Les interactions et complexes entre ARN et protéines

Les interactions et complexes entre ARN et

protéines

Les interactions ARN-protéines

1.  Les grandes lignes 2.  Les complexes constitués d’ARN

et de protéine 3.  Les assemblages constitués

d’ARN et de protéine 4.  L’ARN interférence et les

composants du complexe RISC

•  Maturation de l’ARN •  Epissage Cis ou Trans •  Introns (groupe I et groupe II) •  Epissages alternatifs (1/3 des gènes) •  Coiffe en 5’ •  Variants de polyadénylation

Le long chemin d’un gène à une protéine

Chacune des étapes de la maturation des ARNm codants est source de diversité et de régulation

Nishikura Nature Reviews Molecular Cell Biology 7, 919–931 (December 2006)

Les mécanismes impliquant les ARN non-codants sont tous interconnectés:

remodelage de la chromatine,

ARNi,

édition de l’ARN,...

Plus de 40000 structures dans la Protein DataBase

mais au plus 1200 structures

avec un ARN

Les grandes lignes •  Il n’y a pas de code reliant un type d’acide aminé avec un type de nucléotide; des

préférences existent cependant (par ex. Arg et guanine); •  Certaines protéines reconnaissent des « structures » de manière séquence indépendante

(par ex. les hélices double brin d’ARN); •  Des modules protéiques fréquemment observés dans les complexes ARN-protéiques

existent (Par ex. les RRM, RNA Recognition Module); •  Les modules structuraux de l’ARN (par ex. boucle E, Kink-turn,...) sont régulièrement en

interaction avec les protéines dans les complexes; •  Cependant, il n’existe pas de relation unique entre modules d’ARN et de protéines; •  Certaines protéines reconnaissent à la fois l’ADN et l’ARN (par ex. le facteur de

transcription TFIIA par l’intermédiaire de doigt à zinc); dans ce cas, la protéine présentent des changements conformationnels entre les deux types de complexes;

•  Des changements conformationnels induits (« induced-fit ») sont souvent observés: les structures des ARN seuls et complexés ne sont pas identiques;

•  Utilisation fréquente de « séquence-guide » : les reconnaissances intermoléculaires entre deux brins d’ARN utilisent les complémentarités Watson-Crick d’éléments de séquence (avantages: (1) un même type d’ARN, et donc une même architecture, peut être utilisée maintes fois; (2) positionnement très précis d’un résidu au site actif).

Les structures d’ARN recrutent de nombreux facteurs protéiques

Representative RNA–protein complexes. The panels represent RNA–protein complexes between (a) 5S rRNA and ribosomal proteins L5, L18, L21E, and L30 [PDB ID: 1JJ2] (b) Gln tRNA and its synthetase [PDB ID: 1QTQ] (c) domain IV of 4.5S RNA and SRP protein [PDB ID: 1HQ1] (d) ribosomal protein L1 and its mRNA fragment [PDB ID: 2VPL] (e) hairpin loop IV of U2 snRNA and U2B″/U2A′ protein complex [PDB ID: 1A9N] (f) box C/D snoRNA and L7Ae protein [PDB ID: 1RLG] (g) fragment of pre-miRNA and RISC-loading complex subunit [PDB ID: 3ADL] (h) P3 domain of RNase P/MRP RNA and POP6 and POP7 protein subunits [PDB ID: 3IAB] (i) C-rich fragment of telomeric RNA and polyC binding protein [PDB ID: 2PY9]

Aditi Gupta , Michael Gribskov

The Role of RNA Sequence and Structure in RNA/Protein Interactions

Journal of Molecular Biology 409, 4 2011 574 - 587

http://dx.doi.org/10.1016/j.jmb.2011.04.007

Le ribosome : un assemblage moléculaire fonctionnellement contraint

N.Ban et al., (2000) Science, 289, 905-920

50S: structures des protéines

(H. marismortui) 17 globulaires (vert) 13 partiellement ou complètement étirées (rouge)

RNA versus protein modules No correlation between them

RNA Module Protein Module

Double helix Many folds

Many elements RRM

Loop E, K-turn Many residues

Importance de l’électrostatique: Salt dependence of the association rate constant kon, dissociation rate constant koff and dissociation constant KD of the U1A/U1hpII and Fox-1/UGCAUGU interaction

Surface potential of RNA binding proteins.

Surface potential of RNA binding proteins. Blue areas indicate a positive potential, red areas a negative potential. (A) Vts1, a protein that recognizes a structured RNA loop. The RNA binding surface of the protein is a highly positive patch. (B) Fox-1 RRM, which binds ssRNA. Positive and

negative potentials surround the RNA and the area where most contacts are made is primarily apolar. Figures were generated with PyMOL. PDB accession codes are 2ESE and 2ER.

Auweter S D et al. Nucl. Acids Res. 2006;34:4943-4959 © 2006 The Author(s)‏

RNA double helix recognition

Proteins structurally very different recognize dsRNAs

Double-stranded RNA recognition by double-stranded RNA-binding motifs.

(A)  The double-stranded RNA-binding motif (dsRBM) of Xlrbpa2 bound to dsRNA (Ryter & Schultz, 1998). The beta-helix 1 (in red), amino-terminal part of beta-helix 2, and beta1–beta2 loop recognize non-sequence-specifically the shape of dsRNA. Backbones are coloured blue and light blue for two co-axially stacked duplexes.

(B)  The dsRBM of Rnt1p bound to the stem–loop closed by the AGNN tetraloop (backbone in yellow and bases in black; Wu et al, 2004). The beta-helix 1, a key element for shape-specific recognition by dsRBMs, is highlighted in red. The dsRBM of Rnt1p has an additional carboxy-terminal Éø-helix 3 (in black), that modulates the conformation of beta-helix 1 (Leulliot et al, 2004). Side chains involved in intermolecular interactions are shown.

EMBO reports (2005) 6, 33–38 Richard Stefl, Lenka Skrisovska & Frédéric H.-T.Allain

The energies associated with intermolecular stacking interactions.


(A) Stacking of U11 and A9 on top of Tyr85 in the MS2 coat protein complex, (B) Contacts between Phe126 and U1, G2 and C3 in the Fox-1 complex. (C) Stacking contacts at the U1A RNA binding interface and energetic effects of mutating Phe56.

Note : 1 kJ·mol−1 is equal to 0.239 kcal·mol−1 ou 1kcal.mol-1 = 4.18 kJ.mol-1

Importance des liaisons hydrogène

Pumilio and zinc-binding domains.

Auweter S D et al. Nucl. Acids Res. 2006;34:4943-4959

© 2006 The Author(s)‏

The Watson–Crick pseudo pairs between nucleotide bases and amino acid side-chains.

Kondo J , and Westhof E Nucl. Acids Res. 2011;39:8628-8637

© The Author(s) 2011. Published by Oxford University Press.

The Watson–Crick pseudo pairs between nucleotide bases and the peptide backbone.



Arginine and peptide bond stacking.


(A) General view and close-up view of the splicing endonuclease in complex with RNA (PDB code: 2GJW) At the splicing endonucleoase active-site, A13 is sandwiched between two arginine side-chains. (B) In the Nova KH domain, N1 stacks on a peptide bond within α1. (C) The N0 nucleotide stacks on a peptide bond that lies at the end of β1 of the RRM of hnRNP A1. PDB accession codes are 1EC6 (Nova) and 2UP1 (hnRNPA1). Figures were generated with MOLMOL.

The Hoogsteen pseudo pairs between nucleotide bases and amino acid side-chains.



The Sugar-edge pseudo pairs between nucleotide bases and amino acid side-chains.



The adenine binding [left; PDB-ID  =  1DAD (38)] and guanine binding [right; PDB-ID  =  1G7S (40)] motifs composed of multiple interactions.



Antoine Cléry, Markus Blatter and Frédéric H-T Allain Current Opinion in Structural Biology 2008, 18:290–298

RRM

RNA Recognition Motifs

RNA recognition by RNA-recognition motifs. The similarities and differences are highlighted in red and yellow, respectively. (A) RNA-recognition motif 1 (RRM1) of sex-lethal (shown as a ribbon model) interacts with the triplet UUU (shown as a stick model; Handa et al, 1999). The four-stranded beta-sheet (in red) recognizes three nucleotides—this is the canonical mode of RRM–RNA interaction. (B) RRM1 of U1A bound to an RNA internal loop (Allain et al, 1997). The four-stranded beta-sheet (in red) recognizes three nucleotides. The beta2–beta3 loop and the beta1–beta1 loop (in yellow) contact additional RNA residues. (C) RRM of CBP20 complexed with m7GpppG (7-methyl-G(5’)ppp(5’)G; Mazza et al, 2002). C- and N-terminal extensions (in yellow) provide additional protein–RNA contacts that creates a specific binding pocket for 5’ capped RNAs. (D) RRMs 1 and 2 of nucleolin bound to an RNA stem–loop (Allain et al, 2000). The four-stranded beta-sheet of RRM2 (in red) recognizes only two nucleotides. The interdomain linker (in yellow) participates in the recognition of the hairpin architecture.

The same RNA-recognition motif recognizes proteins in various ways

KH domains (hnRNP K Homology domain).


Some proteins, like the transcription factor TFIIIA, bind to both DNA and

RNA molecules.

Dual nucleic acid binding by zinc fingers of TFIIIA. (a)  Interaction of fingers 4–6, from right to left, with 5S DNA. (b) Endwise view of (a). (c) Interaction of fingers 4–6, from right to left, with a truncated 5S RNA. (d) Endwise view of (c). Nucleic acids are shown in green. Fingers 4–6 are represented as a backbone trace, with their a helices in red and zinc ions as violet spheres. Figure generated using the program RasMol. Raymond S Brown, Current Opinion in Structural Biology 2005, 15:94–98

Nature 426, 96-100 Crystal structure of a zinc-finger–RNA complex reveals two modes of molecular recognition Duo Lu, M. Alexandra Searles & Aaron Klug

DNA vs RNA recognition by CCHH-type zinc fingers. (A) Zinc finger 2 of Zif 268 bound to double-stranded DNA (Pavletich & Pabo, 1991). The Éø-helix of the zinc finger (in red) inserts into the DNA major groove; base contacts are made from positions -1, 2, 3 and 6 of the Éø-helix (the protein side-chains are shown as an element-type coloured stick model). The DNA bases that are recognized by the finger are coloured yellow. (B) Overall view of the complex of transcription factor IIIA (TFIIIA) fingers 4–6 (F4–F6) and 61-nucleotide 5S RNA (Lu et al, 2003). The protein and RNA are represented as ribbon models. The bulged bases involved in the recognitions are highlighted in yellow. Cyan balls represent zinc ions. (C) TFIIIA finger 4 (F4) bound to loop E (Lu et al, 2003). The Éø-helix (in red) of the finger 4 specifically interacts with a guanosine base that bulges out (in yellow); the base contacts are made from the side-chain at position -1, 1 and 2 of the Éø-helix. (D) TFIIIA finger 5 (F5) bound to helix V (Lu et al, 2003). The Éø-helix (in red) of finger 5 recognizes the dsRNA shape by non-sequence-specific contacts to the RNA sugar-phosphate backbone.

Ferritin 5’

Ferritin 5’ Transferrin 3’

Transferrin 3’

Translation of ferritin blocked by binding of IRE-BP to IRE

Transferrin instability element targets the mRNA for rapid degradation

Free ferritin IRE allows translation

IRE-BP masks transferrin instability element blocking degradation

Low Fe

High Fe

IRE-BP binds to ferritin 5’ at low [Fe] and to transferrin instability elements at high [Fe] Result: Translation of both ferritin and transferrin only occurs at high [Fe]

Another example of Regulation of Translation via the binding of a protein to structural elements in two different mRNAs

La surprenante aconitase

Published by AAAS

W. E. Walden et al., Science 314, 1903 -1908 (2006)

Fig. 1. Structure of rabbit IRP1 in complex with frog ferritin H IRE-RNA

Published by AAAS W. E. Walden et al., Science 314, 1903 -1908 (2006)

Nature 434, 183-191 (10 March 2005) | doi: 10.1038/nature03355 Structural basis of HutP-mediated anti-termination and roles of the Mg2+ ion and L-histidine ligand

c, Hexameric HutP quaternary complex, viewed along the three-fold axis.

d, Alternative view of the hexamer, rotated by 90° along the y axis. Ball-and-stick models were used for l-histidine and the bound 21-mer RNA.

e, Molecular surface representation of the quaternary complex and the bound RNA, shown in a ball-and-stick model as in c.

f, HutP dimer viewed along the pseudo-two-fold axis. The bound l-histidine and RNA are shown as a ball-and-stick model and the Mg2+ ions are represented by a yellow cpk (Corey-Pauling-Koltun) model.

Recognition of L-histidine : H-bonding andvia one Mg2+ ion

Science 12 May 2006: Vol. 312. no. 5775, pp. 906 - 910 RNA Recognition and Cleavage by a Splicing Endonuclease Song Xue, Kate Calvin, Hong Li*

we describe at a resolution of 2.85 angstroms the structure of a splicing endonuclease from Archaeglobus fulgidus bound with a bulge-helix-bulge RNA containing a noncleaved and a cleaved splice site. The endonuclease dimer cooperatively recognized a flipped-out bulge base and stabilizes sharply bent bulge backbones that are poised for an in-line RNA cleavage reaction. Cooperativity arises because an arginine pair from one catalytic domain sandwiches a nucleobase within the bulge cleaved by the other catalytic domain.

Published by AAAS S. Xue et al., Science 312, 906 -910 (2006)

A structural model of the pre-tRNAArcheuka bound to AF endonuclease (ribbon models) with the corresponding yeast endonuclease subunits represented in colored shapes, and the splice sites

indicated by arrows

Published by AAAS

S. Xue et al., Science 312, 906 -910 (2006)

Fig. 2. Protein-RNA interactions between the bulge-helix-bulge (BHB) RNA and the endonuclease

Published by AAAS

S. Xue et al., Science 312, 906 -910 (2006)

Fig. 3. Active site interaction and proposed catalytic mechanisms

Les petits ARN nucléolaires (snoRNAs)

Modifications de certains nucléotides d’ARNr et d’ARNsn

(Appariements du snoRNA à sa cible)

Méthylation de la position 2’-O du ribose des nucléotides

Pseudouridylation de nucléotides

Nom

Rôle

Cible chez Sace

ARNr 18S, 25S ou 5.8S

Les ARNr et l’ARNsn U2

Structure 2D (La cible est en rouge, La position modifiée en orange)

CH3

CH3

NΨ NΨ

Taille ~100nt ~200nt (Peut atteindre 1000nt!)

Les petits ARN nucléolaires (snoRNAs)

Modifications de certains nucléotides d’ARNr et d’ARNsn

(Appariements du snoRNA à sa cible)

Méthylation de la position 2’-O du ribose des nucléotides

Pseudouridylation de nucléotides

Nom

Rôle

Cible chez Sace

ARNr 18S, 25S ou 5.8S

Les ARNr et l’ARNsn U2

Structure 2D (La cible est en rouge, La position modifiée en orange)

CH3

CH3

NΨ NΨ

Taille ~100nt ~200nt

Ces snoRNA forment avec des protéines des complexes snoRNP (complexes RiboNucléoProtéiques). La fonction enzymatique est portée par les protéines.

(Peut atteindre 1000nt!)

Nature 443, 302 (2006)

a, Sequence and secondary structure of the single-hairpin archaeal H/ACA RNA used in this study. Also shown is a bound cognate substrate RNA, which is, however, not present in the structure. Paired regions are named as P1 and P2 for the lower and upper stems, and PS1 and PS2 for duplexes formed between guide sequences (orange) and substrate RNA (purple), respectively. The modification target is shown as product pseudouridine (, red). The terminal k-turn and ACA motif are highlighted in red. Every tenth nucleotide is numbered, with prime denoting numbering of the substrate RNA. b, Ribbon representation of the H/ACA RNP structure in front view. c, Side view. Different colours are used for the Cbf5 catalytic domain (dark green), Cbf5 PUA domain (lime green), Nop10 and zinc ion (magenta), L7ae (light blue), Gar1 (cyan), k-turn and ACA motifs (red), guides (orange) and the rest of the RNA (yellow). The same colour coding is used for the other figures. Major secondary structure elements are shown for proteins. The N and C termini are indicated when appropriate. Dots represent disordered chains; star denotes the active site.

Plusieurs protéines impliquées : seul l’ensemble donne une vision correcte même des relations deux à deux

K-Turns bend the RNA

5’

5’

3’ 3’

Depending on the non-WC pairs the turn is either

to the left or to the right

K-turn Recognition

a, Overall view highlighting the intimate protein contacts along the P1 minor groove.

ACA recognition

b, The RNA–protein hybrid binding pocket for A58.

c, Binding of C59 and A60. Interacting residues are shown in ball-and-stick representation, water as a red sphere, hydrogen bonds as dashed lines, and hydrogen-bonding atoms are coloured as red for oxygen and blue for nitrogen.

d, Dyskeratosis congenita mutations in the PUA domain, indicated by C spheres, side chains from this structure and residue numbers in dyskerin. Also shown is the RNA enveloped in the 2fo - fc electron density map at the 1.5 level and the partial RNA-binding surface.

Mutations présentes dans la dyskeratose congénitale

a, Structural model of the substrate complex.

Loop flexibility

b, Two states of the putative substrate-binding loop. In our structure, the loop adopts an open conformation: it docks against Gar1 and appears to be unable to bind substrate RNA. The loop from the Cbf5–Nop10–Gar1 structure23 (grey) is shown as an approximation of the RNA-bound state.

ARN double brin exogène

DICER

Transfection Infection virale

RISC

ARNm

Coupure de l’ARNm

L’ARN interférence (ARNi)

ARN de 21-24 nt

Plants C. elegans

Drosophila

RNA-induced silencing complex

RISC

Double stranded

RNA

Fungi

Caplen et al., PNAS (2001) 98 9742 Elbashir et al., Nature (2001) 411 494

Mammals S. pombe

Fire et al., Nature (1998) 391 806

s

dsRNA processing

RNA interference

Napoli et al., Plant Cell (1990) 2 289 Van der Krol et al., Plant Cell (1990) 2 291

Small interfering

RNAs (SiRNAs)

Romano & Macino Mol. Microbiol (1992) 6 3343

Volpe et al., Science (2003) 292 1833

Misquitta & Paterson PNAS (1999) 96 1451 Kennerdell & Carthew Cell (1998) 95 1017

Andrew FIRE & Craig MELLO

MicroARN endogènes"

DICER

AAAA"3ʼ-UTR"

microARN

RISC

Répression traductionnelle

Les microARN (miARN)

Drosha

ARN ˜ 22 nt

ARN ˜ 70 nt

ADN

Epigénétique

ARN

Transcription Traduction

Un réseau imbriqué et multiple de régulations génétiques contrôlées par l’ARN

miRNAs: Major challenges •  Mechanim of translational inhibition

•  Identification of mRNA targets

•  How are they regulated ?

?"

AAAAAAAAA"3ʼ-UTR"

?"

miRNA gene

Biogenesis of microRNAs

Jinek, M., Doudna, J. A., Nature 457, 405 (2009)

RNase III

Dicers

Drosha

E.c. RNaseC

Piwi domain PAZ domain

Identification of the “Splicer” Nuclease Activity in the RISC Complex

Argonaute is a protein found in the RISC complex and required for RNAi.

The PIWI domain is similar to the RNase H domain

A. Fulgidus Piwi-RNA complex

A. Fulgidus Piwi-RNA complex

Anchoring of the 5’-phosphate

PAZ domain binds 2nt 3’-overhang

Ma, Ye, and Patel, 2004

PAZ recognition of 3’ 2nt-overhang

Piwi domain is nuclease •  Structure similar to RNase H •  RNase H and slicer leave 3’ -OH and 5’ P •  Mutations in key residues abolish cleavage

RNase H1 E.c. Piwi PfAgo PfAgo

Variety of RNases and conservation of RNase

mechanisms

Major types of endoribonucleases RNase A cleaves the 3'-end of unpaired C and U residues, ultimately forming a 3'-phosphorylated product via a 2',3'-cyclic monophosphate intermediate. RNase H is a ribonuclease that cleaves the RNA in a DNA/RNA duplex to produce ssDNA. RNase H is a non-specific endonuclease and catalyzes the cleavage of RNA via a hydrolytic mechanism, aided by an enzyme-bound divalent metal ion. RNase H leaves a 5'-phosphorylated product. RNase I cleaves 3'-end of ssRNA at all dinucleotide bonds leaving a 5'-hydroxyl, and 3'-phosphate, via a 2',3'-cyclic monophosphate intermediate. RNase III is a type of ribonuclease that cleaves rRNA (16s rRNA and 23s rRNA) from transcribed polycistronic RNA operon in prokaryotes. It also digests double strands RNA (dsRNS)-Dicer family of RNAse, cutting pre-miRNA (60–70bp long) at a specific site and transforming it in miRNA (22–30bp), that is actively involved in the regulation of transcription and mRNA life-time. RNase L is an interferon-induced nuclease that, upon activation, destroys all RNA within the cell. RNase P is a type of ribonuclease that is unique in that it is a ribozyme – a RNA that acts as a catalyst in the same way as an enzyme. Its function is to cleave off an extra, or precursor, sequence on tRNA messengers. RNase P is one of two known multiple turnover ribozymes in nature (the other being the ribosome). The mitochondrial form of RNase P that is a protein and does not contain RNA has recently been discovered. RNase PhyM is sequence specific for single-stranded RNAs. It cleaves 3'-end of unpaired A and U residues. RNase T1is sequence specific for single-stranded RNAs. It cleaves 3'-end of unpaired G residues. RNase T2 is sequence specific for single-stranded RNAs. It cleaves 3'-end of all 4 residues, but preferentially 3'-end of As. RNase U2 is sequence specific for single-stranded RNAs. It cleaves 3'-end of unpaired A residues. RNase V1 is non-sequence specific for double-stranded RNAs. It cleaves base-paired nucleotide residues.

Major types of exoribonucleases Polynucleotide Phosphorylase (PNPase) functions as an exonuclease as well as a nucleotidyltransferase. RNase PH functions as an exonuclease as well as a nucleotidyltransferase. RNase II is responsible for the processive 3'-to-5' degradation of single-stranded RNA. RNase R is a close homolog of RNase II, but it can, unlike RNase II, degrade RNA with secondary structures without help of accessory factors. RNase D is involved in the 3'-to-5' processing of pre-tRNAs. RNase T is the major contributor for the 3'-to-5' maturation of many stable RNAs. Oligoribonuclease degrades short oligonucleotides to mononucleotides. Exoribonuclease I (EXRN1) degrades single-stranded RNA from 5'-to-3', exists only in eukaryotes. Exoribonuclease II is a close homolog of Exoribonuclease I. XRN2 also known as DHM1-like protein is an exoribonuclease enzyme that in humans is encoded by the XRN2 gene. The human gene encoding XRN2 shares similarity with the mouse Dhm1 and the yeast dhp1 genes. The yeast gene is involved in homologous recombination and RNA metabolism, such as RNA synthesis and RNA trafficking. Complementation studies show that Dhm1 has a similar function in mouse as dhp1.

Catalytic Mechanism In the ribonuclease A

Site actif du fragment de Klenow de la polymérase d’E. coli Le fragment de Klenow est le plus gros des 2 fragments protéiques formés par l'hydrolyse de l'ADN polymérase I d'Escherichia coli par une protéase. Découvert en 1970, il conserve deux des activités catalytiques de l'ADN polymérase I : la polymérase 5’→3’ et l'exonucléase 3’→5’, mais a perdu son activité d'exonucléase 5'→3' responsable de la dégradation de l'ADN néosynthétisé.

A two-metal-ion catalysis in RNA

Steitz & Steitz, PNAS, 1993

Figure 1 Escherichia coli RNase E. (a) Ribbon representation of the homotetramer of the catalytic domain of RNase E from E. coli (PDB code 2c0b). The different subdomains of the four protomers revealed by the structure are shown as indicated in the c...

Jonathan AR Worrall , Ben F Luisi

Information available at cut rates: structure and mechanism of ribonucleases Current Opinion in Structural Biology, Volume 17, Issue 1, 2007, 128 - 137

http://dx.doi.org/10.1016/j.sbi.2006.12.001

Figure 2 Schematic summary of the modes of RNA processing of some of the endoribonucleases (RNase E) and exoribonucleases discussed in the text and in <ce:cross-ref refid="tbl1"> Table 1</ce:cross-ref> . Common protein domains are indicated and scissors re...


Information available at cut rates: structure and mechanism of ribonucleases

Current Opinion in Structural Biology, Volume 17, Issue 1, 2007, 128 - 137


Figure 4 Ribbon or surface representation of (a) the archaeal core exosome from A. fulgidus (PDB code 2ba0) and (b) PNPase from Streptomyces antibioticus (PDB code 1e3p) viewed along the threefold rotation axis. In the exosome, a ring of alternatin...


Information available at cut rates: structure and mechanism of ribonucleases



RNase II (Nature 443, 110, (2006)

RNase II is a ubiquitous exoribonuclease that processively hydrolyses RNA in the 3’ to 5’ direction, releasing 5’ monophosphates. The enzyme binds RNA and in the presence of divalent cations cleaves single-stranded RNA (ssRNA), one nucleotide at a time, independently of sequence. RNase II is often essential for growth, can be developmentally regulated, and mutations in its gene have been linked with abnormal chloroplast biogenesis, mitotic control and cancer. In eukaryotes, RNase II (also called Dis3/Rrp44) is a component of both the nuclear and cytoplasmic exosome, a complex of exoRNases crucial for RNA metabolism. The exosome is involved in the maturation and turnover of RNA, RNA interference, and surveillance pathways that recognize and degrade aberrant RNAs9–11. The end-product of exosome degradation, like that of RNase II itself, is a four-nucleotide RNA oligomer. RNase II is also important in the regulation of polyadenylation mediated decay in bacteria, and some family members have been shown to be involved in stress responses and virulence.

Nowotny et al.

Stereoview of the RNase HC-substrate complex. The molecular surface of RNase HC is shown in pinkish gray, and the substrate RNA (red) and DNA (blue) are shown as rods (backbone) and sticks (bases). The three crystal (pink) and three NMR (yellow) structures of RNA/DNA hybrids are superimposed onto the RNase HC structure. Nucleotides are numbered relative to the nucleotide at the active site (R 0) and according to the polarity of the RNA strand. Interactions between the RNA/DNA hybrid and RNase HC. Shown are the residues interacting with phosphates (yellow highlight), sugars (green highlight), and bases (gray highlight). Cyan lines indicate interactions made by the protein backbone, and black lines indicate interactions made by side chains. Water-mediated interactions are indicated by -W.

Ribonuclease III -Gan et al. Cell 124, 355 (2006)

Figure 2 Structural insight into bacterial RNase III. (a) Crystal structure of the ribonuclease domain dimer of Aquifex RNase III (PDB code 1RC5). The two polypeptide chains are identical in sequence and colored different shades of green for clarity. C... Ian J MacRae , Jennifer A Doudna

Ribonuclease revisited: structural insights into ribonuclease III family enzymes



Cleavage part of DICER

Published by AAAS

I. J. MacRae et al., Science 311, 195 -198 (2006)

Fig. 2. Crystal structure of Giardia Dicer

Published by AAAS I. J. MacRae et al., Science 311, 195 -198 (2006)

Fig. 4. A model for dsRNA processing by Dicer

Figure 4 Schematic cartoon of the Microprocessor complex bound to a pri-miRNA. Drosha and DGCR8 subunits are colored green and blue, respectively. Black arrows indicate the cleavage sites in the pri-miRNA.

Ian J MacRae , Jennifer A Doudna

Ribonuclease revisited: structural insights into ribonuclease III family enzymes



Loop-loop interactions involved in antisense regulation are processed by the endoribonuclease III in Staphylococcus aureus Cédric Romilly,Clément Chevalier, Stefano Marzi, Benoit Masquida, Thomas Geissmann, François Vandenesch, Eric Westhof and Pascale Romby, RNA Biology 9:12, 1461–1472 (2012).

RNAi inhibitors Measuring device for 21 nt

Argonaute complexes with guide and/or passenger strands

Figure 1 Structure of human Argonaute-2 (hAgo2). (A) Top: Structure of the hAgo2–miR-20a complex in cartoon representation (). The N domain is shown in blue, the Piwi–Argonaute–Zwille (...

Claus-D. Kuhn , Leemor Joshua-Tor

Eukaryotic Argonautes come into focus

Trends in Biochemical Sciences, Volume 38, Issue 5, 2013, 263 - 271

http://dx.doi.org/10.1016/j.tibs.2013.02.008

Ago a bilobal architecture, amino-terminal PAZ-containing (N and PAZ) and carboxy-terminal PIWI-containing (Mid and PIWI) lobes. The PIWI domain adopts an RNaseH fold, in which the catalytic Asp-Asp-Asp/His residues contribute to slicer activity; the Middomain sequesters the 5’-phosphate of the guide strand; The PAZ domain recognizes the 2-nucleotide overhang at the 3’-end of the guide strand. Ago-mediated target-RNA cleavage requires Watson–Crick pairing between guide and target, spanning both the seed segment (positions 2–8) and the cleavage site (10–11 step) as counted from the 5’-end of the guide strand. Endonucleolytic cleavage is mediated by Mg cations and generates fragments containing a 3’-OH for the 5’-segment and a 5’-phosphate for the 3’-segment.

Figure 6 Our current view of eukaryotic Argonaute. The 5′-phosphate of the guide strand is tightly anchored between the Mid and PIWI domains with the base edge of the 5′-nucleotide being recognized by the selectivity loop in the Mid domain (see <ce:cross-r...





a, The crystal structure of the PAZ domain of human AGO1 (ribbon format) is shown in complex with an siRNA-like duplex (stick format) (PDB identity 1SI3). Conserved residues in contact with the 3' nucleotide are shown in stick format and labelled. The 3' end of the siRNA inserts into a preformed hydrophobic pocket, with the base of the 3' nucleotide stacking against an invariant aromatic residue (the phenylalanine at position 292 in the protein, Phe 292). b, The crystal structure of Archaeoglobus fulgidus Piwi bound to an RNA duplex (PDB identity 2BGG), which mimics the guide–target interaction, is shown. A. fulgidus Piwi is composed of a MID domain and a PIWI domain (also referred to as domain A and domain B, respectively). The 5' nucleotide of the guide strand (backbone shown in red) binds at the MID–PIWI domain interface and does not base-pair with the target strand (blue). c, Shown is a detailed view of the pocket in A. fulgidus Piwi that binds to the 5' end of small RNAs. A magnesium ion, coordinated by the C terminus of the protein (Leu 427) and the 5' phosphate group, is shown as a purple sphere. Conserved residues that are involved in metal-ion coordination and 5'-phosphate binding are shown in stick format and labelled.

Putative models for target-RNA recognition by Argonaute proteins are illustrated. The fixed-end model postulates that both the 5' and 3' ends of the guide strand remain docked in their binding pockets during slicing. The two-state model postulates that the seed region of the guide occurs in two steps: first, nucleation of base-pairing with the target RNA; and second, propagation of the guide–target duplex, leading to the release of the 3' end of the guide strand from the PAZ domain.

Figure 2 Path of the seed sequence of the guide RNA. (A) Superposition of the human Argonaute-2 (hAgo2)–miR-20a complex ( and Kluyveromyces polysporus Argonaute (KpAgo) bound to hete...





Guide DNA RED Target RNA BLUE p-TGAGGTAGTAGGTTGTATAGT UGCUCCAUCACUCAACAUAU 5ʹ

Figure 4 The miRNA 5′-end binding pocket. (A) Superposition of human Argonaute-2 (hAgo2) and the Arabidopsis thaliana Argonaute-1 (AtAgo1) Mid domains based on the 5′-U of miR-20a () ...





Figure 5 An updated model for the active site of human Argonaute-2 (hAgo2) and a model for target cleavage. (A) Superposition of RNase H bound to an RNA/DNA hybrid and hAgo2 based on...

Claus-D. Kuhn , Leemor Joshua-Tor Eukaryotic Argonautes come into focus



The active site is formed by FOUR residues and not only THREE. A glutamate in loop L2 is the fourth one (conformational change).

YL Wang et al. Nature 461, 754-761 (2009) doi:10.1038/nature08434

Crystal structure of T. thermophilus Ago(Asn 546) catalytic mutant bound to 5ʹ′-phosphorylated 21-nucleotide guide DNA and 12-nucleotide target RNA.


Crystal structure of T. thermophilus Ago(Glu 546) catalytic mutant bound to 5ʹ′-phosphorylated 21-nucleotide guide DNA and 15-nucleotide target RNA.


Crystal structure of T. thermophilus Ago(Asn 478) catalytic mutant bound to 5ʹ′-phosphorylated 21-nucleotide guide DNA and 19-nucleotide target RNA and identification of Mg2+ binding sites within the catalytic pocket of the wild-type Ago complex.

a, Sequence of the guide DNA–target RNA duplex. The traceable segments of the bases of the guide DNA and target RNA in the structure of the ternary complex are shown in red and blue, respectively. Disordered segments of the bases on both strands that cannot be traced are shown in grey. b, View of the 2.6  Å crystal structure of the Ago ternary complex. The Ago protein domains (N in cyan, PAZ in magenta, Mid in orange, PIWI in green) and linkers (L1 and L2 in grey) are colour-coded. The bound 21-nucleotide guide DNA (red) is traced for bases 1–12 and 20–21, whereas the bound 12-nucleotide target RNA (blue) is traced for bases 2′–12′. Backbone phosphorus atoms are yellow. Both ends of the bound guide DNA are anchored. c, Expanded view of the ternary complex highlighting the alignment of guide DNA (1–3) and target RNA (2′–3′), where the bases of the 1–2 step of the guide strand are splayed. Note the intermolecular hydrogen-bonding of the Watson–Crick edge of T1 with the backbone amide carbonyl of Met  413 and side chain of Asn  436, as well as the positioning of phosphate 1 of the guide strand in the Mid binding pocket. A Mg2+ cation (purple) coordinates to phosphates 1 and 3 of the guide strand, as well as to an inserted carboxylate of Val  685 from the C terminus. d, Expanded view of the ternary complex highlighting the guide DNA (1–12)–target RNA (2′–12′) duplex, together with the catalytic residues (Asp  478, Asp  660 and Asn  546 mutant) of the RNase H fold of the PIWI domain. The scissile phosphate group at the 10′–11′ step of the target RNA is indicated by a red arrow. e, Expanded view highlighting the positioning of the backbone phosphate linking the 10′–11′ step (phosphorus coloured in magenta) of the target RNA relative to the catalytic residues (Asp  478, Asp  660 and Asn  546 mutant) in the ternary complex. f, Positioning of the side chain of Arg  548 relative to the guide DNA (6–12)–target RNA (6′–12′) duplex. Note the intermolecular contacts between the sugar-phosphate backbone of the guide strand and side chains of the protein in the ternary complex.

a, Sequence of the guide DNA–target RNA duplex, with traceable segments colour-coded as in Fig. 1a. b, View of the 3.05  Å crystal structure of the Ago ternary complex, colour-coded as outlined in Fig. 1b. The bound 21-nucleotide guide DNA (red) is traced for bases 1–16, whereas the bound 15-nucleotide target RNA (blue) is traced for bases 2′–15′. Only the 5′-end of the guide DNA is anchored in this ternary complex. c, d, Comparison of the crystal structures of mutant Ago(Asn  546)–12-nucleotide target (c) and of mutant Ago(Glu  546)–15-nucleotide target (d) ternary complexes. The Ago protein is shown in a surface representation with domains and linkers colour-coded as in Fig. 1b. The guide DNA (red) and target RNA (blue) are shown in stick representation with backbone phosphorus atoms in yellow. e, View of the alignment of mutant Ago(Asn  546)–12-nucleotide target complex (magenta) and mutant Ago(Glu  546)–15-nucleotide target complex (silver), after superpositioning of their PIWI-containing (Mid and PIWI) modules. The yellow arrow indicates the magnitude of the conformational change on proceeding from the 12-nucleotide target to 15-nucleotide target ternary complexes. f, Conformational changes in loop 1 (residues 479–488, red arrow) and loop 2 (residues 505–516, green arrow) of the PIWI domain on proceeding from the 12-nucleotide target ternary complex (magenta) to the 15-nucleotide target ternary complex (silver). Only the DNA–RNA duplex for the 15-nucleotide target ternary complex is shown in cyan in a surface representation. Loops 1 and 2 are coloured light red (labelled L1′) and light green (labelled L2′) in the 12-nucleotide target ternary complex, and dark red (labelled L1) and dark green (labelled L2) in the 15-nucleotide target ternary complex. The β-strand involved in sliding is highlighted by a black double-edged arrow. g, Ternary complex containing 12-nucleotide target RNA. Residues 11 and 12 of the guide strand are in red, and loops L1′ and L2′ are in light red and light green, respectively. h, Ternary complex containing 15-nucleotide target RNA. Residues 11 to 15 of the guide strand are in red, and loops L1 and L2 are in dark red and dark green, respectively. Loop L1 switches to a β-turn aligned by hydrogen bonding within the turn and also with loop L2, thereby stabilizing this turn conformation. The main-chain of Glu  512 forms a hydrogen bond with the phosphate group of residue 14 of the guide DNA. The positively charged side chains of Arg  513 and Arg  486 interact with the backbone of the DNA guide strand, as indicated by blue arrows. i, Ribbon representation of the sliding of the β-strand (Gly  489 to Val  494) by one residue, and conformational transition in adjacent L1 loop on proceeding from the 12-nucleotide target RNA ternary complex (magenta) to 15-nucleotide target RNA ternary complex (silver).

a, Sequence of the guide DNA-target RNA duplex, with traceable segments colour-coded as in Fig. 1a. b, View of the 2.8  Å crystal structure of the ternary complex, colour-coded as outlined in Fig. 1b. The bound 21-nucleotide guide DNA (red) is traced for bases 1–16, whereas the bound 19-nucleotide target RNA (blue) is traced for bases 2′–16′. Only the 5′-end of the guide strand is anchored in this ternary complex. c, Expanded view of the 19-nucleotide target ternary complex highlighting blocking of propagation of the guide DNA–target RNA duplex beyond pair 16 by the N domain. Base  16 of the guide strand stacks over the aromatic ring of Tyr  43, whereas base 16′ of the target strand stacks over Pro  44. d, Intermolecular hydrogen-bonding contacts between the sugar-phosphate backbone of the 10′–13′ target RNA segment and backbone and side chains of the PIWI domain in the 19-nucleotide target ternary complex. e, f, Fo  -  Fc omit maps (blue colour, contoured at 3.5σ) of the 9′–12′ segment of bound RNA and catalytic Asp  478, Asp  546 and Asp  660 residues in the 3.3  Å structures of the ternary complexes in 50  mM Mg2+ (e, space group P43212, one molecule in the asymmetric unit) and in 80  mM Mg2+ (f, space group P212121, two molecules in asymmetric unit). Bound Mg2+ cation(s) were identified in omit maps contoured in purple at 6.0σ as outlined in e and f, based on coordination to several oxygen atoms in an approximate octahedral geometry. One bound Mg2+ cation can be assigned in the ternary complex in 50  mM Mg2+ in e, and two bound Mg2+ cations can be assigned in the ternary complex in 80  mM Mg2+ in f.

Figure 3 | RNA degradation by RNase II. a, Stereo view of RNase II D209N mutant active site; bonds are shown as sticks (oxygen in red, nitrogen in blue, phosphorus in orange), waters as red spheres, Mg as a green sphere and its coordination as dashed orange lines, and hydrogen bonds as dashed green lines, superposed with sigma-A corrected Fourier synthesis electron density map (brown mesh) contoured at 1 sigma. Additionally, N1 and N6 of nucleotide 13 are in the vicinity of the carboxylate oxygens of Glu 542, at 3.2 Å (hydrogen bond as dashed green lines) and at 4.3 Å (distance as dotted orange line), respectively. b, Magnified view of the Mg ion and its coordinating environment (distances in Å) superposed with the positive 3 sigma-A corrected Fourier difference map (green mesh) calculated with the Mg and coordinating waters omitted from the model. c, Stereo view of the superposition of the RNase II D209N mutant (yellow) and RNase H (grey) with magnesium coordinating spheres (opposite view to Fig. 3a). RNase H displays two magnesium ions ligated by Glu 109, D132N, Glu 188 and Asp 192 that correspond in RNase II to Asp 201, Asp 210, D209N and Asp 207, respectively.

d, Proposed catalytic mechanism for RNase II, showing the postulated second Mg (Mg II) and the attacking hydroxyl group (grey). e, Model for RNA degradation by RNase II. ssRNA (red) is threaded into the catalytic cavity and clamped between Tyr 253 and Phe 358. The additional stabilization of RNA inside the cavity drives the RNA translocation after each cleavage, up to a final four-nucleotide fragment.

Figure 2 | RNase II–ssRNA interactions. a, Atomic interactions scheme between RNA (enclosed atoms in black or in red for O2’-protein interactions) and protein residues (coloured by domains as in Fig. 1a). Hb indicates hydrogen bonds up to 3.2 Å, and vdW indicates van der Waals interactions up to 3.6 Å. b, c, RNA docking catalytic region (b) with residues 364–381 deleted for clarity, and anchor region (c) involving canonical oligonucleotide-binding motifs16 L23 of CSD2, and chain b3 and loop L45 of S1. RNA (coloured as in Fig. 1) and protein hydrogen bonding side-chain residues shown in sticks (carbon in yellow, nitrogen in cyan, oxygen in red), enzyme domains as cartoons (coloured as in Fig. 1). Hydrogen bonds shown as dashed green lines, Mg shown as green sphere with coordination in dashed yellow lines. Nucleotides (Nt) 9–13 are clamped between the aromatic sidechains of Tyr 253 and Phe 358 (with labels highlighted in green), nucleotides 3 and 4 are between Phe 588 and Pro 104, and nucleotide 5 is nestled between His 103, Pro 104, Asp 102 and Arg 167.

Figure 1 RNase II and its RNA complex. a, Top, representation of RNase II–RNA complex, showing domains CSD1 (orange), CSD2 (yellow), RNB (light cyan) and S1 (green), the Mg ion as a sphere (green) and RNA in sticks (blue to red with increasing B factors). Bottom, linear representation of RNase II domains with numbers specifying the positions of the residues. b, Superposition of the polypeptide chains of native RNase II (blue) and its D209N derivative (yellow). c, Electrostatic potential of RNase II D209N, mapped on its semi-transparent solvent accessible surface, with docked RNA (phosphate backbone in green, ribose rings in yellow and bases in cyan) with numbers highlighting relevant bases. d, e, Docking of RNA over the enzyme surface through d, the catalytic site (nucleotides 9–13), and e, the anchor region (nucleotides 1–5), at the entrance of the cleft. Red to blue surface indicates negative to positive electrostatic potentials.

Les interactions et complexes entre ARN et protéines

Documents

Transcript of Les interactions et complexes entre ARN et protéines