot, 80, (6), 731-739.

Orthen, B.; Wehrmeyer, A., Seasonal dynamics of non-structural carbohydrates in bulbs and shoots of the geophytes Galanthus nivalis. 2004. Physiol plant, 120, 529-536.

Ortíz-Basurto, R.I.; Pourcelly, G.; Doco, T.; Williams, P.; Dornier, M.; Belleville, M.P., Analysis of the main components of the aguamiel produced by the maguey pulquero


58

(Agave mapisaga) throughout the harvest period. 2008. J Agric Food Chem, 56, 3682-3687.

Ouarné, F.; Guibert, A., Fructo-oligosaccharides-enzymatic synthesis from sucrose. 1995. Zuckerindustrie, 120, (9), 793-798.

Pollock, C.K., Storage carbohydrates in vascular plants, Cambridge Univ Press, 1984, 97.

Ramberg, J.E.; Nelson, E.D.; Sinnott, R.A., Immunomodulatory dietary polysaccharides: a systematic review of the literature. 2010. Nutr J, 9, (54), 1-22.

Ramírez, J.F.; Sánchez-Marroquín, A.; Álvarez, M.M.; Valyasebi, R., “Industrialization of Mexican pulque”, In Industrialization of Indigenous Fermented Foods, Marcel Deckker, 2004, 547-586.

Ritsema, T.; Smeekens, S., Fructans: beneficial for plants and humans. Curr Opin Plant Biol, 2003, 6, 223-230.

Rodríguez-Garay, B.; Gutierrez-Mora, A.; Flores-Berrios, E.P.; Loera-Quezada, M.M. A. tequilana Weber var. azul: inicio del proceso. In A. Gschaedler, Ciencia y Tecnología del Tequila. 2004. vol 1 (pp 14-16). Guadalajara, CIATEJ press.

Saengthongpinit, W.; Sajjaanantakul, T., Influence of harvest time and storage temperature on characteristics of inulin from Jerusalem artichoke (Helianthus tuberosus L.) tubers. 2005. Postharvest Biology and Technology, 37, 93-100.

Saldaña-Oyarzábal, I.; Ritsema, T.; Pearce, S.R., Analysis and characterization of fructan oligosaccharides and enzymatic activities in the leaves of Agave tequilana (Weber) var. “Azul”. 2009. Dynamic Biochemistry, Process Biotechnology and Molecular Biology, 3, (1), 40-51.

Sánchez-Marroquín, A.; Hope, P.H., Agave juice: Fermentation and chemical composition studies of some species. 1953. J Agric Food Chem, 1, 246-249.

Sangeetha, P.T.; Ramesh, M.N.; Prapulla, S.G., Recent trends in the microbial production, analysis and application of fructooligosaccharides. 2005. Trends Food Sci Technol, 16, (10), 442-457.

Santamaria, J.M.; Herrera, J.L.; Robert, M.L., Stomatal physiology of a micropropagated CAM plant, Agave tequilana (Weber). 1995. Plant Growth Regul 16, (3), 211-214.


59

Santos, A.M.P.; Maugeri, F., Synthesis of fructooligosaccharides from sucrose using inulinase from Kluyveromyces marxianus. 2007. Food Technol Biotechnol, 45, (2), 181-186.

Segura, L.E., Identificación y caracterización por métodos moleculares de levaduras aisladas del proceso de elaboración del mezcal en el estado de Oaxaca. Tesis de maestría, Posgrado Interinstitucional en Ciencia y Tecnología, CIATEJ-CONACYT, Guadalajara, 2010.

Shin, H.T.; Baig, S.Y.; Lee, S.W.; Suh, D.S.; Kwon, S.T.; Lim, Y.B.; Lee, J.B., Production of fructo-oligosaccharides from molasses by Aerobasidium pullulans cells. 2004. Bior Technol, 93, (1), 59-62.

Shiomi, N., Properties of fructosyltransferases involved in the synthesis of fructan in Liliaceous plants. 1989. J Plant Physiol, 134, 151-155.

Shiomi, N.; Benkeblia, N.; Onodera, S.; Kawazoe, N, Froctooligosaccharides changes during maturation in inflorescences and seeds of onion (Allium cepa L W202). 2006. Can J Plant Sci, 86, 269-278.

Singh, P.; Gill, P.K., Production of inulinases: recent advances. 2006. Food Technol Biotechnol, 44, (2), 151-162.

Singh, R.S.; Sooch, B.S.; Puri, M., Optimization of medium and process parameters for the production of inulinase from a newly isolated Kluyveromyces marxianus YS-1. 2007. Biores Technol, 98, 2518-2525.

Spollen, W.G.; Nelson, C.J., Response of fructan to water-deficit in growing leaves of tall fescue. 1994. Plant Physiol, 106, 329-336.

Sprenger, N.; Bortlik, K.; Brandt, A.; Boller, T.; Wiemken, A. Purification, cloning, and functional expression of sucrose:fructan 6-fructosyltransferase, a key enzyme of fructan synthesis in barley. 1995. Proc Natl Acad Sci USA, 92, 11652-11656.

Starbird, R.; Zuñiga, V.; Delgado, E.; Saake, B.; G. Toriz., Design of microspheres from blue agave fructans for drug delivery to the colon. Part 1. Esterification of agave fructans. 2007. Journal of Biobased Materials and Bioenergy, 1, 238-244.

Suzuki, M.; Nass, H.G., Fructan in winter-wheat, triticale, and fall rye cultivars of varying cold hardiness. 1988. Can. J. Bot., 66, 1723-1728.


60

Szambelan, K.; Nowak, J.; Czarnecki, Z., Use of Zymomonas mobilis and Saccharomyces cerevisiae mixed with Kluyveromyces fragilis for improved ethanol production from Jerusalem artichoke tubers. 2004. Biotechnol let, 26, 845-848.

Tolsma, A.D.; Read, S.M.; Tolhurst, K.G., Roots of Australian alpine plant species contain high levels of stored carbohydrates independent of post-fire regeneration strategy. 2007. Australian J Botany., 55, 771-779.

Tovar, L.R.; Olivos, M.; Gutierrez, M.E., Pulque, an alcoholic drink from rural Mexico, contains phytase. Its in vitro effects on corn tortilla. 2008. Plant Foods Hum Nutr, 63, 189-194.

Urías-Silvas, J.E.; Cani, P.D.; Delmée, E.; Neyrinck, A.; López, M.G.; Delzenne, N.M., Physiological effects of dietary fructans extracted from Agave tequilana Gto. and Dasylirion spp. 2008. British Journal of Nutrition, 99, 254-261.

Van den Ende, W.; Van Laere, A.; Induction of 1-FEH in mature chicory roots appears to be related to low temperatures rather than to leaf damage. 2002. Scientific World J., 2, 1750-1761.

Van den Ende, W.; Clarens, S.; Vergauwen, R.; Van Riet, L.; Van Laere, A.; Yoshida, M.; Kawakami, A., Fructan 1-exohydrolases. Β(2→1)-trimmers during graminan biosynthesis in stems of wheat?. Purification, characterization, mass mapping, and cloning of two fructan 1-exohydrolase isoforms. 2003. Plant Physiol, 131, 621-631.

Van den Ende, W.; Michiels, A.; De Roover, J.; Verhaert, P.; Van Laere, A., Cloning and functional analysis of chicory root fructan 1-exohydrolasse I (1-FEH I) : a vacuolar enzyme derived from a cell-wall invertase ancestor ?. Mass fingerprint of the 1-FEH I enzyme. 2000. Plant J, 24, 447-456.

Van den Ende, W.; Michiels, A.; Van Wonterghem, D.; Clerens, S.P.; De Roover, J.; Van Laere, A.J., Defoliation induces fructan 1-exohydrolase II in Witloof chicory roots. Cloning and purification of two isoforms, fructan 1-exohydrolase IIa and fructan 1-exohydrolase IIb. Mass fingerprint of the fructan 1-exohydrolase II enzymes. 2001. Plant Physiol, 126, 1186-1195.

Van Laere, A.; Van den Ende, W., Inulin metabolism in dicots: chicory as a model system. 2002. Plant Cell Environ, 25, 803-813.

Velázquez-Hernández, M.L.; Baizabal-Aguirre, V.M.; Bravo-Patiño, A.; Cajero-Juárez, M.; Chávez-Moctezuma, M.P.; Valdez-Alarcon, J.J., Microbial fructosyltransferases and the role of fructans. 2009. J Appl Microbiol, 106, 1763-1778.


61

Vereyken, I.J.; Chupin, V.; Demel, R.A.; Smeekens, S.C.; de Kruijff, B., Fructans insert between the headgroups of phospholipids. 2001. Biochim Biophys Acta, 1510, 307-320.

Waleckx, E.; Mateos-Diaz, J.C.; Gschaedler, A.; Colonna-Ceccaldi, B.; Brin, N; García-Quezada, G; Villanueva-Rodríguez, S.; Monsan, P., Use of inulinases to improve fermentable carbohydrate recovery during tequila production. 2011. Food Chem, 124, 1533-1542.

Waleckx, E.; Gschaedler, A.; Colonna-Ceccaldi, B.; Monsan, P., Hydrolysis of fructans from Agave tequilana Weber var. azul during the cooking step in a traditional tequila elaboration process. 2008. Food Chem, 108, 40-48.

Wan-Chun, Z.; Jian, D.; Xiang, G.; Gai-Sheng, Z., Effects of nitrogen fertilizer on fructan accumulation, translocation and their heterosis in hybrid wheat. 2006. Acta Agronomica Sinica, 32, (4), 607-612.

Wang, N.; Nobel, P., Phloem transport of fructans in the crassulacean acid metabolism species Agave deserti. 1998. Plant Physiol, 116, 709-714.

Wang, C.; Van den Ende, W.; Tillberg, J.E., Fructan accumulation induced by nitrogen deficiency in barley leaves correlates with the level of sucrose:fructan 6-fructosyltransferase mRNA. 2000. Planta, 211, 701-707.

Wei, J.Z.; Chatterton, N.J.; Harrison, P.A.; Wang, R.R.C.; Larson, S.R., Characterization of fructan biosynthesis in big bluegrass (Poa secunda). 2002. J Plant Physiol, 159, 705-715.

Wilson, R.G.; Martin, A.R.; Kachman, S.D., Seasonal changes in carbohydrates in the root of Canada thistle (Cirsium arvense) and the disruption of these changes by herbicides. 2006. Weed technol, 20, 242-248.

Wilson, R.G.; Smith, J.A.; Yonts, C.D., Chicory root yield and carbohydrate composition is influenced by cultivar selection, planting, and harvest date. 2004. Crop Sci, 44, 748-752.


62

Yun, J.W.; Song, K.S., “Methods in biotechnology”. In Carbohydrate biotechnology protocols. Human Press Inc, 1999, 141-151.

63

Chapitre II: Caractérisation de la composition des sucres solubles et des structures des fructanes

d’Agave tequilana en fonction de l’âge de la plante.

Ce chapitre a été publiée dans Food Chemistry .

Comparison of the Water-Soluble Carbohydrate composition and fructan structures of Agave tequilana plants of different ages .

Arrizon J ., Morel S., Gschaedler A. and Monsan P. (2010) Food Chemistry, 122, pp 123-130

Chapitre II: Caractérisation de la composition des sucres solubles et des structures des fructanes d’Agave tequilana en fonction de l’âge de la plante.

64

L’un des objectifs de ce travail de thèse, a été d’évaluer les variations de la composition des sucres solubles et de la structure des fructanes d’Agave tequilana en fonction de l’âge de la plante. Cette information est importante pour connaître la dynamique de l’accumulation des fructanes dans la plante, et ainsi prévoir l’étape du développement de l’agave où la récolte sera la plus favorable du point de vue de la concentration en sucre par exemple.

Des fructanes obtenus à partir de plantes d’agave agées de 2, 4 et 6,5 ans ont été utilisées. Les agaves ont été collectés chez un même producteur de la municipalité d’Usmajac dans l’Etat de Jalisco, situé dans l’ouest du Mexique. Ce producteur a été sélectionné parce qu’il contrôle de manière plus stricte ses cultures. En particulier, il utilise uniquement des fertilisants organiques dans ses plantations et contrôle l’âge de ses plantes à partir de la plantation des hijuelos (bourgeons du rhizome). Les plantes collectées se trouvaient dans un périmètre inférieur à 10 km, ce qui nous permet de minimiser les variations liées aux changements climatiques, géographiques et de composition du sol.

Pour la caractérisation de la composition des sucres solubles et des structures des fructanes les techniques analytiques suivantes ont été utilisées :

• Quantification des sucres totaux par l’anthrone et des sucres libres par le réactif DNS.

• Composition des sucres solubles et des fructanes par chromatographie liquide haute performance (HPLC), couplage chromatographie liquide-spectrométrie de masse (LC-MS) et HPAEC-PAD.

• Distribution des masses moléculaires des fructanes par spectrométrie de masse MALDI-TOF-MS .

• Identification des liaisons entre monosaccharides par couplage chromatographie en phase gazeuse et spectrométrie de masse (GC-MS) des alditols partiellement méthylés.

Ces travaux font l’objet de la première publication présentée dans ce chapitre.


65

COMPARISON OF THE WATER-SOLUBLE CARBOHYDRATE COMPOSITION AND FRUCTAN STRUCTURES OF Agave tequilana PLANTS OF DIFFERENT AGES.

Javier Arrizon a,b, Sandrine Morel b,c,d , Anne Gschaedler a, Pierre Monsan b,c,d,e.

aCentro de Investigación y Asistencia en Tecnología y Diseño del Estado de Jalisco, A.C. Avenida Normalistas 800, Col. Colinas de la Normal, 44270 Guadalajara, Jalisco, Mexico.

bUniversité de Toulouse; INSA, UPS, INP, LISBP, 135 Avenue de Rangueil, F-31077 Toulouse, France.

cCNRS, UMR5504, F-31400 Toulouse, France.

dINRA, UMR792 Ingénierie des Systèmes Biologiques et des Procédés, F-31400 Toulouse, France.

eInstitut Universitaire de France, 103 Boulevard Saint-Michel, F-75005 Paris, France.

A. Summary

The composition of water-soluble carbohydrates from Agave tequilana plants of 2, 4 and 6½ years were compared by HPLC, HPAEC-PAD, MALDI-TOF-MS and GC–MS. The plants of 2 years exhibited the highest levels of free monosaccharide and low molecular weight fructans (DP 3–DP 6) with potential application as prebiotics. A maximum of fructan polymerisation was achieved at 4 years with mean DP from 3 to 30, then it was decreased at 6½ years with mean DP from 4 to 24. The linkage analysis showed an increase and decrease in the branching degree from 2 to 6½ years with a maximum at 4 years, correlated to changes in t-b-D-Fruf linkages with increased and decreased synthesis of (2→1) and (2→6)-b-D-Fruf as well as 1,6-di-b-D-Fruf linkages.

B. Introduction

Fructans are fructose-based oligo or polysaccharides present in many species of higher plants. In Agave species (CAM plants), fructans are reserve carbohydrates and they are synthesized and stored in the stems. The main function of these fructose polymers is storage before flowering and acts as osmoprotectans during drought (Hendry 1987; Wang and Nobel 1998). The principal difference of A. tequilana with respect to other common fructan accumulating plants is that it takes from 8 to 12 years to perform the accumulation (Cedeño 1995). Even though Agave tequilana plants have the capacity for sexual reproduction, the cultivation starts with the plantation of hijuelos (plant clones


66

derived from older agave plants), which are 40 produced by asexual means with plant sprouting from rhizome (Rodríguez-Garay et al 2004). Normally the production of hijuelos is carried out with a non controlled method, they could have 1 to 3 years since plant sprouting and normally a head diameter of the plant from 10 to 15 cm is considered by the Agave tequilana producers as a parameter for separation from the mother plants and then the plantation is performed. Agave tequilana fructans (ATF) are very important for the Mexican agroindustry, as they constitute the principal raw material for the elaboration of tequila after their hydrolysis for the subsequent fermentation and distillation processes (Sánchez-Marroquin and Hope 1953). Normally the process of hydrolysis is carried out by cooking with incomplete break down of all fructans and with the production of Maillard compounds (Mancilla-Margalli and Lopez, 2002). Apart from the production of tequila, it has been found recently that ATF have potential for the elaboration of dietary products and drug delivery systems (Urías-Silvas et al 2008). Thus, to know the structure of ATF as well as the factors that affect their synthesis is important. The first characterization of ATF by linkages analysis with GC-MS, as well as 13C NMR, 156 H NMR and MALDI-TOF MS methods applied to ATF of mature plants (8 years) showed that ATF is a complex mix of branched neo-fructans with β(2→1) and β(2→6) linkages, and these molecules have a degree of polymerization (DP) ranging from 3-29 units (Lopez et al 2003; Mancilla-Margalli and Lopez 2006). Similar structures have been found in Agave veracruz with a mixture of highly branched fructans with an internal glucose and containing both β(2→1) and β(2→6) linkages (Mancilla-Margalli et al 2006). In the case of Agave deserti it was reported the presence of a DP5 fructan in the vascular tissue with neokestose (DP3) as the principal fructooligosaccharide, a fructan with an internal glucose moiety (Wang et al 1998). Recently, it was found that fructan structures in agaves varied in function of plant species and region. The comparison of fructan linkage analysis between Agave tequilana, A. potatorum, A. cantala, A. fourcroydes and A. angustifolia showed differences in the proportions of glucose polymerized, as well as in the proportions of β(2→6) and β(2→1) linkages of the principal chains (Mancilla-Margalli and Lopez 2006). In addition, for other plants different to Agavaceae family, the synthesis of fructans is influenced by the production region, the soil nutrients, the plant variety, the seasonal changes, the water regime and the harvest time (Livingstone et al 2006; Faustini-Cuzzuol et al 2005; Dias-Tagliacozzo et al 2004; Martínez-Noël et al 2006; Morcuende et al 2005; Wilson et al 2004; Monti et al 2005; Saengthongpinit and Sajjaanantakul 2005; Orthen and Wehrmeyer 2004; Shiomi et al 2005). To our knowledge, there is only one report about the influence on A. tequilana age over the tequila fermentation process (Pinal et al 2009). Nevertheless, in the case of ATF no studies have been published on the effect of plant age over the structure of


67

fructans and most of the information in other plants correspond to linear polymers with β(2→1) linkages principally. By the other hand, since an economically point of view and in particular for the A. tequilana producers, it is important to know how the composition of fructans changes in function of plant age, because by tradition the harvest for the tequila elaboration process is carried out from 8 to 12 years. Therefore, information over the accumulation of sugars is important in order to possibly decrease the time of harvest. Additionally, the utilization of young agave plants for other purposes such as prebiotics production, could represent an economically important alternative. Thus, the objective of this work was to study the effect of A. tequilana plant age over the changes in the fructan structures for economical purposes.

C. Results and Discussion.

C.1. Morphology, total and free sugars contents of A. tequilana plants at different ages.

The morphology and sugars content of A. tequilana plants at different ages showed a high increase in the growth of the A. tequilana plants from 2 to 4 years, the head diameter and head weight had increased by 4.7 and 7.22 fold, respectively (Table 4). Then between A.tequilana plants of 4 and 6 ½ years, the head diameter and head weight had increased 1.4 and 2.78 fold, respectively (Table 4). The total sugar content in A. tequilana plants had increased 211 % from 2 to 4 years, and 140 % from 4 to 6 ½ years, respectively (Table 4). Comparing the percentage of the free sugars (non polymerized) with respect to total sugars content, it can be seen that it was the highest (35 %) in A. tequilana plants at 2 years, and it was 5.6 and 2.3 % for agaves of 4 and 6 ½ years, respectively (Table 4).


68

Table 4. Morphology and sugar contents of A. tequilana plants at different ages

Morphology Sugarcontents (g of sugar/Kg of Agave)

Age (years) Head diameter

(cm)

Head weight

(Kg)

Total sugars

Free sugars Fructans

2

18.0 ± 0.5

4.51 ± 0.2

42.7 ± 1.2

14.9 ± 0.8

27.75 ± 1.1

4 86.1 ± 2.3 32.6 ± 1.3 90.4 ± 0.94

5.1 ± 0.64

85.27 ± 0.75

6 ½ 125 ± 3.6 90.9 ± 0.8 126.8 ± 1.3 2.96 ± 0.43 123.8 ± 0.87

The fructans content had increased 3.07 and 4.46 fold for A. tequilana plants of 4 and 6 ½ years respectively (Table 4). These results showed a higher increase in plant growth and sugar accumulation between 2 and 4 years after hijuelos plantation, then variations were less pronounced between 4 and 6 ½ years. Normally, in the tequila elaboration process, the sugar content present in Agave tequilana plants at the harvest point was 129 to 174 g of fructose / kg of fresh agave head (Avila-Fernandez et al 2009). As the sugar contain reached at 6 ½ years was 123.8 ± 0.87 g of sugars/Kg of fresh agave head (Table 4), agave plants of this age could be used for the tequila production with a reduction of harvest time. Nevertheless, it has to be taken in account that the use of younger A. tequilana plants decreased the ethanol produced during fermentation and increased the methanol content at the end offermentation as well as changes in the synthesis of other volatile compounds, which could affect the tequila quality 220 (Pinal et al 2009). Considering the sugar composition of A. tequilana plants, fructose is the principal momoner of the fructan polymers (Lopez et al 2003), and as it has normally found that at the harvest point (8 years), the A. tequilana juice used for tequila production has 95 % of fructose and 5 % of glucose (Cedeño 1995; Avila Fernandez et al 2009). Therefore, it could be considered that the fructose content in fructans of A. tequilana plants of 6 ½ years (Table 4) is higher than 90 %.


69

C.2. Profile of water soluble carbohydrates obtained by HPLC, HPAEC-PAD and LC-MS for A. tequilana plants of different ages.

The preliminary carbohydrate profile of A. tequilana plants of different ages was obtained with two different chromatographic techniques: high performance liquid chromatography (HPLC) and high performance anion exchange chromatography with pulsed amperometric detection (HPAEC-PAD). The first technique allowed separating polymerized and not polymerized sugars (Table 5). Table 5. Percentage of sugars determined by HPLC of A. tequilana plants at different age.

Age (years) Fructose (%) Glucose (%) Sucrose (%) Fructans (%)

2

4

6 ½

15.12 ± 0.003

0.91 ± 0.018

0.79 ± 0.005

13.53 ± 0.001

0.49 ± 0.024

0.58 ± 0.005

1.75 ± 0

0.675 ± 0.91

0.74 ± 0.003

68.8 ± 0.37

97.1 ± 1.58

97.3 ± 0.5

With the second technique the distribution of fructans with an approximately range from DP 3 to DP 6 is represented in Figure 18a (chromatogram from 0 to 30 minutes), and the distribution of longer fructans compared versus inulin (Dahlia tubers) is represented in Figure 18b (chromatogram from 30 to 160 minutes).


70

Figure 18: Profile of A. tequilana WSC from different age by high performance anion exchange chromatography with pulsed amperometric detection (HPAEC-PAD ). (a) chromatogram from 0 to 30 minutes, (b) chromatogram from 30 to 160 minutes. 1, 2 and 3 corresponds to A. tequilana WSC of 2, 4 and 6 ½ years respectively. 4 correspond to Inulin from Dahlia tubers. N, S, G, F and K corresponds to the retention times at which nystose, sucrose, glucose, fructose and 1-kestose appear respectively.

G

F

S K N 1

2

3

1

2

3

4

(a)

(b)


71

As it can be seen, agaves of 4 and 6 ½ years contain less fructose, glucose, sucrose, 1-kestose and nystose, and longer polymerized fructans than agaves of 2 years (Table 5 and figure 18a), which is in agreement with results in table 4. The distribution of longer molecules for 2, 4 and 6 ½ years old agave plants showed the presence of fructans with an approximate range from DP 8 to DP 30. It was not possible to obtain a clear separation of these molecules as it was observed in inulin (Dahlia tubers) because of the complex structure of A. tequilana branched fructans (Lopez et al 2003). The same result was obtained by Waleckx et al (2008) when they compared the distribution of chicory inulin versus A. tequilana fructan by HPAEC-PAD. Thus, in this study HPAEC-PAD was more useful in the analysis of low molecular weight carbohydrate (LMWC). Borromeni et al (2009) have found also that for analysis of longer fructans present in Jerusalem artichoke, onion, shallots and elephant garlic, the technique of HPAEC-PAD has less resolution than the technique of MALDI-TOF-MS. Therefore, according to the results presented in tables 4 and 5, and figure 18, it can be inferred that at 2 years, the synthesis of fructans was beginning and the accumulation of fructans as reserve carbohydrate was in the initial phase. The increase of sugar accumulated as fructans has been observed also in physiological process of multiple plants, like the seeds maturation process of onion (Allium cepa L. “W202”), during regrowth and flower development of Galanthus nivalis bulbs and during maturation process of Cichorium intybus L and Helianthus tuberosus L (Wilson et al 2004; Monti et al 2005; Saengthongpinit et al 2005; Orthen et al 2004; Shiomi et al 2005). The common characteristic of the accumulation processes in these plants is that normally the accumulated fructans are linear with β(2→1) linkages whereas in A. tequilana and other graminans like Urginea maritima they are highly branched (Spies et al 1992). Another difference between A. tequilana and these plants is the rate of fructan synthesis. As the reaction achieved by 1-SST (sucrose:sucrose 1-fructosyl transferase) is the first enzymatic step in the fructan synthesis in plants (Avila-Fernandez et al 2007), the 1-STT rate synthesis can impact the global rate of fructans synthesis and elongation. Avila-Fernandez et al (2007) have found that in A. tequilana plants, the enzyme 1-SST showed an estimated kcat value of 260 min -1, corresponding to a lower turnover number than the value of kcat observed for 1-SST from H. tuberosus (1566 min -1). This could explain why in A. tequilana plants the accumulation of sugars is slower with longer times for harvest (8 to 12 years) than other typical fructan producing plants (Cedeño 1995; Avila-Fernandez et al 2009; Wilson et al 2004; Monti et al 2005; Saengthongpinit et al 2005; Orthen et al 2004; Shiomi et al 2005). In figure 18a, it was observed an unknown compound at 5.75 minutes between saccharose (4.98 minutes) and 1-kestose (8.3 minutes), which was in higher concentration in agaves of 2 years and it is absent in


72

agaves of 4 and 6 ½ years. It could be possible that the unknown compound observed corresponds to an oligosaccharide with a DP from 3 or 4 like neokestose and/or bifurcose. These compounds could be intermediary compounds for the inulin, neoserie and levan neoserie molecules synthesis, the principal blocks of ramified fructans present in A. tequilana (Lopez et al 2003). The presence of neokestose as an important low molecular weight fructan (LMWF) was found in Agave deserti (Wang et al 1998). Nevertheless, as neokestose and bifurcose were not available commercially, it was not possible to confirm the identity of the unknown compound. In order to analyze the possible molecular mass of this unknown compound, liquid chromatography coupled to mass spectrometry (LC-MS) was carried out in the samples of 2 years old agave plants. The analysis showed a disaccharide with a potassium adduct of m/z 381 corresponding to a molecule of saccharose, then three isomers of DP 3 with a potassium adduct of 543 m/z. Seven different molecules of DP 4 were found with a potassium adduct of 705 m/z. Molecules of DP 5 and 6 were found with a potassium adduct of 868 and 1030 m/z. As it can be seen LMWF in agaves of 2 years constitute a complex mix with different isomers and the fact that fructose and LMWF were higher in agaves of 2 years confirms one more time that accumulation of fructans as reserve carbohydrate was in an initial phase.

C.3. MALDI-TOF-MS analysis of fructans in A. tequilana plants of different age.

MALDI-TOF-MS analysis showed differences in oligosaccharide distribution for agaves function of plant age. For agaves of 2 years the distribution showed sodium adduct peaks from 706 to 3319 Da (DP from 4 to 20 respectively) with higher intensity in adduct peaks from 680 to 1826.3 corresponding to molecules with DP from 4 to 11 (Figure 19a). For agaves of 4 years the sodium adduct peaks showed a distribution from 706 to 4870 Da (DP from 4 to 30 respectively) with an increased intensity in adduct peaks from 1014.6 to 2313.1 Da corresponding to molecules with DP from 6 to 14 (Figure 19b).Therefore, it seems that oligosaccharides in 4 years old agave plants were longer than in 2 years old agave plants. Contrary to the behaviour observed in 4 years old agave plants, in 6 ½ years old agave plants there was a decrease in the distribution of adduct peaks as well as in the intensity of them, the distribution of adduct peaks was from 690 to 3912 Da corresponding to DP from 4 to 24 respectively (Figure 19c), thus an apparent decrease in the size of molecules been occurred. A similar distribution was found in older A. tequilana plants (8 years) from other regions, the distribution of adduct peaks varied from 527 to 4739 Da corresponding to DP values from 3 to 29 (Lopez et al 2003). It can be also observed that for 2, 4 and 6 ½ years old agave plants, in general there was a decreasing trend in the amount of oligosaccharides as the molecular weight


73

was increased, the same behaviour has been reported by Lopez et al (2003) in agave plants of 8 years, therefore it can be concluded that this is a typical distribution of A. tequilana fructans.

Figure 19: MALDI-TOF-MS spectrum of Agave tequilana fructans of different age; (a) 2 years (b) 4 years and (c) 6 ½ years

This distribution is different to other linear β(2→1) synthesizing plants like chicory (Cichorium intybus L) and Jerusalem artichoke (Helianthus tuberosus L.), with distributions higher than DP 30 at harvest point (Monti at al 2005; Saengthongpinit et al 2005). According to the MALDI-TOF-MS distributions observed in agave plants from 2 to 6 ½ years (Figure 19 a-c), it was possible that an increase in polymerization from 2 to 4 years have occurred with an increase in sugar accumulation (Table 4), and then a depolymerization from 4 to 6 years by the transformation of longer fructans to lower


74

length fructans. Nevertheless, the accumulationof total sugar was less increased in agave plants from 4 to 6 ½ years (Table 4). It was previously found by Nava (1988) and Mendez (1999) that depolymerization of fructans in Agave tequilana started from 4 to 6 years by hydrolysis for the delivering of free sugars where they were required before flowering. Thus our results are in agreement with this previous behaviour observed. The polymerization and depolymerization of fructans is a phenomena observed in most of the fructan accumulating plants and is associated in most of the cases to regulation of water imbalances, adaptation to cold weather or to accumulation of reserve carbohydrate and post utilization as an energy source for flowering or re-growth (Dias-Tagliacozzo et al 2004; Wilson et al 2004; Monti et al, 2005; Saengthongpinit et al 2005; Orthen and Wehrmeyer 2004; Shiomi et al 2005; Vijn and Smeekens 1999; Tolsma et al 2007). Therefore, probably the behaviour observed of fructans distribution of A. tequilana plants from 2 to 6 ½ was due to a fructan accumulation process, which is a required step for agave plants before flowering.

C.4. Linkages analysis by GC-MS of A. tequilana fructans in plants of different ages.

The permethylation analysis was carried out in samples of 2, 4 and 6 ½ years old agave plants. As an example, figure 20 showed the chromatogram of permethylated alditol acetates (PMAA) obtained by GC for 4 years old agave plants.

Figure 20: Partially methylated alditol acetates analysis obtained by gas chromatography and gas chromatography coupled to mass spectrometry of derivatized Agave tequilana fructans of different age; 2 (a), 4(b) and 6 ½ (c) years. The peaks 1 and 2 correspond to the t-β-D-Fruf linkages, and peaks 3, 4, 5, 6, 7 and 8 correspond to the t-α-D-Glcρ, (2→6)-β-D-Fruf, (2→1)-β-D-Fruf, (2→1)/(2→6)-β-D-Fruf, i-α-D-Glcρ and 1,6-di-β-D-Fruf linkages respectively.


75

For the three different ages of agave plants, eight important peaks were found. Peaks 1, 2 (11.05 and 2 11.1 minutes, respectively) correspond to the permethylated alditol acetates 2,5-anhydro-1,3,4,6-tetra-O-methyl-D-mannitol and 2,5-anhydro-1,3,4,6-tetra-O-methyl-D-glucitol respectively, which are representative of fructose at the extreme of fructans with terminal t-β-D-Fruf linkages. Peak 3 (11.5 minutes) corresponds to 1,5-anhydro-2,3,4,6-tetra-O-methyl-D-glucitol, which reveals the presence of glucose at the extreme of the fructans chains with the terminal t-α-D-Glcρ linkage. Peaks 4, 5 and 6 (12.6, 12.7 and 12.8 minutes, respectively) resulted from 1-O-acetyl-2,5-anhydro-3,4,6-tri-O-methyl-D-mannitol, 6-O-acetyl-2,5-anhydro-1,3,4-tri O-methyl-D-mannitol and 1-O-acetyl-2,5-anhydro-3,4,6-tri-O-methyl-D-glucitol respectively, which represent the presence of (2→6)-β-D-Fruf, (2→1)-β-D-Fruf and (2→1)/(2→6)-β-D-Fruf linkages respectively, these linkages are present in the inulin type (2→1) and levan type (2→6) fructan chains. The presence of intern glucose bonded to molecules of fructose inside the fructan chains was revealed by the peak 7 (13.4 minutes), which corresponds to the PMAA of 6-O-acetyl-1,5-anhydro-2,3,4-tri-O-methyl-D-glucitol for the i-α-D-Glcρ linkages. The peaks 8, 9 (14.6 and 14.7 minutes, respectively) corresponds to 1,6-di-O-acetyl-2,5-anhydro-3,4-di-O-methyl-D-mannitol and 1,6-di-O-acetyl-2,5-anhydro-3,4-di-O-methyl-D-glucitol, which are representatives of the1,6-di-β-Fruf linkages, they are associated to fructose in the branching points of fructan molecules. This GC profile was similar to the results found in other reports of fructans linkage analysis of A. tequilana 8 years old plants (Lopez et al 2003; Mancilla-Margalli et al 2006). Nevertheless, in our case, variations were found in the heights of the different PMAA peaks in function of agave plant age, thus 357 integration of the area of the different PMAA peaks was carried out for 2, 4 and 6 ½ years old agave plants, and the mole percentage for each peak was calculated. The results are showed in Figure 21.

Figure 21: Glycosyl linkage composition (mol %) obtained by integration of the principal peaks of partially methylated alditol acetates gas chromatography of derivatized Agave tequilana fructans of different age; 2

(∎), 4(□) and 6 ½ (∎) years.


76

It can be observed that for t-β-D-Fruf linkages, the highest mole percentage was found for 2 years agave plants (55 ± 1.8 %), then there was a decrease in 4 years old agave plants (39 ± 2 %) and then it increased until 46.5 ±1.5 % in 6 ½ years old agave plants (Figure 21). Mancilla-Margalli et al (2006) have found that in 8 years old A. tequilana plants the mole percentage of t-β-D-Fruf linkages varied in function of cultivation region from 26 % to 42 %, in this work variations in the t-β-D-Fruf linkages inside the same cultivation region were caused by the age of A. tequilana plants. The (2→6)- + (2→1)-β-D-Fruf linkages are associated to levan (2→6) and inulin (2→1) chains (Figure 22), the lowest value was observed in 2 years old agave plants (25.5 ± 1.3 %), then in 4 years old agave plants it was increased until 37 ± 1.5 % and for 6 ½ years old agave plants in was decreased to 34 ± 1 %. The same behaviour was observed for the1,6-di-β-D-Fruf linkages, the lowest mol % was found in 2 years old agave plants (5 ± 0.6 %), it was increased in 4 years old agave plants (12 ± 1 %) and decreased in 6 ½ years old agave plants (6 ± 0.5 %). Mancilla-Margalli et al (2006) have found variations in function of cultivation region for 8 years old A. tequilana plants for (2→1) and (2→6) linkages, from 30 to 25 % and from 20 to 10 % respectively, as well as for fructose branched linkages (1,6-di-β-D-Fruf ) from 8 to 18 % depending of the cultivation region. As can be seen in Figure 21, an apparent relation exist in function of the age between the changes of t-β-D-Fruf linkages, with the increase and decrease of (2→6)- + (2→1)-β-D-Fruf and 1,6-di-β-D-Fruf linkages. It probably means that during the maturation process of A. tequilana plants, fructose at the extreme is removed for the synthesis of longer chains with both inulin β (2→1) and levan β (2→6) type linkages, as well as fructose bonded in branching points. In the case of glucose bonded inside the fructan chains (i-α-D-Glcρ linkages), from 2 to 4 years old agave plants, there was a decrease from 8 ± 0.8 to 2.5 ± 0.5 % mol, and then it was increased in 6 ½ years old agave plants to 6 ± 0.9 % mol (Figure 21). The opposite behaviour was observed for the linkages associated to glucose at the extreme of fructan chains (t-α-D-Glcρ linkages), from 2 to 4 years old agave plants, there was an increase from 5 ± 0.3 to 9 ± 0.7 % mol, and then it was decreased in 6 ½ years old agave plants to 7 ± 1 % mol (Figure 21). The differences found by Mancilla-Margalli et al (2006) for the linkages associated with glucose inside and at the extreme of fructans were 4 to 7 % and 1 to 8 % for i-α-D-Glcρ and t-α-D-Glcρ linkages respectively, and they were also in function of cultivation region for A. tequilana plants. As observed for fructose linkages, it could be possible that in function of the age of agave plants, there is a relation between disappearance of internal glucose and breaking out of bonds for the glucose inside the fructans in order to obtain glucose at the extreme of molecules. It means that possibly during the maturation process of A.


77

tequilana plants there is an active process of removing fructan chains and these structures changes in a very complex way.

D. Conclusion

In Agave tequilana plants, the profile of oligosaccharides changes in function of the age. The richest concentration of lower molecular weight fructans was observed in younger plants (2 years old agave plants) and due to its composition they could have potential as prebiotics. According with the quantity of sugar accumulated in A. tequilana plants of 6 ½ years, they could be used for the tequila elaboration process, which represents a reduction in the harvest time with economically rentable consequences for agave plant producers. However, it must be investigated the possible changes and the end of tequila fermentation process, which could affect the tequila quality. It was also observed a polymerization and depolymerization process, which was coupled with an increasing and decreasing branching degree of fructans, both of them with a maximum observed in 4 years old agave plants. These changes of polymerization and the branching degree of fructans could be associated to physiological necessary steps of A. tequilana plants before the flowering process.

E. Experimental Section .

E.1. Standard material. D-glucose, D-fructose and sucrose were purchased from Sigma-Aldrich. 1-kestose, nystose 96 and inulin from Dahlia tubers were supplied by Fluka. All other reagents were of analytical grade.

E.2. Plant material. A. tequilana plants of different ages cultivated organically were collected at the same time from the same cultivation zone (10 km perimeter) of the Usmajac valley (Jalisco state, Mexico). Agave plants of 2, 4 and 6 ½ years of growth from this region were used. According to the information provided by the producers, the age of plants was considered since hijuelos plantation. The diameter and weight of the agave heads at different ages were measured. The sampling process was carried out as follows: the agave head was cut transversally in two halves, one half was then cut in slices from the center to the exterior of the agave head, and 600 grams were taken from three slices. For each age group, this process of sampling was carried out from independent plants of A. tequilana. These samples were frozen for two days at - 20 °C and the water-


78

soluble carbohydrates (WSC) were extracted by mixing 66 ml of distilled water per 100 grams of sample, the mix was blended in a mechanical device made of stainless steel and then stirred at 70 °C for 7 hours. The WSC susp ension was then centrifuged (5 kg for 30 min) and the supernatant was filtered under vacuum with Whatman paper (3 mm CHR). The filtered solution was then lyophilized and stored in a dessicator until they were analyzed. Determination of total nitrogen was carried out in lyophilized samples in order to confirm the absence of proteins.

E.3. Total and free sugars quantification . Total sugar content was determined using anthrone: 100 µl of sample (WSC) were mixed with 200 µl of anthrone (200 mg of anthrone in 100 ml of H2SO4), and the mix was shaken and heated for 10 min at 100 °C. The reactio n was stopped by immersion in ice for 5 min. The sugar content was obtained by comparing the absorbance of sample at 625 nm against a standard curve of sucrose (0 to 100 µg ml-1). Free reducing sugars of all agave samples were determined using 3,5 dinitrosalicylic acid (DNS) reagent : 100 µl of sample (WSC) were mixed with 100 µl of DNS reagent (DNS 10 gl-1, 300 gl-1 sodium and potassium tartrate and NaOH 16 gl-1), the mix was shaken and then heated for 5 min at 100 °C. The reaction was stopped by immersio n in ice for 5 min, then the free sugars was obtained comparing the absorbance of sample at 540 nm against a standard curve of fructose (0 to 2 g l-1). The total fructan content was calculated by the difference between the total sugar content and the free reducing sugars.

E.4. High performance liquid chromatography . High performance liquid chromatography analysis device consisted in a Dionex ASI 100 (Sunnyvalle, CA, USA) with a Shodex 101 RI detector. One column was employed for the analysis of the carbohydrates; a Biorad HPLC Carbohydrate Analysis column: Aminex HPX-87 C column (300 x 7.8 mm; Biorad, Hercules, CA, USA) at 80 °C (elution with degassed ultrapure water at a flow rate of 0.5 ml min-1). As standards, inulin from Dahlia tubers, glucose, fructose, sucrose and nystose were used. The samples of A. tequilana WSC from different ages were diluted in water distilled (100 g/l) and then filtered (membrane with 0.45 µm) before they were injected. After quantification of sugars, the percentage of free and polymerized sugars was calculated.


79

E.5. Liquid chromatography-mass spectrometry (LC-MS) . The molecular mass of fructooligosaccharides was determined by LC-MS using a Q-Trap mass spectrometer from Applied Biosystems. The separation was achieved with C18 RP fusion column and fructans were ionized by Electron Spray Ionisation (ESI) at 450 °C, with a declustering potential of 60 volt, separated by a quadripole and detected in positive ion mode.

E.6. High performance anion exchange chromatography (HPAEC-PAD) . Separation of the WSC of the lyophilized extracts obtained from A. tequilana stems of different ages was performed by HPAEC with pulsed amperometric detection (HPAEC PAD, Bio-LC50 system, detector ED40, Dionex, Sunnyvalle, CA, USA) using an analytical CarboPac PA-100 column (4 x 250 mm; Dionex, Sunnyvalle, CA, USA). The column temperature was 35 °C, and a sodium acetate gradient in 150 mM NaOH was used at a flow rate of 1 ml min-1. The elution program consited of 6 mM sodium acetate (0-10 min), 6-500 mM (10 –190 min), and 6 mM (190 – 200 min). As standards, inulin from Dahlia tubers, glucose, fructose, sucrose, 1-kestose and nystose were used. The samples of A. tequilana WSC from different ages were 153 diluted in water distilled (10 g/l) and then filtered (membrane with 0.45 µm) before they were injected. Inulin was injected at 5 g/l.

E.7. MALDI-TOF-MS Analysis . The MALDI-TOF-MS measurements were performed using a Perseptive DE-STR (Voyager; Perseptive Biosystems; Framingham, MA, USA) mass spectrometer in positive linear mode using an accelerating voltage of 20 KV, 96 % grid and 350 ns delay time. Mass spectra were acquired from 100/m/z/to 6000/m/z. This procedure typically results in a mass accuracy of 10 to 50 ppm. Different concentrations of the sample were assayed in order to optimize the MALDI-TOF-MS analysis, 1 mg/ml was the optimum concentration and the distribution profile was the same for each age independently of the concentration used. Samples were dissolved in water (1mg/ml) and incubated 10 min at 50 °C. A sample solution with 0.5 µl was mix ed with 0.5 µl of the matrix solution (2,5-dihydroxybenzoic acid 10 mg ml-1 in H2O:EtOH 0.5:0.5; v/v) and a total of 1 µl was applied to a stainless steel sample slide and dried under vacuum.


80

E.8. Glycosyl linkage analysis . The alditol-acetate analysis method was carried out with 5 to10 mg of ATF double freeze dried material, they were dissolved in 500 µl of DMSO, then they were sonicated 7 min and 60 mg of dried sodium hydroxyde was added. The mix was sonicated for 21 min more. Then for the methylation reaction 200 µl of ICH3 was added and sonicated again for 7 min and reaction was continued for 2 h in the darkness. To stop the reaction, 1 ml of ethanol was added. In order to eliminate the extra iodine, 80 mg of sodium thiosulfate was added. Permethylated carbohydrates were extracted 3 times with CHCl3, washed with water and dried under a stream of nitrogen. Those derivatives were hydrolyzed under mild acid conditions with 0.5 M TFA at 90 °C for 1 h. Reduction was carried out with 10 mg of NaBD4 dissolved in 1 ml of a NH4OH solution (50 % v/v NH4OH 1 M + 50 % v/v absolute EtOH). This reaction was carried out during 1 h, this mix was dried under a stream of nitrogen. Acetic acid (20 µl) was added to destroy the borate excess, subsequent additions (20 µl of acetic acid + 70 µl of MeOH) and drying were performed 5 times, the same process was applied 5 more times with only 70 µl of MeOH in order to ensure borate destruction. Acetylation was carried out by the addition of 70 µl of pyridine and 70 µl of acetic anhydride and the reaction was performed during 1 h at 110 °C. Then it was dried under a stream of nitrogen. For GC analysis, the derivatized fructans were dissolved in 2 ml of cyclohexane. Injection of 1 µl was performed in a gas chromatograph (Hewlett-Packard 4890) and separated on a 25 m x 0.22 mm column with a GC initial temperature of 100 °C followed by an increase until 290 °C with a rate of 3 °C min -1. The injector and detector (ionization flame) temperatures were 260 and 310 °C respectively. Heli um was used as the carrier gas (2.5 ml h-1). A mass spectrometer (Hewlett-Packard 5889 series) was used for the identification of compounds in the electron ionization mode. The peaks corresponding to different linkages (partially methylated alditol acetates) were identified and compared to the profile found by Mancilla-Margalli et al (2006). After this, they were integrated and the percentage of area were calculated (mol percentage).


81

F. References .

Avila-Fernandez, A.; Olvera-Carranza, C.; Rudiño-Piñera, E.; Iliana-Cassab, G.; Nieto- Sotelo.; Lopez-Munguia, A., Molecular characterization of sucrose: sucrose 1-fructosyltransferase (1-SST) from 423 Agave tequilana Weber var. azul. 2007. Plant Sci 173, 478-486. Avila-Fernandez, A.; Rendon-Poujol, X.; Olvera, C.; Gonzalez, F.; Capella, S.; Peña-Alvarez, A.; Lopez-Munguia, A., Enzymatic Hydrolysis of fructans in the tequila production process. 2009. J Agric Food Chem, 57, 5578-5585. Borromeni, C.; Careri, M.; Cavazza, A.; Corradini, C.; Elviri, L.; Mangia, A.; Merusi, C., Evaluation of fructooligosaccharides and inulins as potentially health benefiting food ingredients by HPAEC-PED and MALDI-TOF MS. 2009. Int J Anal Chem, doi:10.1155/2009/530639. Cedeño, M., Tequila production. 1995. Crit Rev Biotechnol, 15, 1-11. Dias-Tagliacozzo, G.M.; Itaya, N.M.; Machado de Carvalho, M.A.; Figueiredo-Ribeiro, R.C.; Dietrich, S.M.C., Fructans and water suppression on intact and fragmented rhizophores of Vernonia herbacea. 2004. Brazilian Archives of Biology and Technology, 47(3), 363-373. Faustini-Cuzzuol, G.R.; Machado-Carvalho, M.A.; Penteado-Zaidan, L.B.; Roberto-Furlani. Nutrient solutions for plant growth and fructan production in Vernonia herbacea. 2005. Pesquisa Agropecuaria Brasileira, 40(9), 911-917. Hendry, G., The ecological significance of fructan in a contemporany flora. 1987. New Phytol, 106 (1), 201-216. Livingstone, D.P.; Premakumar, R.; Tallury, S.P., Carbohydrate partitioning between upper and lower regions of the crown in oat and rye during cold acclimation and freezing. 2006. Criobiol 52(2), 200-208. Lopez, M.G.; Mancilla-Margalli, N.A.; Mendoza-Diaz, G., Molecular structures of fructans from Agave tequilana Weber var. azul. 2003. J Agric Food Chem, 51, 7835-7840.


82

Mancilla-Margalli, N.A.; Lopez, M.G., Generation of Maillard compounds from inulin during the thermal processing of Agave tequilana Weber var. azul. 2002 J Agric Food Chem, 50, 806-812. Mancilla-Margalli, N.A.; Lopez, M.G., Water-soluble carbohydrates and fructan structure patterns from Agave and Dasylirion species. 2006. J Agric Food Chem, 54, 7832-7839. Martínez-Noël,G.; Tognetti, J.; Nagaraj, V.; Wiemken, A.; Pontis, H., Calcium is essential for fructan síntesis induction mediated by sucrose in weath. 2006. Planta, 225(1), 183-191. Mendez, R.M.D., Master in Science Thesis. 1999. Escuela Nacional de Ciencias Biológicas –Instituto Politécnico Nacional de México, México. Monti, A.; Amaducci, M.T.; Pritoni, G.; Venturi, G., Growth, fructan yield, and quality of chicory (Cichorium intybus L.) as related to photosynthetic capacity, harvest time, and water regime. 2005. J Exp Bot, 56(415), 1389-1395. Morcuende, R.; Kostadinova, S.; Pérez, P.; Martínez-Carrasco, R., Fructan synthesis is inhibited by phosphate in warm-grown, but not in cold-treated, excised barley leaves. 2005. New Phytol 168, (3), 567-574. Nava, C.N., Master in Science Thesis. 1988. Colegio de Posgraduados de México, Mexico. Orthen, B.; Wehrmeyer, A., Seasonal dynamics of non-structural carbohydrates in bulbs and shoots of the geophyte Galanthus nivalis. 2004. Physiol Plant, 120, (4), 529-536. Pinal, L.; Cornejo, F.; Arellano, M.; Herrera, E.; Nuñez, L.; Arrizon, J.; Gschaedler, A., Effect of Agave tequilana age, cultivation field location and yeast strain on tequila fermentation process. 2009. J Ind Microbiol Biotechnol, 36, 655-661. Rodríguez-Garay, B.; Gutierrez-Mora, A.; Flores-Berrios, E.P.; Loera-Quezada, M.M. A. tequilana Weber var. azul: inicio del proceso. In A. Gschaedler, Ciencia y Tecnología del Tequila. 2004. vol 1 (pp 14-16). Guadalajara, CIATEJ press.


83

Saengthongpinit, W.; Sajjaanantakul, T., Influence of harvest time and storage temperature on characteristics of inulin from Jerusalem artichoke (Helianthus tuberosus L.) tubers. 2005. Postharvest Biology and Technology, 37, (1), 93-100. Sánchez-Marroquin, A.; Hope, P.H., Agave juice: Fermentation and chemical composition studies of some species. 1953. J Agric Food Chem, 1, 246-249. Shiomi, N.; Benkeblia, N.; Onodera, S.; Kawazoe, N., Fructooligosaccharides changes during maturation in inflorescences and seeds of onion (Allium cepa L. 'W202'). 2005. Can J Plant Sci, 86, (1), 269-278. Starbid, R.; Zuñiga, V.; Delgado, E.; Saake, B.; Toriz, G., Design of microspheres from blue Agave Fructans for drug delivery to the colon. Part 1. Esterification of Agave Fructans. 2007. Journal of Biobased Materials and Bioenergy, 2, (1), 238-244. Spies, T.; Praznik, W.; Hofinger, A.; Altmann, F.; Nitsch, E.; Wutka, R., Studies of fructans. 1. The structure of the fructan sinistrin from Urginea-maritima.1992. Carbohydr Res, 235, 221-230. Tolsma, A.D.; Read, S.M.; Tolhurst, K.G., Roots of Australian alpine plant species contain high levels of stored carbohydrates independent of post-fire regeneration strategy. 2007. Austral J Bot, 55, (8), 771-779. Urías-Silvas, J.E.; Cani, P.D.; Delmée, E.; Neyrinck, A.; López, M.G.; Delzenne, M., Physiological effects of dietary fructans extracted from Agave tequilana Gto. and Dasylirion spp. 2008. Br J Nutr, 99, 254-261. Vijn, I.; Smeekens, S., Fructan: More than a reserve carbohydrate. 1999. Plant Physiol, 120, (2), 351-359. Waleckx, E.; Gschaedler, A.; Colonna-Ceccaldi, B.; Monsan, P., Hydrolysis of fructans from Agave tequilana Weber var. azul during the cooking step in a traditional tequila elaboration process. 2008. Food Chem, 108, 40-48. Wang, N.; Nobel, P., Phloem transport of fructans in the crassulacean acid metabolism species Agave deserti. 1998. Plant Physiol, 116, (2), 709-714.


84

Wilson, R.G.; Smith, J.A.; Yonts, C.D., Chicory root yield carbohydrate composition influenced by cultivar selection, planting, and harvest date. 2004. Crop Science, 44, (3), 748-752.

85

Chapitre III: Purification et caractérisation d’une fructanase de Kluyveromyces marxianus spécifique des fructanes d’Agave tequilana et comparaison à

une enzyme commerciale.

Ce chapitre a été publiée dans Bioressource Technology .

Purification and substrate specificities of a fructanase from Kluyveromyces marxianus isolated from the fermentation

process of Mezcal

Arrizon J, Morel S, Gschaedler A, Monsan P. (2011) Bioressource Technol, 102, pp 3298-303

Chapitre III: Purification et Caractérisation d’une fructanase de Kluyveromyces marxianus spécifique des fructanes d’Agave tequilana et sa comparaison à une enzyme commerciale.

86

Du fait de la complexité de la composition et de la structure des fructanes d’Agave tequilana, ainsi que du fait de leur haut degré de branchement, il est important de trouver des enzymes spécifiques de ce type de substrat. Dans l’aguamiel (sève naturelle de la plante d’agave) et dans la fermentation du pulque (boisson d’agave non distillée) des levures appartenant à l’espèce Kluyveromyces marxianus productrices de fructanases ont été isolées. En général, dans les études réalisées par différents auteurs sur ce type de souche (K. marxianus isolées de fermentation de moûts d’agave) l’inuline est utilisée comme inducteur. De plus, aucune enzyme de ce type n’a été purifiée et biochimiquement caractérisée et aucune comparaison avec les fructanases commerciales n’a été réalisée. Pour ce motif, une fructanase produite par une levure K. marxianus isolée du procédé de fermentation du mezcal a été purifiée, biochimiquement caractérisée et comparée avec une enzyme commerciale ou cocktail enzymatique (FRUCTOZYME®). La levure K. marxianus OFF1 utilisée dans ce travail provient de la collection de souches du CIATEJ. Elle a été sélectionnée à partir d’un groupe de différentes levures isolées de fermentations de différents types de mezcal, et présente une activité fructanase induite par des fructanes d’agave.

Les activités suivantes ont été déterminées pour la caractérisation d’une fructanase spécifique des fructanes d’Agave tequilana :

• Production des fructanases avec fructanes d’agave comme inducteur.

• Purification de l’enzyme et détermination de la séquence du gène (annexe).

• Détermination du pH optimal, de la température optimale et de la stabilité thermique sur des substrats présentant différentes liaisons entre unités fructose, qui sont normalement trouvées dans la structure des fructanes d’Agave tequilana.

• Détermination de la spécificité sur des substrats présentant différentes liaisons entre unités fructose, qui sont normalement trouvées dans la structure des fructanes d’Agave tequilana.

• Comparaison de la capacité d’hydrolyse des substrats présentant différentes liaisons entre unités fructose avec une enzyme commerciale (FRUCTOZYME®).

Ces travaux font l’objet de la deuxième publication présentée dans ce chapitre.


87

PURIFICATION AND SUBSTRATE SPECIFICITIES OF A FRUCTANASE FROM Kluyveromyces marxianus ISOLATED FROM THE FERMENTATION PROCESS OF MEZCAL.







A. Summary

A fructanase, produced by a Kluyveromyces marxianus strain isolated during the fermentation step of the elaboration process of “Mezcal de Guerrero” was purified and biochemically characterized. The active protein was a glycosylated dimer with a molecular weight of approximately 250 kDa. The specific enzymatic activity of the protein was determined for different substrates: sucrose, inulin, Agave tequilana fructan, levan and Actilight® and compared with the activity of Fructozyme®. The hydrolysis profile of the different substrates analyzed by HPAEC-PAD showed that the enzyme has different affinities over the substrates tested with a sucrose / inulin enzymatic activity ratio (S/I) of 125. For the hydrolysis of Agave tequilana fructans, the enzyme also showed a high enzymatic activity and specificity than Fructozyme®, which is important for its potential application in the tequila industry.


88

B. Introduction.

Fructans are plant reserve carbohydrate polymers with fructose as the repeat unit and a single glucose moiety. Normally they can be found both in monocotyledons and dicotyledons, and are known as inulin owing to the fact that they were first isolated from Inula helenium. Inulin is a β (2→1) linear fructan which is built from 1-kestose. However, other type of fructans such as those found in grasses are β (2→6) macromolecules with building units based on 6 -kestose (Toriz et al 2007). Some of them are longer β (2→6) polymers know as levans and are normally produced from bacteria like Erwinia herbicola and Streptococcus salivarum (Stivala and Khorramian 1982). In the case of Agave tequilana fructans (ATF) they are based on neo-inulin structure (glucose moiety inside the fructose chain). They normally are branched polymers with complex structures combining fructose moieties linked by β (2→1) and β (2→6) bonds which have a degree of polymerization ranging from 3 to 29 units (Lopez et al 2003; Mancilla-Margalli and Lopez et al 2006). It has been found in ATF that the proportion of free and polymerized fructose as well as the branching degree change in function of plant age (Arrizon et al 2010). ATF are very important for the Mexican agro-industry as they constitute the principal raw material for tequila elaboration (Pinal et al 2009). In the traditional tequila process, ATF are hydrolyzed by cooking with incomplete hydrolysis (Waleckx et al 2008), which results in a fructose rich syrup (Pinal et al 2009) with some Maillard compounds important in the aroma quality of tequila (Mancilla-Margalli et al 2002). Nowadays, in order to improve the efficiency of the hydrolysis process, autoclaves are used, and more recently diffusers have replaced the use of autoclaves (Lamas et al 2004). The fructose syrup obtained after hydrolysis is fermented, distilled, and sometimes aged to obtain the final product (Pinal et al 2009). For the optimization of ATF hydrolysis, some studies have been performed developing enzymatic processes to reduce energy consumption and to increase sugar recovery. Muñoz-Gutierrez et al (2009) have characterized ATF hydrolysis with Fructozyme® (endo and exo inulinases produced by Aspergilllus niger) compared to inulin hydrolysis. They found a lower enzymatic specificity on ATF (Vmax=32,10 U/ml, Km=27 mM) than inulin (Vmax=34,10 U/ml, Km=7.2 mM). This behavior was attributed to the complex structure of ATF with high degree of branching as well as different ratio of β (2→1) / β (2→6) linkages. Therefore, the selection of enzymes with higher specificity on ATF is necessary for industrial application. Kluyveromyces sp. yeasts are good inulinase (EC3.2.1.80) producers (Singh et al 2007). The common characteristic of these enzymes is a high ratio of enzymatic activity on sucrose versus inulin (S/I ratio). In the case of Agave beverages, Kluyveromyces sp. yeast strains isolated from Aguamiel (Agave sap) and


89

pulque are inulinase-hyperproducing strains (Cruz-Guerrero et al 1995; Cruz-Guerrero et al 2006) capable of simultaneous production of lactases, pectinases and inulinases (Espinoza et al 1992). In these studies, inulin was used as substrate for inulinases characterization in Kluyveromyces sp. strains (Cruz-Guerrero et al 1995; Zhang et al 2005; Singh et al 2007). Other substrates like sucrose have been extensively used (Cruz-Guerreo et al 1995; Zhang et al 2005; Singh et al 2007; Treichel et al 2009). To our knowledge only one report has been published over the use of a Kluyveromyces marxianus enzymatic extract on Agave fructo-oligosaccharides to obtain fructose syrup (Garcia-Aguirre et al 2009), but there are no reports about the biochemical characterization of a purified fructanase from K. marxianus on ATF as substrate. In this study, a purified enzyme from a K. marxianus yeast strain (isolated from the fermentation of Mezcal in the State of Guerrero, Mexico) was biochemically characterized. As A 1 TF is a complex mixture of short and long fructose polymers with levan β-(2→6) and inulin β-(2→1) type linkages, the hydrolysis was characterized on short fructooligosaccharides like sucrose and Actilight®, and lon fructooligosaccharides like inulin and levan. Actilight® is a commercial mixture of low molecular weight fructooligosaccharides. This is the first time that a fructanase from K. marxianus is evaluated on ATF, Actilight® and levan substrates. The hydrolysis of these substrates is useful to study how the different fructose linkage types present in ATF are hydrolyzed. The same tests were carried out with Fructozyme® for comparing the enzymatic capacity of the purified enzyme with industrial enzymes.

C. Results and Discussion.

C.1. Enzyme purification and partial molecular characterization of the fructanase .

The fraction eluted at 0,15 M (NaCl in Tris-HCl 20 mM) showed the highest enzymatic activity on ATF and corresponded to the purified protein. A yield recovery of 51 % and a purification factor of 12.3 were obtained (Table 6). The enzyme showed in Coomassie blue gel only one glycosylated dispersed band with a molecular weight of approximately 250 kDa (data not shown). It has been found that K. marxianus produces glycosylated inulinases with a molecular weight from 200 to 250 kDa (Pessoa and Vitolo 1997), thus the purified fructanase is within this range. The purified fructanase was separated in two monomers by simple heating with a molecular weight of 125 kDa (data not shown). After deglycosylation, a clearer band with a molecular weight approximately of 65 kDa was observed (data not shown). In literature, inulinases from Kluyveromyces sp. yeasts are


90

close to 60 kDa (Wen et al 2003). The protein showed a typical pink band of fructanase activity in the zymogram (Gabriel and Wang 1969) at 250 kDa. Then a zymogram was performed in the same gel with different substrates (sucrose, inulin and ATF) and it showed enzymatic activity on these different fructose linkages. The fructanase lost the activity when it was deglycosylated (data not shown). It has been found that the deglycosylation decrease the thermal stability and the specificity as well as tolerance to metal ions of a β- fructofuranosidase from Aureobasidium sp ATCC-20524 (Hayashi et al 1992; Hayashi et al 1994). Therefore, it is possible that glycosylation is important for the enzymatic activity of the purified fructanase. Table 6: Fructanase purification.

Step Total activity (U) Total protein (mg) Specific activity (U/mg)

Yield recovery (%) Purification factor

1

7600

1890

4.02

100

1

2

6460

229.5

28.14

85

7

3

3876

78.24

49.5

51

12.3

1: Crude extract. 2: Filtration with membrane 100 kDa. 3: Mono Q Sepharose anionic column.

C.2. Biochemical characterization .

C.2.1. Effect of pH and temperature on enzymatic activity on different substrates .

A maximum enzymatic activity occurred at pH 5.0 for inulin, Actilight® and sucrose (Table 7). For other K. marxianus, differences in the values of the optimal pH depending on the substrate and yeast strain were observed (Table 8). The optimal pH for inulin and sucrose observed for this fructanase were similar (Table 7). For Actilight®, there is no report on enzymatic hydrolysis with inulinases from Kluyveromyces sp. The optimal pH was the same as inulin, possibly due to β (2→1) linkages. In the case of levan, the maximum enzymatic activity was found between 4.5 and 5.0 (Table 7) and it is also the


91

first time reported. For ATF, the enzymatic activity was constant from pH 4.0 to 6.5. Thus, the effect of the enzyme concentration on enzymatic activity on ATF was verified at a pH range from 3.0 to 7.5 (data not shown). Low variations with a 1 small increase in a pH range from 4.5 to 5.0 were observed (Table 7). The optimal temperature for levan and ATF hydrolysis was 50 ºC, while for inulin, Actilight® 3 and sucrose it was 55 ºC (Table 7). Table 7: Optimal temperature, pH and thermal stability of K. marxianus fructanase using different substrates.

Substrate

Optimal Ph

Optimal T (ºC)

Thermal stability (ºC)

Levan

4.5-5 (16.6)*

50 (15.8)*

40 (100)γ

Inulin

5 (52.4)*

55 (41.2)* 40 (84.2)γ

Agave tequilana

fructans

4.5-5.5 (1253.1)* 50 (1406.2)* 40 (98.6)γ

Actilight® 5 (6000)*

50-55 (3750)* 40 (92.9)γ

Sucrose 5 (7656.2)* 55 (7187.5)* 40 (100)γ

*Maximum enzymatic activity of the fructanase (U/mg). γ percentage of residual enzymatic activity (%) at 72 hours of reaction.

As well as for the optimal pH, the optimal temperature for other Kluyveromyces fructanases varied in function of strain and substrate (Table 8).For Actilight®, levan and ATF, there are no reports of optimal temperature for a fructanase from Kluyveromyces marxianus. The optimal temperatures were the same for Actilight® and inulin, possibly due to the presence of β (2→1) linkages, as well as for levan and ATF, possibly due to the presence of β (2→6) linkages. Therefore, it seems that for this fructanase, linkage


92

type could correlate with optimal temperature. Thermal stability of the protein was also determined. The enzyme was stable at 40 ºC for all the substrates (Table 7). Even though the different pH and temperatures tested, the highest and lowest hydrolysis efficiency corresponds to sucrose and levan respectively (Table 7). Table 8: Comparison of the optimal pH, temperature and kinetic parameters of different inulinases from Kluyveromyces sp. yeast strains versus the purified protein.

Yeast strain

Substrate

pH

T

(°C)

Km

(mM)

Reference

ATCC16045

Sucrose

4.75

55

13.4

Kushi et al (2000)

Inulin - 55 17.3

NRRL-Y-7571

Sucrose 4.4-4.8 50 13 Treichel et al (2009)

CDBB-L-278 Sucrose 5 70 40.2 Cruz-Guerrero et al (1995)

Inulin 5 50 3.04

YS-1 Inulin 5.5 50 3.4 Singh et al (2007)

KWO Inulin 4.5 55 5.88 Zhang et al (2005)

Purified fructanase

Sucrose 5 55 29.1 This work

Inulin 5 55 7.26 This work


93

C.2.2. Effect of substrate concentration on the enzymatic activity .

The fructanase followed Michaelis-Menten kinetics for all the substrates tested. The regression coefficient of the linear adjustment was close to 1.0 (Table 9). As the molecular weight of the substrate tested was increased, Km and kcat were decreased (Table 9). The values of kcat/Km showed that the catalytic efficiency was similar for sucrose, Actilight® and ATF and was higher than kcat/Km for inulin and levan. It means that, the catalytic efficiency is higher for low molecular weight substrate molecules (sucrose) and lower for high molecular weight molecules (levan).This behavior can be explained in terms of the access of substrate to the active site of the enzyme. The Km values for inulinases from other K. marxianus showed a high variability 1 for sucrose and inulin (Table 8). The Km values found for the fructanase were within the range reported (Table 9). For ATF, Km was 12.9 mM, which was different from the value reported by Muñoz-Gutierrez et al (2009) using Fructozyme®. In the case of levan and Actilight®4, this is the first time that they are calculated with a fructanase from K. marxianus.


94

Table 9: Kinetic parameters of the K. marxianus fructanase on different substrates

Substrate Molecular

weight (kDa)

Km (mM) kcat (s-1) kcat / Km

(s-1 mM -1)

R2 γ

Levan

26570*

1.8 ± 0.21

0.33 ± 0.102

0.18 ± 0.01

0.98

Inulin

5000*

7.16 ± 0.34

0.70 ± 0.007

0.1 ± 0.00

0.99

A. tequilana

fructans

2690*

12.9 ± 0.39

11.7 ± 0.627

0.90 ± 0.03

0.98

Actilight®

617.6*

27.8 ± 3.98

30.2 ± 0.817

1.09 ± 0.13

0.99

Sucrose

342

29.1 ± 3.47

37.05 ± 1.234

1.27 ± 0.11

0.98

*Molecular weight average, γ Regression coefficient of Michaelis Menten linear adjustment.

C.3. Enzymatic hydrolysis profile on different substrates .

C.3.1. Comparison of enzymatic activity between the fructanase and Fructozyme ® on different substrates.

In general, the fructanase had a higher specific enzymatic activity than Fructozyme® on all the substrates (data not shown). For both systems, the highest enzymatic activity was observed on sucrose and Actilight® (data not shown). In the case of ATF and inulin hydrolysis, Fructozyme® had 1.7-fold more activity on inulin than ATF (data not shown), while the fructanase had 20-fold more activity on ATF than inulin (data not shown). Therefore, the fructanase has a technological advantage for ATF hydrolysis. Muñoz-Gutierrez et al (2009) have compared the enzymatic hydrolysis of inulin and ATF with Fructozyme®. A higher specificity over inulin than ATF was also observed. They explain


95

this behavior on the basis of the complex structure of the branched β (2→1) and β (2→6) molecules of ATF. As the K. marxianus yeast strain used cames from an Agave fermenting step, it could be possible that by evolution, it has developed specific enzymes for ATF consumption. The protein has a S/I ratio of 125, which means that the enzyme acts preferably by an exo-inulinase mechanism (data not shown). In the case of levan, Fructozyme® showed a very low enzymatic activity (data not shown), which was lower for the fructanase (data not shown). Normally, the β (1 2→6) linkages are preferentially degraded by levanases, most of them produced by bacteria. For example, Thermotoga maritima has an exo-inulinase capable of β (2→1) and β (2→6) fructose linkages hydrolysis (Muñoz-Gutierrez et al 2009). As can be seen, both types of enzymatic systems have differences in specificity for the substrates tested. For a better characterization of the hydrolysis of sucrose, Actilight, ATF, inulin and levan, an enzymatic hydrolysis was carried out with solutions of these substrates at controlled rate (0.22 U/ml) with different dilutions of the fructanase and Fructozyme®. The profile of substrate hydrolysis was followed by HPLC and HPAEC-PAD. In the case of levan, it was not possible to determine the hydrolysis rate for the concentrated solution due to the very low enzymatic activity of the fructanase on this substrate.

C.3.2. Comparison of product hydrolysis between the fructanase and Fructozyme ® on different substrates by HPLC and HPAEC-PAD.

The hydrolysis rate and the total sugar hydrolyzed (TSH) followed by HPLC on the different substrates varied in function of the enzyme used (Figure 22). For sucrose, the hydrolysis rate was faster for the Fructozyme® than for the fructanase with a TSH of 99 and 82 % respectively (Figure 22). The same behavior was observed for Actilight® hydrolysis, with a TSH of 97 and 78.8 % respectively (Figure 22). The same behavior was corroborated by HPAEC-PAD (data not shown). Normally, the exo-inulinases have a higher specificity on short molecules like sucrose (Singh and Gill 2006). Thus, it could be possible that the exo-inulinases from Fructozyme® are more active than the fructanase. This could explain why the hydrolysis rate and TSH were higher on sucrose and Actilight® with Fructozyme® than the fructanase. For inulin hydrolysis followed by HPLC, the rate and the TSH were higher with Fructozyme® than with the fructanase with 100 and 74.5 % respectively (Figure 22). This could be caused by the synergetic action of endo and exo-inulinases of the enzymes mixture of Fructozyme®. When the hydrolysis rate of inulin was followed by HPAEC-PAD, for both enzymatic systems only fructose was observed without smaller fructans produced by break down of fructose linkages inside the polymer chain (data not shown). Therefore, it could be possible that


96

the fructanase acts more like an exo-inulinase enzyme, which is in agreement with the observed S/I ratio. Conversely, for ATF hydrolysis followed by HPLC, the hydrolysis rate and the TSH were higher for the fructanase than for Fructozyme® with 80 and 63.8 % respectively (Figure 22).

Figure 22: Comparison of the products of enzymatic hydrolysis on different substrates followed by HPLC with K. marxianus fructanase (□) and Fructozyme® (○), fructose (full symbols) and glucose (empty symbols).

Nevertheless for both enzymatic systems only fructose was observed by HPAEC-PAD as the principal hydrolysis product (data not shown). Even though the complex structure of ATF (Lopez et al 2003; Arrizon et al 2010), one more time the higher specificity of the purified fructanase over ATF is confirmed. It has been found that other K. marxianus yeasts isolated from agave beverages like “pulque (Agave fermented beverage)” and “Aguamiel (Agave sap)” are inulinase hyper-producing strains (Cruz-Guerrero et al 2006). The enzymatic extract of this type of yeast strains has been used for the


97

elaboration of high-fructose syrup from ATF (García-Aguirre et al 2009). Therefore, Kluyeromyces yeasts are well adapted to degrade this type of fructans. In the case of levan hydrolysis, only the level of fructose hydrolyzed was followed by HPLC. A very slow hydrolysis rate for Fructozyme® 20 was observed, corresponding to small quantities of fructose observed (data not shown), while for the fructanase the fructose concentration was not detected (data not shown).

C.4. Effect of ions in the hydrolysis of A. tequilana fructans .

As ATF is the substrate of industrial interest, a comparison of the enzymatic activity with the fructanase was carried out with and without the presence of different ions. It can be observed that a great reduction was observed in the enzymatic activity with Hg2+, Cu2+, Zn2+ and Mn2+ addition, with less than 50 % of residual enzymatic activity. The enzymatic activity on ATF was less affected by Fe2+, Fe3+, Ag+ and Ba2+ with more than 50 % of residual enzymatic activity. Only Ca2+ was capable of increasing the enzymatic activity by 10 %. This result was congruent with the reduction of enzymatic activity in presence of EDTA. It therefore seems that Ca2+ has a significative role on the enzymatic activity. It can be noticed that A. tequilana juice has naturally a high concentration of Ca2+.

D. Conclusion This is the first time that a purified fructanase from Kluyveromyces marxianus is characterized for the enzymatic hydrolysis over short fructooligosaccharides (Actilight®), ATF and levan. An antagonist correlation between substrate specificity and molecular weight of substrates was established for the fructanase. The hydrolysis profile analyzed by HPLC and HPAEC-PAD showed that possibly the fructanase acts by an exo-inulinase mechanism, and it has more hydrolysis capacity over ATF than Fructozyme®. The fructanase is activated by Ca2+, which is naturally present in Agave tequilana. Therefore, the protein has a higher potential application in the tequila industry than Fructozyme®.


98

E. Experimental Section .

E.1. Yeast strain and chemicals .

Kluyveromyces marxianus strain belonging to the culture collection of the Centro de Investigación y Asistencia en Tecnología y Diseño del Estado de Jalisco (Guadalajara, Mexico) was used. Substrates used include sucrose (Sigma-aldrich), inulin from Dalhia tubers (Fluka), levan from Erwinia herbicola (Sigma-aldrich), nystose (Fluka) and 1-kestose (Fluka). Actilight® 16 is a commercial mixture composed of 4.8 % w/v of free sugars (sucrose, glucose and fructose), 35.1 % w/v of 1-kestose, 53 % w/v of 1-nystose and 7.1 % w/v of 1-fructofuranosyl-nystose and it was provided by Beghin Meiji (Marckolsheim, France). ATF was provided by BUSTAR Alimentos (Guadalajara, Mexico). Fructozyme® was purchased from Novozymes A/S (Denmark).

E.2. Enzyme production .

Yeast propagation was carried out by an overnight culture (30 ºC, 250 rpm) in liquid medium (yeast extract 10 g/l, peptone 20 g/l and glucose 20 g/l, pH 5). Then, 2 x 106 cells were inoculated in an optimized medium (yeast extract 0.5 g/l, K2HPO4 3 g/l, CaCl2 and MnCl2 0.002M, pH 5.0 and sterilized by 15 min at 121 °C) , then 50 g/l of ATF was added after filtration (0.45 µm). Fermentation was carried out during 72 hours (30 ºC, 250 rpm) and PMSF (phenylmethylsulfonyl fluoride) was added (0.001 M) as protease inhibitor. The cells were discarded by centrifugation (5000 rpm, 30 min, 4 ºC) and the extract was dialyzed during 24 h at 4 ºC in Tris-HCl (20 mM, pH 7.0), then the dialyzed solution was lyophilized and the powder was conserved at -20 °C.

E.3. Enzyme purification . The lyophilized extract (1.89 g) was dissolved in 1.0 l of buffer A (Tris-HCl 20 mM, pH 7.8) and concentrated to 30 ml by ultrafiltration (100 kDa ultrafiltration filter). It was applied to an anion exchange column (monoQ Sepharose, GE Healthcare, UK) previously equilibrated with 10 column volumes (buffer A). Then the sample was loaded and eluted with buffer B (1 M NaCl in Tris-HCl 20 mM, pH 7.8) by three isocratic flows (0.06, 0.15 and 1.0 M of NaCl). Protein concentration was followed by UV (280 nm) and the enzyme activity was determined by incubation with 2 % (w/v) of substrate in 100 mM acetate buffer, pH 5.0 at 50°C, the rate of glucose and fructose released was determined as described below. Purification of the protein was verified by analysis of the


99

fractions with a 3-8% acrilamide gradient gel by SDS-PAGE and Coomassie staining. A molecular weight characterization of the purified protein was carried out with four different treatments; protein control sample (1). Monomer separation (2) by heating during 10 min at 65 °C. Deglycosylation (3) with 1 Endo Hf (New England Biolabs) at 37 ºC during 24 hours. Comparative control (4) with a commercial enzyme (Fructozyme, Novozymes). The four samples were charged in two replicates to a NuPAGE 3-8 % acrylamide gradient gel. Electrophoresis was carried out with Tris-Acetate buffer (150 V during 80 min). Coomassie staining and a zymogram according to Gabriel and Wang (1969) were applied with triphenyltetrazolium chloride (TTC) as revelator. This zymogram was carried on sucrose, inulin and ATF in order to detect activity on substrates with different fructose linkages.

E.4. Activity assays Enzymatic activity was determined on different substrates: 50 µl of the purified enzyme solution (0.637 – 63.7 mg/l) in 100 mM of acetate buffer were mixed with 50 µl of substrate solution (1 % w/v in 100 mM of acetate buffer), at pH 5.0 during 15 min, 50 ºC. The reaction was stopped by addition of 100 µl of dinitrosalicylic acid (DNS) and boiling for 5 min at100°C, then the mixture was placed on i ce. The blank was obtained by inactivation of 50 µl of diluted protein solution (0.637 – 6.37 mg/l) with 100 µl of DNS during 15 min, then 50 µl of substrate solution was added (1 % w/v). The absorbance was measured with a microplate reader at 540 nm. One unit of enzyme activity was defined as the amount of enzyme liberating one µmol of reducing sugars per minute.

E.5. Determination of optimal temperature, pH and thermal stability on different substrate .

Optimal pH was determined by measuring initial enzymatic activity at 50°C in 100 mM acetate buffer adjusted at different pH (3.0, 3.5, 4.0, 4.5, 5.0, 5.5, 6.0), and 100 mM Tris- HCl buffer for solutions at pH 6.0, 6.5, 7.0, 7.5 and 8.0. For each pH value, substrate solutions (1 % w/v) were prepared for all the substrates. Optimal temperature was determined by measuring enzymatic activity as previously described at a constant pH (5.0) and it was carried out at 30, 40, 50, 55, 60, 70 and 80 ºC. For the thermal stability, enzyme solutions with a substrate concentration of 1 % w/v (100 mM buffer adjusted to optimal pH depending of the substrate) and the reactions were maintained at different constant temperatures (40, 50 and 60 ºC) during 72 hours.


100

E.6. Effect of substrates concentration on fructanase activity . Solutions (100 mM buffer at optimal pH depending on the substrate) were prepared as follows: for inulin and levan, 0.25, 0.5, 1.0, 1.5 and 2 % (w/v) of substrate were used, while for sucrose, Actilight® and ATF, 1, 2, 3, 4, 5 and 10 % (w/v) of substrate were used. The enzymatic activity was carried out as described before at optimal temperature depending on substrate. Km (mM) and V max (U/ml) were calculated from the Michaelis-Menten equation. Catalytic constant kcat (s -1) was calculated considering the concentration of enzyme and molecular weight of the protein (250 kDa). The values of the molecular weight of A. tequilana fructans, inulin and levan were taken from the reports of Toriz et al (2007), Haraguchi et al (2003) and Stivala et al (1982) respectively. The molecular mass of Actilight® was calculated from the composition reported by Barthomeuf et al (1997).

E.7. Comparison of enzymatic hydrolysis of different substrates by the fructanase and Fructozyme ®

.

The protein concentration of the purified enzyme and Fructozyme® 20 corresponding to 63.7 mg/l and 8800 mg/l respectively, were determined by the Bradford method (Bradford 1976). Then hydrolysis reactions were performed with solutions of sucrose, Actilight® and ATF (5.0 % w/v of substrate in 100 mM acetate buffer), and with inulin and levan solutions (2.0 % w/v of substrate in 100 mM acetate buffer). The reactions were performed at optimal pH and temperature depending on the substrate. A hydrolysis rate of 0.22 U/ml was chosen for performing the reactions during 48 hours.

E.8. Quantification of hydrolysis products by high performance liquid chromatography (HPLC) .

High performance liquid chromatography analysis device consisted in a Dionex ASI 100 (Sunnyvalle, CA, USA) with a Shodex 101 RI detector. The column was a Biorad HPLC Carbohydrate Analysis column: Aminex HPX-87 C column (300 x 7.8 mm; Biorad, Hercules, CA, USA) at 80°C (elution with degassed u ltrapure water at a flow rate of 0.5 ml min-1). As standards, inulin, glucose, fructose and sucrose were utilized. All the samples of substrate hydrolysis reactions were diluted in distilled water and then filtered (membrane with 0.45 µm) before injection.


101

E.9. Hydrolysis profile evolution determined by high performance anionic exchange chromatography with pulsed amperometric detection (HPAEC-PAD).

Separation of the products of the hydrolysis reactions was performed by HPAEC with pulsed amperometric detection (HPAEC-PAD, Bio-LC50 system, detector ED40, Dionex, Sunnyvalle, CA, USA) using an analytical CarboPac PA-100 column (4 x 250 mm; Dionex, Sunnyvalle, CA, USA). The column temperature was 35 °C, and a sodium acetate gradient in 150 mM NaOH was used at a flow rate of 1 ml.min-1. The elution program consisted of 6 mM sodium acetate (0-10 min), 6-500 mM (10 –190 min), and 6 mM (190 - 200 min). As standards, inulin, glucose, fructose, sucrose, 1-kestose and nystose were used. The samples of the hydrolysis reactions were diluted in distilled water and filtered (0.45 µm membrane) before injection.

E.10. Effect of ions on A. tequilana fructans hydrolysis . As ATF is the substrate of interest for industrial application, the possible effect of ions over the enzymatic activity of the purified enzyme was evaluated by preparing a solution of ATF (2 % w/v in 100 mM acetate buffer adjusted to pH 5.0) at 50°C in presence of EDTA and different ions (Hg2+, Ag+, Cu2+, Cd2+, Ca2+, Mn2+, Mg2+, Fe2+, Fe3+ and Zn2+) at 20 mM, using HgCl2, AgNO3, Cd(NO3)2, CaCl2, MnCl2, MgCl2, FeSO4, FeCl3 and ZnCl2. A control reaction was carried out only with ATF in order to evaluate the effect of the presence of cations.

F. References .

Arrizon, G.; Morel, S.; Gschaedler, A.; Monsan, P., Comparison of the Water-Soluble Carbohydrate composition and fructan structures of Agave tequilana plants of different ages. 2010. Food Chem, 122, 123-130. Barthomeuf, C.; Grizard, D.; Teulade, J.C., Assay and structural determination of fructo-oligosaccharides synthesized by an enzymatic system from Penicilium rugulosum. 1997. Biotechnol Techniques, 11, 845-848. Bradford, M., A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding. 1976. Anal Biochem, 72, 248-254.


102

Cruz-Guerrero, A.; García-Peña, I.; Barzana, E.; García-Garibay, M.; Gomez-Ruiz, L. 1995. Kluyveromyces marxianus CDBB-L-278: A wild inulinase hyperproducing strain. 1995. J Ferment Bioeng, 80, 159-163. Cruz-Guerrero, A.E.; Olvera, J.L.; García-Garibay, M.; Gómez-Ruiz, L., Inulinase-hyperproducing strains of Kluyveromyces sp. isolated from aguamiel (Agave sap) and pulque. 2006. W J Microbiol Biotechnol., 22, 115-117. Espinoza, P.; Bárzana, E.; García-Garibay, M.; Gómez-Ruiz, L., 1992., Evaluation of Kluyveromyces marxianus for the producion of lactase simultaneously to pectinase or inulinase. 1992. Biotechnol Lett, 14, 1053-1058. Gabriel, O.; Wang, S.F., Determination of enzymatic activity in polyacrylamide gels. I. Enzymes catalysing the conversion of non-reducing substrates to reducing products. 1969. Anal-Biochem, 27, 545-554. García-Aguirre, M.; Sáenz-Álvaro, V.A.; Rodríguez-Soto, M.A.; Vicente-Magueyal, F.J.; Botello-Álvarez, E.; Jímenez-Islas, H.; Cárdenas-Manriquez, M.; Rico-Martínez, R.; Navarrete-Bolaños, J.L., Strategy for biotechnological process design applied to the enzymatic hydrolysis of Agave fructo-oligosaccharides to obtain fructose-rich syrups. 2009. J Agric Food Chem, 57, 10205-10210. Haraguchi, K.; Yoshida, M.; Otsubo, K., Purification and properties of a heat-stable inulin fructotransferase from Arthrobacter ureafaciens. 2003. Biotechnol. Lett., 25, 1049-1053. Hayashi, S., Shimokawa, Y., Tubouchi, M., Takasaki, Y., Imada, K. Properties of the deglycosylated beta-fructofuranosidase P-2 from Aureobasidium sp ATCC-20524. 1992. J Ind Microbiol, 10(3-4), 191-194. Hayashi, S.; Tubouchi, M.; Takasaki, Y.; Imada, K., The effect of chemicals on the activity of deglycosylated aureobasidium beta-fructofuranosidases. 1994. Lett Appl Microbiol., 18, (2), 105-106. Kushi, R.T.; Monti, R. ; Contiero, J., Production, purification and characterization of an extracellular inulinase from Kluyveromyces marxianus var. Bulgaricus.2000. J. Ind Microbiol Biotechnol., 25, 63-69. Lamas-Robles, R.; Sandoval-Fabian, G.C.; Osuna-Tenes, A.A.; Prado-Ramírez, R.; Gschaedler-Mathis, A.C. 2004. Cocimiento y molienda, in: Gsachaedler-Mathis, A.C. (Ed), 2004. Ciencia y Tecnologia del Tequila., Guadalajara, pp. 41-60.


103

Lopez, M.G.; Mancilla-Margalli, N.A.; Mendoza-Diaz, G., Molecular structures of fructans from Agave tequilana Weber var. azul. 2003. J Agric Food Chem, 51, 7835-7840. Mancilla-Margalli, N.A.; Lopez, M.G., Generation of Maillard compounds from inulin during the thermal processing of Agave tequilana Weber Var. azul. 2002. J Agric Food Chem., 50, 806-812. Mancilla-Margalli, N.A.; Lopez, M.G., Water-soluble carbohydrates and fructan structure patterns from Agave and Dasylirion species. 2006. J Agric Food Chem, 54, 7832- 7839. Muñoz-Gutierrez, I.; Rodríguez-Alegría, M.E.; Lopez-Munguía, A., Kinetic behavior and specificity of β-fructosidase in the hydrolysis of plant and microbial fructans. 2009. Process Biochem, 44, 891-898. Pessoa, A.; Vitolo, M., Separation of inulinase from Kluyveromyces marxianus using reversed micellar extraction. 1997. Biotechnol Techniques, 11, 421-422. Pinal, L.; Cornejo, E.; Arellano, M.; Herrera, E.; Nuñez, L.; Arrizon, J.; Gschaedler, A., Effect of Agave tequilana age, cultivation field location and yeast strain on tequila fermentation process. 2009. J Ind Microbio Biotechnol, 36, 655-661. Singh, P.; Gill, P.K., Production of inulinases: Recent advances. 2006. Food Technol Biotechnol, 44, (2), 151-162. Singh, R.S.; Dhaliwal, R.; Puri, M., Partial purification and characterization of exoinulinase from Kluyveromyces marxianus YS-1 for preparation of high-frutose syrup. 2007. J Microbiol Biotechnol, 17, 733-738. Stivala, S.S.; Khorramian, B.A., Assesment of branching in S. salivarum levan from small-angle X-ray scattering. 1982. Carbohydr Res, 101, 1-11. Toriz, G.; Delgado, E.; Zuñiga, V., A proposed chemical structure for fructans from blue agave plant (Tequilana Weber var. Azul). 2007. E-Gnosis, 5, 1-5. Treichel, H.; Mazutti, M.A.; Filho, F.M.; Rodrigues, M.I., Technical viability of the production, partial purification and characterization of inulinase using pretreated agroindustrial residues. 2009. Bioprocess Biosyst Eng, 39, 425-433. Waleckx, E.; Gschaedler, A.; Colonna-Ceccaldi, B.; Monsan, P., Hydrolysis of fructans from Agave tequilana Weber var. azul during the cooking step in a traditional tequila elaboration process. 2008. Food Chem, 108, 40-48.


104

Wen, T.; Liu, F.; Huo, K.; Li, Y.Y., Cloning and analysis of the inulinase gene from Klyveromyces cicerisporus CBS4857. 2003. W J Microbiol Biotechnol, 19, 423-426. Zhang, L.; Zhao, C.; Ohta, W.Y.; Wang, Y., Inhibition of glucose on an exoinulinase from Kluyveromyces marxianus expressed in Pichia pastoris. 2005. Process Biochem, 40, 1541-1545.

105

Chapitre IV: Criblage de l’activité enzymatique fructanase et transfructosylase de levures Non-

Saccharomyces isolées de différentes fermentations du mezcal.

Chapitre IV: Criblage de l’activité enzymatique fructanase et transfructosylase dans levures No-Saccharomyces isolées des différentes fermentations du mezcal.

106

Dans les procédés d’élaboration de boissons distillées obtenue a partir de l’agave, comme le mezcal, l’étape de cuisson est réalisé de manière rudimentaire ce qui a pour conséquence que les fructanes de la matière première ne sont pas toujours totalement hydrolysées a la fin de la cuisson. Ce procédé employé de manière ancestral, laisse supposer que les levures impliquées dans l’étape de fermentations se soient adaptées à dégrader les fructanes d’agave.

Au cours d’un autre projet développé au CIATEJ, les dynamiques microbiennes de différents procédés de fermentation de mezcal de Oaxaca ont été caractérisés et de nombreuses souches de levures ont été isolées. Etant donné l’hypothèse formulée dans le paragraphe antérieur, il nous a semblé intéressant de rechercher de nouvelles souches productrices de fructanases pour hydrolyser des fructanes (et également capables de faire la réaction inverse de synthèse) parmi ces levures.

130 levures de différentes espèces isolées ont donc été utilisées pour réaliser un criblage de l’activité fructanase et transfructosylase, puis une sélection a été réalisée pour une meilleure caractérisation de la production de ces enzymes. Les activités suivantes ont été développées :

A. Criblage de la croissance des levures sur milieu solide avec des fructanes comme source de carbone .

B. Criblage de l’activité fructanase sur différents substrats des levures sélectionnées.

C. Criblage de l’activité transfructosylase des levures sélectionnées avec deux concentrations de saccharose .

D. Caractérisation de la production de fructanases par les levures sélectionnées.

Ces travaux font l’objet de la troisième publication présentée dans ce chapitre.


107

FRUCTANASE AND FRUCTOSYLTRANSFERASE ACTIVITY OF NON-Saccharomyces YEASTS ISOLATED FROM FERMENTATIG MUSTS OF MEZCAL.







A. Summary.

Yeasts strains isolated from the fermentation of “Mezcal de Oaxaca” were screened for fructanase and fructosyltransferase activity. One hundred thirty non-Saccharomyces yeast strains from twenty distinct species were tested. Only fifty grew on solid medium with Agave tequilana fructans (ATF), inulin or levan as carbon sources. The most abundant strains were within Torulaspora delbrueckii, Kluyveromyces marxianus, Rhodotorula mucilaginosa and Zygosaccharomyces bisporus species. In liquid media, inulin was the strongest inducer of fructanase activity in K. marxianus, Issatchenkia orientalis and Z. bisporus yeast strains, while ATF was the strongest fructanase inducer for T. delbrueckii, Candida apicola and Cryptococcus albidus. High exohydrolase enzymatic activity on sucrose was observed for the enzymatic extracts of K. marxianus and T. delbrueckii, , while high endohydrolase activity on inulin and ATF was observed for I. orientalis, C. albidus, and C. apicola enzymatic extracts. The enzymatic extracts of Z. bisporus and C. boidinii had a high hydrolytic activity on levan. Sixteen enzymatic extracts were positive for fructosyltransferase activity (K. marxianus, T. delbrueckii and C. apicola). Temperature was statistically the most important factor for improving the fructosyltransferase yield with K. marxianus, T. delbrueckii, and C. apicola extracts. The highest fructooligosaccharide (FOS) yield (50 %) was reached at 200 g L-1 of sucrose, 40 º C and pH 6.5 for one K. marxianus strain.


108

B. Introduction .

Agave tequilana fructans (ATF) are neo-inulin (glucose moiety inside the fructose chain) polymers, with complex branched structures combining fructose moieties linked by β (2→1) and β (2→6) bonds (Figure 23). The degree of polymerization ranges from 3 to 29 fructose units (Lopez et al 2003; Mancilla-Margalli et Lopez 2006). The proportion of free and polymerized fructose as well as the branching degree of ATF changes as a function of plant age (Arrizon et al 2010).

ATF are very important for Mexican agro-industry as they constitute the principal raw material for tequila production (Pinal et al 2009). In the traditional tequila process, ATF are hydrolyzed by cooking, generating a fructose-rich syrup and a cooking honey (containing non hydrolyzed fructans). In some industries, an extra acid-thermal treatment is applied to the cooking honey to complete hydrolysis of the ATF (Waleckx et al 2008). Alternative enzymatic processes have been evaluated to reduce energy consumption and to increase sugar recovery from ATF (Muñoz-Gutierrez et al 2009; Ávila-Fernández et al 2009; Waleckx et al 2011). However, the identification of enzymes capable of efficiently degrading the complex structure of ATF remains an important problem (Muñoz-Gutierrez et al 2009).

The structural complexity of ATF (Lopez et al 2003; Arrizon et al 2010), may require the use of multiple enzymes capable of degrading both exo- and endo-hydrolase capabilities. Non distilled Agave beverages are a well known source of fructanase (β-fructofuranosidase)-hyperproducing yeast strains (Cruz-Guerrero et al 1995; Cruz-Guerrero et al 2006; García-Aguirre 2009) and recently a new fructanase from Kluyveromyces marxianus isolated from the fermentation of mezcal was purified and biochemically characterized (Arrizon et al 2011). It showed a high substrate affinity for ATF and exo-hydrolase activity (Arrizon et al 2011).

The fermentation process of “Mezcal de Oaxaca” has Agave non hydrolyzed fructans (Lappe-Oliveras et al 2008), involving yeast strains well adapted to Agave fructans degradation. Therefore, the purpose of this study is to evaluate yeast strains isolated from fermenting musts of “Mezcal de Oaxaca” for fructan hydrolytic activity using different fructose-containing substrates.

As ATF have prebiotic (Gómez et al 2010, Urías-Silvas et al 2008) and intestinal immunological effects (Minjarez-Ibañez et al 2010), it is possible to envisage the


109

production of short-chain fructooligosaccharides (FOS) by controlled ATF enzymatic hydrolysis. In addition, since FOS can be obtained diretly from sucrose (Buchholz et al 2008) via β-fructofuranosidase (Maiorano et al 2008, Velázquez-Hernández et al 2009), fructosyltransferase capacity will also be evaluated. Yeasts were previously isolated and characterized through PCR-restriction fragment length polymorphism (PCR-RFLP) of internal transcribed spacer (ITS) region of the 5.8 rRNA gene (ITS 5.8) and sequencing of the D1/D2 region of the 26S rRNA gene (Segura et al 2010).

o

OHO

HOOH

O

CH2

CH2

CH2

O1

6

2

O CH2

CH2OHO

6

2

HO HO

OHOH

O

OHO

OHCH2OH

H2C

O

HO

OHCH2OH

HOH2C

O

O CH2OH

CH2 O

O CH2OH

CH2OH O

m

2 OH

OH

HO

HO

O CH2OH

CH2OHO

2

n

HO

OH

Figure 23: General structure of Agave tequilana fructans proposed by Lopez et al (2003).

C. Results and discussion.

C.1. Screening of growth on solid medium with ATF, inulin and levan as carbon sources.

Differences in the growth capacity on solid medium of the non-Saccharomyces yeasts strains as a function of the fructans was observed, even within the same specie (Table 10). In general, a larger growth halo was observed on ATF (> 5 mm diameter) with 39 positive yeasts strains (Table 10). On inulin-containing medium, smaller growth halo size (2-5 mm diameter) was observed with 24 positive yeast strains (Table 10). Yeasts with positive growth on ATF and inulin medium were tested for growth on solid medium containing levan (Table 10). The smallest


110

growth halo was observed (< 3 mm diameter) with 17 yeast strains. ATF was the best substrate with a high number of growing yeasts, which is expected as they were isolated from different spontaneous fermentation processes of Mezcal. K. marxianus, T. delbrueckii, R. mucilaginosa and Z. bisporus were the principal growing yeast species in solid medium, with differences in predominance depending on the substrate. This shows the metabolic diversity of yeasts. These different microorganisms probably produce one or several enzymes with different fructose linkage specificities in order to degrade the complex structures of Agave fructans (Mancilla-Margalli et Lopez 2006). K. marxianus was highly induced by inulin (Singh et Gill 2006). This yeast is normally found in different fermenting musts of Agave beverages (Lappe-Oliveras et al 2008; Cruz-Guerrero et al 1995; Cruz-Guerrero et al 2006), with enzymes highly specific for ATF (Arrizon et al 2011). These findings explain the vigorous growth performance of K. marxianus with the fructans tested. Some yeasts had capacity to grow on only one type of fructan. Yeasts like C. boidinii and R. fluviale have probably been evolved for the degradation of ATF, while S. pombe, C. albidus, and H. osmophila produce enzymes only able to degrade the fructans with β (2→1) elongations possibly delivered by other fructanases produced by the Mezcal microbiota.


111

Table 10: Growth screening on solid medium with different fructans as carbon source.

Positive growth on different fructans

Yeast species Total of yeasts

screened ATF Inulin Levan

Zigosaccharomyces bisporus 28 4 2 1

Torulaspora delbrueckii 25 12 4 6

Kluyveromyces marxianus 13 11 6 -

Candida apicola 9 2 1 -

Candida zemplinina 3 1 - 1

Candida boidinii 3 2 - -

Candida parapilopsis 1 - - -

Pichia anomala 10 1 - 1

Schizosaccharomyces pombe 8 - 1 -

Rhodotorula mucilaginosa 6 3 5 5

Cryptococcus albidus 4 - 1 -

Hanseniaspora osmophila 4 - 1 -

Issatchenkia orientalis 4 1 2 1

Deckera anomala 4 - 1 1

Rhodosporidium fluvial 3 1 - -

Cyteromyces spp 2 - - -

Aerobasidium spp 1 - - -

Trigonopsis spp 1 1 - 1

Pseudozyme spp 1 - - -

Total of yeasts 130 39 24 17


112

C.2. Screening of fructanase activity induced in liquid medium with inulin and ATF.

Yeasts for growth on ATF and inulin solid medium (50 strains) were evaluated for fructanase activity following induction in liquid medium with inulin or ATF as inducers (Figure 24a and 24b respectively). Enzymatic activity was evaluated on different substrates. Only results from the 10 yeasts with highest induced enzymatic activity are provided (Figure 24). In general, when fructanase activity was induced by inulin, the highest value of enzymatic activity was observed on sucrose (DV4, DA5 and DF1, Kluyveromyces marxianus yeasts), followed by ATF (DI1, Torulaspora delbrueckii), then inulin (MJ and DX1, Rhodotorula mucilaginosa and Issatchenkia orientalis yeasts respectively) and finally levan (DJ2, Zygosaccharomyces bisporus) as shown in Figure 24a. In the case of induction by ATF, the highest values for fructanase activity were observed on sucrose (DA1 and DN1, T. delbrueckii yeasts), followed by ATF and inulin (MC3 and DC4, Candida apicola and Cryptococcus albidus yeasts respectively) and levan (DT1, Candida boidinii) as shown in Figure 24b. Comparing both inducers, Inulin is stronger than ATF, especially for K. marxianus strains (Figure 24a and b respectively). The induction in liquid medium with inulin and ATF showed the high metabolic diversity of Mezcal microbiota. This diversity probably results from differences in the chemical structure of ATF and inulin. As inulin was in general a stronger inducer for fructanase activity, it is probably more difficult to degrade ATF because of its complex structure (Lopez et al 2003, Arrizon et al 2010). In general, for K. marxianus and T. delbrueckiis strains, enzymatic activity was higher on sucrose than on inulin, ATF and levan. K. marxianus inulinases are considered as exo-inulinases (Vijayaraghavan et al 2009) because they present a high enzymatic activity on sucrose versus inulin (S/I ratio). Therefore, the enzymatic extracts of K. marxianus and T. delbrueckii strains can be considered as exo-hydrolase enzymes. Even though I. orientalis and R. mucilaginosa strains present the capacity to grow on solid medium with inulin or ATF, they were induced for fructanase activity only with inulin in liquid medium. I. orientalis and R. mucilaginosa yeasts are thus more efficiently induced for fructanase production in solid state fermentation, as observed for other yeasts like Cryptococcus aureus (Sheng et al 2009) and some K. marxianus strains (Bender et al 2008). I. orientalis, R. mucilaginosa, C. apicola and C. albidus showed a low S/I ratio. They thus could act as endo-hydrolases. C. albidus grew on solid medium with ATF. However, it was induced by inulin for fructanase production in liquid medium. The delivery of β(2→1) fructans in solid state fermentation by the Mezcal microbiota


113

thus probably induces the fructanases for C. albidus. Similar yeasts like C. aureus produced high levels of inulinases in solid state fermentation with inulin as inducer (Sheng et al 2009). As Z. bisporus and C. boidinii yeasts had a higher activity on levan, they could participate in very short periods of Mezcal fermentation, because the proportion of β (2→6) fructose elongations is low in Agave fructans (Mancilla-Margalli et Lopez 2006). C. boidinii was only induced in liquid media by ATF, which was congruent with growth capacity in solid medium. It is therefore well adapted for ATF degradation. Some Zygosaccharomyces yeasts like Z. rouxii were reported as invertase producers (Souciet et al 2009). It is an osmo and halotolerant yeast (Solieri et al 2008), as well as Z. bailii (Tofalo et al 2009). T. delbrueckii strains have been found in wine, at the beginning of fermentation, and other foods (Hanl et al 2005; Jeyaram et al 2008, Senses-Ergul et al 2006). They normally have ethanol tolerance (Bely et al 2008). Therefore, they could hydrolyze the Agave fructans at the beginning of Mezcal fermentation. R. mucilaginosa yeast strains are found as spoilage in foods (Senses-Ergul et al 2006), in the semi-dry processed coffee (Marques-Vilela et al 2010), in fermented milk products (Bai et al 2010). They have also shown capacity for the production of single-cell oil from molasses and inulin hydrolysates (Karatay et Dönmez 2010; Zhao et al 2010). R. mucilaginosa is not an ethanol producer (Senses-Ergul et al 2006). Therefore, it is possible that this yeast participates at the beginning of Mezcal fermentation. C. albidus has been found as spoilage yeast in foods (Senses-Ergul et al 2006). C. apicola produces ethanol in cachaca fermentation (Souza-Olivera et al 2005) and has been found in high sugar grape must (Tofalo et al 2009). I. orientalis participates in wine fermentation (Clavijo et al 2010), traditional milk fermentations (Bai et al 2010) and Himalayan fermented products (Pathania et al 2010). C. boidinii is a methylotrophic yeast not commonly found in alcoholic beverage processes (Yurimoto et Sakai 2009). All these yeast species are found in the Mezcal fermentation process. This is the first time that they are reported as fructanase producers.


114

Yeast strain

DF1 DA5 DV4 MC3 DI1 DD4 DS4 DX1 DJ2 MJ

Fru

ctan

ase

activ

ity (

U m

l-1

)

0.00

0.05

0.10

0.15

0.20

0.25

0.30

Yeast strain

DF1 DA5 DV4 MO6 MC3 DN1 DA1 DR1 DT1 DC4

Fru

ctan

ase

activ

ity (

U m

l-1

)

0.00

0.05

0.10

0.15

0.20

0.25

0.30

Figure 24: Fructanase activity induction with inulin (a) and ATF (b) for the yeasts Issatchenkia orientalis (DX1), Zygosaccharomyces bisporus (DJ2), Torulaspora delbrueckii (DD4, DS4, DI1, DA1, DN1 and DR1), Rhodotorula mucilaginosa (MJ), Candida apicola (MC3), Candida boidinii (DT1), Cryptococcus albidus (DC4), Kluyveromyces marxianus (DF1, DV4, DA5 and MO6). The enzymatic activity was evaluated on different substrates.

(a)

(b)

■ Sucrose

⊞ Inuline

■ ATF

□ Levan

Induction with inulin

Induction with ATF

■ Sucrose

⊞ Inuline

■ ATF

□ Levan


115

C.3. Characterization of fructanase production in selected yeast strains.

Six yeast strains (T. delbrueckii, C. boidinii, C. albidus and C. apicola) were selected for a deeper characterization of enzyme induction with ATF. Fructanase activity on sucrose was the highest for T. delbrueckii, followed by C. albidus, with a maximal activity between 12 and 36 hours of culture (Figure 25a). Fructanase activity on inulin was highest for C. albidus followed by C. boidinii, with both of them exhibiting a maximal activity at 12 hours of culture (Figure 25b). With ATF, similar values of the maximal fructanase activity were obtained for T. delbrueckii and C. albidus yeasts at 24 hours of culture (Figure 25c). Only T. delbrueckii strains exhibited a further increase in fructanase activity (Figure 25c). Peak fructanase activity on levan was highest for C. boidinii , followed by C. albidus and T. delbrueckii yeasts. A maximum of activity was observed between 12 and 36 hours of culture (Figure 25d). Because of ATF structural complexity (Arrizon et al 2010, Lopez et al 2003), fructanases with different fructose linkages specificities are necesary, and as one of the objectives of the present work is the discovery of new fructanase producers for ATF hydrolysis. This justifies the selection of the T. delbrueckii, C. apicola, C. albidus and C. boidinii for the characterization of fructanase production. The fructanase activity on the different substrates reached a maximum at early fermentation time (12-36 hours). ATF was therefore effective for a fast and high fructanase activity induction in these yeasts. For protein production, the highest concentration was observed for C. apicola (data not shown). A higher and faster biomass production was observed for all the T. delbrueckii strains. C. albidus and C. apicola showed a high biomass production after 48 hours of culture (data not shown). Therefore, fructanase activity was associated to cell growth for T. delbrueckii strains, while for C. albidus and C. boidinii it could not be associated to biomass production. For C. apicola, enzyme excretion is probably associated with protease production, as observed for other protein excreting yeasts (Sinha et al 2005; Wang et al 2009). This could explain the decrease of fructanase activity in this case during culture.


116

Time (h)

0 20 40 60 80

Enz

ymat

ic a

ctiv

ity (

U m

l-1

)

0.0

0.2

0.4

0.6

0.8

1.0

1.2

Time (h)

0 20 40 60 80

Enz

ymat

ic a

ctiv

ity (

U m

l-1

)

0.0

0.2

0.4

0.6

0.8

1.0

1.2

Time (h)

0 20 40 60 80

Enz

ymat

ic a

ctiv

ity (

U m

l-1

)

0.0

0.2

0.4

0.6

0.8

1.0

Time (h)

0 20 40 60 80

Enz

ymat

ic a

ctiv

ity (

U m

l-1)

0.0

0.2

0.4

0.6

0.8

1.0

Figure 25: Fructanase activity induced by ATF for the selected yeasts Torulaspora delbrueckii DR1 (∆), DA1 (■) and DN1 (□), Candida apicola MC3 (●), Cryptococcus albidus DC4 (○) and Candida boidinii DT1 (▼). The enzymatic evaluation was performed on sucrose (a), inulin (b), ATF (c) and levan (d).

C.4. Screening of transfructosylase activity at different sucrose concentrations.

The enzymatic extracts obtained by fructanase induction with ATF or inulin (50 yeast strains) were tested for fructosyltransferase activity at 300 and 600 g/l of sucrose. The reactions were followed at 0, 24 and 48 hours. The highest values of transfructosylation were observed at 48 hours for all the enzymatic extracts (Figure 26). From the 50 yeasts tested, only nine T. delbrueckii, six K. marxianus and one C. apicola strains showed fructosyltransferase activity. Differences in transfructosylation were found between the yeast strains as a function of sugar concentration (Figure 26). As the enzymatic extracts are a mixture of enzymes, they may contain both (i) fructanases which perform fructan hydrolysis, but can

(b) (a)

(c) (d)


117

also catalyze transfructosylation reactions (Maiorano et al 2008), and (ii) other fructosyl-transferases (Velázquez-Hernández et al 2009). The enzymatic extracts of T. delbrueckii, K. marxianus and C. apicola were positive for this type of reactions. K. marxianus is capable of catalyzing transfructosylation reactions from sucrose (Santos et Maugeri 2007), but in the case of T. delbrueckii and C. apicola, it is the first time that such activity is reported. Transfructosylation reactions are favored at high sucrose concentration and are biochemically opposite to hydrolytic reactions (Maiorano et al 2008). Therefore, the transfructosylase activity observed at 600 g/l of sucrose could be caused by a thermodynamically favorable redirection of the hydrolysis reaction. For several enzymatic extracts, a possible substrate inhibition was observed. The transfructosylation reactions efficiency depends on temperature and pH (Santos et Maugeri 2007; Maiorano et al 2008; Velázquez-Hernández et al 2009).

Yeast strain

DY DO DF DN1 DR1DW1 DI DZ4 DX4 DL DF1 DV4 DA5 DZ5 DK4 MC3Tra

nsfr

ucto

syla

tion

perc

enta

ge (

%)

0

2

4

6

8

10

12

Figure 26: Screening of transfructosylase activity at 300 (■) and 600 (□) g/l of sucrose for Torulaspora delbrueckii (DY, DO, DF, DN1, DR1, DW1, DI, DZ4 and DX4), Kluyveromyces marxianus (DL, DF1, DV4, DA5, DZ5 and DK4) and Candida apicola (MC3) yeast strains.

■ 300 g L-1

□ 600 g L-1


118

C.5. Transfructosylation reaction improvement in selected yeast strains.

In order to explore under which conditions the transfructosylase activity can be improved for FOS synthesis, an experimental design 2k was applied for the enzymatic extracts of six selected yeast (DF1, DL, DV4, DZ5, DN1 and MC3). For all the yeast strains, the highest yield of transfructosylation was obtained at 48 hours of reaction. Thus, these values were used for statistical analysis (Table 11). For most strains, the most important statistical factor for fructosyltransferase activity was temperature and the interaction of the three factors varied (Table 11).


119

Table 11: Statistical analysis of transfructosylation reactions of the enzymatic extracts for the selected yeasts.

Analysis of variance

Regression coefficients of the statistical model

Yeast strain

Code

Factor p-value Constant A* B* C* AB AC BC ABC R2*

K. marxianus

DF1

ABC

0.0004

-453.6

-2.39

72.8

0.94

15.02

-0.031

-0.149

0.004

90.4

K. marxianus DL C 0.0000 201.6 -0.42 51.8 0.42 6.72

1.726 0.014

-0.003 90.9

K. marxianus

DV4 ABC 0.0000 792.6 5.08 -165 -1.76 24.1 -0.052 0.360 -0.011 94.1

K. marxianus DZ5 C 0.0003 33.12 0.58 -15.8 -0.05 1.42 0.002

0.025

-0.001

75.3

T. delbrueckii

DN1 C 0.0001 63.20 0.49 -16.7 -0.13 1.70 -0.003 0.028 -0.0008 78.1

C. apicola MC3 C 0.0014 182.2 -0.35 -39.3 6.08 1.31 0.011 0.072 -0.0020 78.18 A*= Sucrose concentration, B*= pH, C*= Temperature, R2* = regression coefficient of model adjustment.

120

The statistical models obtained for K. marxianus strains had the best prediction equations for transfructosylase activity with a R2 closer to 100 (Table 11). Table 12 gives the best conditions corresponding to the highest transfructosylation percentage reached for the different experimental combinations tested. For most of the strains, a higher transfructosylation yield was obtained at 200 g/l of sucrose, 40 ºC and pH 6.5 (Table 12). The exception was K. marxianus strain DF1 with ahigher transfructosylation percentage at pH 4.5 (Table 12). The highest transfructosylation yield was found for K. marxianus strain DV4 (Table 12). The experimental design showed that temperature and interaction of the three factors were statistically significant for increasing the transfructosylation activity. Similar results were observed with an immobilized inulinase from K. marxianus (Santos et Maugeri 2007). The differences in the adjustment of the models are caused by variations in the experimental errors of the response variable. At 500 g/l, there is an apparent substrate inhibition for the six enzymatic extracts (data not shown), while for most of the yeasts, the highest sucrose to FOS conversion ratio was obtained at 40 ºC, 200 g/l of sucrose and pH 6.5 (Table 12). These conditions were different of the values reported by Santos and Maugeri (2007): the highest yield for an inulinase from K. marxianus was observed at 50 ºC, 450 g/l of sucrose and pH 6.0. The optimal conversion of sucrose to 6-kestose with a purified β-fructofuranosidase from Schwanniomyces occidentalis was found at 600 g/l of sucrose, pH 5.5 and 45-55 ºC (Alvaro-Benito et al 2007). There was also a difference in the rate and enzyme concentration at which the highest yield was reached: less than 12 hours were necessary with 4 to 6 IU/ml of enzyme (Santos et Maugeri 2007), and 24 hours with 0.3 U/ml of enzyme (Alvaro-Benito et al 2007). For the six enzymatic extracts, the highest conversions were found at 48 hours of reaction. Even though the reaction rate of FOS synthesis was lower, a higher sucrose to FOS conversion was observed (higher than 18.2) for K. marxianus strains, while it was 10 and 16.4 % for the enzymes from K. marxianus and S. occidentalis used by Santos and Maugeri (2007) and Alvaro-Benito et al (2007) respectively. In the case of T. delbrueckii and C. apicola, they can compete with the yields reported by Santos et Maugeri 2007 and Alvaro-Benito et al 2007 respectively. The results showed an improvement in the yield with respect to the initial screening, which was in average close to 4 %. Despite the fact that, in general, pH was not statistically significant, at a pH of 6.5 the highest transfructosylation percentage was reached, while it was 6.0 and 5.5 for Santos and Maugeri (2007), and Alvaro-Benito et al (2007) respectively. These pH values are suitable for FOS synthesis, because the hydrolysis of sucrose is favored at a low pH value. Comparing the FOS synthesis capacity between yeasts and molds, a higher yield (61.5 %) has been observed with an immobilized commercial enzyme from Aspergillus aculeatus (Pectinex Ultra SP-L) at 630 g/l of sucrose (Ghazi et al 2005), and it was increased for the purified enzyme to 88 % at 600 g/l of sucrose (Nemukula et al 2009). In both cases, the enzyme reaction was optimized by surface response experiments.

Chapitre IV: Criblage de l’activité enzymatique fructanase et transfructosylase dans levures No-Saccharomyces isolées des differentes fermentations du mezcal.

121

Table 12: Reaction conditions of the enzymatic extracts for the maximum transfructosylase activity with different yeasts.

Yeast strain Code Sucrose concentration (g/l)

pH T (º C) Trans max* (%)

K. marxianus DF1 200 4.5 40 27.3 ± 0.03

K. marxianus DL 200 6.5 40 29.0 ± 9.17

K. marxianus DV4 200 6.5 40 50.1 ± 0.04

K. marxianus DZ5 200 6.5 40 18.2 ± 3.81

T. delbrueckii DN1 200 6.5 40 11.4 ± 2.68

C. apicola MC3 200 6.5 40 16.5 ± 5.93

Transmax*= maximum percentage of transfructosylation

D. Conclusion.

Mezcal microbiota showed a high diversity of non-Saccharomyces yeasts able to hydrolyse fructans with different fructose linkages specificities. Therefore, it is a potential source of new fructanases for Agave fructans hydrolysis and new fructosyltransferases for FOS synthesis, both with potential industrial interest.

E. Experimental Section.

E.1. Yeast strains and chemicals.

The yeast strains, representing 20 distinct species, belong to the culture collection of the “Centro de Investigación y Asistencia en Tecnología y Diseño del Estado de Jalisco” (Guadalajara, México). They were previously isolated and characterized by PCR-RFLP of the ITS-5.8 regions and D1/D2 sequencing region of the 26S rRNA gene (Segura et al 2010).Glucose, fructose and sucrose and levan from E. herbicola (Sigma-Aldrich, St. Louis, USA), inulin from Dalhia tubers (Fluka, Steinheim, Germany), ATF was provided by BUSTAR Alimentos (Guadalajara, Mexico).


122

E.2. Solid medium.

An aqueous solution with urea (4 g L-1), K2HPO4 (5 g L-1), MgSO4 (1 g L-1) was adjusted to pH 4.5 with HCl (0.25 N), agar was added (2 % w/v) and the medium was sterilized (15 min, 121 °C). After cooling to 50 °C, the oligo saccharide solution at 50 °C was added by filtration (0.45 µm sterile filters) to reach saturation (15, 5 and 1 % w/v for ATF, inulin and levan, respectively).

E.3. Evaluation of growth on solid media.

Each yeast strain colony was deposited by a sterile wood stick on the solid medium containing either ATF or inulin and growth halo measurements were conducted at 0, 24, 48 and 72 hours. Allpositive growth yeast colonies were then tested on levan medium.

E.4. Preparation of aqueous induction medium for fructanase activity.

Aqueous induction medium is composed of urea (8 g L-1), K2HPO4 (10 g L-1), MgSO4 (2 g L-1) in water was sterilized (121 ºC) for 15 min. When temperature decreased to 50 °C, ATF or inulin was added by filtration (0.45 µm sterile filters) to reach a final concentration of 20 g L-1.

E.5. Preparation of enzymatic extracts.

Yeasts selected from solid medium screening were grown overnight in a shaker (250 rpm, 30 °C) in aqueous YPD medium (yeast extract 10 g L-1, peptone 20 g L-1, glucose 20 g L-1). Then, yeast cells (2 x 106) were inoculated in the aqueous induction medium. Depending on the yeast, after 24 to 48 hours of fermentation (30 ºC, 250 rpm) cells were discarded by centrifugation (15 min, 6797 g) and the supernatant (enzymatic extract) was screened for the screening of fructanase and fructosyltransferase activity.

E.6. Evaluation of fructanase activity.

Fructanase activity was determined with different substrates (sucrose, inulin, ATF and levan) as previously reported (Arrizon et al 2011). One unit of enzyme activity was defined as the amount of enzyme liberating one µmol of reducing sugars per minute. All experiments were performed in duplicate.


123

E.7. Characterization of fructanase production for ATF degradation with selected yeasts.

Six yeast strains selected through fructanase activity screening were grown in YPD medium and inoculated in aqueous induction medium with ATF as inducer as described above. Samples were taken at 0, 12, 24, 48 and 72 hours of culture. Biomass production was evaluated by the dry weight determination. Protein was determined according to Bradford method (Bradford 1976). Fructanase activity with sucrose, inulin, ATF and levan was evaluated as described before. All the experiments were performed in duplicates.

E.8. Fructosyltransferase activity screening.

Two sucrose solutions (300 and 600 g L-1 in 100 mM acetate buffer, pH 5.0) were used for fructosyltransferase activity determinations: Each enzymatic extract (100 µl) was added to sucrose solution (900 µl) and the reaction mixture was incubated at 50 ºC. Samples were removed at 0, 24 and 48 hours and thehe concentration of fructose, glucose and sucrose was determined by HPLC with a Biorad HPLC Carbohydrate Analysis column (Aminex HPX-87 C column, 300 x 7.8 mm; Biorad, Hercules, CA, USA) at 80 °C, eluting with degassed ultrapure water at a flow rate of 0.6 ml min-1. As standards glucose, fructose and sucrose were used. Reaction samples were diluted in distilled water to approximately 20 g L-1 and filtered (0.45 µl membrane) before analysis. The difference between the number of moles of glucose and fructose was determined (equivalent to the moles of fructose transferred) and related to the initial number of moles of sucrose. The percentage of transfructosylation was calculated as follows: % Trans = (Ftrans / Sin ) x 100 Where % Trans = percentage of transfructosylation, Ftrans= moles of fructose transferred, Sin= initial moles of sucrose. All the experiments were performed in duplicate.

E.9. Experimental design for improving the transfructosylation yield. Six yeast strains were selected to evaluate the effect of sucrose concentration (300 and 600 g L-1), pH (4.5 and 6.5) and temperature (30 and 40 °C) on the percentage of transfructosylation. A central point was carried out with 450 g L-1 of sucrose, a pH of 5.5 and a temperature of 35 °C. All the experiments wer e performed in duplicate. STATGRAPHICS Centurion XVI software (version 16.1.07, StatPoint Technologies, Inc. 1982-2010, Warrenton, VA, USA) was used for the statistical analysis of percentage of transfructosylation.


124

F. References.

Alvaro-Benito, M.; de Abreu, M.; Fernández-Arrojo, L.; Plou, F.J.; Jíménez-Barbero, J.; Ballesteros, A.; Polaina, J.; Fernández-Lobato, M.Characterization of a β-fructofuranosidase from Schwanniomyces occidentalis with transfructosylating activity yielding the prebiotic 6-kestose. 2007. J. Biotechnol. 132:75-81.

Arrizon, J.; Morel, S.; Gschaedler, A.; Monsan, P. Comparison of the water-solube carbohydrate composition and fructan structures of Agave tequilana plants of different ages. 2010. Food Chem. 122: 123-130.

Arrizon, J.; Morel, S.; Gschaedler, A.; Monsan, P. Purification and substrate specificities of a fructanase from Kluyveromyces marxianus isolated from the fermentation process of Mezcal. 2011. Bioresour. Technol. 102: 3298-3303.

Ávila-Fernández, A.; Rendon-Poujol, X.; Olvera, C.; González, F.; Capella, S.; Peña-Alvarez, A.; López-Munguía, A. Enzymatic hydrolysis of fructans in the tequila production process. 2009. J. Agric. Food Chem. 57: 5578-5585.

Bai, M.; Qing, M.; Guo, Z.; Zhang, Y.; Chen, X.; Bao, Q.; Zhang, H.; Sun, T.S. Occurrence and dominance of yeast species in naturally fermented milk from Tibetan Plateau of China. 2010. Can. J. Microbiol. 56: 707-714.

Bely, M.; Stoeckle, P.; Masneuf-Pomarède, I.; Dubourdieu, D. Impact of mixed Torulaspora delbrueckii-Saccharomyces cerevisiae culture on high-sugar fermentation. 2008. Int. J. Food Microbiol. 122: 312-320.

Bender, J.P.; Mazutti, M.A.; Di Luccio, M.; Treitchel, H. Extraction on inulinase obtained by solid state fermentation of sugarcane bagasse by Kluyveromyces marxianus NRRL Y-7571. 2008. Appl. Biochem. Biotechnol. 149: 195-203.

Bradford, M. A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding. 1976. Anal. Biochem. 72: 248-254.

Buchholz, K.; Seibel, J. Industrial carbohydrate biotransformations. 2008. Carbohydr. Res. 343: 1966-1979.

Clavijo, A.; Calderón, I.L.; Paneque, P. Diversity of Saccharomyces and non-Saccharomyces yeasts in three red grape varieties cultured in the Serrania de Ronda (Spain) wine-growing region. 2010. Int. J. Food Microbiol. 143: 241-245.


125

Cruz-Guerrero, A.; García-Peña, I.; Barzana, E.; García-Garibay, M.; Gómez-Ruiz, L. Kluyveromyces marxianus CDBB-L-278: A wild inulinase hyperproducing strain. J. Ferment. 1995. Bioeng. 80: 159-163.

Cruz-Guerrero, A.E.; Olvera, J.L.; García-Garibay, M.; Gómez-Ruiz, L. Inulinase-hyperproducing strains of Kluyveromyces sp. isolated from aguamiel (Agave sap) and pulque. 2006. World J. Microbiol. Biotechnol. 22: 115-117.

García-Aguirre. M.; Saenz-Álvaro, V.A.; Rodríguez-Soto, M.A.; Vicente-Magueyal, F.J.; Botello-Álvarez, E.; Jiménez-Islas, H.; Cardenas-Manríquez, M.; Rico-Martínez, R.; Navarrete-Bolaños, J.L. Strategy for biotechnological process design applied to the enzymatic hydrolysis of Agave fructo-oligosaccharides to obtain fructose-rich syrups. 2009. J. Agric. Food Chem. 57: 10205-10210.

Ghazi, I.; Gómez de Segura, A.; Fernández-Arrojo, L.; Alcalde, M.; Yates, M.; Rojas-Cervantes, M.L.; Plou, F.J.; Ballesteros, A. Immobilisation of fructosyltransferase from Aspergillus aculeatus on epoxy-activated Sepabeads EC for the synthesis of fructo-oligosaccharides. 2005. J. Mol. Cat. B 35: 19-27.

Gómez, E.; Tuohy, K.M.; Gibson, G.R.; Klinder, A.; Costabile, A. In vitro evaluation of the fermentation properties and potential prebiotic activity of Agave fructans. 2010. J. Appl. Microbiol. 108: 2114-2121.

Hanl, L.; Sommer, P.; Arneborg, N. The effect of decreasing oxygen feed rates on growth and metabolism of Torulaspora delbrueckii. 2005. Appl. Microbiol. Biotechnol. 67: 113-118.

Jeyaram, K.; Singh, W.M.; Capece, A.; Romano, P. Molecular identification of yeast species associated with “Hamei”-A traditional starter used for rice wine production in Manipur, India. 2008. Int. J. Food Microbiol. 124: 115-125.

Karatay, S.E.; Dönmez, G. Improving properties of the yeast cells for biodiesel production using molasses. 2010. Bioresour. Technol. 101: 7988-7990.

Lappe-Oliveras, P.; Moreno-Terrazas, R.; Arrizon-Gaviño, J.; Herrera-Suárez, T.; García-Mendoza, A.; Gschaedler-Mathis, A. Yeasts associated with the production of Mexican alcoholic non distilled and distilled Agave beverages. 2008. FEMS Yeast Res 8: 1037-1052.

Lopez, M.G.; Mancilla-Margalli, N.A.; Mendoza-Díaz, G. Molecular structures of fructans from Agave tequilana Weber var. azul. 2003. J. Agric. Food Chem. 57: 7835-7840.


126

Maiorano, A.E.; Piccoli, R.M.; Da Silva, E.D.; De Andrade-Rodrigues, M.F. Microbial production of fructosyltransferases for synthesis of pre-biotics. 2008. Biotechnol. Lett. 30: 1867-1877.

Mancilla-Margalli, N.A.; Lopez, M.G. Water-soluble carbohydrates and fructan structure patterns from Agave and Dasylirion species. 2006. J. Agric. Food Chem. 54: 7832-7839.

Marques-Vilela, D.M.; Pereira, G.V.; Ferreira-Silva, C.; Roberto-Batista, L.; Freitas-Schwan, R. Molecular ecology and polyphasic characterization of the microbiota associated with semi-dry processed coffee (Coffea Arabica L.). 2010. Food Microbiol. 27: 1128-1135.

Minjarez-Ibañez, A.; Segura-Ortega, J.; Delgado-Rizo, V.; Jave-Suarez, L.; González-Herrera, L.; Fafutis, M. Prebiotic and immunologic effects of fructans from Agave tequilana Weber. 2010. Cl. Immunol. 35: S109.

Muñoz-Gutierrez, I.; Rodríguez-Alegría, M.E.; López-Munguía, A. Kinetic behavior and specificity of β-fructosidases in the hydrolysis of plant and microbial fructans. 2009. Process Biochem. 44: 891-898.

Nemukula, A.; Mutanda, T.; Wilhelmi, B.S.; Whiteley, C.G. Response surface methodology: Synthesis of short chain fructooligosaccharides with a fructosyltransferase from Aspergillus aculeatus. 2009. Bioresour. Tech. 100: 2040-2045.

Pathania, N.; Kanwar, S.S.; Jhang, T.; Koundal, K.R.; Sharma, T.R. Application of different molecular techniques for deciphering genetic diversity among yeast isolates of traditional fermented food products of Western Himalayas. 2010. World J. Microbiol. Biotechnol. 26: 1539-1547.

Pinal, L.; Cornejo, F.; Arellano, M.; Herrera, E.; Nuñez, L.; Arrizon, J.; Gshaedler, A. Effect of Agave tequilana age, cultivation field location, and yeast strain on tequila fermentation process. 2009. J. Ind. Microbiol. Biotechnol. 36, 655-661.

Santos, A.M.P.; Maugeri, F. Synthesis of fructooligosaccharides from sucrose using inulinase from Kluyveromyces marxianus. 2007. Food Technol. Biotechnol. 45: 181-186.

Segura, L.E.; Kirchmayer, M.R.; Flores, E.P.; Gschaedler, A.C. PCR-RFFLP of the ITS-5.8 regions as an identification tool for yeasts: advantages and disadvantages. 2010. E-gnosis 8:1-12.


127

Senses-Ergul, S.; Ágoston, R.; Belák, A.; Deák, T. Characterization of some yeasts isolated from foods by traditional and molecular tests. 2006. Int. J. Food Microbiol. 108: 120-124.

Sheng, J.; Chi, Z.; Yan, K.; Wang, X.; Gong, F.; Li, J. Use of response surface methodology for optimizing process parameters for high inulinase production by marine yeast Cryptococcus aureus G7a in solid state fermentation and hydrolysis of inulin. 2009. Bioprocess Biosyst. Eng. 32: 333-339.

Singh, P.; Gill, P.K. Production of inulinases: Recent advances. 2006. Food Technol. Biotechnol. 44: 151-162.

Sinha, J.; Plantz, B.A.; Inan, M.; Meagher, M.M. Causes of the proteolytic degradation of secreted recombinant proteins produced in methylotrophic yeast Pichia pastoris: case of study with recombinant ovine interferon-tau. 2005. Biotechnol. Bioeng. 89: 102-112.

Solieri, L.; Giudici, P. Yeast associated to traditional balsamic vinegar: Ecological and technological features. 2008. Int. J. Food Microbiol. 125: 36-45.

Souciet, J.L.; Dujon, B., Gaillardin, C.; Johnston, M.; Varet, P.V.; Cliften, P.; Sherman, D.J.; Weissenbach, J.; Westhof, E. Comparative genomics of protoploid Saccharomycetaceae. 2009. Genome Res. 19: 1696-1709.

Souza-Oliveira, E.; Bolini-Cardello, H.M.A.; Marques-Jeronimo, E.; Rocha-Souza, E.L.; Serra, G.E. The influence of different yeasts on fermentation, composition and sensory quality of cachaça. 2005. W.J. Microbiol. Biotechnol. 21: 707-715.

Tofalo, R.; Chaves-López, C.; Di Fabio, F.; Schirone, M.; Felis, G.E.; Torriani, S.; Paparella, A.; Suzzi, G. Molecular identification and osmotolerant profile of wine yeasts that ferment at high sugar grape must. 2009. Int. J. Food Microbiol. 130: 179-187.

Urías-Silvas. J.E.; Cani, P.D.; Delmée, E.; Neyrinck, A.; López, M.G.; Delzenne, N.M. Physiological effects of dietary fructans extracted from Agave tequilana Gto. and Dasylirion spp. 2008. Br. J. Nutr. 99: 254-261.

Velázquez-Hernández, M.L.; Baizabal-Aguirre, V.M.; Bravo-Patiño, A.; Cajero-Juárez, M.; Chávez-Moctezuma, M.P.; Valdez-Alarcón, J.J. Microbial fructosyltransferases and the role of fructans. 2009. J. Appl. Microbiol. 106: 1763-1778.

Vijayaraghavan, K.; Yamini, D.; Ambika, V.; Sowdamini, S. Trends in inulinase production-a review. 2009. Crit. Rev. Biotechnol. 29: 67-77.


128

Waleckx, E.; Gschaedler, A.; Colonna-Ceccaldi, B.; Monsan, P. Hydrolysis of fructans from Agave tequilana Weber var. azul during the cooking step in a traditional tequila elaboration process. 2008. Food Chem. 108: 40-48.

Waleckx, E.; Mateos-Diaz, J.C.; Gschaedler, A.; Colonna-Ceccaldi, B.; Brin, N.; García-Quezada, G.; Villanueva-Rodríguez, S.; Monsan, P. Use of inulinases to improve fermentable carbohydrate recovery during tequila production. 2011. Food Chem. 124: 1533-1542.

Wang, Y.; Wang, Z.; Xu, Q.; Du G.; Hua, Z.; Liu, L.; Li, J.; Chen, J. Lowering induction temperature for enhaced production of polygalacturonate lyase in recombinant Pichia pastoris. 2009. Process Biochem. 44: 949-954.

Yurimoto, H.; Sakai, Y. Methanol-inducible gene expression and heterologous protein production in the methylotropic yeast Candida boidinii. 2009. Biotechnol. Appl. Biochem. 53: 85-92.

Zhao, C.H.; Zhang, T.; Li, M.; Chi, Z.M. Single cell oil production from hydrolysates of inulin and extract of tubers of Jerusalem artichoke by Rhodotorula mucilaginosa TJY15a. 2010. Process Biochem. 45: 1121-1126.

129

CONCLUSIONS

Conclusions.

130

CONCLUSIONS ET PERSPECTIVES

Ce travail de thèse présente deux objectifs principaux :

- Connaître les variations de la composition des sucres solubles et de la structure des fructanes d’Agave tequilana en fonction de l’âge de la plante.

- Etudier de nouvelles enzymes spécifiques de l’hydrolyse des fructanes d’agave.

En ce qui concerne le premier objectif, les premiers travaux réalisés sur ce sujet ont été publiés par Lopez et al (2003) et mettent en évidence que les fructanes d’Agave tequilana sont des polymères de fructose de structure complexe, présentant des liaisons β (2→1) et β (2→6) ainsi que différents points de branchement. De plus, la comparaison de la structure des fructanes d’A. tequilana avec d’autres espèces d’agave montre d’importantes différences de composition des fructanes (Mancilla-Margalli et Lopez, 2006).

Ces premiers travaux de recherche constituent une information scientifique importante pour comprendre la nature des fructanes d’agave. Cependant, pour le secteur industriel de la production de tequila, il est important d’avoir une meilleure connaissance de la dynamique de l’accumulation des sucres en fonction de l’âge de la plante, car l’âge de récolte des agaves varie en fonction du producteur et selon la disponibilité de la production des plantes d’agave.

Pour cela, au cours de ce travail une extraction des fructanes d’agave à partir de plantes âgées de 2, 4 et 6,5 ans a été réalisée. Pour diminuer la variabilité liée aux conditions climatiques et à l’utilisation de fertilisants chimiques, les agaves ont été collectés chez un même producteur pratiquant l’agriculture bio.

Les fructanes extraits d’agaves d’âges différents ont été caractérisés par HPLC, HPAEC-PAD, MALDITOF-MS et analyse des alditols partiellement méthylés par GC-MS. Les résultats obtenus montrent que durant le développement des plantes d’A. tequilana le degré d’accumulation des sucres totaux, de la composition et les structures des fructanes changent. Ces résultats impliquent que le stade de développement de la plante devrait être pris en compte pour optimiser son utilisation postérieure, que ce soit pour l’élaboration de la tequila (ou une accumulation maximale de sucre est recherchée) ou pour l’obtention de FOS, où d’autres stades de développement de l’agave pourraient être utilisés.

Conclusions.

131

Dans le cas du second objectif de ce travail de thèse, du fait de la structure complexe des fructanes d’A. tequilana, il est important de connaître les spécificités enzymatiques de nouvelles fructanases pour réaliser une hydrolyse enzymatique de ces mêmes fructanes.

Lors d’un travail antérieur, Waleckx et al (2011) ont montré qu’il est possible d’augmenter le rendement de la production de la tequila, par l’hydrolyse des fructanes d’A. tequilana présents dans les miels de cuisson et non hydrolysés. Cependant, les enzymes commerciales utilisées ont été développées pour l’hydrolyse de fructanes linéaires, comme l’inuline de chicorée, laquelle contient uniquement des liaisons de type β (2→1).

Pour cela, une fructanase produite par une levure Kluyveromyces marxianus isolée du procédé de fermentation du mezcal (boisson traditionnelle d’agave) a été purifiée et biochimiquement caractérisée, et ensuite comparée avec un cocktail enzymatique commercial (Fructozyme®), normalement utilisé pour l’hydrolyse de l’inuline de chicorée.

L’enzyme de K. marxianus purifiée présente une spécificité plus élevée pour les fructanes d’agave que le cocktail enzymatique Fructozyme®. Elle présente principalement une activité exo-hydrolase, qui peut avoir d’intéressantes applications pour la production de la tequila.

Même si ce travail présente la première caractérisation de l’hydrolyse enzymatique des fructanes d’A. tequilana par une enzyme purifiée d’une levure K. marxianus, cette espèce de levures est bien connue comme productrice des fructanases, et il existe beaucoup d’information publiée sur ce sujet en particulier sur la structure de ces protéines ainsi que de leurs gènes correspondants. Il nous a donc paru intéressant de rechercher de nouvelles fructanases produites par d’autres microorganismes pour l’hydrolyse spécifique de ce fructane branché particulier.

Pour trouver de nouvelles sources de fructanase pour l’hydrolyse des fructanes d’Agave tequilana, 130 levures Non-Saccharomyces de différentes espèces ont été criblées pour l’activité fructanase sur différents substrats. Ces levures ont été isolées de différentes fermentations pour l’élaboration de différents types de mezcal dans l’état de Oaxaca.

Les résultats du criblage ont montré la diversité de la production d’enzymes présentant différentes affinités, lesquelles sont nécessaires pour l’hydrolyse des fructanes d’agave durant la fermentation du mezcal. Donc, le microbiote du mezcal s’est révélé être une source très intéressante de nouvelles fructanases ayant des spécificités enzymatiques pour les différents types de liaisons présents dans le pontre fructoses.

Conclusions.

132

Les réactions de transfructosylation (synthèse) sont contraires aux réactions d’hydrolyse des fructanases, mais elles sont importantes pour la production de fructooligosaccharides de courte chaîne (FOS), qui ont d’importantes applications dans l’industrie alimentaire comme prébiotiques.

Les mêmes levures étudiées dans la partie antérieure ont été criblées pour l’activité fructosyltransférase. Seules seize des levures isolées du microbiote du mezcal ont montré une capacité intéressante pour réaliser la réaction de transfructosylation.

Les perspectives de ce travail sont multiples, en particulier du point de vue scientifique il est important de poursuivre l´étude détaillée des nouvelles fructanases mises en évidence, de leurs capacités catalytiques ainsi que la caractérisation des gènes qui codent pour ces enzymes. Des perspectives sont également envisageables du point de vue industriel, en particulier l’application de la fructanase de Kluyveromyces étudiée pour l’hydrolyse complète de jus d’agave pour la production de la tequila ou pour l’obtention de FOS. Pour la deuxième perspective, il est nécessaire de combiner l’action d’endo et d’exo-hydrolases sur les fructanes d’Agave tequilana. Depuis peu, il existe de nouvelles enzymes commerciales comme Novozyme (N960), qui présenteent une activité endo-fructanhydrolase. Donc, il serait intéressant d’évaluer l’action combinée d’enzymes spécifiques des fructanes d’A. tequilana et les nouvelles enzymes commerciales pour la production de FOS par hydrolyse enzymatique.

133

ANNEXE

Annexe.

134

Figure 1: L’électrophorèse de la protéíne purifiée de Kluyveromyces marxianus a été réalisée en conditions dénaturantes (NuPAGE gel, 3-8 % acrylamide) pendant 80 minutes à 150 V. (1) dimère glycosylé, (2) monomère glycosylé (séparation par chauffage à65 °C pendant 10 minutes), (3) monomère déglycosylé (Endoglucanase Hf, 24 heures à 37 °C), (4) Fructozyme ® comme contrôle positif. (a) Coloration des protéines totales avec bleu de Coomasie, (b) Zymogramme de l’activité fructanase (Gabriel et Wang 1969).

Figure 2: Zimogramme de l’activité fructanase (Gabriel et Wang 1969) de la protéíne purifiée de Kluyveromyces marxianus (dimère glycosylé) sur différents substrats.

Annexe.

135

Figure 3 : Amplification de la séquence d’ADN par PCR à partir de la première extraction de l’ADN chromosomique du K. marxianus: (1) et (3) avec les p amorces GTTAGATATGAAGTTAGCAT (forward) et GCAGATCAGATCAAACG (reverse). (2) et (4) avec les amorces ATGAAGTTAGCATACTCC (forward) et TCAAACGTTAAATTGGGTAAC (réverse).

1 2 3 4

10,000 pb

6,000 pb

4,000 pb

2,500 pb

1,500 pb

800 pb

400 pb

200 pb

Annexe.

136

Figure 4 : Résultats du séquencage de l’ADN de la séquence amplifiée par PCR (forward) du gène de Kluyveromyces marxianus cloné dans E. coli.

Figure 5 : Résultats du séquencage de l’ADN de la séquence amplifiée par PCR (reverse) du gène de Kluyveromyces marxianus cloné dans E. coli.

Annexe.

137

Annexe.

138

Annexe.

139

Figure 6 : Alignement de la séquence d’ADN du gène de Kluyveromyces marxianus deux fois séquencé (Agav1 et Agav2) avec les séquences d’ADN des gènes des inulinases des différentes levures Kluyveromyces marxianus décrites dans NCBI et CAZY. Nucléotides noir et bleu : différences par rapport aux séquences rapportées.

Mklayslllplagvsasvinykrdgdskaitnttfslnrpsvhftpshgwmndpnglwydakeedwhlyyqynpaatiwgtplywghavskdltswtdygaslgpgsddagafsgsmvidynntsgffnssvdprqravavwtlskgpsqaqhisysldggytfqhysdnavldinssnfrdpkvfwhegengedgrwimavaesqvfsvlfysspnlknwtlesnfthhgwtgtqyecpglvkvpydsvadsssnssdskpdsawvlfvsinpggplggsvtqyfvgdfngthftpiddqtrfldmgkdyyalqtffntpnekdvygiawasnwqyaqqaptdpwrssmslvrqftlkdfstnpnsadvvlnsqpvlnydalrkngttysitnytvtsengkkikldnpsgslefhleyvfngspdiksnvfadlslyfkgnnddneylrlgyetnggaffldrghtkipfvkenlffnhqlavtnpvsnyttnvfdvygvidkniielyfdngnvvstntfffstnnvigeidikspydkaytinsfnvtqfnv (a)

Mklayslllplagvsasvinykrdgdskaitnttfslnrpsvhftpshgwmndpnglwydakeedwhlyyqynpaatiwgtplywghavskdltswtdygaslgpgsddagafsgsmvidynntsgffnssvdprqravavwtlskgpsqaqhisysldggytfqhysdnavldinssnfrdpkvfwhegengedgrwimavaesqvfsvlfysspnlknwtlesnfthhgwtgtqyecpglvkvpydsvadsssnssdskpdsawvlfvsinpggplggsvtqyfvgdfngthftpiddqtrfldmgkdyyalqtffntpnekdvygiawasnwqyaqqaptdpwrssmslvrqftlkdfstnpnsadvvlnsqpvlnydalrkngttysitnytvtsengkkikldnpsgplefhleyvfngspdiksnvfadlslyfkgnnddneylrlgyetnggaffldrghtkipfvkenlffnhqlavtnpvsnyttnvfdvygvidkniielyfdngnvvstntfffstnnvigeidikspydkaytinsfnvtqfnv (b)

Figure 7 : Traduction des séquences d’ADN du gène isolé de Kluyveromyces marxianus deux fois séquencé, Agav1(a) et Agav2 (b) avec le programme Multiple translation.

Annexe.

140

Figure 8 : Alignement des séquence des protéines du gène isolé deux fois amplifié et séquencé (Agav1 et Agav2) avec les séquences des acides aminés des gènes des inulinases des différentes levures Kluyveromyces marxianus décrites dans NCBI et CAZY.

141

TABLE DES ILLUSTRATIONS

Table des illustrations

142

LISTE DES FIGURES

Figure 1: Structure des principaux types de fructanes : inuline (a), lévane (b), inuline néosérie (c), lévane néosérie (d), fructane branché (e). ………………………………………………………………………………………….20

Figure 2: Synthèse des fructanes catalysées par les fructosyltransférases (a) la saccharose:saccharose 1-fructosyltransférase (1-SST) (EC 2.4 .1.99) (b) la fructane:fructane 1-fructosyltransférase (1-FFT) (EC 2.4 .1.100) (c) la saccharose:fructane 6-fructosyltransférase (6-SST) (EC 2.4 .1.10) (d) la fructane:fructane 6G-fructosyltransférase (6G-FTT) (EC 2.4 .1.243). ..…………………………………………………………………………..22

Figure 3 : Plante d’ Agave tequilana Weber var. azul ...…………………………………………………………………..25

Figure 4 : Plante mère d’ Agave tequilana Weber var. azul et bourgeon du rhizome (a), plantation d’ Agave tequilana ...…...……………………………………………………………………………………………………………………26

Figure 5: Cœurs des plantes d’ Agave tequilana Weber var. azul des différents âges. .........................................27

Figure 6 : Structure générale des fructanes d’agave (Lopez et al, 2003). ...............................................................27

Figure 7 : Voies de biosynthèse des fructanes d’agave proposées par Saldaña et al (2009): saccharose : saccharose 1-fructosyltransférase (1-SST, EC 2.4.1.99), fructane:fructane 1-fructosyltransférase ( 1-FFT, EC 2.4.1.100 ), 6-FFT ( fructane:fructane 6-fructosyltransférase ), saccharose:fructane 6-fructosyltransférase ( 6-SFT, E.C. 2.4.1.10), fructane:fructane 6G-fructosyltransférase (6G-FFT, EC 2.4.1.243). Glucose (G), Fructose (F), inuline (I), Néosérie (N). ……………………………………………………………………….28

Figure 8 : Schéma général du procédé de fabrication de la tequila. .......................................................................29

Figure 9: Réaction générale des enzymes de type glycoside-hydrolase. ...............................................................32

Figure 10 : Sites d’hydrolyse des enzymes exo et endo-hydrolases. .....................................................................32

Figure 11 : Mécanisme catalytique général d’hydrolyse des glycoside-hydrolases ; interaction du carbone anomérique avec un groupe nucléophile et un groupe acide/base (a), rétention de l’intermédiaire au stade de transition dans le site actif de l’enzyme (b), hydrolyse à partir du carbone anomérique par une molécule d’eau (c). .....................................................................................................................................................................34

Figure 12 : Principaux produits des réactions de transfructosylation des fructosyl-transférases microbiennes en fonction du site du groupe fructofuranosyle transféré. ..............................................38

Figure 13 : Modèle de la synthèse des FOS basé sur les comportements observés pour les fructosyl-transférases microbiennes d’ Aureobasidium pullulans , Aspergillus niger et Rhodotorula spp . Glucose (G) et fructose (F) d’après Monsan et Ouarné (2009). .........................................................................................................39

Figure- 14- :-- Modèle- d’inhibition- de la synthèse des FOS par le glucose. Glucose (G) et fructose (F) d’après Monsan et Ouarné (2009). ............................................................................................................................................39

Figure 15 : Modèle d’hydrolyse de FOS. Glucose (G) et fructose (F) d’après Monsan et Ouarné (2009)… ......39

Figure 16 : Procédé enzymatique industriel de production des FOS d’après Monsan et Ouarné (2009). ..........40

Figure 17 : Procédé artisanal de production de mezcal de Oaxaca à partir d’ Agave angustifolia .......................46

Table des illustrations.

143

LISTE DES FIGURES COMPLEMENTAIRES

Figure 1: Electrophorèse de la protéíne purifiée de Kluyveromyces marxianus réalisée en conditions dénaturantes (NuPAGE gel, 3-8 % acrylamide) pendant 80 minutes à 150 V. (1) dimère glycosylé, (2) monomère –glycosylé-- (séparation par chauffage à 65 °C pendant 10 minutes), (3) monomère déglyc osylé (Endoglucanase Hf, 24 heures à 37 °C), (4) Fructozyme ® comme contrôle positif. (a) Coloration des protéines totales avec le bleu de Coomasie, (b) Zymogramme de l’activité fructanase (Gabriel et Wang 1969)……….. 134

Figure-- 2:-- Zimogramme --de --l’activité –fructanase-- (Gabriel –et- Wang- 1969)- de- la- protéíne- purifiée- de Kluyveromyces marxianus (dimère glycosylé) sur différents substrats ………………………………………...….134

Figure 3 : Amplification de la séquence d’ADN par PCR à partir de la première extraction de l’ADN chromosomique du K. marxianus : (1) et (3) avec les amorces GTTAGATATGAAGTTAGCAT (forward) et GCAGATCAGATCAAACG (reverse). (2) et (4) avec les amorces ATGAAGTTAGCATACTCC (forward) et TCAAACGTTAAATTGGGTAAC (réverse) ………………………………………………………………………………...135

Figure 4 : Résultats du séquencage de l’ADN de la séquence amplifiée par PCR (forward) du gène de Kluyveromyces marxianus cloné dans E. colli ........................................................................................................136

Figure 5 : Résultats du séquencage de l’ADN de la séquence amplifié par PCR (reverse) du gene de Kluyveromyces marxianus cloné dans E. colli …………………………………………………………………………..136

Figure 6 : Alignement des séquences d’ADN du gène de Kluyveromyces marxianus deux fois séquencé (Agav1 et Agav2) avec les séquences d’ADN des gènes des inulinases des différentes levures Kluyveromyces marxianus décrites dans NCBI et CAZY. Nucléotides noir et bleu : différences par rapport aux séquences rapportées) ………………………………………………………………………………………………….……139

Figure 7 : Traduction des séquences d’ADN du gène isolé de Kluyveromyces marxianus deux fois séquencé, Agav1 (a) et Agav2 (b) avec le programme Multiple translation ………………….……………………………….139

Figure 8: Alignement des séquence des protéines du gène isolé deux fois amplifié et séquencé (Agav1 et Agav2) avec les séquences des acides aminés des gènes des inulinases des différentes levures Kluyveromyces marxianus décrites dans NCBI et CAZY …………………………………...………………………….140

LISTE DES TABLES


144

Tableau 1 : Caractérisation du microbiote du pulque d’après Lappe et Ulloa (1993), Estrada-Godina et al (2001), Escalante et al (2004), Escalante et al (2008). ...............................................................................................43

Tableau 2 : Espèces d’agave utilisées et régions de production des différentes boissons distillées du Mexique d’après Lappe et al (2008) et Narváez-Zapata et al (2010). .......................................................................................44

Tableau 3 : Caractérisation du microbiote de différentes boissons distillées d’agave d’après Lappe et al (2008) et Segura et al (2010)....................................................................................................................................................48

Liste des abréviations

145

ATF : fructanes d’Agave tequilana

CAM : métabolisme de type acide crassulacée

CNTI : chambre nationale de l’industrie de la tequila

DMSO : diméthylsulfoxyde

DNS : acide 3,5 dinitrosalicylique

DP : degré de polymérisation

Fructozyme® : cocktail enzymatique d’inulinases produites par Aspergillus niger (Novozyme).

FOS : fructooligosaccharides à courte chaîne

FEH : fructan-exohydrolase

1-FFT : fructan : fructan 1-fructosyltransférase

CG-MS : chromatographie en phase gazeuse et spectrométrie de masse

6G-FFT : fructan : fructan 6G-fructosyltransférase

HPAEC-PAD : chromatographie haute performance liquide d’échange ionique avec détection ampérométrique.

HPLC : chromatographie liquide haute performance

LC-MS : couplage chromatographie liquide-spectrométrie de masse

LMWC : lower molecular weight carbohydrates

MALDI-TOF-MS : Matrix-assisted laser desorption/ionization time-of-flight mass spectrometry.

NMR : résonance magnétique nucléaire

PMAA : alditols partiellement méthylés

1-SST : saccharose : saccharose 1-fructosyltransférase

6-SST : saccharose : saccharose 6-fructosyltransférase

TFA : acide trifluoracétique


146

TSH : sucres totaux hydrolysées

TTC : chlorure de triphenyltetrazolium

WSC : glucides solubles dans l’eau

%NVUEDEL OBTENTIONDU %0$5035 %&- 6/7&345² … · %nvuedel obtentiondu %0$503"5 %&- 6/7&345²...

Documents

Transcript of %NVUEDEL OBTENTIONDU %0$5035 %&- 6/7&345² … · %nvuedel obtentiondu %0$503"5 %&- 6/7&345²...

%NVUEDEL OBTENTIONDU %0$5035 %&- 6/*7&34*5² … · %nvuedel obtentiondu %0$503"5 %&- 6/*7&34*5²...

Documents

Transcript of %NVUEDEL OBTENTIONDU %0$5035 %&- 6/*7&34*5² … · %nvuedel obtentiondu %0$503"5 %&- 6/*7&34*5²...

%NVUEDEL OBTENTIONDU %0$5035 %&- 6/7&345² … · %nvuedel obtentiondu %0$503"5 %&- 6/7&345²...

Transcript of %NVUEDEL OBTENTIONDU %0$5035 %&- 6/7&345² … · %nvuedel obtentiondu %0$503"5 %&- 6/7&345²...