OLIVIER DOMINGUE

INDUCTION DE RÉPRESSION GÉNÉTIQUE POST-TRANSCRIPTIONNELLE DE ATMLH1, UN DES PRINCIPAUX GÈNES DE CORRECTION DES

MÉSAPPARIEMENTS DE L’ADN CHEZ ARABIDOPSIS THALIANA

Mémoire présenté à la Faculté des études supérieures de l'Université Laval

dans le cadre du programme de maîtrise en biologie végétale pour l’obtention du grade de maître ès sciences (M. Sc.)

FACULTÉ DES SCIENCES DE L’AGRICULTURE ET DE L’ALIMENTATION UNIVERSITÉ LAVAL

QUÉBEC

AVRIL 2005

© Olivier Domingue, 2005

ii

RÉSUMÉ

Afin de caractériser sa fonction, des lignées transgéniques de type ihpRNA ont été

produites pour induire une inactivation spécifique du gène AtMLH1 chez Arabidopsis

thaliana. Elles ont été générées en transformant la plante avec un vecteur comportant un

même fragment du gène AtMLH1 inséré en directions sens et anti-sens. Cinq lignées

montrant un éventail d'intensités de répression ont été rigoureusement analysées. Trois

lignées, ihpMLH1-63, -70 et -73, présentaient une forte réduction de l’abondance du

transcrit (~10 % du sauvage), une (ihpMLH1-51) montrait un abaissement intermédiaire

(~30 % du sauvage) et une dernière (ihpMLH1-54) n’avait qu’une inactivation mineure

(~60 %), tel que mesuré par RT-PCR semi-quantitatif. Une étude northern a permis de

détecter des siRNA dont l’abondance était corrélée avec l’intensité de la répression.

L’étude des conséquences phénotypiques de l’inactivation du gène AtMLH1 a été amorcée

en examinant son impact sur l’instabilité des microsatellites via un gène rapporteur. Dû à

un phénomène de co-suppression, cette analyse n'a pas été informative. Les conséquences

de l’inactivation du gène AtMLH1 feront donc l'objet de futurs travaux.

iii

AVANT-PROPOS

Cet ouvrage a été rédigé sous forme de mémoire avec insertion d'article. J'ai entièrement

composé le manuscrit formant le corps du travail (Olivier Domingue, bachelier en biologie

-spécialisation biotechnologie- de l'Université de Sherbrooke, premier auteur). Les résultats

obtenus sont également l'œuvre de mes travaux, conseillé et dirigé par Dre Martine Jean,

professionnelle de recherche (seconde auteure), et par Dr François Belzile, directeur de

recherche (troisième auteur). Le manuscrit s'intitule «ihpRNA-mediated post-

transcriptional gene silencing of AtMLH1, an Arabidopsis thaliana DNA mismatch repair

gene.» et traite de la production de lignées réprimées du gène végétal de correction de

mésappariements AtMLH1. Il sera soumis sous cette forme ou en version modifiée,

conjointement aux recherches doctorales de M. Eric Dion (étudiant au laboratoire du Dr

François Belzile), à un périodique spécialisé en génétique moléculaire végétale.

En plus du travail décrit plus haut, j’ai également contribué au projet de recherche doctorale

de M. Abdourahamane Alou. Cette contribution m’a valu d’être co-auteur d’un article de la

thèse de ce dernier (Alou et al., 2004). Comme il n’y avait pas de lien direct entre ce travail

et le corps principal du mémoire, cet article a été placé en annexe, précédé d’un court texte

détaillant ma contribution à celui-ci.

D'autre part, je tiens à utiliser l'espace qui m'est ici alloué pour remercier tous ceux qui

m'ont apporté aide et conseils durant ma maîtrise.

Je voudrais d'abord remercier mon directeur de recherche, M. François Belzile, pour son

attention, sa disponibilité et surtout pour l’attitude calme et optimiste qu’il a conservée tout

iv

au long de ce travail de maîtrise. Ses conseils m’ont régulièrement aidé à remettre les

choses en perspective et à mener à bien mes recherches.

J’aimerais également adresser des remerciements particuliers à Martine Jean, Samuel

Santerre-Ayotte, Eric Dion et Abdourahamane Alou pour l'aide qu’ils m’ont chacun

apportée au cours de diverses expériences et pour les discussions enrichissantes que leur

interaction a suscitée.

De façon plus générale, je remercie également tous les membres du laboratoire qui ont fait

de mon séjour à l'Université Laval une expérience unique, soit Liang, Vicky, Cindy, Eric

B., Aïda, Julien, Isabelle, Maxime, Suzanne, Tung, Geneviève, Ana, Mélanie et Éveline.

Je tiens à remercier par dessus tout ma copine Mélissa; sa patience infinie et son amour

m’ont été d’un support inestimable tout au long de ces deux années passées à Québec.

Enfin, ce travail de recherche a été soutenu et financé par le Conseil de Recherche en

Sciences Naturelles et en Génie du Canada.

v

« If we knew what we were doing,

it wouldn't be called research, would it ? »

Albert Einstein

vi

TABLE DES MATIÈRES

RÉSUMÉ ii

AVANT-PROPOS iii

TABLE DES MATIÈRES vi

LISTE DES TABLEAUX viii

LISTE DES FIGURES ix

LISTE DES SYMBOLES ET ABRÉVIATIONS x

CHAPITRE1: INTRODUCTION 1

1.1 Le Système MMR 1

1.1.1 Rôle du MMR dans la correction des mésappariements lors de la réplication 1

1.1.2 Rôle du système MMR dans les phénomènes de recombinaison 5 1.1.3 Rôle du système MMR au cours de la méiose 7 1.1.4 Le système MMR chez la plante 7

1.2 Répression génétique post-transcriptionnelle 8

1.2.1 Mécanismes et fonctions du PTGS 9 1.2.2 Rôles des petits ARN interférants 11 1.2.3 Utilisation du PTGS en génétique

fonctionnelle et génétique inverse 13 1.2.4 Induction du PTGS en génétique

fonctionnelle végétale; les ihpRNA 14 1.2.5 Avantages du PTGS 15

1.3 Problématique 17

1.4 Objectifs 18

vii

CHAPITRE 2: ihpRNA-mediated post-transcriptional gene silencing

of AtMLH1, an Arabidopsis thaliana DNA mismatch repair gene 19

Résumé du manuscrit 20

Summary 21

Introduction 22

Materials and methods 25

Construction of the ihpRNA construct for RNAi silencing 25 Plant transformation, selection and growth 25 RNA Extraction and reverse Transcriptase-Mediated PCR 26 Visualization of small RNA fragments (siRNA) 26 Northern blot analysis 27 Crosses of the ihpMLH1 RNAi lines with GUS reporter lines 27 Histochemical GUS assay 28 Results 29

Production of AtMLH1 RNAi lines 29 Analysis of AtMLH1 mRNA level in RNAi T2 plants 29 The presence of siRNA correlates with the level of AtMLH1 transcript 30 Cross with microsatellite instability reporter line 30 Observed co-suppression of transgenes 30 Discussion 32

Acknowledgements 41

References 41

CHAPITRE 3 : CONCLUSION 44

BIBLIOGRAPHIE 48

ANNEXES 53

viii

LISTE DES TABLEAUX CHAPITRE 1: Tableau 1 : Caractéristiques des différentes classes de siRNA 12 CHAPITRE 2: Tableau 1 : Primers used in the making of the ihpRNA construct,

probe synthesis, PCR and RT-PCR experiments 36

ix

LISTE DES FIGURES CHAPITRE 1: Figure 1 : Modèle de reconnaissance et de réparation des

mésappariements par le système MMR 2 Figure 2 : Homo- ou hétérodimères formés des homologues

de MutS et MutL en fonction des types de mésappariements corrigés chez différents organismes 4

Figure 3 : Prise en charge d'hétéroduplexes contenant des

mésappariements par le système MMR 6 Figure 4 : Mécanismes de la répression génétique post-transcriptionnelle 10 Figure 5 : Techniques d'induction stable du PTGS 14 Figure 6 : Structure du vecteur pHANNIBAL et procédure

pour la création d'une construction ihpRNA 15 CHAPITRE 2: Figure 1 : RT-PCR analysis of AtMLH1 transcript level in five RNAi lines 37 Figure 2 : Northern detection of siRNA in five RNAi lines and

its correlation with transcript levels 38 Figure 3 : Northern analysis of the GUS transcript

in F1 (ihpMLH1 x 131D) plants 39 Figure 4 : Partial resistance to kanamycin in F1 plants 40

x

LISTE DES SYMBOLES ET ABRÉVIATIONS

abRNA : ARN aberrant

ADN : Acide désoxyribonucléique

ARN : Acide ribonucléique

ARNm: ARN messager

ATP : Adénosine triphosphate

°C : degré Celsius

cDNA: ADN complémentaire

DICER : ribonucléase de type III intervenant en PTGS

dsRNA: ARN double brin

hpRNA: ARN en épingle à cheveux

ihpRNA: ARN en épingle à cheveux comportant un intron

mg: Milligramme

min: Minute

miRNA: Micro ARN

mM: Millimolaire

MLH : Homologue de MutL

MMR : Correction des mésappariements

MSH : Homologue de MutS

MSI: Instabilité des microsatellites

nt: Nucléotide

pb : Paire de bases

PCR : Réaction de polymérisation en chaîne

PMS : Ségrégation post-méiotique

PTGS: Répression génétique post-transcriptionnelle

RISC: Complexe d’inactivation génétique induit par ARN

RNAi: Interférence d'ARN

RT-(PCR): Amplification PCR d'une réaction de transcription inverse

sec: Seconde

siRNA: Petits ARN interférants

stRNA: Petits ARN temporels

T-DNA : ADN de transfert

TGS: Répression génétique transcriptionnelle

xi

µl: Microlitre

µg: Microgramme

VIGS: Répression génétique induite par un virus

1

CHAPITRE 1 : INTRODUCTION

Les êtres vivants sont constamment exposés aux effets dommageables d'agents mutagènes.

Plusieurs de ces agents sont d’origine exogène tels que les radiations, les métaux lourds et

autres composés chimiques mutagènes qui entrent en contact avec les plantes. Par ailleurs,

il existe également de nombreux agents nocifs qui sont produits par la cellule elle-même

tels que des dérivés du métabolisme naturel (peroxyde, oxyde nitrique, composés

phénoliques, etc.). Finalement, les erreurs inhérentes aux processus de réplication de l'ADN

contribuent également aux stress que subit le génome. Comme une seule mutation peut

s'avérer fatale, plusieurs mécanismes ont évolué pour limiter ces dégâts. L’un d’eux, le

système MMR, pour « Mismatch Repair » ou correction des mésappariements, est quasi

ubiquiste chez les êtres vivants et constitue une arme de première importance contre les

mutations. Ce travail visait à contribuer à une meilleure compréhension fonctionnelle de ce

système chez la plante-modèle Arabidopis thaliana en tirant profit des plus récentes

découvertes au niveau de l'expression génétique. Les bases sous-jacentes à cette recherche

se divisent en deux volets qui sont ici revus, soit le système MMR et la technique de

répression génétique post-transcriptionnelle (PTGS).

1.1 Le système MMR

Dans l’optique d’une compréhension approfondie du système MMR, il sera discuté ici de

son activité de correction des mésappariements lors de la réplication, de son implication

dans les phénomènes de recombinaison, de son rôle lors de la méiose et, enfin, de l'état des

connaissances de ce système chez la plante.

1.1.1 Rôle du MMR dans la correction des mésappariements lors de la réplication

La réplication de l'ADN lors des divisions cellulaires est un événement hautement

sophistiqué. Plusieurs milliards de paires de bases doivent être agencées de façon exacte

pour maintenir la fidélité des informations du brin mère au brin répliqué. De nombreux

mécanismes s’emploient donc à réduire le nombre d’erreurs et à corriger celles qui se

produisent lors de la polymérisation.

2

La polymérase elle-même exhibe un très faible taux d’erreur (entre 10-3 et 10-6 par

nucléotide incorporé et par division cellulaire) en plus de posséder un mécanisme de

correction sur épreuve (Kunkel et Bebeneck, 2000). Ce dernier mécanisme réduit le nombre

d’erreurs à un taux avoisinant 10-7 (de Wind et Hays, 2001). Les erreurs ayant échappé à ce

contrôle rigoureux peuvent ensuite être prises en charge par les systèmes de correction de

l'ADN, tout particulièrement par le système MMR.

Le système MMR s’illustre facilement

par son paradigme bactérien largement

caractérisé. Chez E. coli, il se compose

de trois protéines, MutS, MutL et MutH,

dont les deux premières agissent en

homodimères.

MutS est une ATPase dont le rôle est de

reconnaître les mésappariements.

Structurellement, elle possède trois sites

conservés : une région C-terminale

impliquée dans la dimérisation, une

région liant/hydrolysant l’ATP et une

région N-terminale reconnaissant/liant le

mésappariement (Harfe et Jinks-

Robertson, 2000). Chez les procaryotes,

MutS lie tous les types de

mésappariements (à l'exception des C/C)

ainsi que les courtes boucles

nucléotidiques (≤ 4 nt.) (de Wind et

Hays, 2001). Bien que chaque

monomère contacte l’ADN, un seul lie

réellement le mésappariement, décrivant

un dimorphisme structurel rappelant

Figure 1. Modèle de reconnaissance et deréparation de mésappariements par le systèmeMMR. (Tiré de Harfe et Jinks-Robertson, 2000)

3

l’hétérodimérisation du système eucaryote (Schofield and Hsieh, 2003). La fonction exacte

de l’activité ATPase n’est pas claire, mais il semblerait que la liaison et l’hydrolyse de

l’ATP conduisent à des changements structuraux entraînant les étapes subséquentes de la

correction d’erreurs (Wu et Marinus, 1994).

MutH est une endonucléase qui a pour fonction de cliver le brin nouvellement synthétisé

contenant l'erreur. La discrimination est possible grâce à l’état transitoire non-méthylé du

brin nouvellement formé (Harfe et Jinks-Robertson, 2000). Ainsi, MutH reconnaît le brin

fille via ses sites GATC non-méthylés et y induit une coupure simple brin (Figure 1). Cette

activité est strictement dépendante des mésappariements et est stimulée par la formation du

complexe MutHLS. Une fois le brin clivé, celui-ci est spécifiquement dégradé (activité

exonucléase 5’→3’ ou 3’→5’ selon le côté où le clivage a eu lieu) de façon à permettre une

resynthèse et donc, la correction de l’erreur (Cooper et al., 1993). L’activité

exonucléotidique requiert l'intervention de l'hélicase UvrD.

MutL, tout comme MutS, est une ATPase agissant sous forme d’homodimère. Son rôle,

quoique essentiel (Harfe et Jinks-Robertson, 2000), est cependant moins clair. On croit

qu’il serait principalement structurel et que cette protéine agirait de façon à coordonner

chacune des composantes du système MutHLS (Schofield et Hsieh, 2003). On sait par

exemple que MutL lie directement MutS, MutH et UvrD, pouvant activer ces deux

dernières protéines (Hall et Matson, 1999). Plusieurs sites conservés ont été identifiés,

indiquant que les sites de dimérisation et d’interaction avec MutS, MutH et UvrD se

trouvent en C-terminal tandis que la région N-terminale contiendrait le site de

liaison/hydrolyse d’ATP (Ban et al., 1998). Encore une fois, l'activité ATPase de MutL,

provoquant des changements de conformation, reste nébuleuse.

Chez les eucaryotes, le système MMR est semblable dans ses grandes lignes. Cependant, il

existe deux différences principales, soit la présence de plusieurs homologues

fonctionnellement spécialisés et l’absence d’homologue de MutH.

4

En effet, les homologues eucaryotes de MutS (MSH ; de l’anglais « MutS Homolog ») et de

MutL (MLH et PMS, de l’anglais « MutL Homolog » et « Post-Meiotic Segregation ») sont

présents en plusieurs copies distinctes, chacune ayant acquis des fonctions spécialisées.

Ainsi, la protéine MSH1 est codée par un gène nucléaire mais est exportée vers les

mitochondries où elle est responsable du maintien de l'intégrité du génome de cet organite

(Harfe et Jinks-Robertson, 2000). Les homologues MSH4 et MSH5, lorsque présents, ont

acquis une fonction extérieure à la correction d’erreurs et sont plutôt impliqués dans la

méiose (Schofield et Hsieh, 2003). La correction d’erreurs elle-même s’effectue via des

hétérodimères possédant différentes spécificités (Figure 2). L’homologue MSH2 est présent

dans tous les complexes de correction nucléaire, en hétérodimère avec les autres

homologues de MutS. Le complexe MSH2/MSH6 (MutSα) reconnaît les mésappariements

et les boucles d’insertion/délétion, tandis que MSH2/MSH3 (MutSβ) lie les boucles de

tailles variables, mais pas les mésappariements (Marti et al., 2002). Les homologues de

MutL s’agencent également avec les complexes MSH, remplissant le même rôle que chez

les procaryotes. MLH1 est le noyau central présent dans tous les hétérodimères, en

combinaison avec les autres homologues MLH ou PMS.

La seconde différence a trait à l’absence d'homologue de MutH ; aucun homologue de cette

protéine n’a pu être identifié clairement à ce jour chez les eucaryotes. De plus, le système

exact de méthylation des séquences GATC n'est pas strictement conservé chez les

Figure 2. Homo- ou hétérodimères formés des homologues de MutS et MutL en fonction des types de mésappariements corrigés chez différents organismes. (Tiré de Marti et al., 2002)

5

organismes supérieurs. En suggérant que la méthylation joue toujours un rôle dans la

reconnaissance et le clivage du brin nouvellement synthétisé, il devrait reposer sur un

mécanisme plus sophistiqué qui reste encore à élucider. Certaines expériences suggèrent

que la cassure simple brin des fragments d’Okazaki du brin à synthèse discontinue pourrait

constituer un substrat adéquat pour la dégradation (Pavlov et al., 2003). Les suggestions

proposées pour expliquer la correction d’erreurs sur le brin à synthèse continue sont

toutefois encore plus discutées.

1.1.2 Rôle du système MMR dans les phénomènes de recombinaison

Le système MMR a également une implication importante dans les processus de

recombinaison. La recombinaison implique la mise en commun de brins d’ADN provenant

de différents duplexes. Lorsque les deux séquences ne sont pas identiques (séquences

hétérologues), il en résulte la formation de mésappariements pouvant être reconnus par les

protéines du MMR. Le système MMR peut traiter ces mésappariements de deux façons:

soit en procédant à la « correction » du mésappariement, soit en faisant avorter le processus

de recombinaison (anti-recombinaison) (Figure 3).

La correction de mésappariements lors d'un événement de recombinaison chez les

eucaryotes mène à un phénomène appelé conversion génique. Il s’agit d’un événement où

l'information contenue sur un chromosome est remplacée par l’information présente sur le

chromosome avec lequel il recombine, menant à une ségrégation non-mendélienne des

produits (de Wind et Hays, 2001). Des mutants nuls des gènes MMR chez la levure

empêchent ce type de réparation, conduisant à un duplexe d’ADN hétérologue où chacun

des allèles ségréguera à la première mitose suivant la méiose (Williamson et al., 1985). Ce

phénomène de ségrégation post-méiotique est à l'origine de la découverte d’homologues

eucaryotes de MutL.

L’anti-recombinaison est un mécanisme d'une grande importance sur le plan du maintien de

l’intégrité du génome et il joue un rôle déterminant dans l’évolution. Cette fonction d’anti-

recombinaison contribue à limiter les échanges génétiques qu’on pourrait qualifier

d’illégitimes entre des séquences hétérologues. Il a été suggéré qu’il constitue un des

6

obstacles majeurs au transfert de matériel génétique entre espèces et un joueur important

dans le processus de spéciation (Rayssiguier et al, 1989).

L’anti-recombinaison a été démontrée pour la première fois par Rayssiguier et al. en 1989.

En utilisant des souches bactériennes au système MMR déficient, les auteurs ont observé

une augmentation de recombinaison de 1000 fois lors de la conjugaison entre deux espèces

de bactéries. Ainsi, il a été suggéré que le système MMR agit de manière à inhiber la

recombinaison entre séquences hétérologues.

Deux modèles ont été

proposés pour

expliquer cet effet

d’anti-recombinaison.

Le premier modèle, dit

destructif, implique la

dégradation de

l'hétéroduplexe par la

formation de multiples

cassures simple brin

dépendantes de MutH

(Rayssiguier et al,

1989). Ce modèle est

cependant contestable,

puisque des recherches ont montré qu'un plasmide contenant jusqu'à 18% de

mésappariement (inséré par transformation) n'est pas dégradé par la bactérie

(Westmoreland et al., 1997). Le second mécanisme proposé est appelé modèle non-

destructif de rejet de l'hétéroduplexe (Rayssiguier et al, 1989). Dans ce modèle,

l'événement de recombinaison serait renversé par la simple reconnaissance des

mésappariements, sans clivage de l’hétéroduplexe intermédiaire. Les données amassées à

ce jour chez la levure et chez E. coli vont en ce sens. Il a été démontré que l'anti-

recombinaison s’exerce principalement via la reconnaissance des mésappariements par les

Figure 3. Prise en charge d'hétéroduplexes contenant des mésappariements (M) par le système MMR. a) Conversion génique où se situait les mésappariements (CM) b) Rejet de l'hétéroduplexe: anti-recombinaison (Modifié de de Wind et Hays, 2001)

7

hétérodimères MSH. Ceux-ci interagiraient même avec les protéines impliquées dans

l’échange des brins (telles RecA), bloquant leur fonction et inhibant la recombinaison

(Worth et al., 1998).

La recombinaison hétérologue serait donc soumise successivement à deux contrôles du

MMR. Un premier, tôt dans la formation de l’hétéroduplexe et indépendant de toute

coupure simple brin, régulerait l’homologie nécessaire pour permettre un événement de

recombinaison. Un second, une fois l'hétéroduplexe formé, corrigerait les mésappariements

existants selon le modèle de dégradation et de resynthèse.

1.1.3 Rôle du système MMR au cours de la méiose

La présence chez les eucaryotes de multiples homologues de MutS a permis le

développement de divergences fonctionnelles. Ainsi, les protéines MSH4 et MSH5 ne

jouent aucun rôle dans la reconnaissance des mésappariements, étant vraisemblablement

impliquées dans la stabilisation des structures de recombinaison méiotique (Harfe et Jinks-

Robertson, 2000). Agissant également en dimères, ces complexes interagissent directement

avec l'ADN au site de recombinaison. Des mutants nuls de ces gènes chez la levure ont

montré une chute de près de 50 % de la recombinaison méiotique (Ross-Macdonald et

Roeder, 1994). Des mutants mlh présentent également une réduction du taux de

recombinaison méiotique ainsi qu’un subtil phénotype de biais de ségrégation (Wang et al.,

1999), observation conséquente à leur interaction avec MSH4 et MSH5. Chez la souris, les

mutants msh4, msh5, mlh1 et pms2 exhibent des phénotypes de stérilité attribués à cette

fonction méiotique (Harfe et Jinks-Robertson, 2000). Il est très intéressant de constater que

les mêmes protéines, dans des contextes différents, peuvent avoir des rôles totalement

opposés: soit d’empêcher la recombinaison, ou encore de promouvoir celle-ci.

1.1.4 Le système MMR chez la plante

Grâce à la forte homologie interspécifique de ces gènes, sept homologues de MutS

(AtMSH-1 à 7) (Culligan et al., 2000; Adé et al., 1999) et trois homologues de MutL

(AtMLH1, AtMLH3 et AtPMS1) (Alou et al., 2004a et b; Jean et al., 1999) ont récemment

été identifiés et clonés chez Arabidopsis thaliana. AtMSH7 est unique aux plantes et des

8

études ont montré que le dimère AtMSH2/AtMSH7 possède un spectre de reconnaissance

différent des autres complexes AtMSH (Culligan et Hays, 2000). Ces données reflètent soit

l’existence d’erreurs propres aux végétaux (pris en charge par AtMSH7), soit la gestion par

AtMSH7 d’erreurs corrigées par les complexes classiques chez les autres organismes. Des

études sur la fonction des gènes AtMSH2 et AtPMS1 révèlent leur implication dans

l’instabilité des microsatellites, un phénomène très intimement rattaché à la correction des

erreurs de réplication et observé chez les autres eucaryotes (Alou et al., 2004a; Leonard et

al., 2003; Tran et al., 1997). Pour l’instant, cependant, aucun travail de ce type n’a été

publié sur les fonctions du gène AtMLH1 chez Arabidopsis. C’est pourquoi nous avons

voulu inactiver ce gène et explorer les conséquences phénotypiques d’une telle inactivation.

1.2 Répression génétique post-transcriptionnelle

Il existe plusieurs façons d'inactiver un gène chez une plante. Chez Arabidopsis, la

mutagenèse insertionnelle occupe une place de choix. Elle permet souvent l'obtention de

lignées à allèle complètement nul dû à l'insertion d'un large segment d'ADN dans le gène

d'intérêt, ce qui empêche la transcription. Dans le cas de complexes multimériques, la

technique de dominants négatifs peut aussi être employée. Il s'agit de générer par

transgénèse un monomère non fonctionnel qui éclipsera la forme multimérique active en

liant les monomères sauvages. Il existe également une procédure dite d'ARN antisens. Elle

agit en réduisant l'abondance d'un transcrit par l'insertion dans le génome de la plante d'un

segment (antisens) du gène cible. Cette méthode est en fait un dérivé du système de

répression génétique post-transcriptionnelle qui a été utilisé pour la fabrication des lignées

réprimées AtMLH1 de cette étude. Ce dernier procédé est ici décrit de façon exhaustive.

La répression génétique post-transcriptionnelle (PTGS, en anglais « post-transcriptional

gene silencing ») a été découverte chez les plantes (Napoli et al., 1990) où,

paradoxalement, la surexpression d’un transgène provoquait la répression des transcrits qui

lui étaient homologues. Maintenant abondamment étudié, on sait que ce contrôle génétique

agit par l'intermédiaire de petits ARN (siRNA) qui dirigent spécifiquement la dégradation

d'ARNm cibles. Le PTGS n’est qu’une composante de tout un système de régulation

complexe, comprenant également la répression génétique transcriptionnelle (TGS) et divers

9

éléments affectant l’expression de gènes tels que la méthylation de l’ADN et la structure de

la chromatine. La correspondance entre ces éléments et le rôle clef des siRNA constituent

une découverte majeure des dernières années dans la compréhension de l'expression des

gènes et des phénomènes épigéniques, mettant en lumière un tout nouvel univers de

régulation. Cette section sera consacrée aux mécanismes par lesquels le PTGS s'exprime et

sur la façon d'en tirer profit pour des analyses génétiques.

1.2.1 Mécanismes et fonctions du PTGS

La terminologie utilisée pour décrire ces mécanismes est parfois complexe. De façon à bien

cerner les phénomènes reliés au PTGS, voici une description sommaire de ceux-ci.

Le terme co-suppression est utilisé chez la plante pour décrire la répression d'un gène ou

d'un transgène par un transgène homologue (Napoli et al., 1990). Cette répression peut agir

soit via une réduction de la transcription des gènes affectés, soit via la modification du

traitement des ARNm après transcription. Les deux phénomènes ne sont pas mutuellement

exclusifs, mais agissent plutôt de façon concomitante.

La réduction de la transcription se nomme répression génétique transcriptionnelle (TGS).

Elle fait appel principalement à des mécanismes épigéniques comme la méthylation du

promoteur ou de la séquence codante (Mette et al., 2000). Ce volet de la répression par

ARN n'est pas encore complètement élucidé. Il fait l'objet d'intenses recherches dans des

domaines connexes, tels les fonctions centromériques et le contrôle des éléments

transposables (Llave et al., 2002; White et Allshire, 2004).

L'altération de l'ARNm après transcription, visant une réduction de l'expression, se nomme

répression génétique post-transcriptionnelle (PTGS). Ce terme est surtout employé chez les

végétaux et les eucaryotes inférieurs, le mot « quelling » pour ce même mécanisme étant

réservé aux champignons et l'expression « interférence d'ARN » (RNAi) s'adressant surtout

aux animaux (Tang et al., 2002). Chez ces derniers, le RNAi agit soit en procédant à la

dégradation des transcrits, soit en empêchant leur traduction. Chez les végétaux, le terme

PTGS réfère surtout à la dégradation des transcrits, quoiqu'un effet traductionnel ne soit pas

écarté. L'expression RNAi s'emploie également chez les plantes. Elle se rapporte alors le

10

plus souvent à l'induction artificielle du PTGS, par exemple lors de la création de « lignées

RNAi » destinées à réprimer l'expression d'un gène.

Le modèle actuel expliquant le PTGS s’appuie

sur le rôle clef des ARN double brin (dsRNA) et

des petits ARN interférants (siRNA) qui en

dérivent. Selon ce modèle (Figure 4), les dsRNA

présents dans une cellule seraient reconnus par

une RNase nommée DICER (DCL1 à DCL4

chez A. thaliana [Schauer et al., 2002]) qui les

dégraderait en petits ARN interférants d'environ

21 nucléotides. Ces siRNA guideraient alors le

complexe multiprotéique à activité nucléasique

RISC (« RNA-induced silencing complex ») de

façon à cliver spécifiquement tout ARN leur

étant homologue (y compris les ARNm

fonctionnels), ce qui entraînerait la répression

post-transcriptionnelle (Vaucheret et al., 2001).

Plusieurs autres protéines ont un rôle en PTGS,

dont les homologues Argonaute (AGO). Au

nombre de 10 chez A. thaliana, ils sont

impliqués autant en PTGS qu'en TGS et

interagissent avec les siRNA et le complexe

RISC (Baulcombe, 2004).

Les dsRNA peuvent être produits de plusieurs façons. L'expression de transgènes, virus ou

transposons peut créer des ARNm aberrants (« abRNA ») qui sont rendus double brin par la

synthèse du brin complémentaire via des ARN polymérases dépendantes de l’ARN, (SGS2

et SDE1 chez A. thaliana)(Meins, 2000 ; Vaucheret et al., 2001; Llave et al., 2002; Ketting

et al., 1999). Des transgènes transcrits normalement mais conduisant à des ARN à structure

double brin (insertion inversée-répétée) peuvent également déclencher ce mécanisme. De la

même façon, des locus endogènes aux eucaryotes comportent des sections menant à la

Figure 4. Mécanismes de la répression génétique post-transcriptionnelle. (Tiré de Voinet, 2002)

11

production de petits ARN interférants (alors généralement appelés miRNA, ou stRNA chez

C. elegans) dirigés contre des gènes régulant le développement (Mallory et al., 2004;

Voinet, 2002). Des ARN viraux sont également la cible de ce processus, et des protéines

virales ont évolué pour l'inhiber (Voinet et al., 2000).

Le PTGS n'est donc pas un mécanisme isolé, mais une voie métabolique complexe et

ramifiée, ayant des implications dans plusieurs systèmes cellulaires vitaux.

1.2.2 Rôles des petits ARN interférants.

Les petits ARN interférants jouent plusieurs rôles clefs dans tous les mécanismes de

répression par l’ARN. Premièrement, ils sont les agents responsables de la spécificité de la

répression. Des études ont montré qu'une homologie parfaite sur au moins 18 nt consécutifs

était essentielle pour mener à la dégradation du messager cible chez la plante (Thomas et

al., 2001). Une telle séquence suffit à cibler un transcrit spécifique au sein d'un

transcriptome. Chez les animaux, ce type d'homologie parfaite conduit aussi à la

dégradation du messager par RISC, tandis qu'une homologie plus faible des petits ARN

avec l'ARNm cible conduit à une répression traductionelle (Carrington et Ambros, 2003).

On croit que ces petits ARN, qui comportent des mésappariements, s'apparient au messager

cible durant la traduction. Ce type de petits ARN est associé aux miRNA chez les animaux.

Les miRNA sont des siRNA produits par l'organisme pour jouer un rôle de régulation des

messagers endogènes. Ils sont issus du clivage (par DICER) d'ARN partiellement double

brin d'environ 70 nt transcrits du génome et comprenant des mésappariements et des

boucles non-appariées (Voinet, 2002; Llave et al., 2002) (Tableau 1). On peut retrouver de

tels précurseurs dans les régions intergéniques ou même dans des introns (Llave et al.,

2002). En général, les miRNA sont exprimés de façon temporelle, sont complémentaires à

la région 3' du messager cible et visent surtout des gènes impliqués dans le développement

(Voinet, 2002). Contrairement aux siRNA qui sont double brin et doivent être désappariés

par RISC pour diriger la répression, les miRNA sont directement simples brins. Plusieurs

petits ARN régulant le développement végétal ont été découverts (Llave et al., 2002; Jones-

Rhoades et Bartel, 2004). Cependant, par opposition au mécanisme animal, ceux-ci

semblent généralement présenter une parfaite homologie avec les ARNm cibles et procéder

12

via une dégradation par RISC des

messagers. Malgré cette règle

générale, certains miRNA végétaux

comportent des mésappariements par

rapport à leur gène cible putatif et

pour au moins un d'entre eux, miR172

(Chen, 2004), une activité de

répression traductionnelle a été

démontrée.

Les siRNA ont également un rôle de

messager, les mécanismes de

répression par ARN étant

transmissibles d'une cellule à une

autre. Chez les végétaux, il a été

proposé que cette tâche soit

attribuable à la fois aux siRNA de

21nt ainsi qu'à une classe de siRNA de plus grande taille (24-26nt) (Hamilton et al., 2002;

Baulcombe, 2004). Il a été démontré que les siRNA de 21nt, en plus de cibler la

dégradation des ARNm, opèrent une transmission du message de répression à faible

distance (Himber et al., 2003). La seconde classe de siRNA végétal ne semble pas

directement impliquée dans la dégradation d'ARN via le complexe RISC, mais corrèle dans

certains cas avec l'établissement d'une répression systémique et l'adressage du TGS

(Hamilton et al., 2002). Cependant, certaines études montrent que la présence de ces

siRNA de 24-26nt n'est pas essentielle à ces deux phénomènes et suggèrent une action

potentielle des précurseurs double brin comme messagers à longue distance et comme

agents directeurs de la méthylation (Mallory et al., 2001).

Chez le nématode, seule la classe de siRNA avoisinant les 21nt peut être détectée et un

canal membranaire (SID1) exportant le dsRNA a été découvert (Winston et al., 2002),

appuyant la dernière hypothèse chez le modèle animal. Cependant, la présence de siRNA et

de miRNA dans le phloème et l'existence de protéines liant la forme simple brin

Tableau 1. Caractéristiques des différentes classes de siRNA. (Tiré de Voinet, 2002)

13

correspondante (Yoo et al., 2004) vont dans le sens d'un rôle majeur des siRNA dans la

propagation du message de régulation chez la plante.

Un autre type de transmission de message incombe également aux siRNA (ou peut-être aux

dsRNA) chez les végétaux. Ils seraient responsables de cibler la méthylation de novo des

résidus cytosines de certaines régions du génome de façon à effectuer une répression

transcriptionnelle (TGS) (Aufsatz et al., 2002). Par opposition au PTGS, qui est un

processus essentiellement cytoplasmique, la TGS est provoquée par une action nucléaire

via des méthyltransférases. Ce mécanisme est l'apanage des végétaux et agirait par la

méthylation des régions génomiques homologues aux siRNA, réprimant la transcription

(Aufsatz et al., 2002). Cependant, des travaux chez la levure ont montré l'importance des

protéines reliées à la répression par ARN pour la fonction (et la méthylation) du centromère

et le remodelage de la chromatine, signes que cette implication dans la méthylation n'est

pas restreinte aux plantes (White et Allshire, 2004). Les experts tendent maintenant à

subdiviser en différentes voies les mécanismes de répression par ARN en fonction de leur

action, des protéines impliquées et de leur compartimentation cellulaire (cytoplasme vs.

noyau) tant leurs rôles sont répandus et variés.

1.2.3 Utilisation du PTGS en génétique fonctionnelle et génétique inverse

Chez les animaux, les essais utilisant la répression par ARN sont généralement effectués en

transformant directement des siRNA synthétiques ciblant un gène d'intérêt dans l'organisme

étudié (souvent des cultures cellulaires). On obtient alors une répression transitoire du gène

cible (Dykxhoorn et al., 2003). D'ailleurs, plusieurs paramètres empiriques guidant la

construction de siRNA efficaces ont été découverts, certains s'adressant à l'efficacité de la

répression, d'autres au temps de demi-vie des siRNA (et donc à la période efficace de

répression) (Dykxhoorn et al., 2003). Des systèmes conduisant à une répression héritable

fondés sur la production d'ARN double brin ont également été développés. D'autres

dispositifs utilisent de courts ARN transcrits en trans, ou des ARN sous contrôle de

promoteurs spécifiques à la polymérase III (Figure 5). Des mécanismes originaux utilisant

des promoteurs inductibles ou spécifiques ont même permis de contrôler le moment où se

14

produit la répression (Stevens et al., 2004; Guo et al., 2003). L'acheminement dans la

cellule de ces structures se fait alors par transgénèse traditionnelle.

Contrairement aux animaux et

aux levures, seules des

techniques indirectes

d'inactivation génétique ont pu

être développées jusqu'à

présent chez la plante. La

répression génétique par ARN

a donc permis d'envisager la

recherche en biologie végétale

sous un nouvel angle. Quoi

qu'il existe également des

techniques de PTGS à

efficacité transitoire chez les

végétaux (par exemple : le

VIGS ou le PTGS par

infiltration), nous discuterons

ici de l'hpRNA, l'outil

principal utilisé pour

l'induction de PTGS stable

chez A. thaliana.

1.2.4 Induction du PTGS en génétique fonctionnelle végétale; les ihpRNA

Wesley et al. (2001) ont développé une technique tirant profit du mécanisme de PTGS. Ils

ont suggéré qu’un ARN en épingle à cheveux (abréviation «hpRNA», pour «hairpin RNA»)

pourrait se substituer à l’ARN double brin en PTGS. Un hpRNA est un brin d’ARN

comprenant deux segments complémentaires qui s’apparient entre eux, formant un ARN

bicaténaire. Il est issu de la transcription d'un même fragment d'ADN dupliqué, en direction

inversée. En utilisant la séquence transcrite d'un gène d’intérêt pour fabriquer une

Figure 5. Techniques d'induction stable du PTGS. a)hpRNA par transcription de segment dupliqué-inversé. b)Expressions en trans de courtes séquences complémentaires. c)Court segment dupliqué-inversé sous promoteur de la polymérase III. d)Précurseur miRNA avec mésappariements. (Tiré de Dykxhoorn et al., 2003)

15

construction à insert dupliqué-inversé, il est donc possible de former un hpRNA qui jouera

le rôle d'un dsRNA homologue au gène cible. Une fois le hpRNA dégradé par DICER, les

siRNA produits dirigeront le clivage des ARNm fonctionnels de ce gène, entraînant une

répression spécifique. Une fois le gène réprimé, il est possible d'examiner l'effet de son

inactivation et d'ainsi en dégager la fonction.

Des vecteurs plasmidiques (pHANNIBAL et pKANNIBAL) permettant la fabrication facile

de constructions de type hpRNA ont été générés (Figure 6) (Wesley et al., 2001). La

technique a même été raffinée par l’ajout d’un intron entre les deux segments

complémentaires du hpRNA, ce qui améliore pour une raison inconnue l’efficacité de la

répression (Smith et al., 2000). Ces structures comportant un intron se nomment

« ihpRNA » et ont été utilisées avec succès dans plusieurs études fonctionnelles.

1.2.5 Avantages du PTGS

La répression génétique post-transcriptionnelle présente plusieurs avantages. D'abord, cette

technique est beaucoup moins fastidieuse que la mutagénèse insertionnelle, où le criblage

d'une banque de plusieurs milliers de graines est requis. De plus, le PTGS est exportable à

toutes les espèces végétales (où la transgénèse est possible), contrairement à la mutagénèse

insertionnelle qui ne peut être utilisée que chez Arabidopsis (Wesley et al., 2001). Le PTGS

conduit à la répression de toutes les copies d'un même gène, à l'opposé de la mutagénèse

insertionnelle qui n'affecte que la copie génomique où le T-DNA s'est inséré.

Figure 6. Structure du vecteur pHANNIBAL et procédure pour la création d'une construction ihpRNA. (Modifié de Wesley et al., 2001)

16

Contrairement aux dominants négatifs pour lesquels seules se prêtent à l'utilisation les

protéines multimériques dont la structure a été caractérisée en détail, le PTGS est applicable

à tous les types de gènes dont la séquence a été clonée. Beaucoup plus efficace que l'ARN

antisens, elle mène à une répression mesurable chez 60 à 100% des lignées produites

(Chuang and Meyerowitz, 2000; Wesley et al., 2001). Pour la technique d'ARN antisens, ce

nombre de lignées efficacement réprimées avoisine plutôt les 15 % (Wesley et al., 2001).

De plus, plusieurs caractères généraux font du PTGS une technique avantageuse. La

variation d'intensité de répression souvent constatée d'une lignée à une autre peut permettre

l'observation de phénotypes nuancés ou encore la viabilité de mutants qui seraient

autrement létaux lors d'une inactivation complète. Finalement, le phénotype de répression -

qui est héréditaire- demeure constant au sein des générations et ségrège comme un

caractère mendélien dominant, observable même chez l’hétérozygote (Chuang et

Meyerowitz, 2000).

17

1.3 Problématique

L'étude du complexe MMR présente des motivations autant fondamentales que pratiques.

Vraisemblablement impliqué dans le maintien de l'intégrité du génome, dans les processus

de recombinaison ainsi que dans certains mécanismes méiotiques, il remplirait chez les

végétaux un rôle capital dont l'appréciation est essentielle. D'un point de vue appliqué, le

contrôle exercé par ces protéines sur la promiscuité des échanges génétiques est d'intérêt

pour le développement de nouveaux cultivars, par croisement entre plantes plus ou moins

distantes sur le plan phylogénétique. La compréhension -et le contrôle- de ce système offre

donc des retombées concrètes.

Le développement des techniques de PTGS pour l'inactivation de gènes chez les végétaux

permet d’explorer la fonction des gènes MMR. Ceux-ci ayant été clonés, leur séquence est

disponible pour la création de constructions ihpRNA et la répression des gènes sauvages.

Les phénotypes observés après répression nous instruiront sur le rôle spécifique de ce

complexe chez la plante. L'impact sur le taux de mutation, sur le niveau de recombinaison

et sur les événements méiotiques pourra être investigué efficacement.

18

1.4 Objectifs

Cette étude a pour but l'inactivation par PTGS du gène AtMLH1, un gène majeur du

complexe MMR, de façon à en dégager la fonction chez la plante. Ce gène est

particulièrement significatif puisqu'il constitue la composante centrale de tous les

complexes MutL. L'hypothèse de recherche se divise en deux volets. Premièrement, nous

soutenons qu'il est possible d'effectuer une répression génétique post-transcriptionnelle du

gène AtMLH1 chez A. thaliana en utilisant une construction de type ihpRNA. En second

lieu, nous croyons que la répression de ce gène mènera à la perte de certains mécanismes de

correction d'erreur, de contrôle d'homologie de recombinaison et/ou de stabilité lors de la

recombinaison méiotique. Le phénotype général des plantes réprimées doit donc être

examiné en conséquence, en portant une attention particulière à un accroissement potentiel

du taux de mutation (dû à la perte de mécanismes de correction). Concrètement, les

objectifs sont :

1) Fabriquer et introduire des constructions ihpRNA dirigées contre le gène AtMLH1 chez

A. thaliana.

2) Caractériser les lignées et isoler celles présentant un seul locus d'insertion et une

répression maximale du gène sauvage.

3) Documenter et étudier les phénotypes obtenus, plus précisément au niveau du taux de

mutation, en croisant avec des systèmes rapporteurs du taux de mutations (lignées

développées au laboratoire).

19

CHAPITRE 2

ihpRNA-mediated post-transcriptional gene silencing of AtMLH1, an Arabidopsis

thaliana DNA mismatch repair gene.

(Manuscript)

Olivier Domingue1, Martine Jean1 and François J. Belzile1* 1Département de phytologie, Université Laval, Québec, G1K 7P4, Canada *Author to whom correspondence should be addressed:

F.J. Belzile

1243 Pavillon C.E. Marchand, Université Laval, Québec, G1K 7P4, Canada

Tel. 1-418-656-2131 ext. 5763, Fax: 1-418-656-7176, E-mail: fbelzile@rsvs.ulaval.ca

20

Résumé

Afin d’inactiver le gène AtMLH1, une construction de type ihpRNA a été créée en insérant

un fragment de 526 pb de ce gène en directions sens et anti-sens dans le vecteur

pHANNIBAL, de part et d'autre d'un intron. Cinq lignées réprimées (ou RNAi de l’anglais

« RNA interference »;) présentant une insertion du T-DNA à un seul locus ont été

identifiées. Les lignées ihpMLH1-63, -70 et -73 présentent une forte réduction de transcrit

du gène AtMLH1, soit 10 % de celui observé chez le type sauvage. La lignée ihpMLH1-51

présente une quantité de transcrit intermédiaire (~30% du sauvage), tandis que la lignée

ihpMLH1-54 ne montre qu’un abaissement modeste du niveau d'ARN messager (~60% du

sauvage), tel qu’évalué par RT-PCR semi-quantitative. Une étude northern a permis

l’observation de petits ARN interférants, ou siRNA (« small interfering RNA »), les

signatures moléculaires témoignant de l’efficacité du PTGS. L’abondance relative de ces

siRNA semble corrélée à l'intensité de la répression observée. Ainsi, ces analyses ont

permis de confirmer qu’une inactivation significative du gène AtMLH1 a été obtenue chez

certaines lignées. Les cinq lignées RNAi identifiées ont été croisées à des lignées

rapportrices de l’instabilité des microsatellites. Notre attente était que l’inactivation du gène

AtMLH1 entraînerait un accroissement de l’instabilité des microsatellites, phénomène que

nos rapporteurs mesurent aisément. Malheureusement, il semblerait que l'expression des

gènes rapporteurs ait été abolie suite à un phénomène de co-suppression. Cela a donc rendu

impossible l’examen des conséquences phénotypiques de la répression post-

transcriptionnelle du gène AtMLH1. De futurs travaux, faisant appel à d’autres lignées

rapportrices, permettront vraisemblablement de documenter les conséquences

phénotypiques d’une inactivation du gène AtMLH1.

21

Summary

An ihpRNA construct directed against the AtMLH1 gene was designed by inserting a 526-

bp fragment in both the sense and anti-sense orientations on either side of the intron located

in the pHANNIBAL vector. Five single locus interfering lines (RNAi) showing a range of

silencing intensity were characterized. Lines ihpMLH1-63, -70 and -73 present a major

reduction in the steady-state level of the transcript, as the mRNA abundance was

approximately 10% of the wild type. Line ihpMLH1-51 showed an intermediate level of

transcript (~30% of wt), while line ihpMLH1-54 exhibited only a minor reduction of

messenger RNA (~60% of wt), as evaluated by semi-quantitative RT-PCR. Northern

blotting revealed the presence of small interfering RNAs (siRNAs), a hallmark of PTGS.

The abundance of these siRNAs was roughly correlated with the intensity of the observed

silencing. These results clearly suggest that PTGS has been achieved in some of the lines

under study. These lines were crossed with a microsatellite instability reporter line to

document the phenotypic consequences resulting from the inactivation of AtMLH1. We

expected the loss of AtMLH1 activity to result in a significant increase in microsatellite

instability (a phenomenon easily assessed with our reporter line). Unfortunately, no such

data were obtained. Apparently, due to co-suppression, all of the genes on the reporter

T-DNA were silenced, including the GUS-based reporter of microsatellite instability.

Future studies using other reporter lines should, however, allow us to document the

phenotypic consequences of a reduction in the abundance of AtMLH1 transcript.

22

Introduction

Plants, being unable to move, are constantly exposed to exogenous mutational stresses such

as UV radiation, heavy metals or chemical mutagens. Their own oxygen-producing

metabolism yields reactive oxygen species that can be mutagenic. Lacking a reserved germ

line, they have to constantly protect and repair their genetic information form harmful

mutations, not only for the own fitness, but also for the survival and fitness of their

offspring (Kovalchuk et al., 2000). For all these reasons, DNA repair systems such as the

ubiquitous DNA mismatch repair (MMR) system are of prime interest in plants.

The foremost role of the MMR system is the repair of single base pair mismatches and

small insertions/deletions that arise during DNA replication (Harfe and Jinks-Roberston,

2000). In addition, however, the MMR system is known to be involved in regulating the

specificity of recombination events in other eukaryotes (Schofield and Hsieh, 2003). Given

the propensity of plants to hybridize quite readily with close (and sometimes even with

rather remote) relatives, the MMR system clearly deserves further investigation in plants.

Primarily characterized in prokaryotes, MMR orthologues have been identified in many

eukaryotes: yeasts, invertebrates, mammals and plants (Harfe and Jinks-Robertson, 2000).

In all of the cases where it has been examined in detail, the repair process starts with

mismatch recognition, is followed by the excision of the mismatch (along with surrounding

DNA), and concludes with the repair of the resulting gap by a repair-specific DNA

polymerase. In bacteria, mismatch recognition is accomplished by MutS homodimers.

Similarly, seven eukaryotic homologues of MutS (MSH) proteins have been identified,

three of which are known to be directly involved in mismatch identification (Kolodner and

Marsischky, 1999) and repair. The MSH2/MSH6 heterodimer (MutSα) corrects basepair

mismatches and single nucleotide loops, while the MSH2/MSH3 complex (MutSβ) is

responsible for the repair of longer extrahelical loops. In plants, a fourth homologue,

MSH7, is known to interact with MSH2 (MutSγ) and binds mismatches (Culligan and

Hays, 2000), but its particular role has not been elucidated yet.

Prokaryotic MutL homodimers, via their interaction with MutS, are thought to couple

mismatch recognition to DNA excision. Similarly, eukaryotic homologues of MutL

23

proteins perform the same task in higher organisms. Four MutL homologues have been

identified in eukaryotes; MLH1, MLH2, MLH3 and PMS1. As with MSH complexes,

MLH/PMS homologues work in heterodimers known as MutLα (MLH1/PMS1), MutLβ

(MLH1/MLH3) and MutLγ (MLH1/MLH2) (Harfe and Jinks-Robertson, 2000). Again,

each complex exhibits a preference for a type of mismatch. Therefore, MLH1 clearly plays

a central role as it is involved in all such heterodimers. The loss of MLH1 gene function

should impede mismatch repair of all types.

Null mutants of MLH1 have been produced in a few organisms. In the yeast Saccharomyces

cerevisiae, mlh1 mutants showed an increased mutation rate, a reduction in the frequency

of meiotic cross-over events and a higher recombination rate (Chen and Jinks-Robertson,

1998; Hunter and Borts, 1997). The latter two characteristics seem to be in contradiction,

but it makes sense when you consider that MLH1 interacts both with proteins that promote

the stability of recombination structures and with enzymes that exert a negative control

over heterologeous duplex formation (Harfe and Jinks-Robertson, 2000). In mammals,

mlh1 mutants are sterile (in mice) due to premature chromosome separation in meiosis,

while human (cultured cells) and mouse mutants are more subject to various cancers (Prolla

et al., 1998; Edelmann et al., 1996; Huang et al., 1996).

Frequently, microsatellite instability (MSI) is investigated to monitor mismatch repair

activities and mutation rate. Microsatellites are simple tandem repeats of nucleotides that

are intrinsically unstable. This instability is due to the high level of DNA slippage on

repetitive DNA during the replication process (Streisinger and Owen, 1985). If this kind of

error is not repaired by the MMR system, it gives rise to novel alleles (with smaller or

longer stretches). Increased MSI is thus considered a hallmark of MMR deficiency

(Schofield and Hsieh, 2003; Tran et al., 1997). In plants, MSI has been documented in lines

defective in MMR. In a null mutant of the AtMSH2 gene and in transgenic lines carrying

dominant negative alleles of the AtPMS1 gene, the loss of MMR activity resulted in 5- to

28-fold increases in MSI relative to wild type (Leonard et al., 2003; Alou et al., 2004a).

Similar studies have yet to be performed on the AtMLH1 gene.

24

Post-transcriptional gene silencing (PTGS) by RNA interference (RNAi) has been used in

several studies to repress gene expression in plants. Briefly, the presence of a double-

stranded RNA (dsRNA) leads to the degradation of homologous transcripts by the

production, via dsRNA cleavage, of small interfering RNA (siRNA) (Vaucheret et al.,

2001). It is thus possible to create a construct that, upon transcription, will form dsRNA

and lead to homologous target mRNA degradation. The most frequently used constructs are

intron-containing hairpin structures (ihpRNA), which generate effective interfering dsRNA

(Wesley et al., 2001).

In this work, we report the production of lines in which the AtMLH1 gene has been

inactivated by RNA interference to investigate the role of this gene in plants. Lines with

single locus transgene insertions were characterized for the intensity of silencing (based on

the residual level of target mRNA) and were monitored for the presence of small interfering

RNA. Crosses with reporter lines to assess MSI were made, but the resulting F1 progeny

proved uninformative due to co-suppression of the reporter gene.

25

Materials and methods

Construction of the ihpRNA construct for RNAi silencing

A 526-bp fragment of AtMLH1 (bases 1629 to 2155 relative to the ATG) was amplified

from the AtMLH1 cDNA clone (GenBank no. AJ012747) (Jean et al, 1999), using the

following primers containing restriction sites (underlined): hpMLH1s 5’-

GGAGGATCTAGATCCTCGAGATGATACAA-3’ (XbaI and XhoI) and hpMLH1as 5’-

GTAAACTTAGCTACCATGGACCACCGAAG-3’ (ClaI and KpnI). The reaction was

performed with the high fidelity Pfu DNA polymerase (Stratagene,Vancouver, Canada). A

sense copy of the PCR product was digested with Xho1/KpnI and ligated into the

pHANNIBAL vector (Wesley et al., 2001) digested with the same enzymes. An antisense

copy was subsequently introduced by digesting the original PCR product with XbaI/ClaI

and ligating into the pHANNIBAL derivative obtained at the previous step. A NotI

fragment containing the CaMV35S promoter, the sense and antisense segments of AtMLH1

(separated by an 800-bp intron) and an OCS terminator was cloned into the unique NotI site

of the binary vector pART27 (Gleave, 1992) to create pART27-MLH1. The sense and

antisense segments of AtMLH1 were sequenced to be sure that no mutation had occurred

during the amplification and cloning. The binary vector was then transformed into

A. tumefaciens prior to plant transformation.

Plant transformation, selection and growth

Flower buds of Arabidopsis thaliana (ecotype Columbia) were infected with

Agrobacterium tumefaciens strain GV3101 containing the binary vector pART27-MLH1

using the floral-dip method (Clough and Bent, 1998). Seeds from the treated plants were

selected on germination medium (GM) (Valvekens et al., 1988) containing 50 mg/L

kanamycin and 0.8% agar. Kanamycin-resitant seedlings (T1) were transferred to soil

(Promix) and permitted to grow until the harvest of seeds. The segregation ratio for

kanamycin resistance was determined by plating T2 seeds on selective medium. Only the

lines that showed a single T-DNA insertion locus (3 Resistant: 1 Sensitive ratio) were kept.

Homozygous lines were identified by plating T3 progeny of resistant T2 plants and keeping

the seeds of those generating only resistant offspring. All seedlings (on soil or medium)

were grown under a photoperiod of 16h light and 8h dark at 25ºC.

26

RNA Extraction and reverse Transcriptase-Mediated PCR

Total RNA was isolated by grinding 200 mg of 21-day old in vitro grown seedling in liquid

nitrogen in the presence of Trizol reagent (Invitrogen, Carslbab, USA) according to the

manufacturer’s instructions. First-strand cDNA was synthesized from 10 ug of total RNA

using the First-strand cDNA Synthesis Kit (Amersham, Pitscataway, USA) according to the

manufacturer’s instructions. Primer AtMLH1-Red2 (see Table 1) was used for specific

reverse transcription of the endogenous AtMLH1 mRNA. For semi-quantitative reverse

transcriptase-mediated (RT) PCR analysis, 1.5 µl of first-strand cDNA was used in a final

volume of 25 µl. The PCR conditions were optimized such that the amount of amplified

product was proportional to the initial concentration of template. In this case, conditions

were an initial 2 min denaturation at 94°C followed by 23 cycles of 30 sec at 94°C, 45 sec

at 60°C, 1 min at 72°C and a single final step of 10 min at 72°C. The primers used for this

amplification were AtMLH1-Red2 and MLH3. Fifteen µl of reaction products were then

separated on a 2% agarose gel and stained in EtBr to visualize the results. RT-PCR

experiments for the uidA (GUS) and AtPMS1 genes were performed similarly, using either

a generic (oligo-d(T)) or a specific primer for reverse transcription (oligo-d(T) for uidA and

AtPMS1_11R for AtPMS1) and specific primers for PCR amplification (GUSrev2 and

EB_Gus_SacI for the uidA gene and AtPMS1-RED2 and AtPMS1-FED3 for AtPMS1).

AtPMS1 control reverse transcriptions, performed to ensure that an equal amount of RNA

was used when comparing different samples, were done in the same tube as the AtMLH1

RTs.

Visualization of small RNA fragments (siRNA)

siRNA fragments were detected as previously described (Llave et al., 2002), except that we

did not concentrate the low molecular weight RNA. Total RNA (80 µg) was separated on

15% polyacrylamide 7 M urea gels in a Protean apparatus (Bio-Rad, Mississauga, Canada).

After electrophoresis in 0.5% TBE (45 mM Tris-borate, 1 mM EDTA, pH 8), RNA was

electroblotted (using a Trans-Blot semi-dry transfer cell, Bio-Rad, Mississauga, Canada)

onto a Hybond-N+ membrane (Amersham Biosciences, Piscataway, USA) for 1 h at 400

mA at room temperature. RNA was then fixed on the membrane by UV cross-linking.

27

Prehybridization and hybridization were performed essentially as described by Church and

Gilbert (1984) except that the membranes were incubated at 45°C and rinsed in 2X SSC

followed by two washes of 20 min in 2X SSC, 1% SDS (at room temperature) before

exposure. Exposures were performed on a Phosphorimager apparatus (Molecular

Dynamics/Amersham Biosciences, Piscataway, USA) according to the manufacturer’s

instructions. The probe used was a 32P-labeled 838-bp PCR product (Rediprime II Random

Prime Labelling System kit, Amersham, Pitscataway, USA) generated with AtMLH1-Red2

and MLH3 primers using AtMLH1 cDNA as template.

Northern blot analysis

Total RNA was extracted from seedlings as described above. Afterwards, 10 µg was

separated on a denaturing 1% formaldehyde-agarose gel and transferred in alkaline buffer

onto Hybond-N+ membrane (Amersham Biosciences, Piscataway, USA) for one hour

(Sambrook and Russell, 2001). Before transfer, RNA quality was evaluated by EtBr

staining of the gel. A two-hour prehybridization at 68°C and an overnight hybridization at

65°C were performed in 0.5 M sodium phosphate, 7% SDS, 1 mM EDTA (Church and

Gilbert, 1984) followed by one low-stringency wash (10 min in 1X SSC, 0.1%SDS) and 3

high-stringency washes (10 min at 65°C in 0.5X SSC, 0.1% SDS) before exposure.

Exposures were done on a Phosphorimager apparatus (Molecular Dynamics/Amersham

Biosciences, Piscataway, USA) according to manufacturer’s instructions. Probes were PCR

products 32P-labeled using Rediprime II Random Prime Labeling System kit (Amersham

Biosciences, Piscataway, USA). These PCR fragments were generated with primers

GUSrev2 and EB_Gus_SacI (687 bp) for the uidA gene and with ACT2F and ATC2R

(1154 bp) for the actin (ACT2) gene, using the respective cloned cDNAs as template.

Crosses of the ihpMLH1 RNAi lines with GUS reporter lines

To investigate the effect of the inactivation of AtMLH1 in RNAi lines on somatic repeat

instability, we used a homozygous T4 reporter line developed in our laboratory (Azaiez et

al. in preparation). This reporter line, 131D, contains a non-functional uidA (GUS) gene

thrown out of frame due to the insertion of a synthetic microsatellite (G7). The reporter line

was crossed to five heterozygous T2 ihpMLH1 lines to generate plants containing both the

28

reporter and the ihpRNA construct and plants containing only the reporter. This last set of

plants was used as control. In all crosses, the reporter line was used as pollen provider. All

F1 progeny were genotyped using Cam35S and diMLH1 primers (ihpMLH1 T-DNA

specific-primers) on genomic DNA extracted as per Edwards et al (1991).

Histochemical GUS assay

Plants were grown in soil until the 8- to 10-leaf stage (3 to 4 weeks) and were vacuum

infiltrated twice with staining solution [10 min in 50 mM phosphate buffer pH7.0

containing 250 mg/L 5-bromo-4-chloro-3-indoly-ß-D-glucuronide (X-Gluc, Rose

Scientific, Canada) and 0.05% (v/v) Triton X-100] (modified from Kovalchuk et al., 2000).

After 48h of incubation at 37°C, plants were cleared with 70% ethanol. Blue sectors were

counted under a binocular microscope at a magnification of 160X.

29

Results

Production of AtMLH1 RNAi lines

To explore the function of the AtMLH1 gene, an intron-containing hairpin RNA construct

(ihpMHL1) was prepared. To this end, a 526-bp segment of the AtMLH1 cDNA was

inserted in duplicate and inverse orientation within the pHANNIBAL vector on either side

of an intron. The resulting cassette was transferred to a binary vector (pART27) and

transformed into plants. RNAi lines in which the transcript of the AtMLH1 gene is

specifically targeted for degradation via PTGS were produced. Approximately 16,000 T1

seeds resulting from Agrobacterium transformation of Arabidopsis plants were plated on

selective medium. A total of 132 (0.8%) resistant seedlings were obtained. Almost all

plants showed a normal growth and development (no obvious morphological or

developmental defects). Two lines were the sole exception to this rule as they exhibited a

partial loss of fertility (marked reduction of seeds per silique). In subsequent generations of

these two lines, a normal fertility was observed suggesting that the initial defect might have

been simply an environmental artifact. T2 seeds from 36 independent T1 plants were sown

on selective medium to analyze the segregation of the transgene. Eighteen transformants

showed a 3:1 (R: S) segregation ratio, typical of a single T-DNA insertion locus, and were

used for the evaluation of their AtMLH1 mRNA level.

Analysis of AtMLH1 mRNA level in RNAi T2 plants

We performed RT-PCR analysis on the T2 generation of the 18 transformants known to

harbor a single T-DNA insertion locus to determine if post-transcriptional gene silencing

had been achieved in these lines. The results of this analysis are presented in Figure 1. As

expected, various levels of residual transcript abundance were observed among these plants

(Figure 1, upper panel). Five lines were selected to represent the range of silencing;

ihpMLH1-63, -70 and -73 showed a pronounced silencing, with transcript levels estimated

to be as low as 10% of the wild type level. Line ihpMLH1-51 exhibited an intermediate

level of messenger RNA (∼30% of wt), whereas ihpMLH1-54 plants presented only a

moderate decrease (∼60% of wt) of transcript level. In contrast, approximately equal

amounts of PCR product were obtained for the AtPMS1 transcript (Figure 1, lower panel).

30

The presence of siRNA correlates with the level of AtMLH1 transcript

The presence of siRNA was analyzed in each of the five lines shown to represent the range

of residual transcript abundance. Total RNA was separated on a polyacrylamide gel, blotted

onto a nylon membrane and hybridized. As shown in Figure 2, small RNAs were easily

detectable in the three lines that exhibited the most important reduction in AtMLH1

transcript abundance (ihpMLH1-63, -70 and -73). In line ihpMLH1-51 (intermediate level

of mRNA), siRNA were detected but only as a faint signal. Finally, line ihpMLH1-54

showed no detectable signal. Therefore, the quantity of siRNA seems inversely correlated

with the level of AtMLH1 messenger, lines harboring the least intact transcript being those

that present the largest quantity of siRNA.

Cross with microsatellite instability reporter line

To examine the impact of the silencing of the AtMLH1 gene, we chose to measure

microsatellite instability using a GUS-based reporter system. One heterozygous T2 plant for

each of the five selected RNAi lines was crossed with a T4 plant of G7-131D, a line

homozygous for a modified GUS gene containing a synthetic microsatellite (G7). In its

initial state, the reporter gene is out of frame and does not allow the production of

functional enzyme. Upon the loss of one G or the gain of two Gs via mutation, a functional

reading frame is restored leading to blue sectors on a white background. For each cross, 30

to 40 F1 plants with or without (controls) the ihpMLH1 construct (all had the MSI reporter)

were grown (4 to 5 weeks) and stained. Surprisingly, no blue sectors could be observed in

any of the stained individuals. Even the control and G7-131D T4 plants failed to show any

sectors whereas in the previous (T3) generation of the reporter line, 1.4 blue sectors per

plant had been documented (Azaiez et al., in preparation).

Observed co-suppression of transgenes

To uncover the reason behind the complete absence of blue sectors in plants purportedly

carrying the MSI reporter construct, we tested various hypotheses. The first of these was

that the crosses might have been erroneously made onto a line that was not the intended

reporter line. Genomic DNA and first-strand cDNA from randomly chosen F1 plants was

amplified with primers flanking the synthetic microsatellite in the GUS gene. A PCR

31

product of the expected size was obtained in every case. Following sequencing of the PCR

products, no mutations were found suggesting that an intact copy of the correct reporter

construct was indeed present in the sectorless F1 progeny. Secondly, a northern analysis

was conducted to measure the abundance of the GUS transcript in the F1 (ihpMLH1 x

131D) compared to other reporter lines. As show in Figure 3, no (or very little) GUS

transcript was observed in the F1 plants, some was found in T4 and T5 plants of line 131D

whereas a much more important amount of transcript was detected in another reporter line

carrying a related GUS reporter with a longer synthetic microsatellite (G16). This near

absence of transcript could certainly explain the lack of blue sectors among the F1 plants.

To examine whether this situation was unique to the GUS gene, we also assayed the plants

for kanamycin resistance (conferred by the NPTII gene, present both on the MSI reporter

and on the ihpMLH1 T-DNAs). When plated on selective media, we observed only

partially resistant seedlings whose cotyledons were green but whose true leaves were

bleached (Figure 4). On the other hand, T4 plants of the ihpMLH1 lines remained

completely resistant to kanamycin (Figure 4). This suggests that the NPTII genes present on

both T-DNAs had been silenced in the F1 plants.

32

Discussion

Genetic components of the MMR system in plants have only recently been cloned and their

study remains largely incomplete (Ade et al., 1999; Jean et al., 1999; Alou et al., 2004b).

All eukaryotic MSH/MLH genes are present in plants, plus one MutS homologue (MSH7)

that is apparently unique to plants (Culligan and Hays, 2000). The specific functions of

these MMR constituents have been suggested by biochemical studies of their

heterodimerisation and mismatch recognition in vitro (Culligan and Hays, 2000). However,

only the AtMSH2 and AtPMS1 genes have been shown to be involved in DNA repair in

planta (Leonard et al., 2003; Alou et al., 2004a). No such demonstration of function of

AtMLH1 has been published. Using PTGS and RNAi technology, we successfully created

Arabidopsis lines with reduced expression of AtMLH1 and attempted to assess the impact

of this reduced expression.

Among the lines with a single T-DNA locus that were examined by semi-quantitative RT-

PCR, a reduction in the steady state level of the AtMLH1 transcript was observed in most

cases. More than 60% of the ihpRNA lines showed some degree of transcript reduction.

The decrease in transcript abundance ranged from 40% to 90% in the five lines that were

selected to reflect the range of observed silencing. These results are in excellent agreement

with the published literature. Indeed, it has been reported that a majority of RNAi lines

present silencing, but to different extents. Sixty to one hundred percent of RNAi T1 plants

were silenced (to some degree) for the targeted gene in independent experiments (Chuang

and Meyerowitz, 2000; Wesley et al., 2001). When the severity of the silencing has been

monitored, various levels of silencing have been observed. Transcript abundance varied

from nearly undetectable to wild type level (Kerschen et al., 2004). To our knowledge, no

study has reported total inactivation of the targeted gene.

Recent work by Kerschen et al. (2004) has contributed to a better understanding of the

causes of this variation. They characterized a large number of RNAi lines by examining the

degree of PTGS (by quantifying the reduction in the amount of transcript) and the copy

number of the T-DNA bearing the construct leading to PTGS. This experiment revealed

that maximal silencing of the target gene is achieved by single copy insertions of the RNAi

33

construct, while multiple copies gave rise to less effective and more variable transcript

reduction. In our work, while all five ihpMLH1 lines are known to have a single T-DNA

integration locus, no analysis was performed to determine the number of copies of the T-

DNA at this one locus. We can reasonably assume that the silencing differences between

lines come at least in part from this unknown variable.

Another result of interest that came out of the work of Kerschen et al. (2004) is the

susceptibility of a gene to PTGS. Apparently, genes that are highly transcribed will be

subject to a greater degree of silencing, while genes that are less highly transcribed will be

less prone to pronounced silencing. As AtMLH1 is known to be expressed very weakly

(Jean et al, 1999), the 90% reduction in transcript abundance seen in lines ihpMLH1-63,

-70 and -73 is likely near the maximum of reduction that one can expect to obtain by PTGS

for such a gene.

The efficiency of silencing has been documented not only via the AtMLH1 transcript

reduction, but also by the observation of siRNA. Small RNAs (21 to 26 nt) complementary

to AtMLH1 were easily detectable in the lines showing the greatest reduction in transcript

abundance, while only a faint signal was detected in ihpMLH1-51 and no signal at all in

ihpMLH1-54. Since ihpMLH1-54 does show some reduction in transcript abundance, albeit

limited, we would have expected to detect some small RNAs. This absence of signal

probably indicates that the siRNA detection threshold only permits the visualization of

relatively large amounts of siRNA. Nevertheless, the amount of siRNA correlate with the

transcript reduction; plants with the lowest transcript level being those that showed the

most siRNA, while lines with more abundant transcript showed less (if any) siRNA. The

observed correlation between the reduction in transcript levels and the abundance of siRNA

is highly suggestive that a high degree of silencing was indeed achieved in at least three of

the five lines under more intense scrutiny.

The correlation between siRNA abundance, target mRNA reduction and phenotypic effects

of the RNAi have been documented several times (Chuang and Meyerowitz, 2000; Thomas

et al., 2001; Wesley et al. 2001; Stevens et al., 2004). On this basis, it seemed reasonable to

34

think that the silencing of the AtMLH1 gene would result in a detectable phenotype. In

other eukaryotes, the most striking phenotype associated with the loss of AtMLH1 activity

is a reduction in fertility (Hunter and Borts, 1997; Edelmann et al., 1996). In mice, a

complete sterility (both male and female) is observed whereas in the yeast S. cerevisiae, a

reduction in spore viability is detected. Of the 132 T1 plants obtained, two showed reduced

fertility (low number of seeds per silique). This partial sterility did not persist, however, in

subsequent generations. No such reduction in fertility was observed among the three lines

showing the greatest reduction in mRNA levels. Finally, in ongoing work in the laboratory,

an insertional mutant of AtMLH1 is being characterized and it also does not show a reduced

fertility (Dion, E., personal communication). Hence, we can assume that in Arabidopsis

AtMLH1 is not essential for normal growth and fertility and that the absence of evident

phenotype is not due to a malfunction of the RNAi lines.

To further explore the effects of silencing AtMLH1, all five selected RNAi lines were

crossed with a microsatellite instability reporter line (131D). To date, this is the only

phenotype that has been associated with the loss of MMR activity in plants (Alou et al.,

2004a; Leonard et al., 2003). To our surprise, no blue sectors were observed on any of the

plants examined, including the controls. As the baseline mutation frequency in this reporter

line is 1.4 sectors/plant, we would have expected to see several dozen sectors on the 30-40

plants that were stained. PCR and RT-PCR experiments confirmed that the reporter gene

was present, intact, and that the transcribed sequence was functional in these plants. We

then performed a northern experiment to measure GUS transcript levels and found that it

was nearly undetectable in the F1 plants harboring the GUS reporter (with or without the

ihpMLH1 construct). In contrast, T4 and T5 plants of the reporter line exhibited a detectable

signal and another reporter line with a G16 microsatellite in the GUS gene showed a strong

signal. The virtual absence of transcript provides a likely explanation for the absence of

blue sectors in the F1. It is noteworthy, however, that T4 plants of line 131D, despite a

detectable amount of transcript, also failed to show any blue sectors. Why is this so? First,

it is not clear that the mRNA abundance in T4 and T5 generations is sufficient to result in

the production of detectable blue sectors. Compared to the G16 reporter line, the level of

transcript is clearly several times lower. Also, despite being driven by a reportedly strong

35

promoter (CaMV35S), the GUS transcript in the T4 and T5 generations of line 131D was

much lower than that of the actin gene (ACT2) used as a control. Unfortunately, T3 plants

and seeds of line 131D are no longer available and it is therefore no longer possible to

determine the abundance of the GUS transcript in plants on which blue sectors were seen.

The co-suppression hypothesis for the absence of blue sectors and the weak level of

reporter gene expression is strengthened by our work on the NPTII gene. Both T-DNAs

carried a copy of the NPTII gene as a selectable marker. When plated on kanamycin, the F1

plants exhibited only partial resistance. The majority of seedlings died or ceased growth.

Interestingly, even the F1 that did not inherit the ihpMLH1 construct developed the same

phenotype. In contrast, no ihpMLH1 line of any generation (T1 to T4) ever developed such

a phenotype and remained fully resistant. This suggests that the observed silencing

probably originated directly from line 131D. Increased gene silencing from a generation to

another is also a hallmark of co-suppression (Anand et al., 2003; Meyer, 1996). The loss of

blue sectors from T3 to T4 generation together with the appearance of the partial resistance

phenotype and the observed reduction of GUS transcript concords well with this idea.

Taken together, our results suggest that a co-suppression silencing signal coming from G7–

131D plants caused a reduction of transcript abundance of genes carried on the T-DNAs,

producing kanamycin sensitive plants and preventing the observation of blue sectors.

Despite the fact that our best attempts to document the impact on MSI of silencing AtMLH1

were not fruitful, we remain confident that this gene has been successfully silenced based

on the low levels of residual mRNA and the associated presence of siRNAs. Further work,

including crosses with other reporter systems are already going on in our laboratory and

should result in a more comprehensive assessment of the phenotypes resulting from the

inactivation of the AtMLH1 gene.

36

Table 1. Primers used in the making of the ihpMLH1 construct, probe synthesis, PCR and RT-PCR experiments.

Primer Sequence (5'→3') hpMLH1s GGAGGATCTAGATCCTCGAGATGATACAA hpMLH1as GTAAACTTAGCTACCATGGACCACCGAAG AtMLH1-Red2 AGCATCGTTCGAATATCTTGTA MLH3 CTTATTGCTGGAGTTGACAGCTGC AtPMS1_11R CCGGGAGGAGCACTTGGATTC GUSrev2 CAGTTCAACGCTGACATCACCATTG EB_GUS_SacI GGTGGTCAGTCCCTGAGCTCACGTCCTGTA AtPMS1-RED2 CTGATAATATCCATGTGCATTAACA AtPMS1-FED3 CAGATAACACACTCACCAAGGGGGAT Cam35S GGAAACCTCCTCGGATTCCATTGC diMLH1 GGATTGACCATTCACGTTGTGCCC ACT2F ATGGCTGAGGCTGATGATATTC ACT2R GCCTTTGATCTTGAGAGCTTAG

37

Figure 1. RT-PCR analysis of AtMLH1 transcript level in five RNAi lines.

Semi-quantitative RT-PCR was performed on RNA extracted from 18 RNAi lines with a

single T-DNA locus. The five lines illustrated above (upper panel) represent the range of

silencing observed among these plants. From left to right: molecular size standard

(MassRuler DNA Ladder, Fermentas, Burlington, Canada), RT-PCR result for the wild-

type RNA, for a 1/10 dilution of wild-type RNA, for the RNA of line ihpMLH1-51

(intermediate silencing), for the RNA of lines ihpMLH1-70, -63 and -73 (strong silencing),

for the RNA of line ihpMLH1-54 (weak silencing) and a positive control (PCR

amplification of the cloned cDNA). In the lower panel, RT-PCR amplification of the

AtPMS1 gene is shown as a further control. The figure is an inverted color image of the

original EtBr stained gel.

38

Figure 2. Northern detection of siRNA in five RNAi lines and its correlation with the

transcript levels. Northern blot analysis of the 5 selected ihpMLH1 lines (lower panel)

showed the presence of siRNA (21- to 26- nt long) that correlate with the intensity of

silencing (level of transcript, upper panel). The lane on the left contains 1.5 µg of a control

(C) consisting of a 24-nt labeled oligonucleotide.

39

Figure 3. Northern analysis of the GUS transcript in F1 (ihpMLH1 x 131D) plants.

Ten µg of total RNA from T4 or T5 plants of the reporter line 131D, from F1 plants

(ihpMLH1-X x 131D), and from a different reporter line with a G16 microsatellite was

separated on a denaturing formaldehyde-agarose gel and blotted onto a nylon membrane.

Hybridization was first performed with a GUS-specific probe (upper panel), then, the

membrane was stripped and re-hybridized with an actin (ACT2) probe to check the loading

uniformity (lower panel).

A

Figure 4. Partial resistance to kanamycin in

F1 seeds (ihpMLH1-70 x 131D) (panels on th

right) were plated on selective media. These

growth. A) F1 seedlings of ihpMLH1-70 x 131

cotyledons followed by bleaching of the tru

ihpMLH1-70 T4 resistant seedlings, presenting

agent (kanamycin).

ihpMLH1/G7 cross (F1)

B

40

F1 plants.

e left) or T4 of line ihpMLH1-70 (panels on the

photographs were taken after 2 to 3 weeks of

D exhibit only partial resistance: large and green

e leaves and a complete arrest of growth. B)

normal growth in the presence of the selective

ihpMLH1 T4

41

Acknowledgements

O. Domingue was supported by a graduate studentship from the Natural Sciences and

Engineering Research Council of Canada. This work was also supported by a grant from

the Natural Sciences and Engineering Research Council of Canada to F.J. Belzile. We also

thank Msc. M. Lieutenant-Gosselin for enlightening suggestions on this work.

References

Adé, J., Belzile, F., Philippe, H., and Doutrioux, M.-P. (1999) Four mismatch repair paralogues coexists in Arabidopsis thaliana: AtMSH2, AtMH3, AtMSH6-1, AtMSH6-2. Mol. Gen. Genet. 262, 239-249. Alou, A. H., Azaiez, A., Jean, M., and Belzile, F.J. (2004a) Involvement of Arabidopsis thaliana AtPMS1 gene in somatic repeat instability Plant Mol. Biol. In press Alou, A. H., Jean, M., Domingue, O., and Belzile, F.J. (2004b) Structure and expression of AtPMS1, the Arabidopsis ortholog of the yeast DNA repair gene PMS1. Plant Science 167, 447-456. Anand. A., Trick, H.N., Gill, B.S., and Muthukrishnan, S. (2003) Stable transgene expression and random gene silencing in weat. Plant Biotechnology journal 1, 241-251. Clough, S.J., and Bent, A.F. (1998) Floral dip; A simplified method for Agrobacterium-mediated transformation of Arabidopsis thaliana. Plant journal 16, 735-743. Chen, W., and Jinks-Robertson, S. (1998) The role of the mismatch repair machinery in regulating mitotic and meiotic recombination between diverged sequences in yeast. Genetics 151, 1299-1313 Chuang, C. F., and Meyerowitz, E.M. (2000) Specific and heritable genetic interference by double-stranded RNA in Arabidopsis thaliana. PNAS 97, 4985-4990 Church, G.M., Gilbert, W. (1984) Genomic sequencing. PNAS 81, 1991-1995 Culligan, K. M., and Hays, J.B. (2000) Arabidopsis MutS Homologs - AtMSH2, AtMSH3, AtMSH6, and a novel AtMH7-form three distinct protein heterodimers woth different specificities for mismatched DNA. The Plant Cell 12, 991-1002 Edelmann W., Cohen P.E., Kane, M., Lau, K., Morrow B., Bennett, S., Umar, A., Kunkel, T., Cattoretti, G., Chaganti, R., Pollard, J.W., Kolodner, R.D., and Kucherlapati, R. (1996) Meiotic pachyteme arrest in MLH1-deficient mice. Cell 85, 1125-1134 Edwards, K., Johnstone, C. and Thompson, C. (1991) A simple and rapid method for the preparation of plant genomic DNA for PCR analysis. Nucl. Acids Res. 19, 1349 Gleave, A.P. (1992) A versatile binary vector system with a T-DNA organisational tructure conducive to efficient integration of cloned DNA into the plant genome. Plant Mol. Biol. 20, 1203-1207

42

Guo, H.-S., Fei, J.-F., Xie, Q., and Chua, N.-H. (2003) A chemical-regulated inducible RNAi system in plants. The Plant Journal 34, 383-392 Hamilton, A.J., and Baulcombe, D.J. (1999) A species of small antisense RNA in post-transcriptional gene silencing in plants. Science 286, 950-952

Hamilton, A.J., Voinet, O., Chappell, L., and Baulcombe, D.J. (2002) Two classes of short interfering RNA in RNA silencing. EMBO 21, 4671-4679 Harfe, B. D., and Jinks-Robertson, S. (2000) DNA Mismatch repair and genetic instability. Annu.

Rev. Genet. 34, 359-399

Huang, J., Papadopoulos, N., McKinley, A.J., Farrington, S.M., Curtis, L.J., Wyllie, A.H., Zheng, S., Willson, J.K.V., Markowitz, S.D., Morin, P., Kinzler, K.W., Vogelstein, B., and Dunlop M.G. (1996) APC mutations in colorectal tumors with mismatch repair deficiency. PNAS 93, 9049-9054

Hunter, N., and Borts, R.H., (1997) MLH1 is unique among mismatch repair proteins in its ability to promote crossing-over during meiosis. Genes Dev. 11, 1573-1582 Jean, M., Pelletier, J., Hilpert, M., Belzile, F., and Kunze, R. (1999) Isolation and characterisation of AtMLH1, a MutL homologue from Arabidopsis thaliana. Mol. Gen. Genet. 262, 633-642. Kerschen, A., Napoli, C.A., Jorgensen, R.A., Müler, A. E. (2004) Effectiveness of RNA interference in transgenic plants. FEBS Leters 566, 223-228 Koldoner, R.D., and Marsischky, G.T. (1999) Eukaryotic DNA mismatch repair. Curr. Opin. Genet. Dev. 9, 89-96 Kovalchuk, I., Kovalchuk, O., and Hohn, B. (2000) Genome-wide variation of the somatic mutation frequency in transgenic plants. The EMBO journal 19 (17) 4431-4438. Llave, C., Kasschau, K.D., Rector, M.A., and Carrington J.C. (2002) Endogenous and Silencing-Associated Small RNAs in Plants. The Plant Cell, 14, 1605–1619 Leonard, J.M., Bollmann, S.R., and Hays, J.B. (2003) Reduction of Arabidopsis genomic and transgenic DNA-repeat sequences (microsatellites) by inactivation of AtMSH2 mismatch-repair function. Plant Physiol. 133, 1-11 Meyer, P. (1996) Homology-dependent gene silencing in plants. Annu.Rev. Plant Physiol. Plant Mol. Biol. 47, 23-48 Prolla, T.A., Baker, S.M., Harris, A.C., Tsao, J.L., Yao, X., Bronner, C.E., Zheng, B., Gordon. M., Reneker, J., Arnheim, N., Shibata, D., Bradley, A., Liskay, R.M. (1998) Tumour susceptibility and spontaneous mutation in mice deficient in Mlh1, Pms1 and Pms2 DNA mismatch repair. Genes Dev. 12, 1573-1582

43

Sambrook, J., and Russel, D.W., (2001) Molecular cloning: a laboratory manual, Ed 3rd. Cold Spring Harbord Laboratory Press, Cold Spring Harbord, N.Y. Schofield, M.J., and Hsieh, P. (2003) DNA mismatch repair: molecular mechanisms and biological function. Annu. Rev. Microbiol. 57, 579-608 Stevens, R., Grelon, M., Vezon, D., Oh, J., Meyer, P., Perennes, C., Domenichini, S., and Bergounioux, C. (2004) A CDC45homlog in Arabidpsis is essential for meiosis, as shown by RNA interference-induced gene silencing. The Plant Cell. 16, 99-113 Streisinger, G., and Owen, J.E. (1985) Mechanisms of Spontaneous and induced frameshift mutation in bacteriophage T4. Genetics 109, 633-659. Thomas, C.L., Jones, L., Baulcombe, D.C., and Maule A.J. (2001) Size constraints for targetting post-transcriptional gene silencing and for RNA-directed methylation in Nicotina benthamiana using a potato virus X vector. The Plant journal 25, 417-425 Tran, H.T., Keen, J.D., Kricker, M., Resnick, M.A., and Gordening, D.A. (1997) Hypermutability of homonucleotide runs in mismatch repair and DNA polymerase proofreading mutants. Mol. Cell. Biol. 17, 2859-2865 Valvekens, D., Van Montagu, M. and Van Lijsebettens, M. (1988) Agrobacterium tumefaciens-mediated transformation of Arabidopsis thaliana root explants by using kanamycin selection. PNAS 85, 5536-5540. Vaucheret, H., Béclin, C., and Fagard, M. (2001) Post-transcriptional gene silencing in plants. Journal of Cell Science. 114, 3083-3091 Wesley, S.V., Helliwell, C.A., Smith, N.A., Wang M.B., Rouse, D.T., Liu, Q., Gooding, P.S., Singh, S.P., Abbott, D., Stoutjesdijk, P.A., Robinsons, S.P., Gleave, A.P., Green, A.G., et Waterhouse, P.M. (2001) Construct design for efficient, effective and high-throughput gene silencing in plants. The Plant Journal 27, 581-590

44

CHAPITRE 3 : CONCLUSION

Ce projet de maîtrise a permis le développement de lignées RNAi réprimées pour le gène

AtMLH1, l'un des principaux gènes de correction des mésappariements de l'ADN chez

Arabidopsis. Cinq lignées simple locus représentant la gamme de répression obtenue ont

été conservées. Les lignées ihpMLH1-63,-70 et -73 sont celles qui présentent une

inactivation maximale, pour une quantité de transcrits évaluée à ~10 % de celle du type

sauvage. La lignée ihpMLH1-51, quant à elle, présente une inactivation intermédiaire (~30

% du sauvage) et la lignée ihpMLH1-54 une inactivation mineure (~60 % du sauvage).

Outre ces données sur l'abondance des transcrits obtenues par RT-PCR semi-quantitif, des

analyses northern confirmant la présence de siRNA ont été réalisées. Les siRNA sont la

signature moléculaire d'une répression efficace et leur quantité a ici été corrélée à l'intensité

de la répression observée pour chaque lignée. Une première tentative pour évaluer l'effet de

la répression du gène cible a été menée par le croisement avec un système rapporteur de

l'instabilité des microsatellites. Cette tentative s'est révélée infructueuse due à un

phénomène de co-suppression. Des études futures utilisant ces lignées permettront

vraisemblablement une bonne appréciation de l'effet de l'abolition de ce gène chez la

plante.

De façon précise, nous avons vérifié la première hypothèse par l'atteinte des objectifs un et

deux. Le gène AtMLH1 a efficacement été réprimé par l'insertion d'une construction de type

ihpRNA dans la plante (première hypothèse et premier objectif). Le second objectif a

également été atteint. Nous avons été en mesure d'obtenir cinq lignées simple locus et de

documenter l'intensité de la répression (abondance du transcrit) et la présence de siRNA

chez celles-ci. Cependant, la seconde hypothèse n'a pu être vérifiée. Il nous a été impossible

de documenter l'effet phénotypique de l'inactivation du gène AtMLH1, et ce malgré

l'atteinte partielle du troisième objectif. En effet, s'il a été possible d'obtenir par croisement

des plantes contenant le gène rapporteur, celui-ci a toutefois été inactivé par un phénomène

de co-suppression.

Les données obtenues suggèrent une répression très efficace chez au moins trois lignées

(ihpMLH1-63, -70 et -73). Il est intéressant de constater qu'un bon degré d'inactivation a pu

45

être atteint vu le type de gène ciblé. En effet, la susceptibilité au PTGS varie d'un gène à un

autre et certains répondent peu à ce type d'inactivation. Les gènes transcrits en faible

abondance (comme le gène AtMLH1) sont souvent moins réceptifs au PTGS et présentent

une répression moins efficace. La diminution du transcrit de près de 90 % chez ces trois

lignées est donc considérable et est probablement très près de la répression maximale

pouvant être espérée pour un tel gène.

La variation d'intensité de la répression documentée au sein des lignées mérite également

notre attention. L'étude de Kerschen et al. (2004) a montré qu'une des principales causes de

variabilité entre lignées RNAi était le nombre de copies d'ADN-T insérées dans le génome.

Il semblerait qu'une répression maximale soit obtenue par l'insertion d'une seule copie de

l'ihpRNA, tandis que l'insertion de plusieurs copies conduit à une répression moins efficace

et plus variable. Si nous savons que les lignées analysées comportent un seul locus

d'insertion, nous ignorons cependant combien de copies du transgène sont présentes à ce

locus. Il est raisonnable d'assumer que la variabilité observée entre les lignées provient

probablement d'une différence de nombre de copies d'insertions. Une analyse plus

approfondie des lignées à l'étude (par Southern) permettrait de vérifier cette hypothèse. De

la même façon, il pourrait être utile pour des études ultérieures de situer le locus d'insertion

des ADN-T de chaque lignée, de façon à pouvoir faire des croisements éclairés avec de

bons systèmes rapporteurs. En effet, dans de tels cas, il est souvent souhaitable de croiser

des lignées dont les ADN-T (ihpRNA et rapporteur) ne sont pas situés sur le même

chromosome de façon à obtenir une ségrégation mendélienne. S’il est nécessaire d’aller au-

delà de la F1, il sera plus facile d’obtenir tous les génotypes souhaités si les deux ADN-T

montrent une ségrégation indépendante.

Malgré une répression efficace du gène AtMLH1, le croisement des lignées RNAi avec le

système rapporteur n'a pu être informatif. L'absence totale de points bleus a été imputée au

phénomène de co-suppression. En effet, la disparition des points bleus (même chez les

plantes ne comportant pas d'ihpRNA), la chute de la quantité de transcrits du gène GUS

ainsi que l'apparition de résistance partielle à la kanamycine sont autant d'indices pointant

vers cette cause d'inactivation du rapporteur. La co-suppression est un phénomène bien

46

documenté et assez répandu. De plus, la présence de multiples transgènes comportant des

séquences homologues, comme c’est le cas dans la présente étude, est connue pour

accentuer le phénomène. À la lumière de ces résultats, certaines précautions devraient être

prises dans le futur pour éviter semblable situation. D'abord, les systèmes rapporteurs

utilisés devraient contenir le moins possible de séquences homologues à l'ihpRNA.

Secondement, l'utilisation de lignées rapporteuses à historique bien caractérisé devrait être

privilégiée. Des lignées montrant un taux appréciable et stable de points bleus sur plusieurs

générations (ex. jusqu'en T5 ou T6) sont moins susceptibles d'être spontanément co-

supprimées. Comme la co-suppression est connue pour s'accentuer de génération en

génération, il serait également adéquat de croiser les lignées le plus tôt possible (par

exemple sur des parents T2). Quoique toutes ces précautions ne garantissent pas l'immunité

à la co-suppression, elles limitent les risques de faire face à nouveau à une situation

frustrante d'inactivation des transgènes.

De façon à contourner les problèmes de co-suppression, nous pourrions faire appel à

d'autres techniques pour documenter l'effet de la répression d'AtMLH1. Par exemple, pour

mesurer l'instabilité des microsatellites, il serait possible d'utiliser les microsatellites

naturels de la plante et de documenter leur instabilité sur une population d'une lignée RNAi

par rapport à une population sauvage (sur un certain nombre de générations). D'autre part,

des observations histologiques de la méiose ont révélé des anomalies pour de tels mutants

chez plusieurs organismes, et une semblable analyse pourrait être informative chez la

plante. Enfin, il serait pensable d'effectuer des observations sur la recombinaison

hétérologue en croisant différents écotypes d'Arabidopsis et d'observer les schémas de

recombinaison sur des sites polymorphes connus.

Même si cette recherche n'a pu fournir de détails sur la fonction précise d'AtMLH1 chez la

plante, elle a permis l’obtention de lignées efficacement réprimées qui serviront à l'étude de

ce gène capital. La modulation du système MMR est envisageable pour faciliter la

promiscuité des échanges entre espèces plus ou moins apparentées, et ce, dans le but de

l'amélioration génétique des cultures. Un système de type ihpRNA est tout indiqué pour ce

genre d'application, et les résultats probants des lignées discutées dans ce travail

47

permettraient déjà d'aller de l'avant chez des espèces d'intérêt agronomique. Dans un futur

proche, l'amélioration génétique végétale disposera peut-être de cet outil supplémentaire

grâce, en partie, aux efforts qui ont été investis dans cette recherche.

48

BIBLIOGRAPHIE

Adé, J., Belzile, F., Philippe, H., and Doutrioux, M.-P. (1999) Four mismatch repair paralogues coexists in Arabidopsis thaliana: AtMSH2, AtMH3, AtMSH6-1, AtMSH6-2. Mol. Gen. Genet. 262, 239-249. Alou, A. H., Azaiez, A., Jean, M., and Belzile, F.J. (2004a) Involvement of Arabidopsis thaliana AtPMS1 gene in somatic repeat instability. Plant Mol. Biol. In press Alou, A. H., Jean, M., Domingue, O., and Belzile, F.J. (2004b) Structure and expression of AtPMS1, the Arabidopsis ortholog of the yeast DNA repair gene PMS1. Plant Science 167, 447-456. Anand. A., Trick, H.N., Gill, B.S., and Muthukrishnan, S. (2003) Stable transgene expression and random gene silencing in weat. Plant Biotechnology journal 1, 241-251. Aufsatz, W., Mette, M.F., vaan der Winden, J., Matzke, A.J.M., and Matzke, M. (2002) RNA-directed DNA methylation in Arabidopsis. PNAS 99, 16499-16506 Ban, C., and Yang, W. (1998) Crystal structure and ATPase activity of MutL; implcations for DNA repar and mutagenesis. Cell 95 (4), 541-552 Baulcombe, D. (2004) RNA silencing in plants. Nature 431, 356-463 Carrington, J., and Ambros, V., (2003) Role of microRNAs in plants and animal development. Science 301, 336-338 Clough, S.J., and Bent, A.F. (1998) Floral dip; A simplified method for Agrobacterium-mediated transformation of Arabidopsis thaliana. Plant journal 16, 735-743. Chen, W., and Jinks-Robertson, S. (1998) The role of the mismatch repair machinery in regulating mitotic and meiotic recombination between diverged sequences in yeast. Genetics 151, 1299-1313 Chen, X. M. (2004) A microRNA as a translational repressor of APETALA2 in Arabidopsis flower development. Science 303, 2022–2025 Chuang, C. F., and Meyerowitz, E.M. (2000) Specific and heritable genetic interference by double-stranded RNA in Arabidopsis thaliana. PNAS 97, 4985-4990 Church, G.M., and Gilbert, W. (1984) Genomic sequencing. PNAS 81, 1991-1995 Cooper, D.L., Lahue, R.S., and Modrich, P. (1993) Methyl-directed mismatch repair is bidirectional. J. Biol. Chem. 268 (16), 11823-11829 Culligan, K. M., and Hays, J.B. (2000) Arabidopsis MutS Homologs - AtMSH2, AtMSH3, AtMSH6, and a novel AtMSH7-form three distinct protein heterodimers woth different specificities for mismatched DNA. The Plant Cell 12, 991-1002 de Wind, N., and Hays, J.B. (2001) Mismatch repair: praying for genome safety. Current Biology. 11 (14), R545-R548

49

Dykxhoorn, D.M., Novina, C.D., and Sherp, P.A. (2003) Killing the messenger: short RNAs that silence gene expression. Nature reviews 4, 457-467 Edelmann W., Cohen P.E., Kane, M., Lau, K., Morrow B., Bennett, S., Umar, A., Kunkel, T., Cattoretti, G., Chaganti, R., Pollard, J.W., Kolodner, R.D., and Kucherlapati, R. (1996) Meiotic pachyteme arrest in MLH1-deficient mice. Cell 85, 1125-1134 Edwards, K., Johnstone, C. and Thompson, C. (1991) A simple and rapid method for the preparation of plant genomic DNA for PCR analysis. Nucl. Acids Res. 19, 1349 Gleave, A.P. (1992) A versatile binary vector system with a T-DNA organisational tructure conducive to efficient integration of cloned DNA into the plant genome. Plant Mol. Biol. 20, 1203-1207 Guo, H.-S., Fei, J.-F., Xie, Q., and Chua, N.-H. (2003) A chemical-regulated inducible RNAi system in plants. The Plant Journal 34, 383-392 Hall, M.C., and Matson, S.W. (1999) The Escherichia coli MutL protein physically interacts with MutH and stimulates the MutH-associated endonuclease activity. Journal of Biological Chemistry. 274 (3), 1306-13312 Hamilton, A.J., and Baulcombe, D.J. (1999) A species of small antisense RNA in post-transcriptional gene silencing in plants. Science 286, 950-952 Hamilton, A.J., Voinet, O., Chappell, L., and Baulcombe, D.J. (2002) Two classes of short interfering RNA in RNA silencing. EMBO 21, 4671-4679 Harfe, B. D., and Jinks-Robertson, S. (2000) DNA Mismatch repair and genetic instability. Annu. Rev. Genet. 34, 359-399 Hunter, N., and Borts, R.H., (1997) MLH1 is unique among mismatch repair proteins in its ability to promote crossing-over during meiosis. Genes Dev. 11, 1573-1582 Jean, M., Pelletier, J., Hilpert, M., Belzile, F., and Kunze, R. (1999) Isolation and characterisation of AtMLH1, a MutL homologue from Arabidopsis thaliana. Mol. Gen. Genet. 262, 633-642. Jones-Rhoades, M.W., and Bartel, D.P. (2004) Computational Identification of Plant MicroRNAs and Their Targets, Including a Stress-Induced miRNA. Mol Cell 6,787-99. Kerschen, A., Napoli, C.A., Jorgensen, R.A., Müler, A. E. (2004) Effectiveness of RNA interference in transgenic plants. FEBS Leters 566, 223-228 Ketting, R.F., Haverkamp, T.H., van Luenen HG, Plasterk RH. (1999) Mut-7 of C. elegans, required for transposon silencing and RNA interference, is a homolog of Werner syndrome helicase and RNaseD. Cell 2, 133-41 Koldoner, R.D., and Marsischky, G.T. (1999) Eukaryotic DNA mismatch repair. Curr. Opin. Genet. Dev. 9, 89-96

50

Kovalchuk, I., Kovalchuk, O., and Hohn, B. (2000) Genome-wide variation of the somatic mutation frequency in transgenic plants. The EMBO journal 19 (17) 4431-4438. Kunkel, T.A., and Bebeneck, K. (2000) DNA replication fidelity. Annu. Rev. Biochem. 69, 497-529 Llave, C., Kasschau, K.D., Rector, M.A., and Carrington J.C. (2002) Endogenous and Silencing-Associated Small RNAs in Plants. The Plant Cell 14, 1605–1619 Leonard, J.M., Bollmann, S.R., and Hays, J.B. (2003) Reduction of Arabidopsis genomic and transgenic DNA-repeat sequences (microsatellites) by inactivation of AtMSH2 mismatch-repair function. Plant Physiol. 133, 1-11 Mallory, A.C., Ely, L., Smith, T.H., Marathe, R., Anandalakshmi, R., Fagard, M., Vaucheret, H., Pruss, G., Bowman, L., and Vance, V.B. (2001) HC-Pro Suppression of Transgene Silencing Eliminates theSmall RNAs but Not Transgene Methylation or the Mobile Signal. The Plant Cell 13, 571–583 Mallory, A.C., and Vaucheret, H. (2004) MicroRNAs: something important between the genes. Current Opinion in Plant Biology 7, 120-125 Marti, T.M., Kunz, C., Fleck, O. (2002). DNA mismatch repair and mutation avoidance patways. Journal of cellular physiology 191, 28-41 Meins, F.Jr. (2000) RNA degradation models for post-transcriptional gene silencing. Plant Mol. Biol. 43, 261-273 Mette, M.F., Aufsatz, W, van der Winden, J., Matzke, M.A., Matzke, AJ. (2000) Transcriptional silencing and promoter methylation triggered by double-stranded RNA. EMBO J. 19, 5194-201 Meyer, P. (1996) Homology-dependent gene silencing in plants. Annu. Rev. Plant Physiol. Plant Mol. Biol. 47, 23-48 Napoli, C., Lemieux, C., Jorgensen, R. (1990) Introduction of a chimeric chalcone synthase gene into petunia result in reversible co-suppression of homologous gene in trans. The Plant Cell 2, 279-289 Pavlov, Y.I., Mian, I.M., and Kunkel, T.A. (2003) Evidence for preferential mismatch repair of lagging strand DNA replication errors in yeast. Curr. Biol. 13 (9), 744-748 Prolla, T.A., Baker, S.M., Harris, A.C., Tsao, J.L., Yao, X., Bronner, C.E., Zheng, B., Gordon. M., Reneker, J., Arnheim, N., Shibata, D., Bradley, A., Liskay, R.M. (1998) Tumour susceptibility and spontaneous mutation in mice deficient in Mlh1, Pms1 and Pms2 DNA mismatch repair. Genes Dev. 12, 1573-1582 Rayssiguier, C., Thaler, D.S., and Radman, M. (1989) The barrier to recombination betwen Escherichia coli and Salmonella typhimurium is disrupted in mismatch repair mutants. Nature 342, 396-401

51

Ross-Macdonald, P., and Roeder, G.S. (1994) Mutation of a meiosis-specific Muts homolog decreases crossing over but not mismatch correction. Cell 79 (6), 1069-1080 Sambrook, J., and Russel, D.W., (2001) Molecular cloning: a laboratory manual, Ed 3rd. Cold Spring Harbord Laboratory Press, Cold Spring Harbord, N.Y. Sanders M., Lannoo, N., Maddelein, W., Depicker, A., Montagu, M.V., Cornelissen, M., and Jacobs, J. (2004) The preferred route for the degradation of silencing target RNAs in transgenic plants depends on pre-established silencing conditions. Nucleic Acids Research 32, 3400-3409 Schauer, S., Jacobson, S., Meinke, D., and Ray, A. (2002) DICER-LIKE 1: blind men and elephants in Arabidopsis development. Trends Plant Sci. 7, 487-491 Schofield, M.J., and Hsieh, P. (2003) DNA mismatch repair: molecular mechanisms and biological function. Annu. Rev. Microbiol. 57, 579-608 Smith, N. A., Singh, S.P., Wang, M.-B., Stoutjesdijk, P.A., Green, A.G. and Watherhouse, P.M. (2000) Total silencing by intron-spliced hairpin RNAs. Nature 407, 319-320. Stevens, R., Grelon, M., Vezon, D., Oh, J., Meyer, P., Perennes, C., Domenichini, S., and Bergounioux, C. (2004) A CDC45homlog in Arabidpsis is essential for meiosis, as shown by RNA interference-induced gene silencing. The Plant Cell 16, 99-113 Streisinger, G., and Owen, J.E. (1985) Mechanisms of Spontaneous and induced frameshift mutation in bacteriophage T4. Genetics 109, 633-659. Tang, G., Reinhart, B.J., Bartel, D.P., and Zamore, P.D. (2002) A biochemical framework for RNA silencing in plants. Genes and Developement. 17, 49-63 Thomas, C.L., Jones, L., Baulcombe, D.C., and Maule A.J. (2001) Size constraints for targetting post-transcriptional gene silencing and for RNA-directed methylation in Nicotina benthamiana using a potato virus X vector. The Plant Journal 25, 417-425 Tran, H.T., Keen, J.D., Kricker, M., Resnick, M.A., and Gordening, D.A. (1997) Hypermutability of homonucleotide runs in mismatch repair and DNA polymerase proofreading mutants. Mol. Cell. Biol. 17, 2859-2865 Valvekens, D., Van Montagu, M. and Van Lijsebettens, M. (1988) Agrobacterium tumefaciens-mediated transformation of Arabidopsis thaliana root explants by using kanamycin selection. PNAS 85, 5536-5540. Vaucheret, H., Béclin, C., and Fagard, M. (2001) Post-transcriptional gene silencing in plants. Journal of Cell Science. 114, 3083-3091 Voinnet, O. (2002) RNA silencing: small RNAs as ubiquitous regulators of gene expression. Current Opinion in Plant Biology. 5, 444-451 Voinet, O., Lederer, C., and Baulcombe, D.C. (2000) A viral movement protein prevents spread of the gene silencing signal in Nicotiana benthamiana. Cell. 103, 157-167

52

Wang, T.-F., Kleckner N., Hunter, N. (1999) Functionnal specificity of MutL homologs in yeast: evidence for three Mlh1-based heterocomplexes with distinct roles during meiosis in recombination and mismatch correction. PNAS 96 (24), 7348-7351 Wesley, S.V., Helliwell, C.A., Smith, N.A., Wang M.B., Rouse, D.T., Liu, Q., Gooding, P.S., Singh, S.P., Abbott, D., Stoutjesdijk, P.A., Robinsons, S.P., Gleave, A.P., Green, A.G., et Waterhouse, P.M. (2001) Construct design for efficient, effective and high-throughput gene silencing in plants. The Plant Journal 27, 581-590 Westmoreland, J., Porter, G., Radman M., and Resnick M.A. (1997) Highly mismatched molecules resembling recombination intermediates efficiently transform mismatch repair proficient Escherichia coli. Genetics 145 (1), 29-38 White, S.A., and Allshire, R.C. (2004) Loss of Dicer fowls up centromeres. Nature Cell Biology 6, 696 - 697 Williamson, M.S., Game, J.C., Fogel, S. (1985) Meiotic gene conversion mutant in Saccharomyces cerevesiae. I. Isolation and characterization of pms1-1 and pms1-2. Genetics 110 (4), 609-646. Winston, W. M., Molodowitch, C. and Hunter, C. P. (2002) Systemic RNAi in C. elegans requires the putative transmembrane protein SID-1. Science 295, 2456–2459 Worth, L.W. Jr., Bader, T., Yang, J., Clark, S. (1998) Role of Muts ATPase activity in MutL-dependant block of in vitro strand transfer. J. Biol. Chem. 273, 23176-23182 Wu T-H., and Marinus, M.G. (1994) Dominant negative mutator mutations in the muts gene of Escherichia coli. J. Bateriol. 176, 5393-5400 Yao, X., Buermeyer A.B., Narayanan, L., Tran, D., Baker, S.M., Prolla, T.A., Glazer, P.M., Liskay, R.M., and Arnheim, N. (1999) Different mutator phenotypes in Mlh1- versus Pms2-deficient mice. PNAS 96, 6850-6855 Yoo, B.C., Kragler, F., Varkonyi-Gasic, E., Haywood, V., Archer-Evans, S., Lee, Y.M., Lough, T.J., Lucas, W.J. (2004) A systemic small RNA signaling system in plants. Plant Cell 8, 1979–2000

53

ANNEXE

Ce second article a été rédigé par Abdourahaman Alou (de l'Institut national de recherche

agronomique du Niger) dans le cadre de ses études doctorales au laboratoire du Dr.

François Belzile. Intitulé « Structure and expression of AtPMS1, the Arabidopsis ortholog

of the yeast DNA repair gene PMS1. » il rapporte la découverte, le clonage et la

caractérisation de l'homologue végétal (AtPMS1) du gène de correction des

mésappariements PMS1. Cette recherche a été supervisée par Dr François Belzile (directeur

de recherche, dernier auteur) et a bénéficié de l'apport de Dre Martine Jean (professionnelle

de recherche, seconde auteure). L'article a été publié dans la revue «Plant Science» (167(3);

447-456) sous la forme présentée ici.

Ma contribution à cet article se situe au niveau de l'évaluation de l'expression des transcrits

du gène AtPMS1. L'expertise développée au cours de mes travaux de recherche dans

l'évaluation de la quantité de transcrits (par RT-PCR semi-quantitatif et analyse northern) a

été mise à profit. J'ai participé à l'élaboration d'une stratégie permettant la discrimination

entre transcrits alternatifs possibles du gène AtPMS1 et j'ai vérifié expérimentalement les

conclusions. La figure 2 de la publication et les textes s'y rapportant sont les résultats

directs de ma contribution à ce travail.

1

Plant Science 167 (2004) 447-456

Structure and expression of AtPMS1,the Arabidopsis ortholog

of the yeast DNA repair gene PMS1

A.H. Aloua,b, M. Jean b, O. Domingue b, F.J. Belzile b,*

aInstitut National de Recherches Agronomiques du Niger (INRAN), B.P. 429, Niamey, Niger bDépartement de Phytologie, Université Laval, 1243 Pavillon C. E. Marchand, Qué., Canada G1K 7P4

Received 30 January 2004; received in revised form 1 April 2004; accepted 8 April 2004 Available online 18 May 2004

Abstract

The DNA mismatch repair (MMR) machinery of eukaryotes involves several genes whose products interact to repair mispaired bases resulting from DNA replication errors or homoeologous recombination. We report here the cloning and characterization of AtPMS1,a gene that codes for a predicted polypeptide sequence of 924 amino acids containing the typical MutL motifs. It is one of three homologs of the Escherichia coli MutLgene in Arabidopsis thalianaand constitutes the first ortholog of the yeast PMS1gene to be characterized in plants. The gene is present in a single copy in the Arabidopsisgenome and is located in the top portion of chromosome IV. Northern and RT-PCR analyses indicate that theAtPMS1gene is expressed at very low levels in mature leaves but is much more highly expressed in cultured cells. Furthermore, an alternate form of the messenger, apparently coding for an incomplete protein lacking a key portion of the C-terminus, appears to co-exist in some plant tissues, albeit at a lower abundance. Primer extension and 5’ -RACE experiments suggest that this gene has multiple transcription start sites, observationsthat are in agreement with the lack of a detectable TATA box. These results underline the importance of experimentally-derived results to confirm and, occasionally, to correct and extend the information provided by genome projects. © 2004 Elsevier Ireland Ltd. All rights reserved.

Keywords: Arabidopsis thaliana;Mismatch repair; MutL homolog; PMS1; Phylogenetic analysis

1. Introduction Throughout the life of a cell, its DNA is subjected tovarious kinds of damages that, if left unrepaired, can lead tomutations and genome instability. Organisms have thereforeevolved a complex set of enzymatic systems to repair differenttypes of DNA damage. The DNA mismatch repair (MMR)system is specialized in the repair of mispaired bases andcontributes in many ways to maintaining genome stability [1].First, it corrects replication errors and random errors due tomutagens. Second, it exhibits an anti-recombination activitypreventing or interrupting recombination between divergedsequences, such as repetitive DNA in ectopic sites orhomoeologous loci in wide crosses [2]. Some of theserecombination events could lead to important and deleteriouschromosomal rearrangements. *Corresponding author. Tel.: +1-418-656-2131x5763; fax: +1-418-656-7176. E-mail address:fbelzile@rsvs.ulaval.ca (F.J. Belzile).

In Escherichia coli,the key components of the systemare the products of the mutS,mutL, and mutHgenes [3]. The MMR system relies on a MutS homodimer for the recognition of mispaired bases. This initial recognition step is followed by the recruitment of a MutL homodimer via protein-protein interactions between MutS and MutL. Similarly, MutL is thought to recruit a helicase (UvrD) and to activate the MutH endonuclease. Once the DNA strand carrying the mismatch has been removed, DNA synthesis and ligation steps follow to produce a perfectly matched duplex. The MutL protein is therefore often referred to as a "molecular matchmaker" because of its interactions with other proteins involved in MMR [4]. In addition, MutL has been called a molecular switch in MMR as it has been hypothesized to convert an initiation complex into a processing complex [5]. Thus, MutL is viewed as playing acritical role in MMR by coordinating the recognition ofmismatches with the strand removal process [3]. The high degree of conservation of the MMR system has allowed homologs of mutSand mutLto be identified in many

0168-9452/$ - see front matter © 2004 Elsevier Ireland Ltd. All rights reserved.doi:10.1016/j.plantsci.2004.04.012

2

448 eukaryotes. The number of MMR genes in eukaryotes ishowever generally greater than in bacteria and this number canvary from species to species [3]. For example, the yeast and human genomes each contain six homologs of the mutSgene (named MSH for mutShomolog) and four homologs of themutLgene (named MLH for mutLhomolog or PMSfor post-meiotic segregation). In contrast, only two homologs have beenfound for each of mutSand mutLin Drosophila melanogaster.Inplants, recent research on Arabidopsisthalianahas identified six homologs of mutS[6-8] and three homologs of mutL[9]. Interestingly, in eukaryotes, MutS and MutL functionsare carried out by homologs which form heterodimers, all ofwhich involve either MSH2, or MLH1. A diversity of homologsleads to a number of possible heterodimers, each of which may play a highly specialized role. For example, a functional analysis of the yeast homologs of MutL has revealed thatalthough yMLH1-yPMS1 and yMLH1-yMLH2 are both involved in mismatch correction, their activities are different[10-13]. In contrast, yMLH1-yMLH3 has no role in mismatchcorrection but rather promotes meiotic crossing-over and suppresses frameshift mutations. Functional and structural analyses have ascribedcertain functions to specific domains of the MutL protein andits homologs. Broadly speaking, the N-terminal portion is involved in ATP binding and hydrolysis whereas the C-terminal region is important for MutL dimerization and interaction withother proteins. For example, the C-terminal portion of MutL isrequired for protein-protein interaction with MutS [14,15], MutH [16-18], and UvrD [19-21]. In plants, the MMR system could prove to play aparticularly important role. First, plants can be exposed to highlevels of natural (UV light) and man-made mutagens (soil or water contamination) without being able to avoid them through flight. Also, the barriers to interspecific hybridization in plantsare much less important than in animals and wide crosses occurboth naturally and in the context of plant breeding efforts. In theresulting alloploids, the regulation of homoeologousrecombination can be of particular significance. For thesereasons, it would seem important to clone and characterizehomologs of MMR genes in the plant kingdom. We and others have begun to study homologs of mutS [6,7] and mutL[9] inArabidopsis thaliana.In the present work, we report thestructure and expression of the first plant homolog of the yeastPMS1gene. 2. Materials and methods 2.1.Plant material Plants used in this study were grown in potting mix(Promix) in a controlled environment under fluorescent lights at22°C (16 h day/8 h night). The ecotypes used were Landsbergerectaand Columbia. Seeds were provided by the ArabidopsisBiological Resource Center (ABRC, Columbus, USA).

Genomic DNA was extracted from young leaves using a modified CTAB method [22]. A cell suspension culture (ecotype Columbia) was grown and harvested as previously described [7]. 2.2.Amplification with degenerate primers Degenerate primers PMS1 (5’-ACCGCTGTTAAGG AGCTCGTNGARAA-3’) and PMS2 (5’-AGAGATCTC AGAGCCTCICCICKRAANCC-3’) were used in amplifica-tions with genomic DNA from Arabidopsis thalianaecotype Landsberg erecta. Primer positions are displayed in Fig. 1A, and PCR was performed in a 20 µl reaction volume containing 0.2 mM dNTPs, 1× Taq buffer (Amersham Biosciences, Piscataway, USA), 500 nM of each primer, and 1.25U of Taq DNA polymerase (Amersham Biosciences, Piscataway, USA). Cycling was done in a Perkin Elmer Thermocycler (Model 480) in the following conditions: denaturation (94°C, 30 s), annealing (50°C, 30 s), and extension (72°C, 1 min) for 30 rounds of amplification. Each PCR amplification was initiated by a 5 min hot start at 94°C, and was completed with a 10 min extension period at 72C. A major 320 bp amplification product was digested with SacI and BglII and cloned into theSacI and BamHI sites of pBluescript (Stratagene, Vancouver, Canada). 2.3.Isolation of a cDNA clone Size fractionated cDNA libraries were obtained fromthe ABRC (CD4-6, CD4-7, CD4-12, CD4-13, CD4-14, and CD4-16) and screened with the following primers: AtPMS1-1 (5’-ATAGGATCCAGCAAATGCAAGGAGATTC-3’), AtPMS1-2 (5’-GGTTGCTCCGAATTCTCCTCGAACC-3’), AtPMS2-1 (5’-GGTTCGAGGAGAATTCGGAGCAACC-3’), and AtPMS2-2 (5’-GACTCTCGAGTGTTCATGCCAAT GAGATGG-3’). The location of these primers is shown inFig. 1A. Screening of phage libraries was accomplished essentially as previously described [7]. A total of 10 aliquots of 50,000 phages each were plated on 150mm petri dishes and, following overnight growth, phage were collected in 7 ml SM buffer (100 mM NaCl, 10 mM MgSO 4·7H2 O, 1 M Tris-HCl pH 7.5, 2% gelatin) and 1 of this solution was used for PCR amplification in the conditions previously described. The screening yielded six positive pools, two of which were plated again at a density of 10,000 phage per plate and ten plates per pool. Twelve out of the twenty plates yielded a positive signal and membranes were lifted on four of these. A probe was prepared 32 by labeling with P[dCTP] the PCR product (1.1 kb) obtained with primers AtPMS1-1 and AtPMS1-2 and usedto screen the plaque lifts. Agar plugs were collected from the vicinity of positive plaques and placed in 100 l of SMsolution. The resulting phage suspensions were plated againand candidate plaques were tested by PCR. A positive clonewas then amplified for in vitroexcision from the Lamda Zap II phage using XL1-Blue and SORL bacteria, and Ex-Assist

A.H. Alou et al. / Plant Science 167 (2004) 447-456

3

A.H. Alou et al. / Plant Science 167 (2004) 447-456 449

Fig. 1. Schematic representation of the AtPMS1gene. (A) Structure of the genomic region containing the AtPMS1gene. Relative size (in bp) and position of introns (empty boxes) and exons (filled boxes) are displayed. The position of the initiating (ATG) and the stop (TGA) codons are shown. The location of the degenerate primers PMS1, and PMS2 used to initially clone this gene and the resulting amplicon (320 bp) are shown above the diagram. Gene-specific primers used to screen cDNA libraries are depicted as arrows immediately above or below the representation of the gene: AtPMS1-1 (1-1), AtPMS1-2 (1-2), AtPMS2-1 (2-1), and AtPMS2-2 (2-2). (B) The schematic diagram of the 5_ region of the gene shows the transcription start sites revealed by the 5_ -RACE (5_R), the primer extension (PE), and the isolated cDNA. Also shown are the location of the primers used for these analyses: AtPMSFED2 (FED2), AtPMS9R (9R), AtPMS7R (7R), and AtPMS8R (8R).

helper phage as recommended by the supplier (Stratagene,Vancouver, Canada). The cloned cDNA was completelysequenced on both strands using an automatic sequencer andhas been assigned GeneBank accession number AY047228.

Two more washes were done at 60°C in 2X SSC, 1% SDS solution for 25 min each. The washed membrane was exposed on X-ray film for three days –80°C.

2.5.Northern analysis

2.4.Southern analysis Total RNA was extracted from 1.5 g of either a Columbia Genomic DNA of Columbia and Landsbergerectawas digested with restriction enzymes EcoRI, HindIII, KpnI, and SacI each digestion was conducted on 3µg of DNAin 20µl digestion volume containing the appropriate digestionbuffer and 20 units of enzyme. Digestion was carried out allnight at 37°C and the restricted DNA was then fractionated on1% agarose gel. Gel migration was done in TBE (QIAgen, Mississauga, Canada) and 2 at 22 V overnight. The DNA wasblotted onto GeneScreen Plus (DuPont, Boston, USA) nylonmembrane as per the manufacturer's guidelines. Themembrane was then baked for 1h at 80°C. The entire cDNAinsert was amplified with the universal primers KS and SKand 25 ng were labeled with 50 µCi of α 32 P[dCTP] using theOligolabelling kit for 1 h at 80 (Amersham Biosciences,Piscataway, USA). Hybridization was carried out overnight at60°C following a two-hour pre-hybridization at 65°C insolution containing 6X SSC, 5X Denhardt’s solution, 0.5% SDS and 30 µg/ml salmon sperm DNA. The membrane waswashed twice for 15 min in 2X SSC at room temperature.

cell suspension, 72 h-old seedlings, or fully grown leaves from mature plants. These materials were ground to a fine powder using a mortar and pestle in the presence of liquid nitrogen. The extraction procedure was based on a modified phenol/SDS method [23]. Poly (A)+ RNA was purified from total RNA using the Oligotex mini mRNA kit (Qiagen, Mississauga, Canada) and 2µg of the poly (A)+ RNA was fractionated overnight on a 1% formaldehyde gel. Capillary transfer onto a GeneScreen Plus (Dupont, Boston, USA) membrane was thereafter carried out overnight in conditions specified by the manufacturer. Following transfer, RNA was permanently fixed to the membrane by baking it for 1h at 80°C. A two-hour prehybridization at 50°C and a overnight hybridisation at 55°C were performed in buffer containing 5X SSPE, 5X Denhardt's solution, 1% SDS, and 10%dextran sulfate. The probe was prepared as described above for the Southern analysis. The membrane was washed twice for 15 min in 2X SSPE at room temperature, twice for 20 min at 60°C in 2X SSPE, 1% SDS, twice for 15 min

4

A.H. Alou et al. / Plant Science 167 (2004) 447-456450 at 65°C in 2X SSPE, 1% SDS and once at 65 °C in 0.5X SSPE for 20 min. The signal was detected after three hours of exposure on X-ray film at -80°C. 2.6.RT-PCR To avoid any contamination of the RNA by DNA, 6of total RNA was treated with 6 units of Amplification 5Grade DNase I (Invitrogen, Carslbad, USA), and incubated in a total reaction volume of 60µl at room temperature for15min. DNase I inactivation was done at 65° C for 10 min in the presence of 2 mM EDTA as recommended by the supplier. First strand cDNA was synthesized with a First-Strand formed using 3 cDNA Synthesis Kit (Amersham Biosciences, Piscataway, USA), using 20µl of the DNase I treated RNA and either a universal primer (NotI-d(T)) or a gene-specific primer ACA-3_) in a total volume of 50 (AtPMS2-2) at a concentration of 500 nM per reaction. Two microliters from

the first-strand reaction were used as template to perform PCR (30 cycles; 94°C, 30s; 55°C, 30s; and 72°C, 1 min)with primers AtPMS1-1 and AtPMS1-2. We extracted total RNA from 21 days old seedlings,mature leaves, cell suspension, and roots. For each tissue type, RNA extraction was performed in Trizol (Invitrogen, Carslbad, USA) using 200 mg of plant tissues according to the manufacturer's recommendations. We used 5µl of the extracted total RNA to synthesize first strand with First-Strand cDNA Synthesis Kit (Amersham Biosciences, Piscataway, USA). RT reaction was performed as above described, and the primer used was AtPMS11R (5’-CCGGGAGGAGCACTTGGATTC-3’). PCR was performed using 3µl of first strand reaction with primers At-PMS10F (5’ –CTCGGGCAATTCAATCTTG GGTTC-3’) and AtPMSRED2 (5’-CTGATAATATCCAT GTGCATTAACA-3’) in a total volumeof 50µl, and the PCR condition was: 30 cycles; 94°C, 30s; 60sc; and 72°C, 45s.

Fig. 2. Products resulting from alternate splicing of the AtPMS1gene. (A) Size and structure of the amplicons obtained for genomic DNA and two alternately spliced transcripts. Open rectangles represent exons (Ex6 to 9) and the filled rectangles represent introns (In6, 7 and 8). The white box within the partially spliced intron 6 (in GenBank accession no. AK117777) shows the location of the probe DNA PSouth (5’ -ctagtctgattttgaagaaatggtatagac-3’ ) used in the Southern analysis. The position of the first premature stop codon in exon 7 of AK117777 is also displayed. The primer used for reverse transcription was AtPMS11R (11R), and PCR was performed with primers AtPMS10F (10F) and AtPMS1RED2 (RED2). B) RT-PCR products obtained for the C-terminal portion of AtPMS1in various tissues. Migration on a 2% agarose gel of the amplicons generated after RT-PCR using RNA extracted from different plant tissues or after PCR on control DNA. Lane 1: 21-day old seedlings (RNA), lane 2: mature leaves (RNA), lane 3: cell suspension (RNA), lane 4: roots (RNA), lane 5: genomic DNA, lane 6: cDNA (GenBank accession no. AY047288). Arrows point to the expected location of the completely spliced cDNA, the partially spliced cDNA, and the genomic DNA amplicons. The 50 bp DNA ladder (Fermentas, Burlington, Canada) was used as a size standard (lane M; sizes provided on the left side of the gel).

5

We used genomic DNA and the cloned AtPMS1 cDNA(AY047288) as control in the PCR reaction. Amplifiedproducts were visualized on a 2% agarose gel. These productswere transferred on nylon memMgSO brane for Southernanalysis. Procedures were as above described and we used theoligonucleotides Psouth (5’-CTAGTCTGATTTTGAAGAAATGGTATAGAC-3’) as probe to detect splicing variantcontaining the intron 6. Primers and probe localization aredisplayed on Fig. 2A. 2.7. 5’-RACE

We treated 5µg of total RNA from Columbia plantswith Dnase I (Invitrogen, Carslbad, USA) in a 10µl reactionvolume in presence of two units of DNase I. The reaction wasincubated for 15 min at room temperature, and terminated byaddition of 1µl of 25mM EDTA. DNase I was heat inactivatedby 15 min incubation at 65°C. We used 6µl of DNase I treatedRNA to synthesize first strand cDNA using SuperScript II RT(Invitrogen, Carslbad, USA). Reverse transcription was doneusing primer AtPMS1-2 in conditions specified by themanufacturer. The dC-tailed cDNA was subjected to 35 cyclesof PCR using one gene-specific primer AtPMS7R (5’-CTTGTTTCCACAGTGAGATTTCCC-3’) and one primersupplied in the kit AAP (5’-GGCCACGCGTCGACTAGTACGGGIIGGGIIGGGIIG-3’) at an annealing temperature of65°C for 45 s. An additional nested amplification (35cycles)was performed with one gene-specific primer AtPMS8R (5’-GCACAGAGAGAGCTCAAG GCTTCTCC-3’) and thesecond primer supplied in the kit AUAP (5’-GGCCACGCGTCGACTAGTAC-3’). We used a 1:10 in Fig.1B. dilution of the primary PCR reaction as template. The 5’ -end of AtPMS8R is 3 nucleotides from the 3_ -end ofAtPMS7R 2.9.Phylogenetic and homology analysis (Fig. 1B).For cloning purposes, AtPMS8R included a SacI restrictionsite and the primers supplied in the kit (AAP and AUAP)comprised restriction sites for MluI, SalI, and SpeI. A 650 bpamplicon from the AtPMS8R-AUAP amplification wasextracted and purified from 1% agarose gel with gel extractionkit (QIAgen, Mississauga, Canada). The purified fragment2was digested with restriction enzymes SalI and SacI andcloned into plasmid pBluescript (Stratagene, Vancouvert,Canada) for sequencing. 2.8. Primer extention

We incubated 10µg of total RNA with 10 units RQ1l reaction volume for 30 min at 37 °C. The reaction wasterminated with 3µl RQ1 DNase stop solution, and the DNaseI was heat inactivated by incubation at 65°C for 10 min. Weused 12µl of RQ1-treated total RNA for reverse transcriptionwith SuperScript II RT (Invitrogen, Carslbad, USA) at 50°Cfor 50 min. The total reaction volume was 25µl and itcontained 25 ng of primer AtPMS9R (5’-CCCTTAGGGCTTATGTT TTGCCGCC-3’). The primercarries an IRD800 fluorescent label at its 5’ end (MWG-Biotech, Ebersberg, Germany).

451 Final content of the first strand reaction was 20 mM Tris-HCl pH 8.4, 50 mM KCl, 2.5 mM , MgSO4 10mM DTT, 400µM of each of the four dNTPs, 4µg RNA, and 200 units of SSII-RT. Extension was terminated by incubating the reaction at 70°C for 15 min, and RNA was removed by incubating at 37°C for 30 min in presence of 1µg RNase A. To remove proteins, the final volume was increased to 200 µl with water, and a singlephenol:chloroform extraction was performed followed by an ethanol precipitation. The pellet was dissolved in 5µl buffer (95% deionized formamide, and 10 mM EDTA).

In parallel, we sequenced a 389 bp amplicon extracted from 1% agarose gel with QIAgene kit (QIAgen, Mississauga, Canada). Template was genomic DNA (50 fmoles) from the ecotype Columbia, and the PCR was accomplished in standard conditions using primers AtPMS1FED2 (5’-GCGAATAGCTTTACGTTTCCACTTA-3’) and AtPMS9R. Template was prepared as specified by themanufacturer, and sequencing was performed with ThermoSequenase (Amersham Biosciences, Piscataway, USA), in presence of IDRDye 800 terminator pre-mixes (LI-COR, Lincoln, USA). We denatured 2.5 µl of the primer extension reaction for 3 min at 75 °C, and then added 1 µl of LI-COR sequencing stop solution. We then applied 0.8µl of each sequencing reaction to a 5.5% polyacrylamide-urea gel for co-migration with the extension reaction. The gel was run under standard electrophoresis conditions in a LI-COR IR2 DNA-analyzer, and data processed with the E-seq software supplied by the company. The positions of the primers used in this step are indicated in Fig. 1B. 2.9. Phylogenetic and homology analysis

We used BLASTp to search various protein databases for sequences with strong homology to the deduced amino acid sequence of our cDNA clone. Phylogenetic analysis was accomplished by removing the regions with the lowest shared homology between species. Sequence alignment was performed for each subclass of genes (mutL,PMS1,MLH1and MLH3) using ClustalX [24]. Because of their low homology, two other homologs of the mutLgene (HsPMS1,ScMLH2) were first aligned manually. Within each subclass, we used the program Gblocks [25] to remove the ill-conserved segments and gaps in each alignment. Retained blocks for each subclass were completely re-aligned in ClustalX, and the bootstraps and the distances were thereafter generated with the same program using the Neighbor-Joining method [26]. A phylogenetic tree was drawn with the NJ-Plot program [27]. The sequence referred to here asAtMLH3(GenBank accession no. Atg35520) has been previously reported as AtMLHx [9]. In addition, we searched the Plant Genome Database (http://www.plantgdb.org/cgi-bin/PlantGDBblast) for orthologs of the yeast PMS1gene, in all available plant EST and short genomic DNA sequences. These plants orthologs were then aligned as above described,

6

452 A.H. Alou et al. / Plant Science 167 (2004) 447-456

and homology matrices were generated using the computer program MacBoxshade.

suggested that this gene was present in a single copy in theArabidopsis genome. We confirmed this by Southern analysis by digesting genomic DNA from Columbia and Landsbergerecta ecotypes with EcoRI, HindIII, KpnI, and SacI

3. Results 3.1.Structural characterization of AtPMS1 At the time this work was undertaken, no genomic orcDNA clone homologous to PMS1was available in Arabidopsis. We therefore designed degenerate oligonucleotide primers based on conserved domains(AVKELVENS, GFRGEALSS) found in the N-terminal region of various homologs of the E. coli mutLgene. A single strong band (~320 bp) was observed following amplification of genomic DNA (Landsberg erectaecotype). This product was digested with SalI and BglII, two restriction sites that hadbeen included in the degenerate primers to facilitate thecloning process. Most of the clones sequenced contained aPCR product derived from the AtMLH1gene as previouslydescribed [9], but some revealed a 283 bp SalI-BglII fragment that was found to be highly homologous to eukaryoticmutLhomologs of the yeast PMS1 type. Soon afterwards, aGeneBank search revealed that the Arabidopsis Genome Initiative had sequenced the entire genomic region containingthis gene on BAC T14P8 (a region of chromosome IV that was among the first to be sequenced). Sequence searches

(Fig. 3). All the bands observed are those predicted based on the restriction map of this portion of BAC clone T14P8. The sequence of a full-length cDNA was predicted based on the genomic sequence and four primers (AtPMS1-1, AtPMS1-2, AtPMS2-1, and AtPMS2-2; positions shown in Fig. 1A) spanning the entire coding region were designed and used to screen cDNA libraries obtained from the ABRC. Of several candidate clones, we fully sequenced the longest and its sequence was deposited in GenBank under accession number AY047288. Analysis of this 3023 bp cDNA sequence revealed a 2772 bp ORF preceded by 155 bp upstream of the putative ATG, and followed by 96 bp of downstream sequence. This sequence did not contain a poly (A)+ tail. Alignment of the genomic sequence from GeneBank and our sequenced cDNA showed the presence of 10 introns ranging in size from 75 bp to 362 bp (Fig. 1A) and making up about 34% of the genomic sequence. Interestingly, gene-prediction algorithms initially had provided an incorrect description of the protein coding sequence. It is only upon reporting the sequence of our cDNA that this situation was corrected to more accurately reflect the structure of the gene.

3.2.Mapping the transcription start site

As no canonical promoter constituents were found immediately upstream of the 5_ -terminus of our cDNA, we performed 5_ -RACE and primer extension experiments to more precisely determine the transcription start site ofAtPMS1. The nested amplifications yielded a major 650 bp product and two minor products of 200 and 300 bp which would place the transcription initiation site within the ORF. Sequencing of the 650 bp amplicon positioned the start site anadditional 51 bp upstream of the 5_ end of the isolated cDNAclone, at position -206 bp from the putative ATG (Fig. 1B). Asa complementary test, we performed a primer extensionreaction using a labeled primer (AtPMS9R). The primer wasselected to be very close to the 5_ end of the isolated cDNA(only 33 bp from that extremity). However, this extensionreaction yielded a major band whose 5_ end was only six nucleotides upstream to the 5_ -end of the cDNA clone. Usingthese two techniques, two different positions for the transcription start were obtained: one at position -206 and theother at -161 (Fig. 1B).

3.3.Expression analysis

Fig. 3. Southern analysis of AtPMS1gene. Genomic DNA from Landsbergerecta(L) and Columbia (C) was digested with the restriction enzymes EcoRI,HindIII, KpnI, and SacI and fractionated on 1% agarose. Restriction fragments were detected with α32P-labeled probe prepared using the full-length cDNA clone. Molecular size (in bp) of the bands from the standard marker (1 Kb;Invitrogen, Carslbad, USA) is shown to the left.

To study the expression of AtPMS1,we performed

both northern and RT-PCR analyses. For the northernanalysis, poly (A)+ RNA was prepared from young seedlings,mature leaves as well as from a cell suspension culture. Uponprobing with the full-length cDNA, the AtPMS1 mRNA was

7

A.H. Alou et al. / Plant Science 167 (2004) 447-456 453

dicted peptide sequence. To determine whether these twoclones correspond to bona fidetranscripts actually present in planta,RT-PCR analysis was performed. Amplification with primers AtPMS1RED2 and AtPMS10F is expected to yield amplicons of 208, 271, and 561 bp for the AY047288 cDNA, the AK117777 cDNA, and genomic DNA, respectively (Fig. 2A). As can be seen in Fig. 2B, in all tissues examined, the most abundant form is the completely spliced mRNA corresponding to AY047288. Since we could not see the partially spliced variant in all tissues (it was only visible in seedlings and roots), we performed a Southern analysis of the RT-PCR products using as probe a 30 nt oligonucleotide contained within the unspliced sequence of intron 6 (Fig. 2A). This hybridization revealed the presence of the variant in all tissues tested (data not shown).

3.5.Phylogenetic relationships to other MutL proteins

We used BLASTp to search various protein databasesFig. 4. Analysis of the expression of the AtPMS1 gene. (A) Northern for full length sequences with strong homology to the de-hybridization conducted on 3µg of poly (A)+ RNA isolated from a cell duced amino acid sequence of our cDNA clone. This searchsuspension (CS), seedlings (S), or mature leaves (ML) using the full revealed the strongest homology scores with peptide se-length cDNA as probe. The arrow points to the revealed mRNA and its

quences previously identified as homologs of MutL in differ-size. B) RT-PCR done on total RNA isolated from mature leaves (ML)as described in the text. Molecular size (in bp) of the standard marker(1Kb; Invitrogen, Carslbad, USA) is displayed on the right. detected only in the lane containing RNA from the culturedcells (Fig. 4A). Upon prolonged exposure (7 days), a faintsignal was also detected in the RNA extracted from youngseedlings but not from mature leaves (data not shown). In all cases, however, the mRNA detected is of the predicted size (~3 kb). To further test whether AtPMS1expression is detectable in mature leaves, we performed RT-PCR on total RNA frommature leaves. As shown in Fig. 4B, a product of the expectedsize was indeed detected suggesting that AtPMS1is expressed in mature leaves, although at such a low level that it could notbe detected in a northern analysis using 3µg of poly (A)+ RNA. 3.4.Alternate splicing of the AtPMS1 gene In addition to the cDNA clone reported above(GenBank accession no. AY047288), the sequence of anotherAtPMS1 cDNA (GenBank accession no. AK117777) is alsoreported in GeneBank (as of December 2002). Strangely, wefound important discrepancies in the sizes of the ORFs andpredicted peptides based on these two sequences. Beyond a relatively minor difference (codon S288 is missing in the predicted peptide sequence of GenBank accession no.AK117777), AK117777 differs markedly from AY047288 in the splicing of introns 6 and 8. The former is apparentlyincompletely spliced resulting in the presence of 63 bp of this intron in which a premature stop (at codon 734) is found (Fig. 2A). Lastly, the entire intron 8 remained unspliced inAK117777, generating an additional stop codon in the pre-

ent species. To investigate the relationships between varioushomologs of MutL, we assembled a phylogenetic tree using the conserved portions in the N-terminal and C-terminal region of each protein. The species included in this phylogenic analysis are shown in Fig. 5. The tree displays two distinct branches that separate the eukaryotic and the prokaryotic peptides with the latter serving as outgroup to the former. Within the eukaryotic peptides, two distinct branches diverged from an ancestral sequence (Fig. 5). One branch leads to the MLH1 subclass, and the other branch leads to the differentiation of three subclasses: MLH2, MLH3 andPMS1 (based on the yeast nomenclature). Within each subclass, the majority of the sequences encode about the same number ofamino acid. That is is ~600 aa for the MutL subclass, ~700 aa for the MLH1 subclass, ~900 aa for the PMS subclass, and ~1000 aa for the MLH3 subclass. This phylogenetic tree clearly supports the hypothesis that AtPMS1 is an ortholog of the yeast PMS1 and the mammalian PMS2 proteins. 3.6.Plant homologs of AtPMS1 In addition to the two Arabidopsis cDNAs described previously, we found a complete but unannotated genomicsequence of rice that is homologous to AtPMS1(Oryza sativa,GeneBank accession no. AP005874). Additionally, we foundmany ESTs or genomic sequences that are homologous toAtPMS1in Hordeum vulgare(GenBank accession nos. BJ483567 and BQ470381), Triticum aestivum(GenBank accession nos. BE416542 and BE443951), Glycine max (GenBank accession no. BI945219), Sorghum propinquum (GenBank accession nos. BG050038 and BG049799), Lycopersicon esculentum(GenBank accession no. BI933338), and Zea mays(GenBank accession no. BZ653983).

8

454 A.H. Alou et al. / Plant Science 167 (2004) 447-456

Table 1 Percent identity and similarity values for amino acid residues of homologs of the AtPMS1 protein in plants

%Identity/% Similarity HvPMS1 TaPMS1 OsPMS1 GmPMS1 AtPMS1 AtMLH1

HvPMS1 100.0 93.6 76.1 76.8 33.3TaPMS1 98.2 93.6 76.1 76.8 33.3OsPMS1 88.2 88.2 75.2 75.9

32.5GmPMS1 66.4 66.4 65.5 81.4

29.2AtPMS1 66.1 66.1 65.2 66.429.2AtMLH1 22.5 21.7 24.2 21.7 19.2

Alignment was based on conserved residues in the C-terminal portion of the proteins (corresponding to residues 797 to 907 of A. thalianasequence). The alignment was made with the pileup program of the GCG-package (Wisconsin). Species used were barley (Hordeum vulgare,accession nos. BJ483567 and BQ470381), wheat (Triticum aestivum,accession nos. BE416542 and BE443951), rice (Oryza sativa,accession no. AP005874), soybean (Glycine max, accession no. BI945219), andArabidopsis thaliana(AtPMS1, accession no. AAL01156; AtMLH1, accession no. AJ012747). The matrix table was generated with the MacBoxshade software.

Many of these DNA sequences were incomplete however andlimited to either the N-terminal or the C-terminal regions. For the ensuing analyses, we used only species for which the C-terminal sequence was available, since this region is characteristic of the orthologs of AtPMS1. Our results (Table 1) showed that the plant orthologs of the AtPMS1 protein shared a high percent amino acid identity (65.2% to 98.2%), and even higher percent amino acid similarity (75.2%to 100%). By contrast, the same C-terminal region of AtMLH1 presented a very low amino acid homology relative to its paralog, AtPMS1 (<20%), and to the other plant PMS1 proteins (Table 1).

4. Discussion

Despite the fact that the study of mismatch repair in plants is still in its infancy, it is apparent that plants share with other eukaryotes a sophisticated mismatch repair system whichrelies on the interaction of numerous and functionally specializedhomologs of the Escherichia coli mutSand mutL genes. Having previously reported the cloning of four mutS homologs [7] and onemutLhomolog [9], we extend these findings by reporting here on the structure and expression of the first plant homolog of theSaccharomyces cerevisiae PMS1gene.

We named this gene AtPMS1 based on the size of the deduced peptide sequence and the extent of homology with the Fig. 5. Phylogenetic analysis of MutL homologs. Subfamilies of MutL

homologs involved in eukaryotic MMR are identified on the right, and the three homologs of MutL found in Arabidopsis are shaded. The tree was constructed using the NJPlot program (Perriere and Gouy, 1996). The scale of the phylogenetic distance is displayed on the top, and numbers represent bootstrap values. Species, gene, and GenBank accession number were: Arabidopsis thaliana(PMS1: AAL01156; MLH1: AJ012747; MLH3: NP 195277), Bacillus subtilis(mutL: P49850), Caenorhabditis elegans(PMS2: CAA98478), Drosophila melanogaster(PMS2: AAL39978; MLH1: NM 057674), Escherichia coli(mutL: P23367), Haemophilus influenzae(mutL: P44494), Homo sapiens(PMS1: P54277;PMS2: P54278; MLH1: P40692; MLH3: Q9UHC1), Mus musculus(PMS2: P54279), Rattus norvegicus(MLH1: P97679), Saccharomyces cerevisiae(PMS1:P14242; MLH1: P38920; MLH2: NP 013135; MLH3: NP 015161), Salmonella typhimurium(mutL: AAL23179).

eukaryotic homologs of MutL. Phylogenetic studies acrosskingdoms and species revealed that the eukaryotic homologs of the E coliMutL protein can be grouped into distinct subfamilies (Fig. 5). Whereas four paralogs (MLH1, MLH2, MLH3 and PMS1) are present in the yeast Saccharomyces cerevisiaeand in humans, only three (MLH1, MLH3 and PMS1) were found in the two plant genomes that are entirely sequenced (Arabidopsis and rice). Lengthwise, AtPMS1 is similar in size to other members of the PMS subclass (~900 aa), whereas the average size of theparalogs MLH1 and MLH3 is around 700 aa or 1000 aa residues, respectively. A comparison of amino acid sequences shows that

9

A.H. Alou et al. / Plant Science 167 (2004) 447-456 455 be 6 tpm. This is the equivalent of detecting only 6 pg of aspecific mRNA per 1 g of polyA+ RNA, again showing that this gene is weakly expressed. Transcript abundance in some of the tissues sampled was as follows: 0, 2, 4, 8, 17,and 22 tpm for leaves, callus, silique, flower bud (AP1), flowers, and roots respectively. An equivalent analysis of AtMLH1 revealed an average abundance of 17 tpm, i.e. about three times that of theAtPMS1gene. It is tempting to speculate that this difference arises from the ubiquitous nature of the AtMLH1 protein in all heterodimers of the MutL class whereas the AtPMS1 protein is required only in one such heterodimer (AtMLH1/AtPMS1).Finally, despite the tremendous resources available inArabidopsis, in the absence of an experimentally-derived full-length cDNA (and confirmatory work), gene structure prediction algorithms alone can incorrectly predict the coding sequence of a specific gene. Therefore, a detailed characterization of gene structure and expression remain a necessary and useful contribution to the proper characterization of the Arabidopsisgenome. Acknowledgements A.H. Alou was supported by a graduate fellowship from the "Programme Canadien de Bourses de la Francophonie". This work was supported by a research grant from the Natural Sciencesand Engineering Research Council of Canada to F.J. Belzile.

[1] M. Strand, T.A. Prolla, R.M. Liskay, T.D. Petes, Destabilization of tracts of

simple repetitive DNA in yeast by mutations affecting DNA mismatch repair, Nature 365 (1993) 274-276.

[2] P. Modrich, Mechanisms and biological effects of mismatch repair, Annu. Rev.

Genet. 25 (1991) 229-253. [3] B.D. Harfe, S. Jinks-Robertson, DNA mismatch repair and genetic instability,

Annu. Rev. Genet. 34 (2000a) 359-399. [4] A. Sancar, J.E. Hearst, Molecular matchmakers, Science 259 (1993) 1415-1420. [5] C. Ban, M. Junop, W. Yang, Transformation of MutL by ATP binding and

hydrolysis: a switch in DNA mismatch repair, Cell 97 (1999) [6] K.M. Culligan, J.B. Hays, DNA mismatch repair in plants. An Ara bidopsis

thalianagene that predicts a protein belonging to the MSH2 subfamily of eukaryotic MutS homologs, Plant Physiol. 115 (1997) 833-839

[7] J. Ade, F. Belzile, H. Philippe, M.P. Doutriaux, Four mismatch re pair

paralogues coexist in Arabidopsis thaliana:AtMSH2, AtMSH3, AtMSH6-1 and AtMSH6-2, Mol. Gen. Genet. 262 (1999) 239-249.

[8] K.M. Culligan, J.B. Hays, Arabidopsis MutS homologs-AtMSH2, AtMSH3,

AtMSH6, and a novel AtMSH7-form three distinct proteinheterodimers withdifferent specificities for mismatched DNA, Plant Cell 12 (2000) 991-1002.

[9] M. Jean, J. Pelletier, M. Hilpert, F. Belzile, R. Kunze, Isolation and

characterization of AtMLH1, a MutL homologue from Arabidopsis thaliana, Mol. Gen. Genet. 262 (1999) 633-642.

.

As a complement to our own northern analysis and to get anoverall expression profile of the AtPMS1gene in various planttissues (leaves, callus, flower bud (AP1), flowers, roots, siliques etc.), we consulted the Arabidopsis MPSS (Massively ParallelSignature Sequencing) database(http://mpss.udel.edu/). This method yields an absolute measure of transcript abundance,expressed in parts per mil lion (tpm), by tallying the number ofoccurrences of a short(17or 20 pb ), gene-specific signaturesequences [35,36] A single signature sequence from theAtPMS1gene, lo cated at 106 bp downstream of the putativestop codon, was found and the average transcript abundance(averaged over 14libraries and over 37 million cDNAs) wasestimated to

AtPMS1 shares much higher identity with other members of thePMS subclass of MutL homologs than with any other group ofhomologs. For example, among plant homologs, amino acididentity in the C-terminal portion of AtPMS1 is much greaterwith the orthologous PMS1 proteins in other species (averaging~66%) than with the paralogous Arabidopsis thalianaMLH1protein (19.2%) (Table 1). From a functional standpoint, MMR proteins play avital role by maintaining genome integrity and stability. In spiteof this, these key molecules are weakly expressed as shownpreviously for MutShomologs in Arabidopsis and maize [7,28],and for AtMLH1[9]. Many lines of evidence suggest that thesame is true for AtPMS1.Indeed, we were able to detectexpression of the AtPMS1messenger by northern analysis onlywhen using poly (A)+ RNA from a cell suspension culture orfrom young seedlings (upon a lengthy exposure). This low levelof transcript abundance may be a consequence of thecomposition of the AtPMS1promoter. As shown in the 5_ -RACE and primer extension experiments, transcription of thisgene appears to initiate at more than one site. Searchingupstream of these putative start sites, we were unable to identifya convincing TATAA motif within 200 bp of these sites.Together, these data suggest that AtPMS1may have a so-called"TATA-less promoter". These are known to be weaklyexpressed and often lead to imprecise transcription initiation[29-31] such as was documented here. Intriguingly, two alternate forms of theAtPMS1messenger apparently coexist in many plant tissues.While both transcripts are over 3 Kb in size, the sizes of theirpredicted ORFs differ greatly. As detailed above, one form ofthe transcript would lead to a protein isoform lacking 189 aminoacid residues in the functionally important C-terminal region ofthe protein. As all orthologs of the yeast PMS1 proteinReferences reported to date encode proteins of about 900 aminoacids, it remains questionable whether such a truncated versionof the yeast PMS1 protein reported to date encode proteins ofabout 900 amine acids, it remain questionable whether suchtruncated version of the protein can properly fold and interactwith other MMR proteins. Indeed, the highly conserved motif inthe C-terminal region has been shown to be essential for protein-protein interaction [32-34]. It seems highly likely that such avariant form of protein, should it be produced, would not con-tribute to MMR function. Whether this variant transcript is"accidental" or has some functional significance remainsunclear.

References

10

456 A.H. Alou et al. / Plant Science 167 (2004) 447-456

[10] H. Flores-Rozas, R.D. Kolodner, The Saccharomyces cerevisiae MLH3 gene functions in MSH3-dependent suppression of frameshift mutations, Proc. Natl.Acad. Sci. U.S.A. 95 (1998) 12404-12409.

[11] T.F. Wang, N. Kleckner, N. Hunter, Functional specificity of MutL homologs

in yeast: evidence for three MLH1-based heterocomplexes with distinct roles during meiosis in recombination and mismatch correction, Proc. Natl. Acad.Sci. U.S.A. 96 (1999) 13914-13919.

[12] T.A. Prolla, D.M. Christie, R.M. Liskay, Dual requirement in yeast DNA

mismatch repair MLH1 and PMS1, two homologs of the bacterial mutLgene, Mol. Cell Biol. 14 (1994a) 407-415.

[13] T.A. Prolla, Q. Pang, E. Alani, R.D. Kolodner, R.M. Liskay, MLH1, PMS1,

and MSH2 interaction during the initiation of DNA mismatch repair in yeast, Science 265 (1994) 1091-1093.

[14] L. Galio, C. Bouquet, P. Brooks, ATP hydrolysis-dependent formation

of a dynamic ternary nucleoprotein complex with MutS and MutL, gene Nucl. Acids Res. 27 (1999) 2325-2331.

[15] T.H. Wu, M.G. Marinus, Deletion mutation analysis of the mutS in Escherichia

coli,J. Biol. Chem. 274 (1999) 5948-5952. [16] C.W. Yang, ATPase activity of MutL: implications for DNA repair and

mutagenesis, Cell 95 (1998) 541-552. [17] C. Ban, W. Yang, Structural basis for MutH activation in E. coli mismatch

repair and relationship of MutH to restriction endonucleases EMBO J. 17 (1998) 1526-1534.

[18] M.C. Hall, S.W. Matson, The Escherichia coli MutL protein physically

interacts with MutH and stimulates the MutH-associated en activity, J. Biol.Chem. 274 (1999) 1306-1312.

[19] V. Dao, P. Modrich, Mismatch-, MutS-, MutL-, and helicase II-dependent

unwinding from the single-strand break of an incised heteroduplex, J. Biol. Chem. 273 (1998) 9202-9207.

[20] M.C. Hall, J.R. Jordan, S.W. Matson, Evidence for a physical interaction

between the Escherichia coli methyl-directed mismatch repair proteins MutL and UvrD, EMBO J. 17 (1998) 1535-1541.

[21] M. Yamaguchi, V. Dao, P. Modrich, MutS and MutL activate DNA helicase II

in a mismatch-dependent manner, J. Biol. Chem. 273 (1998) 9197-9201. [22] P. Dubois, S. Cutler, F.J. Belzile, Regional insertional mutagenesis on

chromosome III of Arabidopsis thalianausing the maize Ac element, Plant J. 13 (1998) 141-151.

[23] T.C. Verwoerd, B.M. Dekker, A. Hoekema, A small-scale procedure for the

rapid isolation of plant RNAs, Nucl. Acids Res. 17 (1989) 2362. [24] J.D. Thompson, T.J. Gibson, F. Plewniak, F. Jeanmougin, D.G. Higgins, The

CLUSTAL X windows interface: flexible strategies for multiple sequencealignment aided by quality analysis tools, Nucl Acids Res. 25 (1997) 4876-4882.

[25] J. Castresana, Selection of conserved blocks from multiple alignments fortheir use in phylogenetic analysis, Mol. Biol. Evol. 17 (2000) 540-552.

[26] N. Saitou, M. Nei, The neighbor-joining method: a new method for

reconstructing phylogenetic trees, Mol. Biol. Evol. 4 (1987) 406-425. [27] G. Perriere, M. Gouy, WWW-query: an on-line retrieval system for

biological sequence banks, Biochimie 78 (1996) 364-369. [28] M. Horwath, W. Kramer, R. Kunze, Structure and expression of the Zea

maysmutS-homologs Mus1 and Mus2, Theor. Appl. Genet. 105 (2002)423-430.

[29] L. Weis, D. Reinberg, Transcription by RNA polymerase II: initiator-

directed formation of transcription-competent complexes, FASEB J. 6(1992) 3300-3309.

[30] S.T. Smale, Core promoters: active contributors to combinatorial gene

regulation, Genes Dev. 15 (2001) 2503-2508. [31] J.E. Butler, J.T. Kadonaga, The RNA polymerase II core promoter: a key

component in the regulation of gene expression, Genes Dev. 16(2002)2583-2592.

[32] Q. Pang, T.A. Prolla, R.M. Liskay, Functional domains of the Saccha

romyces cerevisiaeMLH1p and PMS1p DNA mismatch repair proteins andtheir relevance to human hereditary nonpolyposis colorectal cancer-associated mutations, Mol. Cell Biol. 17 (1997) 4465-4473.

[33] S. Guerrette, S. Acharya, R. Fishel, The interaction of the human MutL

homologues in hereditary nonpolyposis colon cancer, J. Biol. Chem. 274(1999) 6336-6341.

[34] E. Kondo, A. Horii, S. Fukushige, The interacting domains of three MutL

heterodimers in man: hMLH1 interacts with 36 homologous amino acidresidues within hMLH3, hPMS1 and hPMS2, Nucl. Acids Res. 29 (2001)1695-1702.

[35] S. Brenner, M. Johnson, J. Bridgham, G. Golda, D.H. Lloyd, D. Johnson, S.

Luo, S. McCurdy, M. Foy, M. Ewan, R. Roth, D. George, S. Eletr, G.Albrecht, E. Vermaas, S.R. Williams, K. Moon, T. Burcham, M. Pallas,R.B. DuBridge, J. Kirchner, K. Fearon, J. Mao, K. Corcoran, Geneexpression analysis by massively parallel signature sequencing (MPSS) onmicrobead arrays, Nat. Biotechnol. 18 (2000) 630-634.

[36] S. Brenner, S.R. Williams, E.H. Vermaas, T. Storck, K. Moon, C.

McCollum, J.I. Mao, S. Luo, J.J. Kirchner, S. Eletr, R.B. DuBridge, T.Burcham, G. Albrecht, In vitro cloning of complex mixtures of DNA onmicrobeads: physical separation of differentially expressed cDNAs, Proc.Natl. Acad. Sci. U.S.A. 97 (2000) 1665-1670.