Université de Montréal

Implication des peptides RALFs dans les communications

cellulaires lors du développement du gamétophyte femelle

chez Solanum chacoense et Arabidopsis thaliana

par

Eric Chevalier

Département des Sciences Biologiques, Institut de Recherche en Biologie Végétale (IRBV)

Faculté des Arts et des Sciences

Thèse présentée à la Faculté des Arts et des Sciences

en vue de l’obtention du grade de Philosophiæ doctor (Ph. D.)

en Sciences Biologiques

Août, 2012

© Eric Chevalier, 2012

Université de Montréal

Faculté des études supérieures et postdoctorales

Cette thèse intitulée:

Implication des peptides RALFs dans les communications cellulaires lors du

développement du gamétophyte femelle chez Solanum chacoense et Arabidopsis thaliana

Présentée par :

Eric Chevalier

a été évaluée par un jury composé des personnes suivantes :

Jean Rivoal, président-rapporteur

Daniel P. Matton, directeur de recherche

Mohamed Hijri, membre du jury

C. Peter Constabel, examinateur externe

Daniel Pérusse, représentant du doyen de la FES

i

Résumé

Chez les angiospermes, la reproduction passe par la double fécondation. Le tube

pollinique délivre deux cellules spermatiques au sein du gamétophyte femelle. Une cellule

féconde la cellule œuf pour produire un zygote; l’autre féconde la cellule centrale pour

produire l’endosperme. Pour assurer un succès reproductif, le développement du

gamétophyte femelle au sein de l’ovule doit établir un patron cellulaire qui favorise les

interactions avec le tube pollinique et les cellules spermatiques. Pour ce faire, un dialogue

doit s’établir entre les différentes cellules de l’ovule lors de son développement, de même

que lors de la fécondation. D’ailleurs, plusieurs types de communications intercellulaires

sont supposées suite à la caractérisation de plusieurs mutants développementaux. De

même, ces communications semblent persister au sein du zygote et de l’endosperme pour

permettre la formation d’un embryon viable au sein de la graine. Malgré les

développements récents qui ont permis de trouver des molécules de signalisation

supportant les modèles d’interactions cellulaires avancés par la communauté scientifique,

les voies de signalisation sont de loin très incomplètes.

Dans le but de caractériser des gènes encodant des protéines de signalisation

potentiellement impliqués dans la reproduction chez Solanum chacoense, l’analyse

d’expression des gènes de type RALF présents dans une banque d’ESTs (Expressed

Sequence Tags) spécifiques à l’ovule après fécondation a été entreprise. RALF, Rapid

Alcalinization Factor, est un peptide de 5 kDa qui fait partie de la superfamille des

«protéines riches en cystéines (CRPs)», dont les rôles physiologiques au sein de la plante

sont multiples. Cette analyse d’expression a conduit à une analyse approfondie de

ScRALF3, dont l’expression au sein de la plante se limite essentiellement à l’ovule.

L’analyse de plantes transgéniques d’interférence pour le gène ScRALF3 a révélé un rôle

particulier lors de la mégagamétogénèse. Les plantes transgéniques présentent des

divisions mitotiques anormales qui empêchent le développement complet du sac

embryonnaire. Le positionnement des noyaux, de même que la synchronisation des

ii

divisions au sein du syncytium, semblent responsables de cette perte de progression lors

de la mégagamétogénèse. L’isolement du promoteur de même que l’analyse plus précise

d’expression au sein de l’ovule révèle une localisation sporophytique du transcrit. La voie

de signalisation de l’auxine régule également la transcription de ScRALF3. De surcroît,

ScRALF3 est un peptide empruntant la voie de sécrétion médiée par le réticulum

endoplasmique et l’appareil de Golgi. En somme, ScRALF3 est un important facteur

facilitant la communication entre le sporophyte et le gamétophyte pour amener à

maturité le sac embryonnaire. L’identification d’un orthologue potentiel chez Arabidopsis

thaliana a conduit à la caractérisation de AtRALF34. L’absence de phénotype lors du

développement du sac embryonnaire suggère, cependant, de la redondance génétique au

sein de la grande famille des gènes de type RALF. Néanmoins, les peptides RALFs

apparaissent comme d’importants régulateurs lors de la reproduction chez Solanum

chacoense et Arabidopsis thaliana.

Mots-clés : Communication Cellulaire, Signalisation, Rapid Alcalinization Factor, Ovule, Sac

Embryonnaire, Mégagamétogénèse, Peptides, Sporophyte, Gamétophyte

iii

Abstract

In angiosperms, reproduction occurs through double fertilization. The pollen tube

delivers two sperm cells into the female gametophyte. A first sperm cell fertilizes the egg

cell to produce a zygote, while the other fertilizes the central cell to produce the

endosperm. To ensure reproductive success, the development of the female gametophyte

within the ovule must establish a cellular pattern allowing interaction with the pollen tube

and sperm cells. To this end, a dialogue must be established amongst the various cells of

the ovule during its development, as well as during fertilization. Several types of

communication are suggested by the analysis of developmental mutants. These

communications must persist in the zygote and endosperm to allow the formation of a

viable embryo within the seed. Recent developments have helped to find signaling

molecules that support cell interaction models developed by the scientific community, but

the signaling pathways are far from complete.

In order to characterise genes encoding signaling proteins which are potentially

active during reproduction in Solanum chacoense, I undertook the expression analysis of

the RALF-like genes present in a bank of ESTs (Expressed Sequence Tags) specific to the

ovule after fertilization. RALF, Rapid Alcalinization Factor, is a 5 kDa peptide that is part of

the superfamily of Cysteine Rich Proteins (CRPs), which play a wide variety physiological

roles within the plant. This expression analysis led to a detailed analysis of ScRALF3, whose

expression in the plant is largely restricted to the ovule. The analysis of ScRALF3 RNAi

transgenic plants revealed a function during megagametogenesis. The transgenic plants

exhibit abnormal mitotic divisions that prevent the maturity of the embryo sac. The

positioning of the nuclei, as well as the timing of divisions in the syncytium, appear to be

responsible for the arrest of development during megagametogenesis. Isolation of the

promoter as well as more accurate analysis of transcript expression reveals localisation

within the ovule sporophytic tissue. The auxin signaling pathway is also involved in the

regulation of ScRALF3 expression. ScRALF3 is a secreted peptide passing via the

iv

endoplasmic reticulum and the Golgi apparatus. In summary, ScRALF3 may be an

important factor facilitating communication between the gametophyte and the

sporophyte to allow maturation of the embryo sac. The identification of a potential

orthologue in Arabidopsis thaliana led to the characterisation of AtRALF34. The lack of a

phenotype during embryo sac development, however, suggests that genetic redundancy

within the family of RALF-like genes is very complex. Nevertheless, the RALF peptides

appear to be important regulators during reproduction in Solanum chacoense and

Arabidopsis thaliana.

Keywords : Cell-cell communication, Signalling, Rapid Alcalinization Factor, Ovule, Embryo

Sac, Peptides, Sporophyte, Gametophyte

v

Table des matières

RÉSUMÉ ........................................................................................................................................................ I

ABSTRACT ................................................................................................................................................... III

TABLE DES MATIÈRES .................................................................................................................................. V

LISTE DES TABLEAUX ................................................................................................................................ VIII

LISTE DES FIGURES ...................................................................................................................................... IX

LISTE DES ABBRÉVIATIONS .......................................................................................................................... XI

REMERCIEMENTS ................................................................................................................................... XVIII

1. INTRODUCTION ...................................................................................................................................... 20

1.1 Les communications cellule-cellule et les voies de signalisation au sein de l’ovule : de sa conception

à la double fécondation ........................................................................................................................... 20 1.1.1 Sommaire .................................................................................................................................................... 20

1.2 Cell-cell communication and signalling pathways within the ovule: from its inception to fertilization

................................................................................................................................................................. 21 1.2.1 Apport original ............................................................................................................................................ 21 1.2.2 Summary ..................................................................................................................................................... 22 1.2.3 Introduction ................................................................................................................................................ 22 1.2.4 Signal transduction during ovule and embryo sac development ................................................................ 24

Inter-cell-layer communication required for the initiation of the integuments ........................................ 26 Embryo sac development (Polygonum-type) ............................................................................................ 27 Is lateral inhibition involved in germline establishment? .......................................................................... 28 Phosphorylation cascades during megagametogenesis ............................................................................ 31 Cell fate specification ................................................................................................................................ 34 Cell-cell communication between the sporophyte and the female gametophyte .................................... 38

1.2.5 Signalling during double fertilization .......................................................................................................... 40 Involvement of the synergids and central cell in PT attraction ................................................................. 40 Signalling proteins involved in PT attraction ............................................................................................. 42 Synergid-pollen tube interaction ............................................................................................................... 43 Cell-cell communication within the female gametophyte ........................................................................ 47 Interaction between the male and the female gametes ........................................................................... 50 Male cytoplasmic RNA transfer during fertilization .................................................................................. 51

1.2.6 Conclusion ................................................................................................................................................... 52 1.2.7 Acknowledgements ..................................................................................................................................... 53

1.3 RALF, un peptide potentiel dans les communications cellulaires lors de la reproduction .................. 53 1.3.1 Diversité des gènes de type RALF et implication lors de la reproduction ................................................... 53 1.3.2 Régulation transcriptomique, post-traductionnelle et voie de signalisation .............................................. 57

vi

1.3.3 RALF et la reproduction : un projet de doctorat ......................................................................................... 59

2. CINQ GÈNES DE TYPE RALF CHEZ SOLANUM CHACOENSE ....................................................................... 61

2.1 La Caractérisation de cinq gènes de type RALF chez Solanum chacoense appuie un rôle dans le

développement ........................................................................................................................................ 61 2.1.1 Préambule ................................................................................................................................................... 61 2.1.2 Sommaire .................................................................................................................................................... 61

2.2 Characterization of five RALF-like genes from Solanum chacoense support a role in development . 62 2.2.1 Apport original ............................................................................................................................................ 62 2.2.2 Abstract ....................................................................................................................................................... 62 2.2.3 Introduction ................................................................................................................................................ 63 2.2.4 Materials and methods ............................................................................................................................... 65

cDNA library construction and sequence analysis ..................................................................................... 65 Phytohormone and wounding treatments ................................................................................................ 66 Isolation and gel blot analysis of RNA and DNA ........................................................................................ 67

2.2.5 Results ......................................................................................................................................................... 67 ScRALF isolation and sequence analysis .................................................................................................... 67 ScRALF1–5 are single-copy genes in S. chacoense ..................................................................................... 71 ScRALF1–5 mRNA expression in mature tissues ........................................................................................ 72 Is ScRALF expression modulated by wounding or growth regulator treatments? .................................... 73

2.2.6 Discussion ................................................................................................................................................... 76 2.2.7 Acknowledgements ..................................................................................................................................... 78

3. IMPLICATION DE SCRALF3 DANS LA REPRODUCTION ............................................................................. 79

3.1 Communication cellule-cellule entre le sporophyte et le gametophyte femelle via la sécrétion d’un

peptide RALF ............................................................................................................................................ 79 3.1.1 Préambule ................................................................................................................................................... 79 3.1.2 Sommaire .................................................................................................................................................... 79

3.2 Cell-Cell communication between the sporophyte and the female gametophyte through a secreted

RALF-like peptide ..................................................................................................................................... 80 3.2.1 Apport original ............................................................................................................................................ 80 3.2.2 Abstract ....................................................................................................................................................... 81 3.2.3 Introduction ................................................................................................................................................ 82 3.2.4 Experimental Procedures ............................................................................................................................ 86

Material ..................................................................................................................................................... 86 RNA extraction and Northern Hybridization ............................................................................................. 86 Hormone treatment .................................................................................................................................. 86 Genome Walking and allele isolation ........................................................................................................ 86 Plants Transformation and selection ......................................................................................................... 87 Ovules Clearing .......................................................................................................................................... 87 In situ hybridization ................................................................................................................................... 89 GUS staining .............................................................................................................................................. 89 Onion cell bombardment .......................................................................................................................... 89 Western blot ............................................................................................................................................. 89

3.2.5 Results ......................................................................................................................................................... 90

vii

ScRALF3 transcripts are induced during fruit initiation ............................................................................. 90 ScRALF3 promoter contains auxin regulatory elements............................................................................ 91 ScRALF3-silenced Solanum plants display a severe reduction in seed set ................................................. 94 Female gametophyte development is impaired in mutant ovules ............................................................ 98 The embryo sac of ScRALF3-silenced plants display abnormal nuclear distribution and asynchronous

nuclear divisions ...................................................................................................................................... 102 ScRALF3 is mostly expressed in the sporophytic tissue of the ovule ....................................................... 106 ScRALF3 is a secreted peptide ................................................................................................................. 109

3.2.6 Discussion ................................................................................................................................................. 111 3.2.7 Acknowledgements ................................................................................................................................... 115

4. IMPLICATION DES GÈNES ATRALF-LIKE LORS DE LA REPRODUCTION CHEZ ARABIDOPSIS THALIANA .... 116

4.0.1 Préambule ................................................................................................................................................. 116

4.1 Analyse fonctionnelle de l’orthologue potentiel de ScRALF3 chez Arabidopsis thaliana, AtRALF34 116 4.1.1 Identification de l’orthologue potentiel de ScRALF3, AtRALF34 ............................................................... 116 4.1.2 Expression de AtRALF34 lors du développement ..................................................................................... 121 4.1.3 Analyse de lignées mutantes pour le gène AtRALF34 ............................................................................... 125 4.1.4 AtRALF34 joue-t-il un rôle dans la reproduction? ..................................................................................... 126

4.2 Autres gènes de type RALF pouvant possiblement être impliqués dans la reproduction ................ 130 4.2.1 Plusieurs gènes de type RALF sont exprimés au niveau du carpelle ......................................................... 130 4.2.2 Candidats pouvant assurer une communication sporophytique-gamétophytique .................................. 133

5. DISCUSSION GÉNÉRALE ........................................................................................................................ 136

5.1 RALF comme projet de doctorat .................................................................................................................. 136 5.2 Les petits peptides sécrétés lors de la reproduction ................................................................................... 136 5.3 Le rôle des peptides RALFs dans l’organisation du sac embryonnaire ......................................................... 139 5.4 Contrôle de qualité dans le réticulum endoplasmique et la maturation peptidique ................................... 141 5.5 Interactions entre les phytohormones et les peptides sécrétés .................................................................. 145 5.6 La redondance fonctionnelle et les couples ligand-récepteur ..................................................................... 146

CONCLUSION ............................................................................................................................................ 149

BIBLIOGRAPHIE ........................................................................................................................................ 150

viii

Liste des tableaux

TABLE I LIST OF PRIMERS. ........................................................................................................................................ 88

TABLE II SELECTED REGULATORY ELEMENTS WITHIN THE SCRALF3 PROMOTER. ................................................................. 92

TABLE III UNMATURE EMBRYO SAC AT ANTHESIS IN DOWNREGULATED SCRALF3 PLANTS. ................................................... 98

TABLE IV MEGASPOROGENESIS AND MEGAGAMETOGENESIS IN WILD-TYPE (G4) AND MUTANT PLANTS (RNAI). ..................... 101

ix

Liste des figures

FIGURE 1 FLORAL STRUCTURES INVOLVED IN DOUBLE FERTILIZATION. .............................................................................. 23

FIGURE 2 OVULE AND FEMALE GAMETOPHYTE DEVELOPMENT ARE SYNCHRONIZED IN ARABIDOPSIS. ..................................... 25

FIGURE 3 INTER-CELL-LAYER SIGNALLING MEDIATED BY STRUBELLIG (SUB) AND QUIRKY (QKY) DURING OUTER INTEGUMENT

INITIATION. ................................................................................................................................................. 27

FIGURE 4 CELL-CELL COMMUNICATION WITHIN THE NUCELLUS IS INVOLVED IN THE ESTABLISHMENT OF THE GERMLINE. .............. 29

FIGURE 5 POSSIBLE SIGNALLING PATHWAYS INVOLVED IN MEGAGAMETOGENESIS. ............................................................... 33

FIGURE 6 CELL-CELL COMMUNICATION INVOLVED IN CELL FATE PATTERNING DURING EMBRYO SAC DEVELOPMENT. ................... 37

FIGURE 7 POSSIBLE MODELS OF CELL-CELL COMMUNICATION AND SIGNALLING DURING DOUBLE FERTILIZATION. ....................... 49

FIGURE 8 STRUCTURE DE LA PRÉPROPROTÉINE NTRALF................................................................................................. 54

FIGURE 9 MODÈLE DE VOIES DE SIGNALISATION POTENTIELLES POUR LES PEPTIDES RALF. .................................................... 60

FIGURE 10 SEQUENCE ALIGNMENT OF THE FIVE DEDUCED RAPID ALCALINIZATION FACTOR (RALF)-LIKE PROTEINS FROM SOLANUM

CHACOENSE (SCRALF1 TO 5) WITH THE ORIGINAL NICOTIANA TABACUM RALF (NTRALF). ........................................ 69

FIGURE 11 PHYLOGENETIC DISTANCE ANALYSIS (NEIGHBOR-JOINING) OF RALFS. ................................................................ 70

FIGURE 12 (A) DNA GEL BLOT ANALYSIS AND (B) RNA GEL BLOT ANALYSIS OF THE FIVE SCRALF GENES. ................................. 74

FIGURE 13 EFFECT OF WOUNDING AND VARIOUS STRESS-RELATED HORMONES ON MRNA LEVELS OF FOUR SCRALF IN (A) LEAF, (B)

STYLE AND (C) OVARY. ................................................................................................................................... 75

FIGURE 14 SCRALF3 IS AN AUXIN-RESPONSIVE GENE DURING FRUIT INITIATION. ................................................................ 91

FIGURE 15 DOWNREGULATION OF SCRALF3 BY RNAI CAUSES PRODUCTION OF SMALL FRUITS WITH FEWER SEEDS. .................. 95

FIGURE 16 SPECIFIC DOWNREGULATION OF SCRALF3 IN TRANSGENIC PLANTS. .................................................................. 96

FIGURE 17 DNA GEL BLOT ANALYSIS OF THE FOUR INDEPENDENT SCRALF3 TRANSGENIC LINES USED. .................................. 97

FIGURE 18 EMBRYO SAC DEVELOPMENT WITHIN THE WILD-TYPE (G4) SOLANUM CHACOENSE OVULES. ................................ 100

FIGURE 19 LOST OF EMBRYO SAC POLARIZATION IN MUTANT OVULES ASSOCIATED WITH A WIDE RANGE OF NUCLEI DISTRIBUTION.

............................................................................................................................................................... 104

FIGURE 20 ASYNCHRONOUS DIVISIONS WITHIN THE SYNCYTIUM OF MUTANT OVULES. ....................................................... 105

FIGURE 21 REGULATION OF SCRALF3 EXPRESSION WITHIN THE SPOROPHYTIC TISSUE DURING OVULE DEVELOPMENT. ............. 107

FIGURE 22 EXPRESSION OF SCRALF3 IN THE SPOROPHYTIC TISSUE OF THE OVULE AS REVEALED BY GUS STAINING. ................. 108

FIGURE 23 SCRALF3 PASS THROUGH THE SECRETORY PATHWAY IN ONION TRANSIENT EXPRESSION ASSAY. ............................ 109

FIGURE 24 SCRALF3 IS PROCESSED WITHIN THE SECRETORY PATHWAY IN S. CHACOENSE. .................................................. 110

FIGURE 25 ARBRE DE DISTANCE RÉALISÉ À PARTIR DE LA SÉQUENCE PEPTIDIQUE DE SCRALF3 ET LE PROGRAMME BLAST. ....... 118

FIGURE 26 PRÉDICTION DE MOTIFS AU SEIN DES PEPTIDES RALFS AVEC LE PROGRAMME MEME. ........................................ 119

FIGURE 27 SÉQUENCES DES MOTIFS RETROUVÉS AU SEIN DES PEPTIDES RALFS. ................................................................ 120

FIGURE 28 EXPRESSION DE ATRALF34 DANS DIFFÉRENTS TISSUS CHEZ ARABIDOPSIS THALIANA SELON LES RÉSULTATS DES

MICROPUCES À ADN PAR (A) TILLING OU (B) TRADITIONNEL (ATH1). ................................................................... 121

FIGURE 29 ANALYSE SEMI-QUANTITATIVE PAR RT-PCR DE L'EXPRESSION DE ATRALF34 DANS DIFFÉRENTS TISSUS CHEZ

ARABIDOPSIS THALIANA. .............................................................................................................................. 122

FIGURE 30 ANALYSE FONCTIONNELLE DU PROMOTEUR DE ATRALF34. .......................................................................... 124

FIGURE 31 LE MUTANT RALF34-1 NE PRÉSENTE PAS D'ANOMALIE DU DÉVELOPPEMENT DU GAMÉTOPHYTE FEMELLE................ 127

FIGURE 32 LA SUREXPRESSION DE ATRALF34 N'AFFECTE PAS LE DÉVELOPPEMENT CHEZ ARABIDOPSIS THALIANA. .................. 128

FIGURE 33 EXPRESSION DE PLUSIEURS GÈNES DE TYPE RALF DANS LE CARPELLE AU STADE FLORAL 12. .................................. 131

x

FIGURE 34 ANALYSE FONCTIONNELLE DE CERTAINS PROMOTEURS DES GÈNES DE TYPE RALFS DANS LES ORGANES REPRODUCTEURS.

............................................................................................................................................................... 132

FIGURE 35 MODÈLE PROPOSÉ DE LA RÉGULATION DE SCRALF3 SUR LE DÉVELOPPEMENT ET L'ORGANISATION DU SAC

EMBRYONNAIRE. ......................................................................................................................................... 144

xi

Liste des abbréviations

ABA Abscissic Acid

ABP1-3 Auxin Binding-Protein 1-3

ACA9 Autoinhibited Ca2+ ATPase 9

AGL Agamous-Like

AGO9 Argonaute 9

AGP18 Arabinogalactan Protein 18

AHK Arabidopsis Histidine Kinase Receptor

AHP Arabidopsis Histidine Phosphotransfer Protein

AMC Abstinence by Mutual Consent

ANX1/2 Anxur1/2

APM2 Aberrant Peroxisome Morphology 2

ARF Auxin Regulator Factor

ARR Arabidopsis Response Regulator

At Arabidopsis thaliana

BLAST Basic Local Alignment Search Tool

CAF1 Chromatin Assembly Factor 1

CCG Central Cell Guidance

cDNA complimentary DNA

CGM Cellule de Garde Mère

CKI1 Cytokinin Independent 1

CLE Clavata3/Embryo-Surrounding Region (ESR) Related

xii

CLV CLAVATA

CMM Cellule-Mère du Méristémoïde

CRE1 Cytokinin Response 1

CRP Cysteine-Rich Peptide

CrRLK Crinkly Receptor-Like Kinase

DAG Days after Germination

DAP Days after Pollination

DIF1 Determinant Infertile 1

DNA Deoxyribonucleic Acid

Delta-BLAST Domain Enhanced Lookup time Accelerated Blast

DVL Devil

EA1 Egg Apparatus 1

EPF1/2 Epidermal Patterning Factor 1/2

ES4 Embryo Sac 4

ESR Embryo Surrounding Region

EST Expressed Sequenced Tag

FBL17 F-Box-Like 17

FER Feronia

FG Female Gametophyte

FIS Fertilization Independent Seed

FQRNT Fonds Québécois de la Recherche sur la Nature et les Technologies

FRK1/2 Fertilization-Related Kinase 1/2

xiii

GCS1 Germ Cell Specific 1

GFP Green Fluorescent Protein

HEX Trans-2-hexanal

HypSys Hydroxyproline-rich Systemin

IAA Indole Acetic Acid

IDA Inflorescence Deficient in Abscission

IG1 Indeterminate Gametophyte 1

INO Inner-No-Outer

IP3 Inositol triphosphate

JA Jasmonic Acid

Le Lycopersicon esculentum

LIS LACHESIS

LLG Lorelei-Like Gene

LRE Lorelei

LTP5 Lipid Transfer Protein 5

MAC1 Multiple Archesporial Cell 1

MAP/K/KK/KKK Mitogen Activated Protein/Kinase/2Kinase/3Kinase

MCTP Multiple C2 Domain Proteins and Transmembrane Region

MEG1 Maternally Expressed Gene 1

MEL1 Meiosis Arrested at Leptotene 1

MET1 Methyltransferase 1

MLO Mildew Resistance Locus O

xiv

MMC Megaspore Mother Cell

MeJa Methyl Jasmonate

MEME Multiple Em for Motif Elicitation

mRNA messenger Ribonucleic Acid

MSI1 Multicopy Suppressor of Ira 1

MSP1 Multiple Sporocyte 1

NACK1 NPK1-Activating Kinesin-like protein

NCR Nodule Cysteine-Rich

NO Nitric Oxide

NSERC National Sciences and Engineering Research Council of Canada

Na Nicotiana attenuata

Nt Nicotiana tabacum

NTA Nortia

Os Oryza sativa

PCR Polymerase Chain Reaction

PDI Protein Disulfide Isomerase

PIP2 Phosphatidylinositol 4,5-biphosphate

PMA Plasma Membrane ATPase

PRK1/2 Pollen Receptor Kinase ½

PSK Phytosulfokine

PT Pollen Tube

Ptd Populus trichocarpa X Populus deltoides

xv

QKY Quirky

RALF Rapid Alcalinization Factor

RDR6 RNA-Dependant RNA Polymerase 6

RGF Root Growth Factor

RNA Ribonucleic Acid

ROS Reactive Oxygen Species

RT-PCR Reverse Transcription Polymerase Chain Reaction

S1P Site-1 Protease

SA Salicylic Acid

SBT Subtilase

Sc Solanum chacoense

SCR S-Locus Cysteine-Rich Protein

SGS3 Suppressor of Gene Silencing 3

SIGnAL SALK institute Genomic Analysis Laboratory

Sl Solanum lycopersicum

SP11 S-Locus Protein 11

SPL Sporocyteless

SRN Sirène

SSP Short Suspensor

STIG1 Stigma-Specific Protein 1

SUB Strubbelig

TDIF Tracheary Element Differentiation Inhibition Factor

xvi

TDL1A Tapetum Determinant-Like 1A

T-DNA Transfer DNA

TES Tetraspore

TIR1 Transport Inhibitor Response 1

UTR Untranslated Region

Wt Wild-type

WUS Wuschel

YDA Yoda

YFP Yellow Fluorescent Protein

YUC YUCCA

Zm Zea mays

xvii

Je dédie cette thèse à mes parents, pour

m’avoir enseigné la persévérance, pour leur

soutien et pour le sentiment de fierté qu’ils

ont suite à l’accomplissement de ce travail.

Eric Chevalier

xviii

Remerciements

Mes nombreuses années au doctorat ont été pour moi une source de découvertes

personnelles et de remise en question. Je voudrais remercier Daniel P. Matton d’abord et

avant tout pour son ouverture d’esprit, sa compréhension et son sens de l’écoute.

Toujours confiant, Daniel croit en nos capacités. Sans lui, je n’aurais jamais cru en mon

sens de leadership, ni même à ma capacité d’enseigner. Il n’hésite pas à te laisser tenter ta

chance. Pour toutes les opportunités que tu m’as laissé à bâtir ma carrière en recherche et

en enseignement, je t’en suis très reconnaissant.

Aussi, je dois dire un merci particulier à Hugo Germain. Hugo Germain a été mon

superviseur de stage et c’est lui qui a initié mon projet de recherche. Hugo m’a démontré

une très grande confiance en me laissant travailler de concert avec lui sur le premier

article. Hugo n’a pas seulement été un très bon professeur dans le laboratoire, mais il m’a

fait découvrir la vie en général, et les bienfaits de l’entraînement physique. Hugo, tu as été

un phare dans ma vie. Par ton sens de l’organisation, ta capacité à concilier famille-étude-

travail-activité, ta ténacité, ta joie de vivre et ta passion pour les sports et la biologie, tu

demeures un modèle à suivre à mes yeux.

Un gros merci, et sans doute l’un des plus gros, est offert à Audrey Loubert-Hudon.

Sans toi, cette thèse n’existerait pas aujourd’hui. En travaillant de concert avec toi, tu m’as

motivé à aller jusqu’au bout. Tu as accepté mes absences, et malgré tout, tu as toujours

continué à collaborer. Tu as bâtis des illustrations qui enrichissent cette thèse, et tu as

complété les expériences essentielles à mon projet de recherche. Sans ta détermination,

ce projet n’aurait pas été exploité à sa juste valeur. Merci d’avoir collaboré sur ce projet,

et je te serai toujours reconnaissant et fier d’avoir partagé un laboratoire avec toi. Je te

souhaite le plus grand succès en enseignement, et abuse de tes talents artistiques pour le

bien de tous.

xix

Je ne pourrais pas m’arrêter ici sans remercier Erin L. Zimmerman. Erin, avec qui je

partage ma vie aujourd’hui, est une source de motivation exceptionnelle. Malgré les

milliers de kilomètres qui nous ont séparés pendant mon été de stage à Whistler, Erin, de

par sa conscience professionnelle, était toujours là pour me rappeler de terminer ce

manuscrit. Toujours là pour me soutenir, Erin est un pillier sur qui je peux compter. Grâce

à toi, mon anglais s’est grandement amélioré, quoique toujours loin d’être parfait, d’où un

très grand merci pour passer de nombreuses heures à corriger mes textes écrits dans la

langue de Shakespeare. Merci de me transmettre tranquillement ta véritable passion sur

la beauté des fleurs, et sache que ton intérêt particulier pour toutes les choses étranges

de la biologie te mèneront loin. Tu es une véritable passionnée qui inspire les autres.

Enfin, je tiens à souligner l’équipe dynamique avec qui j’ai eu la chance de travailler

pendant mon long séjour à l’Institut de Recherche en Biologie Végétale. Je me souviendrai

du sourire d’Édith, du côté chaleureux de Sier Ching, de la passion de Martin, du côté

énergique de Geneviève, des cris de sursaut de Josée, du professionnalisme de Madoka et

de Mohammed, de la détermination de Faiza, du souper libanais de Mohammad, de

Rachid «la peanut» et de Caroline la «puce stressée».

Je remercie Sophie Carpentier pour son dynamisme et ses colorations GUS. Aussi,

je suis très fier de tous les étudiants avec qui j’ai fait des projets d’Expo-Sciences qui se

sont donnés à 100% pour atteindre la finale pancanadienne.

Un merci à mes parents, Hélène & Claude Chevalier, de même qu’à ma sœur,

Chantal, et mon frère, Martin, qui m’ont poussé à terminer ce PhD et qui ont toujours cru

en moi jusqu’au bout.

De même, un merci particulier à tous mes collègues optométristes et futurs

optométristes qui valorisent mon travail et ma ténacité.

Et un gros merci à toute l’équipe de l’IRBV.

1. INTRODUCTION

1.1 LES COMMUNICATIONS CELLULE-CELLULE ET LES VOIES DE

S IGNALISATION AU SEIN DE L ’OVULE : DE SA CONCEPTION À LA DOUBLE

FÉCONDATION

Eric Chevalier

Institut de Recherche en Biologie Végétale, Département de Sciences Biologiques,

Université de Montréal, 4101 rue Sherbrooke est, Montréal, QC, Canada, H1X 2B2

1.1.1 Sommaire

Les communications cellule-cellule contrôlent plusieurs aspects de la vie d’une

plante. En particulier, les communications cellulaires sont cruciales lors du développement

des gamètes, de même que lors de leurs interactions permettant la double fécondation.

L’ovule est composé d’un funicule, d’un ou deux téguments et d’un gamétophyte compris

au sein du nucelle. Le développement adéquat de l’ovule et du sac embryonnaire sont

critiques pour le succès reproductif. Pour permettre la fécondation, la différentiation des

cellules du sac embryonnaire, de même que leur positionnement relatif, sont essentiels.

Le développement des téguments est aussi intimement lié avec le développement normal

du gamétophyte femelle; le sporophyte et le gamétophyte ne sont pas des tissus

totalement indépendants. À l’intérieur du gamétophyte, plusieurs évidences de

communication cellule-cellule ont lieu durant toutes les étapes de développement de

l’ovule, incluant la détermination du destin cellulaire, la fécondation et les étapes

précoces lors de l’embryogénèse. Cette revue de littérature met en évidence les

communications cellule-cellule basées sur des observations struturelles et physiologiques

de même qu’à partir de l’observation phénotypique de mutants affectant la structure de

l’ovule et de ses composantes. En combinant les données provenant de différentes

espèces, des modèles d’interactions cellulaires ont été proposés, régulant la différention

du destin cellulaire, la mégagamétogénèse et la double fécondation. Bien que beaucoup

de nœuds manquent dans les cascades de signalisation régulant ces types de

communication, des modèles ont été proposés qui pourront guider les travaux futurs dans

le domaine de la signalisation cellulaire lors de la reproduction.

21

Cette première partie d’introduction, publiée dans New Phytologist, sera suivi

d’une revue littérature couvrant plus spécifiquement les gènes de type RALF. Ayant été

identifiés comme des peptides de signalisation, les gènes de type RALF sont retrouvés

dans plusieurs tissus de la plante et sont des candidats potentiels dans la régulation de

plusieurs processus physiologiques, incluant la reproduction chez les végétaux.

1.2 CELL-CELL COMMUNICATION AND S IGNALLING PATHWAYS WITHIN THE

OVULE : FROM ITS INCEPTION TO FERTIL IZATION

Chevalier, Éric; Loubert-Hudon, Audrey; Zimmerman, Erin L.; and Matton, Daniel P.

Institut de Recherche en Biologie Végétale, Département de Sciences Biologiques,

Université de Montréal, 4101 rue Sherbrooke est, Montréal, QC, Canada, H1X 2B2

Publié dans : New Phytologist (2011) 192 : 13-28.

1.2.1 Apport original

Daniel P. Matton a reçu une invitation pour écrire un article de revues (Transley Review)

pour New Phytologist avec comme thème central : la signalisation lors de la reproduction

chez les végétaux. Il a supervisé la rédaction, en participant à l’écriture et assurant le suivi

des corrections.

Audrey Loubert-Hudon est notre conceptrice d’images. Elle a conçu la totalité des images

de l’article selon les recommandations initiales de Eric Chevalier. L’aspect artistique et la

conception originale lui reviennent de droit.

Erin L. Zimmerman est l’éditrice en chef du papier. Elle a participé activement dans la

traduction anglaise du papier; elle a aussi vérifié que les règles de grammaire et de

syntaxe soient bien appliquées selon les normes de la langue anglaise.

Eric Chevalier est l’auteur principal du papier. Eric a proposé le plan et le thème précis du

papier, à savoir les communications cellule-cellule qui semblent prévaloir lors de la double

fécondation et du développement du gamétophyte femelle. Il a fait la recherche

22

documentaire nécessaire et retiré l’information pertinente pour rédiger un article

cohérent et bien structuré. Il a de plus construit des modèles de signalisation en utilisant

son esprit de synthèse et d’analyse.

1.2.2 Summary

Cell-cell communication pervades every aspect of the life of a plant. It is

particularly crucial for the development of the gametes and their subtle interaction

leading to double fertilization. The ovule is composed of a funiculus, one or two

integuments, and a gametophyte surrounded by nucellus tissue. Proper ovule and embryo

sac development are critical to reproductive success. To allow fertilization, the correct

relative positioning and differentiation of the embryo sac cells are essential. Integument

development is also intimately linked with the normal development of the female

gametophyte; the sporophyte and gametophyte are not fully independent tissues. Inside

the gametophyte, numerous signs of cell-cell communication take place throughout

development, including cell fate patterning, fertilization and the early stages of

embryogenesis. This review highlights the current evidence of cell-cell communication and

signalling elements based on structural and physiological observations as well as the

description and characterization of mutants in structurally specific genes. By combining

data from different species, models of cell-cell interactions have been built, particularly

for the establishment of the germline, for the progression through megagametogenesis

and for double fertilization.

1.2.3 Introduction

Sexual reproduction is a key element in the life cycle of higher plants. Within the

flower, the stamens produce the pollen, in which the haploid sperm cells (1n) are

contained (Figure 1, p.23). The carpel is the female organ in which double fertilization, the

interaction of one sperm cell with the egg cell and a second sperm cell with the central cell

of the embryo sac, takes place. The carpel includes the stigma, which promotes the

23

deposition and germination of pollen; the style, which plays an essential role in the

elongation and guidance of the pollen tube (PT); and the ovary, which protects the ovules.

Within the ovules, a highly organized structure called an embryo sac includes the four

different cell types required to complete the double fertilization. These are the egg cell

(1n) and central cell (2n), which will develop into an embryo (2n) and the endosperm (3n),

respectively, after fertilization, as well as synergids (1n) and antipodals (1n). Each ovule

becomes a seed, and each ovary a fruit. The seed contains the embryo that will, under the

correct conditions, germinate to generate a new organism.

FIGURE 1 FLORAL STRUCTURES INVOLVED IN DOUBLE FERTILIZATION.

After landing on the stigma, pollen grains germinate and elongate through the style. Funicular and

micropylar guidance signals help the pollen tube to reach the ovule and the female gametophyte.

The pollen tube carries the two sperm cells to complete the double fertilization with the egg cell

and the central cell

24

Proper ovule and embryo sac development are critical to reproductive success. The

multiple cell layers or cell types of the ovule and the embryo sac form the various

components of the future seed. Several cell-cell interactions must take place within the

ovule, first, to ensure the appropriate division and differentiation of cells and tissues to

generate a complete and fertile embryo sac; second, to synchronize the double

fertilization process; and third, to assure the development of a viable seed. This review

will cover the various signalling elements identified thus far as affecting plant

reproduction with respect to the ovule, as well as evidence of cell-cell communication

discovered via the phenotypic characterization of several mutants.

1.2.4 Signal transduction during ovule and embryo sac development

In Arabidopsis thaliana, the mature gynoecium consists of two fused carpels whose

locules are separated by a central septum. The central region of the septum forms the

transmitting tissue, while its peripheral cells are fused with the inner wall of the ovary.

Placental tissue differentiates along the septum adjacent to the lateral wall of the ovary.

The ovule primordia begin to emerge from the placenta during stage 9 of floral

development (Robinson-Beers et al., 1992; Smyth et al., 1990). The inner and outer

integuments then appear on the surface of each primordium, originating from the chalaza,

which separates the apical nucellus from the funiculus. The integuments grow and cover

the nucellus, leaving a small opening at the apical end, the micropyle. The funiculus

contains vasculature which supplies nutrients to the ovule and the embryo, and which, in

part, determines the orientation of the micropyle. The integuments are required to

protect the embryo sac, contribute to the positioning of the ovule and eventually form the

seed wall. The nucellus provides the initial cell, which will differentiate into a

megasporocyte or megaspore mother cell (MMC), starting the germ line (Figure 2a, p.25)

(Bowman, 1994; Skinner et al., 2004). Several transcription factors have been

characterized as playing a role in the development and cell fate patterning of the ovule.

Although several genetic interactions have been identified, their regulation remains

25

largely unknown. At this level, the signalling pathways involved in the cell fate patterning

of the ovule are poorly understood. Nevertheless, cell-cell communication between cell

layers of the nucellus has been documented.

FIGURE 2 OVULE AND FEMALE GAMETOPHYTE DEVELOPMENT ARE SYNCHRONIZED IN ARABIDOPSIS.

(a) Integument initiation occurs concomitantly with megasporogenesis (stage 11). As

megagametogenesis continues, the integuments elongate (Early Stage 12). The integuments grow

upward around the nucellus (mid-stage 12); the outer integument begins to cover both the inner

integument and the nucellus as the embryo sac is maturing (late stage 12). At maturity, the outer

integument delimits the micropyle, which is close to the funiculus. (b) Megasporogenesis and

megagametogenesis in Arabidopsis. An MMC undergoes two successive meioses to form a tetrad,

of which three cells degenerate. The remaining functional megaspore undergoes three successive

rounds of mitosis within a syncytium, followed by nucleus positioning and cell differentiation. The

mature embryo sac has two synergids, one egg cell and one central cell. MMC: Megaspore Mother

Cell, FG1-7: Female Gametophyte stage 1-7.

26

Inter-cell-layer communication required for the initiation of the integuments

The integuments differentiate from the L1 cell layer at the chalazal end of the

primordium (Figure 2a, p.25). In Arabidopsis, however, the discovery of the receptor-like

kinase STRUBBELIG (SUB) shows that the L2/L3 cell layers are involved in the

differentiation of the outer integuments. In fact, sub-1 ovules, characterized by an

incomplete coverage of the outer integument resulting in a finger-like clamps surface,

exhibit disturbances during the initiation of these tissues (Chevalier et al., 2005). The SUB

protein is only present in L2/L3 cell layers. Expression of SUB under the control of specific

promoters (AINTEGUMENTA and WUSCHEL) in the nucellus and L2/L3 cell layers is able to

recover the sub-1 mutant phenotype. In some cases, WUS::SUB:GFP is restricted to the

nucellar epidermis, and the sub-1 mutant phenotype is not rescued (Yadav et al., 2008).

These results demonstrate that SUB acts via a non-cell autonomous pathway, and is

involved in a signalling network between the inner cell layers of the primordium required

for the initiation of the outer integuments (Figure 3, p.27).

The search for Arabidopsis mutants with phenotypes similar to sub-1 led to the

identification of three new genes: DETORQUEO, QUIRKY (QKY) and ZERZAUST (Fulton et

al., 2009). The analysis of all combinations of double mutants revealed that the three had

considerable functional redundancy, but also specific functions. The genes do not seem to

be epistatic and acting in a simple linear signalling pathway, but their complex phenotypes

make it difficult to assess the additive or synergistic effects between them. QKY encodes a

protein with four cytoplasmic C2 domains that is anchored to the membrane by its C-

terminal domain. Despite the limited sequence homology, QKY appears to belong to the

MCTP (Multiple C2 Domain Proteins and Transmembrane region) family. MCTPs play a

role in both exocytosis and membrane repair, functions that are conserved throughout

several of the living kingdoms (Fulton et al., 2009). Thus, a model was proposed (Figure 3,

p.27) in which the receptor kinase SUB may affect QKY activity in the inner layers of the

27

primordium and regulate the exocytosis of some factors affecting the cell fate of the L1

cell layer (Fulton et al., 2010).

FIGURE 3 INTER-CELL-LAYER SIGNALLING MEDIATED BY STRUBELLIG (SUB) AND QUIRKY (QKY) DURING

OUTER INTEGUMENT INITIATION.

In this model, SUB regulates the exocytosis of a morphogen mediated by QKY in the L2 cell layer.

Some mediators are secreted into the apoplast and may affect a signalling pathway into the L1 cell

layer, regulating aspects of cell division and differentiation of the outer integuments.

Embryo sac development (Polygonum-type)

While the sequence of events during embryo sac development can vary among

species, Polygonum-type development is the most commonly observed route in

angiosperms (Friedman and Ryerson, 2009). The female gametophyte, or embryo sac, is

formed by the differentiation of a nucellus cell into an archesporial cell (2n), which then

acquires the MMC identity (2n). The MMC undergoes meiosis to form a tetrad of

megaspores (1n). Three of these cells, usually those at the distal end of the primordium,

will degenerate, and the fourth will become the functional megaspore. These steps

constitute megasporogenesis (Figure 2b, p.25) (Christensen et al., 1997). The functional

28

megaspore (FG1) then goes through three successive rounds of mitosis without

cytokinesis, generating the eight nuclei necessary to complete the differentiation of a

mature embryo sac. This syncytium (FG5) has a polarity linked to the positioning of nuclei

during mitosis. Some nuclei migrate, reposition themselves, and merge: six haploid cells

and one diploid cell are formed after cellularization, each with a specific cellular identity.

The embryo sac has two synergid cells (1n) and one egg cell (1n) on its micropylar pole,

plus a central cell (2n) and three antipodal cells (1n) at its chalazal pole. The antipodal cells

may degenerate to form a mature embryo sac of four cells (FG7). These steps constitute

megagametogenesis (Christensen et al., 1997).

Is lateral inhibition involved in germline establishment?

A sporophytic cell in the nucellus must differentiate into an archesporial cell to

start a germline. Several cells appear to acquire this cellular identity within the

primordium. Indeed, in rice, the MEIOSIS ARRESTED AT LEPTOTENE1 (MEL1) gene, which

encodes an ARGONAUTE-like protein, is expressed in all cells of the inner layers of the

nucellus; its expression is then limited to the MMC and down-regulated once the first

meiosis starts. The mel1 mutant embryo sacs do not complete megasporogenesis, but

show no abnormality in the initiation and establishment of the germline (Nonomura et al.,

2007). Thus, the inner cell layers of the nucellus differentiate into archesporial cells, which

potentially become immature MMCs, although only one becomes the mature MMC. This

model is valid if cell-cell communication occurs; for example, signal emission by the

mature MMC that abolishes the acquisition of MMC identity by neighbouring cells (Figure

4, p.29) But which signalling molecules could potentially be involved in this lateral

inhibition mechanism?

In rice (Oryza sativa), MULTIPLE SPOROCYTE 1 (MSP1) encodes a receptor-like

kinase with expression limited to cells surrounding the MMC. In the msp1 loss-of-function

mutant, several MMCs appear in the nucellus. This suggests that MSP1 activates a

29

signalling pathway in companion archesporial cells that inhibits MMC differentiation

(Nonomura et al., 2003). TAPETUM DETERMINANT-LIKE 1A (OsTDL1A) is a peptide binding

the MSP1 receptor. OsTDL1A is co-expressed with MSP1 in the ovule, and interference

with OsTDL1A expression causes the appearance of several MMCs within the nucellus

(Zhao et al., 2008). The OsTDL1A/MSP1 interaction may therefore be involved in a cell

autonomous pathway that restricts the number of MMCs. It is possible, however, that

other, unidentified, partners may bind to this complex and participate in lateral inhibition.

FIGURE 4 CELL-CELL COMMUNICATION WITHIN THE NUCELLUS IS INVOLVED IN THE ESTABLISHMENT OF THE

GERMLINE.

Purple. MEL1 is a rice archeospore cell marker (thin and thick purple dashed line) whose

expression becomes limited to the MMC (thick purple dashed line). An unknown lateral inhibition

mechanism is proposed to maintain a unique MMC. Blue. Sporocyteless (SPL), involved in

Arabidopsis megasporogenesis initiation, is expressed at the apex of the primordium. Red. Small

RNAs produced by AGO9 within the L1 cell layer inhibit the development of additional functional

megaspores in Arabidopsis. Green. The cell autonomous pathway, involving the receptor kinase

MSP1 and the small peptide OsTDL1A, inhibits the differentiation of additional MMCs in rice.

30

In maize (Zea mays), MULTIPLE ARCHESPORIAL CELL 1 (MAC1) is required for the

establishment of the female germline. Several MMCs develop in the mac1 mutant and

undergo meiosis to form tetrads. Within a tetrad, several megaspores can survive and

generate embryo sacs, potentially causing infertility. Although the mutation has been

localized on chromosome 10, the nature of the gene is unknown (Sheridan et al., 1996).

While the phenotype associated with MAC1 is similar to that of MSP1, the MAC1 gene is

not the MSP1 orthologue in maize (Ma et al., 2007). Nevertheless, MAC1 remains a good

candidate to support the model of lateral inhibition exerted by the MMC.

Signalling by small RNAs also affects the establishment of the female germline. In

Arabidopsis, AGO9 is another ARGONAUTE-like protein which is expressed in the L1 cell

layer of the nucellus. AGO9 is associated with small RNAs (ta-siRNAs) that specifically

target long primary RNAs (TAS genes) not predicted to encode proteins (Vaucheret, 2006).

The absence of AGO9 leads to additional functional megaspores in the nucellus, which

directly differentiate out of a sporophytic cell. Likewise, mutations in RNA-DEPENDENT

RNA POLYMERASE 6 (RDR6) and SUPPRESSOR OF GENE SILENCING 3 (SGS3), proteins

involved in both the biogenesis of ta-siRNAs and their activity in adjacent cells, cause the

same phenotype (Olmedo-Monfil et al., 2010). Together, these results support cell-cell

communication between the L1 cell layer and somatic companion cells by transport of

small RNAs, limiting the number of gametic cells within the ovule. Isolation of the small

RNAs showed that their primary targets are transposable elements (Olmedo-Monfil et al.,

2010).

Aside from the nuclear protein SPOROCYTELESS (SPL), which initiates sporogenesis

in Arabidopsis, we still do not know which signal initiates the establishment of the MMC

(Yang et al., 1999b). Cell-cell communications are numerous and diverse, and several

mechanisms are in place to limit the proliferation of the germ line. Are those pathways

sufficient in limiting the establishment of multiple MMCs? Unlikely, as the neighbouring

cells must receive a signal indicating that an adjacent cell has initiated megasporogenesis.

31

Phosphorylation cascades during megagametogenesis

After meiosis, in most flowering plants, the chalazal megaspore differentiates into

the functional megaspore, while others enter into programmed cell death (Figure 2b,

p.25). Thus, the germ cells react according to their position within the ovule. The MMC

already displays signs of polarity through the positioning of organelles, the deposition of

callose, and the arrangement of the microtubule cytoskeleton. This polarity persists during

megasporogenesis. The Arabidopsis switch1/dyad mutant produces two diploid

megaspores, but only the chalazal one expresses specific markers of the functional

megaspore (Motamayor et al., 2000; Ravi et al., 2008). These observations suggest that

cell-cell communication involved in polarization takes place between the germline and the

neighbouring sporophytic cells at an early stage of megasporogenesis. Again, we do not

yet know the components of the possible signalling pathway involved.

The functional megaspore (FG1) undergoes three successive rounds of mitosis to

form the eight nuclei essential to the formation of the mature embryo sac (FG7, Figure 2b,

p.25). Signalling proteins are also involved in this process. In Solanum chacoense, FRK1, a

MAPKKK, is critical to development beyond stage FG1 (Gray-Mitsumune et al., 2006;

Lafleur, 2010). In Arabidopsis thaliana, the protein AGP18, a classical arabinogalactan

protein, was found to regulate this same process (Acosta-Garcia and Vielle-Calzada, 2004).

Similarly, the CYTOKININ INDEPENDENT 1 (CKI1) signalling pathway and a kinesin-MAPKKK

pathway may be important in the complete cellularization and positioning of nuclei during

stage FG5.

CKI1 was isolated by activation tagging in an Arabidopsis mutant showing a

phenotype associated with a constitutive cytokinin signalling pathway. This histidine

kinase receptor (AHK) was initially seen as part of the cytokinin receptor family (Hwang

and Sheen, 2001; Kakimoto, 1996; Zheng et al., 2006), but was later shown to be unable to

bind cytokinin (Yamada et al., 2001). Infertility occurs in the cki1-5/CKI1 and cki1-6/CKI1

mutants, and the T-DNA alleles are never transmitted through the female gametophyte

32

(Pischke et al., 2002). The abnormalities appear after the FG4 stage; at stage FG5, embryo

sacs have an unusual morphology, with additional vacuoles and poor positioning of the

nuclei. At stage FG7, some embryo sacs are completely degenerated, while others contain

several small vacuoles separated by many cytoplasmic strands (Pischke et al., 2002).

Further study of a mutant obtained by transposon insertion, cki1-i/CKI1, suggests that the

integrity of the vacuole is affected first; if this structure does not form properly,

degeneration of the embryo sac results (Hejatko et al., 2003). Although cytokinin is not

directly involved in the progression through stage FG5, signalling proteins downstream

from the AHKs, such as the ARABIDOPSIS HISTIDINE PHOSPHOTRANSFER PROTEINS (AHPs)

and the ARABIDOPSIS RESPONSE REGULATORS (ARRs), do appear to play a role (Figure 5a,

p.33). Thus, CKI1 uses elements downstream from the cytokinin receptors to control

female gametophyte development (Deng et al., 2010).

33

FIGURE 5 POSSIBLE SIGNALLING PATHWAYS INVOLVED IN MEGAGAMETOGENESIS.

(a) During megagametogenesis, CKI1 acts independently of the cytokinin receptors (AHK2-4), but

uses a common phosphorelay signalling system such as the AHPs for nuclear translocation and

ARR1/IPT8 as a transcriptional regulator. (b) In tobacco, the NACK-PQR pathway is involved in

sporophytic cytokinesis. In Arabidopsis, the homologous kinesins AtNACK1-2 are also involved at

the FG5 stage of megagametogenesis; the homologous NPK1 MAPKKK, ANP1-3, and the

homologous NQK1, ANQ/MKK6, control female gametophyte viability. This suggests that this

MAPK pathway is conserved, in part, to regulate female gametophyte development. NACK1, NPK1-

activating kinesin-like protein; PQR, acronym for the three MAPK that are part of the signaling

cascade: NPK1 (MAPKKK), nucleus- and phragmoplast-localized protein kinase; NQR1 (MAPKK);

NRK1 (MAPK).

34

A MAPK pathway may also be involved in the cellularization/differentiation which

occurs during stage FG5 (Figure 5b, p.33). In tobacco and Arabidopsis, the NACK-PQR

pathway, a NACK1 kinesin-like protein and mitogen activated protein (MAP) cascade,

plays an essential role in sporophytic cytokinesis (Krysan et al., 2002; Nishihama et al.,

2002; Soyano et al., 2003). In Arabidopsis, the triple mutant for the ANP MAPKKK,

anp1anp2anp3, is not transmitted through the male and female gametes (Krysan et al.,

2002). The viability of the female gametes is also severely affected in the mkk6-2/anq-2

mutant (Takahashi et al., 2010). AtNACK2/STUD/TETRASPORE and AtNACK1/HINKEL

genes, both encoding kinesins, have redundant functions during female gametophyte

development; in the double heterozygote mutant atnack1-1/+; atnack2-1/+, 25% of the

eggs show a nucleus cluster advanced to the middle of the embryo sac at stage FG5

(Tanaka et al., 2004). Investigation of components of the NACK-PQR MAPK pathway in the

completion of female gametophyte development would be interesting, as

AtNACK2/STUD/TETRASPORE, AtANP3, AtMKK6 and AtMPK4 define a putative signalling

module that regulates male-specific meiotic cytokinesis in Arabidopsis (Zeng et al., 2011).

Cell fate specification

Cells within the embryo sac must be adequately differentiated to allow for its

proper functioning. For example, in the Arabidopsis eostre mutant, there are two egg cells

and only one synergid, rather than two synergids and one egg cell. Although this

differentiation defect only mildly affects the attraction and guidance of the PT through the

micropyle, it can lead to the formation of two zygotes without an endosperm (Pagnussat

et al., 2007). Similarly, improper differentiation of the central cell can cause problems

during fertilization (Bemer et al., 2008; Portereiko et al., 2006; Steffen et al., 2008). Two

models have been proposed to explain the cell fate of nuclei within the female

gametophyte: the auxin gradient within the embryo sac and the LACHESIS pathway. These

models are not mutually exclusive; both posit that all gametophytic cells have the

35

potential to become a gametic cell. The former deals with cell fate determination, while

the latter explains the maintenance of proper differentiation within the embryo sac.

In Arabidopsis, analysis of the wild-type and the eostre mutant supports the idea

that the proper positioning of nuclei within the female gametophyte is a prerequisite in

the cell fate specification. By the FG5 stage (Figure 2b, p.25), we can predict cell fate

specification of the three nuclei located at the extremity of the wild-type syncytium: two

nuclei are side by side at the micropylar end, becoming the synergids, while another

nucleus is positioned slightly toward the middle of the embryo sac, becoming an egg cell.

In the eostre mutant, the positioning of these nuclei is reversed, as is their cell fate

(Pagnussat et al., 2007). In the maize indeterminate gametophyte 1 (ig1) mutant,

additional divisions occur which are associated with supernumerary cells whose fate also

seems to depend on their positioning (Evans, 2007). Thus, the nuclei located at the

micropylar end become synergids, followed by the egg cell, central cell, and antipodal cells

as we move along the longitudinal axis (Figure 6, p.37). This cell fate specification and

organization within the syncytium is crucial to facilitate the PT reception, as well as the

reception of the sperm cells following the discharge of the PT (Hamamura et al., 2011).

An auxin gradient appears to play a major role in cell fate determination within the

syncytium (Pagnussat et al., 2009). Using a reporter gene sensitive to auxin (DR5::GFP), a

high concentration of the hormone was visualized at the micropylar end of the

Arabidopsis embryo sac. The experimental down-regulation of the AUXIN REGULATING

FACTORS (ARFs) within the embryo sac simulates a low level of auxin. In this case, the

synergid cell fate is compromised and two egg-like cells are formed. Similarly, the

quadruple mutant of the auxin F-box receptors tir1afb1afb2afb3 displays defective

embryo sacs in which synergid cells express an egg cell marker. The YUCCA auxin

biosynthesis genes (YUC) appear to be preferentially expressed on the micropylar side of

the syncytium. Their expression throughout the megagametophyte in transgenic

overexpression studies stimulates the expression of synergid markers in the egg cell,

36

central cell and antipodal cells, as well as the expression of an egg cell marker within the

antipodal cells; no abnormality occurs in the expression of the central cell marker

(Pagnussat et al., 2009). Put simply, the signalling pathway of auxin, including its

biosynthesis, is required for the differentiation of cells within the embryo sac in a

concentration-dependent manner, although it does not affect the positioning of nuclei

(Pagnussat et al., 2009).

Angiosperms have developed a second molecular pathway involved in determining

cell fate within the embryo sac: a lateral inhibition mechanism involving cell-cell signalling.

By screening Arabidopsis mutants that exhibited delocalization of an egg cell marker,

lachesis (lis), clotho and atropos, were identified (Figure 6, p.37). In these mutants, the

synergids and the central cell express an egg cell marker, while the antipodal cells express

a central cell marker (Gross-Hardt et al., 2007; Moll et al., 2008). The associated genes

encode proteins that are components of the spliceosome, and their interactions allow the

localization of the complex into the nucleus. LIS is expressed exclusively in gametic cells

(egg and central cell). Thus, the spliceosome may be involved in processing specific genes

within the gametic cells, directly or indirectly producing a signal molecule. These

molecular signals then inhibit gamete differentiation in the accessory cells and are

involved in communication between the egg cell and the central cell (Gross-Hardt et al.,

2007; Moll et al., 2008). The nature of these signals is unknown, as are the specific mRNA

targets of the spliceosomal proteins.

37

FIGURE 6 CELL-CELL COMMUNICATION INVOLVED IN CELL FATE PATTERNING DURING EMBRYO SAC DEVELOPMENT.

Phenotypic characterization of mutants reveals some cell-cell communication within the embryo

sac, despite the fact that the mutated gene is not directly involved in those communications.

Gametophyte/sporophyte communication is reciprocal (yellow arrow). An auxin gradient at the

FG5 stage is responsible for the proper differentiation of the cell within the embryo sac. A

reciprocal communication occurs between the gametic cells (egg and central cell), while the egg

cell also produces a signal to block egg cell differentiation in the neighbouring cells. The central

cell communicates with the antipodals and the synergids for maintenance of cell identity, and a

signal from the central cell mitochondria is generated to control the lifespan of the antipodals.

38

The role of gametic cells in the specification of the other cells within the embryo

sac is also supported by the characterization of various Arabidopsis mutants. The

agamous-like61/diana mutant exhibits early degeneration of the central cell after fusion

of the polar nuclei (Figure 6, p.37). After degeneration, there is a widespread expression

of synergid and egg cell markers throughout the chalazal pole, coupled with a broader

expression of antipodal markers at the micropylar pole (Bemer et al., 2008). This supports

a major role for the central cell in the determination and maintenance of cellular identity

in adjacent cells. More recently, the characterization of the fiona/syco-1 mutant has

produced further proof of cell-cell communication inside the embryo sac (Figure 6, p.37).

The fiona/syco-1 mutation affects the integrity of the mitochondria of the central cell, as

well as the fusion of polar nuclei, without broadly affecting central cell identity. SYCO is

specifically expressed in the central cell, but the fiona/syco-1 mutation increases the

lifespan of the antipodals without changing their identity (Kagi et al., 2010), as observed in

lis and clotho mutants (Gross-Hardt et al., 2007; Moll et al., 2008). Thus, the mitochondria

of the central cell would appear to be required for the fusion of the polar nuclei in these

cells, as well as for the control of the programmed cell death of the antipodals.

Interestingly, the wild-type paternal allele is sufficient to restore fusion of the polar nuclei,

and leads to normal seed development (Kagi et al., 2010).

Cell-cell communication between the sporophyte and the female gametophyte

The fact that auxin first accumulates in the nucellus before forming a gradient in

the embryo sac (Pagnussat et al., 2009) supports the idea that there is communication

between the sporophytic tissue and the female gametophyte. This cell-cell

communication occurs not only during initiation of the germ line, but throughout its

development. In fact, several studies of Arabidopsis mutants have suggested that the

development of the sporophytic and gametophytic tissues during ovule development is

synchronized. Recessive mutants with phenotypes related to ovule development are

divided into three categories: those with defects in sporophytic and gametophytic tissues,

39

those with defects during megasporogenesis, and those with defects during

megagametogenesis (Schneitz et al., 1997). Many gametophytic mutants exist without

abnormalities in sporophytic tissue structures, but the reverse condition, sporophytic

ovule mutants without abnormalities in gametophyte development, is not observed. This

suggests an interaction between the two tissues in the sporophyte to gametophyte

direction (Schneitz et al., 1997). For example, in the mutants bel1 and aintegumenta, in

which the morphogenesis and identity of the integuments are disrupted (Figure 6, p.37),

embryo sac development is arrested (Robinson-Beers et al., 1992). The expression of

BELL1 and AINTEGUMENTA is sporophyte-specific (Elliott et al., 1996; Klucher et al., 1996;

Reiser et al., 1995); the gametophytic phenotype may be explained by sporophytic signals

acting on embryo sac development. At the transcriptional level, however, the absence of

an embryo sac causes sporophytic genes to be up-regulated, suggesting that

communication is reciprocal (Johnston et al., 2007). Since the presence or absence of the

gametophyte does not appear to affect the development of the sporophyte, this suggests

the production of signals by the gametophyte to negatively control sporophytic signalling

acting on it.

Recently, three Arabidopsis sporophytic cytokinin receptors, CYTOKININ RESPONSE

1 (CRE1), AHK2 and AHK3, have been found to be putative signalling candidates in this

sporophyte-gametophyte interaction. The triple mutants of these (cre1-12 ahk2-2tk ahk3-

3) principally produce ovules lacking an embryo sac. In a few cases, premature arrest of

the female gametophyte is observed or the ovules are slightly smaller compared to wild-

type (Kinoshita-Tsujimura and Kakimoto, 2011). The inguments grow normally, suggesting

that these receptors facilitate gametophyte development through cell-cell communication

with the sporophyte.

40

1.2.5 Signalling during double fertilization

Once the embryo sac is fully developed, fertilization can take place. The female

reproductive structures are actively involved in the process of double fertilization.

Communication between the style and the PT via multiple types of signalling molecules,

such as chemocyanin and arabinogalactan proteins in Arabidopsis, guide the PT to the

ovule (Cheung et al., 1995; Kim et al., 2003). Sporophytic signal molecules like GABA, can

also be produced by the integuments of the ovule to attract PTs (Palanivelu et al., 2003).

Signals stemming from the gametophyte, however, are ultimately required to guide the PT

through the micropyle, as demonstrated from embryo sac-less mutants (Hulskamp et al.,

1995). These signals are also temporally linked to the double fertilization, since fertilized

ovules lose their attractiveness, as shown in Torenia fournieri and Arabidopsis

(Higashiyama et al., 1998; Palanivelu and Preuss, 2006).

Involvement of the synergids and central cell in PT attraction

The histological configuration and location of the synergids, as well as the entry

point of PTs in the embryo sac, are clues as to the role played by the synergids in PT

guidance (Higashiyama et al., 1998; Huang and Russell, 1992; Russell, 1992, 1996). In T.

fournieri, laser ablation of synergids completely abolishes attraction of PTs, a

phenomenon not observed by the removal of gametic cells (egg and central cell) or a

single synergid (Higashiyama et al., 2001). In Arabidopsis, the synergid-expressed

transcription factor MYB98 was first identified as an under-expressed gene in the mutant

determinant infertile 1 (dif1), which does not form an embryo sac (Kasahara et al., 2005).

The myb98 mutant shows abnormalities in the integrity of the filiform apparatus and in

the attraction of PTs (Kasahara et al., 2005). The discovery of this mutant supports the

active role of synergids in PT attraction via the expression of genes encoding attractive

peptides under MYB98 regulation (Figure 7a, p.49) (Punwani et al., 2007).

41

In the majority of cases, ablation of the central cell affects the integrity of the

embryo sac. We cannot, therefore, assert its non-participation in PT attraction

(Higashiyama et al., 2001). The Arabidopsis central cell guidance (ccg) mutant was isolated

as a female gametophyte mutant with Mendelian segregation distortion that also affects

guidance of the PT (Chen et al., 2007). The CCG gene encodes a transcription factor of the

TFIIB family specific to the central cell (Figure 7a, p.49). While differentiation and the

integrity of the embryo sac are not affected by the mutation, CCG seems to be involved in

the production of signals by the central cell to attract the PT or to coordinate the

expression of the chemoattractants from the synergid cells (Chen et al., 2007). However,

the fusion of the polar nuclei is not a decisive event regulating PT guidance, since

Arabidopsis mutants defective in this step may either fail (Shimizu and Okada, 2000;

Shimizu et al., 2008) or succeed (Christensen et al., 2002; (Maruyama et al., 2010) in

attracting PTs. Nevertheless, when cell fate determination of the central cell does not

occur properly, as in the agl61/diana and agl80 insertional mutants, mutant ovules are

still able to attract the PT (Bemer et al., 2008; Portereiko et al., 2006; Steffen et al., 2008).

This suggests that a basal level of cell fate acquisition is sufficient for PT attraction. A

correlation between the level of differentiation of the central cell and the expression of

CCG throughout female gametophyte development could bring new insights into this

matter. The involvement of the central cell in PT attraction may be indirect, as the central

cell and the egg cell can exchange molecules of less than 10 kD via the plasmodesmata

prior to anthesis (Han et al., 2000).

Does the female gametophyte play a role in PT repulsion? This phenomenon has

not been observed in Arabidopsis mutants myb98 and matagama1/matagama3/ccg, in

which it is common to see more than one PT at the entrance of the micropyle in the

absence of micropylar guidance (Chen et al., 2007; Kasahara et al., 2005; Shimizu et al.,

2008; Shimizu and Okada, 2000). In wild-type Arabidopsis ovules, the behavior of PTs near

the micropyle reflects the initiation of repulsion soon after a PT enters via the micropyle

42

and long before it reaches the female gametophyte (Palanivelu and Preuss, 2006). This

indicates that either the sporophyte or the female gametophyte emits a repulsion signal

when it detects the PT, or the PT issues this repellent after detecting the attractant

molecule (Palanivelu and Preuss, 2006). The signals involved are still unknown.

Signalling proteins involved in PT attraction

The CRPs, cysteine-rich proteins, are an important class of small peptides that are

abundant in reproductive tissues (Silverstein et al., 2007). In T. fournieri, 16 CRP genes are

over-represented in the synergids. Among them, two peptides, LURE1 and LURE2, are able

to attract the PT in a semi in vivo assay and are immunolocalized at the surface of the

filiform apparatus (Figure 7a, p.49). Microinjection of antisense morpholino

oligonucleotides against LURE1 and 2 in the central cell of the T. fournieri protruding

embryo sac leads to their diffusion in the neighbouring gametophytic cells and to a

decrease in PT attraction (Okuda et al., 2009). In maize, another gene, ZmEA1, expressed

by the egg cell and synergids, encodes a non-CRP peptide localized at the filiform

apparatus (Figure 7a, p.49). The embryo sac of plants under-expressing ZmEA1 show no

structural abnormalities, but display reduced seed set and decreased PT targeting to the

synergids (Marton et al., 2005).

Semi in vivo approaches have also shown that PT attraction is species-specific and

thus may act as an interspecific reproductive barrier (Higashiyama et al., 2006; Palanivelu

and Preuss, 2006). Proteins belonging to the CRP class are known to evolve very rapidly

and therefore make prime candidates as species-specific chemoattractants (Silverstein et

al., 2007), although a number of different signals may have been recruited in plants to

fulfill this purpose.

Signalling pathways regulating proper PT targeting following the perception of

attracting signals are only beginning to be understood. Two Arabidopsis potassium

transporter homologues, CHX21 and CHX23, localized in the PT endoplasmic reticulum,

43

are required for PT targeting to the ovule. Double mutant (chx21/chx23) PTs germinate

and extend normally within the transmitting tract, but fail to turn toward the ovules,

having no apparent funicular or micropylar guidance (Lu et al., 2011). A simple model

could be that a localized change in pH and/or cation level is directed by transporters

acting downstream of a transduction cascade in response to guidance cues (Figure 7a,

p.49). The characterization of an Arabidopsis sperm cell-specific transmembrane protein,

GCS1/HAP2, suggests the involvement of the sperm cell in PT guidance (Mori et al., 2006;

von Besser et al., 2006). When a wild type plant is pollinated with heterozygous

LAT52::GUS pollen grains, ~50% of ovules show staining related to the presence of the β-

glucuronidase (GUS). When the hap2-1/+ mutant is pollinated with those pollen grains,

despite the normal growth of all PTs, ~25% of ovules show the specific GUS staining,

suggesting that only the HAP2 pollen is able to reach the synergid and burst (von Besser et

al., 2006). However, based on current data, it is still difficult to propose a model in which

the sperm cell plays a key role in this process.

Synergid-pollen tube interaction

In Arabidopsis, the following sequence of events is observed: 1) the PT reaches the

synergid, 2) the PT continues to grow around the synergid, 3) the synergid degenerates, 4)

the PT discharges, and 5) the released sperm cells fuse with the central cell and the egg

cell (Sandaklie-Nikolova et al., 2007). Recent live-cell imaging observations suggest,

however, that the breakdown of the receptive synergid cell occurs concomitantly with PT

discharge (Hamamura et al., 2011). This implies that the interaction of the PT and the

synergid induces a signalling cascade resulting in synergid degeneration and the bursting

of the PT; or, alternatively, that the force generated by PT discharge can cause the

breakdown of the synergid.

Communication between the PT and the synergid may initially occur via the

activation of a receptor kinase at the surface of the synergid. In a genetic screen of

44

Arabidopsis insertional mutants with distorted segregation, which was run in parallel with

cytological screening of sterile mutants without structural abnormalities in the embryo sac

and pollen, feronia (fer) & sirène (srn) mutants were isolated (Figure 7b, p.49) (Huck et al.,

2003; Rotman et al., 2003). In both cases, the embryo sac attracts PTs, but the synergids

are not recognized by the PT, which continues to grow inside the embryo sac. In some

cases, supernumerary PTs are found inside the embryo sac (Huck et al., 2003; Rotman et

al., 2003). The in-depth characterization of the fer mutant showed that FER and SRN are

allelic (Escobar-Restrepo et al., 2007). FER/SRN encodes a receptor kinase that belongs to

the CrRLK1L-1 family. FER/SRN is weakly expressed in the mature embryo sac with a

stronger expression in the synergids, although it is expressed in other tissues as well.

FER/SRN is localized to the plasma membrane of the synergids at the filiform apparatus.

Using FER homologues from numerous species, it was found that the putative ligand-

binding extracellular region showed the greatest degree of amino acid diversification,

indicating that this domain was evolving faster than the rest of the protein. Since pollen

from closely related species can be attracted, but not recognized by the synergids, FER

may act as a reproductive barrier at the PT reception step (Escobar-Restrepo et al., 2007).

Lorelei (lre) mutants, in which a potential GAP protein anchored to the membrane

is disrupted, exhibit a similar phenotype, although less penetrant (fertilization

abnormalities in 50% of homozygous mutants) (Capron et al., 2008; Tsukamoto et al.,

2010). The low penetrance of the phenotype may be due to functional redundancy among

three Arabidopsis paralogues (LLGs), although this would be unlikely, since the paralogues

show stronger expression in the PT, while LRE is expressed in the synergids of the mature

embryo sac (Capron et al., 2008). Furthermore, the lre-5;llg1 double mutant does not

show a more severe phenotype than lre (Tsukamoto et al., 2010). Taken together, these

results demonstrate the involvement of a serine/threonine kinase receptor in the

reception of a PT and in the activation of a signalling cascade, possibly involving a GAP

protein, in the synergid (Figure 7b, p.49). This activation may in turn activate the

45

degeneration of the synergid, as well as the release of factors affecting PT growth and

integrity. Notably, Arabidopsis synergid degeneration requires GFA2, a protein similar to

the yeast mitochondrial Mdj1p chaperone (Christensen et al., 2002). This suggests a role

for the mitochondria in triggering synergid degeneration and their potential as a target by

pathways such as the FER pathway (Figure 7b, p.49). However, the fact that there is no

fertilization in the gfa2 mutant could support a model in which the mitochondria are

involved in a signalling pathway leading to the release of pollen bursting factors.

The involvement of the FER pathway in the release of pollen bursting factors is

supported by another Arabidopsis female gametophytic mutant named nortia (nta). This

mutant displays reduced fertility as well as PT overgrowth in the synergids (Kessler et al.,

2010). The NTA gene, or AtMLO7, codes for a member of the Mildew resistance locus o

(MLO) family. These MLO proteins, originally discovered as being required for powdery

mildew susceptibility in barley, typically have seven transmembrane domains, preceded

by a signal peptide and followed by a C-terminal calcium-binding domain. Arabidopsis

plants stably transformed with a pNTA::NTA-GFP fusion construct revealed a punctate

pattern throughout the cytoplasm of the synergids in mature but unfertilized female

gametophytes. Interestingly, upon PT arrival at the micropyle, NTA-GFP was localized to

the basal half of the synergids. However, polar localization of NTA-GFP upon PT arrival was

not observed in fer mutant embryo sacs (Kessler et al., 2010). Since MLO proteins appear

to modulate SNARE-dependant and vesicular transport-associated processes at the

plasma membrane (Bhat et al., 2005), NTA could be involved in delivering regulatory or

signalling proteins to the plasma membrane. The FER receptor-kinase could thus initiate a

signalling cascade upon PT arrival, leading to the relocalization of NTA-containing vesicles

to the filiform apparatus (Figure 7b, p.49).

Signalling proteins are also involved in the integrity of the PT. ANXUR1 (ANX1) and

ANX2 are Arabidopsis pollen-specific receptor kinases paralogous to FER (Figure 7c, p.49).

The anx1anx2 mutant is almost 100% male sterile. In in vitro assays, mutant PTs burst

46

shortly after germination, while in in vivo assays, the tube burst within the stigma

(Boisson-Dernier et al., 2009; Miyazaki et al., 2009). The anx1anx2 phenotype suggests

that the ANXUR receptors are involved in the activation of a pathway maintaining the

integrity of the PT. A signal released by the synergid would cause ANXUR inactivation, thus

leading to tube burst and sperm cell discharge. However, the early bursting phenotype

made a direct observation of this conclusion impossible.

The recent discovery of the EMBRYO SAC4 (ZmES4) peptide, in maize, supports this

signalling model. ZmES4, a member of the large CRP family, is normally stored in secretory

vesicles of the egg apparatus cells until fertilization. ZmES4-RNAi plants show no defects in

PT attraction, but the tubes do not burst and will continue to grow in or around the egg

apparatus. In vitro, ZmES4 causes PTs to rupture. Significant depolarization of the PT

membrane occurs involving KZM1, a pollen-expressed potassium import channel (Amien

et al., 2010). This supports a model in which the synergid perceives the PT and liberates a

small peptide, thereby stopping growth and bursting the PT through depolarization of its

membrane (Figure 7c, p.49).

An Arabidopsis calcium pump on the plasma membrane of the PT, AUTOINHIBITED

Ca2+ATPase9 (ACA9), also affects the growth and reception of the PT (Figure 7c, p.49). It

has been proposed that this pump controls a calcium signalling pathway by modulating

Ca2+ oscillations. Although the aca9 phenotype is similar to fer/srn, PTs stop at the

synergid, suggesting that this pump is involved in the bursting rather than the halting of

the tube. Thus, the arrest and rupture of the PT appear to be regulated via different

signalling pathways (Schiott et al., 2004).

Another link for the importance of organelles in PT reception is revealed in the

Arabidopsis abstinence by mutual consent (amc) mutant (Boisson-Dernier et al., 2008).

The AMC gene (also known as Aberrant Peroxisome Morphology 2 or APM2, (Mano et al.,

2006) codes for an atypical peroxin, a peroxisome biogenesis factor that is targeted to the

47

peroxisome. When an amc PT encounters an amc female gametophyte, a PT overgrowth

phenotype without sperm cell discharge is observed, and often, multiple amc PTs can

target an amc ovule. Genetic interaction between the FER and APM2/AMC pathways

reveals a partial but significant additive effect for the amc and fer mutations in amc/+ and

fer/+ double mutant plants, suggesting that the two pathways are most likely

independent. In an amc background, peroxisome formation is severely affected. Thus,

functional peroxisomes must be present in either the male or female gametophyte to

enable PT reception. The authors postulate that, in amc gametophytes, mislocalization of

a protein normally targeted to the peroxisome could affect PT reception. Since

peroxisomes are involved in the production of numerous signalling molecules, including

jasmonic acid, salicylic acid, auxin (IAA), reactive oxygen species (ROS) and nitric oxide

(NO), this opens up the scene for possible roles of these molecules in the male-female

gametophyte dialogue.

Cell-cell communication within the female gametophyte

The FERTILIZATION INDEPENDENT SEED (FIS) pathway, which inhibits the

proliferation of the endosperm, also appears to be linked to the signalling pathway

involved in PT reception through FER/SRN (Figure 7b, p.49) (Rotman et al., 2008). With the

aim of identifying the components of the FER signalling pathway, a screen was carried out

to identify other Arabidopsis mutants with abnormal PT reception. The scylla mutant was

identified, in which the autonomous development of endosperm was also observed. This

led to a reassessment of the fer/srn phenotype, which demonstrated that a very small

percentage of fer/srn ovules present the autonomous endosperm development typical of

fis mutants. Conversely, multicopy suppressor of ira1 (msi1) mutants (MSI1 is part of the

FIS polycomb complex) have a very low percentage of ovules with the fer/srn phenotype.

The msi1;fer/srn double mutant shows a synergistic effect. This indicates that the FER/SRN

signalling pathway of the synergid interacts with the FIS signalling pathway of the central

cell, and that this interaction controls the release of sperm cells and the development of

48

the endosperm (Rotman et al., 2008). In other words, during fertilization, the synergids

and central cell are in constant communication.

Communication between the egg cell and central cell may persist during

fertilization, possibly to synchronize the development of the embryo and endosperm.

During fertilization, one sperm cell fertilizes the egg cell to initiate the development of the

diploid zygote, while another fuses with the central cell to initiate the development of a

triploid endosperm. The discovery of the Arabidopsis cdc2a and F-box-like17 (fbl17)

mutants allowed researchers to dissect the phenomenon of double fertilization. During

pollen development, microspores undergo a first mitosis to produce a generative cell

enveloped within a vegetative cell. The former undergoes a second mitosis to produce the

two sperm cells needed for double fertilization. In cdc2a and fbl17 mutants, this second

mitosis does not occur, and a single sperm-like cell is present in mature pollen (Gusti et

al., 2009; Iwakawa et al., 2006; Kim et al., 2008; Nowack et al., 2006). Surprisingly, both

the development of the zygote and the endosperm is initiated following fertilization of the

egg cell (Gusti et al., 2009; Kim et al., 2008; Nowack et al., 2006). Thus, a positive signal

from the fertilized egg cell to the central cell is produced, thereby triggering endosperm

development (Nowack et al., 2006). However, recent analyses have questioned these

findings. For the cdc2a mutant, in some cases, the generative cell undergoes division

within the growing PT, and the second sperm cell is able to merge with the central cell.

The karyogamy between the sperm cell and the central cell is incomplete, leading to seed

abortion. Is there a positive signal emitted from the egg cell? Apparently not, as evidenced

by the presence of only the zygote in some cdc2a ovules (Aw et al., 2010), as well as only

two zygotes in the mutant eostre (Pagnussat et al., 2007), without any proliferation of the

endosperm. The fusion of the sperm cell with the central cell is sufficient to initiate

division of the central cell, which could be done via a signalling pathway involving

membrane proteins, such as GENERATIVE CELL SPECIFIC1 (GCS1/HAP2) (Mori et al., 2006;

von Besser et al., 2006), or via cytoplasmic signals (Bayer et al., 2009) (see below).

49

FIGURE 7 POSSIBLE MODELS OF CELL-CELL COMMUNICATION AND SIGNALLING DURING DOUBLE FERTILIZATION. (a) In the synergids, MYB98 regulates the expression of secreted peptides possibly involved in the attraction of the pollen tube. The central cell may act directly or indirectly in this process through the transcription factor CCG. This attractant changes the direction of pollen tube growth toward the micropyle by regulating the K

+ transporters CHX21/23. The ANX1/2 receptor kinases are activated to maintain the integrity of the

pollen tube. NORTIA (NTA) is associated to secretory vesicles, until PT reception. (b) FER/SRN is a receptor kinase involved in the arrest of the pollen tube. A GAP protein, LORELEI, may mediate its action. The FER/SRN pathway regulates vesicular trafficking by relocalization of NTA on the basal side of the synergids; it also interacts with the FIS pathway, possibly to prime the central cell to receive the sperm cell. The FER/SRN pathway may directly regulate synergid degeneration by targeting the mitochondria, or indirectly following the release of bursting factor(s) and the subsequent discharge of the pollen tube. (c) Synergid degeneration (dashed line) or regulation of vesicular trafficking causes the release of small signalling peptides, like ZmES4. This peptide is perceived by the PT and causes membrane depolarization, perhaps by inhibiting ANX1/2 signalling, leading to activation of the K

+ transporter KZM1 and the Ca

2+ transporter ACA9. This

depolarization and a consequent water uptake would be responsible for PT bursting. (d) Alternatively, as observed by Hamamura et al. (2011), degeneration of the receptive may occur upon pollen tube discharge. An initial sperm cell fuses with the egg cell, while a second sperm cell fuses with the central cell, possibly via protein interaction involving GCS1/HAP2. An inhibitory signal is then produced by the egg cell to prevent polyspermy, although the fusion events appear to occur concomitantly.

50

Interaction between the male and the female gametes

When sperm cells are released into the degenerated synergid, they merge with the

central cell and the egg cell. Recognition proteins are essential at this point to activate cell

fusion. GCS1/HAP2, a sperm cell membrane protein, is involved in the interaction of the

sperm cell with the central cell and egg cell (Figure 7d, p.49) (Wong et al., 2010).

GCS1/HAP2 was originally isolated by differential display from Lilium longiflorum pollen as

being highly specific to the generative cell, and indeed, the protein gradually accumulates

during pollen development, particularly during the advanced bi-cellular stage (Mori et al.,

2006). In Arabidopsis, the sperm cells of the gcs1/hap2 mutant are able to penetrate the

embryo sac, but do not fuse with the central cell and egg cell (Mori et al., 2006; von

Besser et al., 2006).

In Arabidopsis, the cdc2a and fbl17 mutant phenotypes suggested a preferential

interaction between the sperm cell and the egg cell (Gusti et al., 2009; Nowack et al.,

2006), although this finding was not supported by a recent analysis of the cdc2a mutant,

which detected no preference (Aw et al., 2010). The single sperm cell of the chromatin

assembly factor1 (caf1) mutant can also merge with either the central cell or the egg cell

(Chen et al., 2008). However, using the GCS1/HAP2 promoter to express the DTA toxin in

the generative cell blocked the division that would have generated the two sperm cells.

The resulting single cell expresses markers characteristic of the sperm cell and is able to

fertilize either the egg cell or the central cell, with a strong preference (9:1) for the central

cell (Frank and Johnson, 2009). Discrepancies between results regarding preferential

fertilization of the egg or central cells from the two sperm cells could be related to the use

of mutants. Very recent data using wild-type plants under physiological conditions may

have resolved this issue (Hamamura et al., 2011). Using a photobleaching procedure to

follow the fate of each labelled sperm cell, the study of Hamamura et al. (2011) did not

reveal any preferential fertilization, and concluded that the two sperm cells are

functionally equivalent.

51

On the opposite end of the spectrum, subjecting the embryo sac to several male

gametes is useful in determining the egg and/or central cell involvement in the

polyspermy block phenomenon. The tetraspore (tes) mutant of Arabidopsis can produce

pollen with up to four sperm cells with different ploidy levels (Spielman et al., 1997).

However, fertilization with tes mutant pollen causes the abortion of the seed by genetic

imbalance due to imprinting. The phenotype is rescued by using a methyltransferase1

(met1) mutant background, in which the imprinting mechanism is inhibited (Scott et al.,

2008). Thus, the karyotype of the endosperm and the embryo could be characterized, and

only the karyotype of the endosperm showed signs of multiple fertilizations. In other

words, if the egg and central cell are subjected to several male gametes, only the central

cell becomes polyploid. The fertilized egg cell must therefore produce a signal that blocks

polyspermy (Scott et al., 2008). Hamamura et al. (2011) addressed this issue by observing

the time required for gamete fusion and found no significant difference between egg cell

and central cell plasmogamy, suggesting that polyspermy block may be concurrent.

Male cytoplasmic RNA transfer during fertilization

When the zygote is formed from the fertilized egg cell, the single cell extends to

nearly three times its initial length, at which point an asymmetric division takes place,

forming a round apical cell and an elongated basal cell. While the apical cell becomes the

embryo proper, the basal cell forms the suspensor. Bayer et al. (2009) found that the

YODA MAPKKK may control the asymmetric division of the zygote, for which its activity

depends on a male cytoplasmic RNA transfer occurring during fertilization. Previously,

Lukowitz et al. (Lukowitz et al., 2004) had demonstrated that activation and regulation of

YODA (YDA) MAPKKK activity are required for proper differentiation of the zygote.

Although the yda mutant has defects other than those observed during embryogenesis,

the short suspensor (ssp) mutant phenotype mimics yda only in that respect. While SSP is

transcribed in mature pollen, it is transiently translated in the central cell and the egg cell

after fertilization. SSP encodes a membrane-bound protein which is part of the PELLE/IRAK

52

superfamily. The yda;ssp double mutant is anatomically identical to the single yda mutant,

while the expression of the hyperactive form of YODA reverses the ssp phenotype.

Together, these double mutants suggest that SSP acts upstream from YODA to control

asymmetric division of the zygote (Bayer et al., 2009). YODA is a MAPKKK located

upstream from the MKK4/MKK5 and MPK3/MPK6, all of which are involved in stomatal

development (Wang et al., 2007). It will be interesting to further investigate, via temporal

and spatial knockout, the involvement of this signalling pathway in embryo development.

The MPK3 and MPK6 kinases have already been shown to be involved in ovule

development, as the mpk3(+/-)/mpk6 shows normal megasporogenesis and

megagametogenesis, but impaired development of the integuments, leading to female

sterility (Wang et al., 2008b).

1.2.6 Conclusion

In the last decade, considerable progress was made in the area of cell-cell

communication related to female gametophyte development and double fertilization.

Forward genetics was shown to be a powerful tool for the study of plant reproduction,

and several regulatory genes were isolated. These genes variously encode proteins

involved in signalling, genetic regulation, and the structural integrity of the cell. Most

importantly, several newly characterized mutants are specific to a cell type and have been

useful in dissecting the interplay among the cells of the ovule, the female gametophyte

and those tissues playing a role in double fertilization. Thus, although little is known about

the molecules involved in cell-cell communication, genetic evidence supports their

existence. The female gametophyte has revealed surprising cell-cell communication

mechanisms. Cells are able to communicate amongst themselves using the typical

ligand/receptor kinase signalling pathways, MAPK and histidine phosphorelay

transduction cascades, but are also able to carry out atypical signalling through the

transfer of RNA molecules. The greater use of proteomic tools to characterize protein-

protein interactions with the aim of completing the numerous hypothetical signalling

53

pathways discovered via mutant analysis will surely be part of the next frontier in our

understanding of the intricacies of cell-cell communication in sexual plant reproduction.

1.2.7 Acknowledgements

This work was supported by the Natural Sciences and Engineering Research Council

of Canada (NSERC) and the Canada Research Chair program. E. Chevalier is a recipient of

Ph.D. fellowships from NSERC and from Le Fonds Québécois de la Recherche sur la Nature

et les Technologies (FQRNT); A. Loubert-Hudon is a recipient of an M.Sc. fellowship from

FQRNT; and E. L. Zimmerman is a recipient of a Ph.D. fellowship from NSERC.

1.3 RALF, UN PEPTIDE POTENTIEL DANS LES COMMUNICATIONS

CELLULAIRES LORS DE LA REPRODUCTION

1.3.1 Diversité des gènes de type RALF et implication lors de la reproduction

Beaucoup de petits peptides sécrétés font partie de la grande famille des CRPs

(Cysteine-rich peptides), dont les différentes classes varient surtout au niveau du nombre

et de l’organisation dans la séquence primaire des cystéines (Silverstein et al., 2007). Ces

derniers partagent plusieurs similarités au niveau des propriétés moléculaires, de

l’organisation génomique, la distribution taxonomique, ainsi que de leur expression

spatiale et temporelle. Plus précisément, un peptide signal de sécrétion en N-terminal, un

peptide mature chargé positivement ou polaire avec des résidus cystéines conservés, des

gènes regroupés sur les chromosomes et pour la plupart sans introns, surreprésentés dans

des familles taxonomiques spécifiques et dans les ESTs des structures reproductives, sont

les caractéristiques communes (Silverstein et al., 2007). D’ailleurs, chez Torenia fournieri,

les peptides LUREs appartenant à la sous-classe des Defensin-like, sont sécrétés par les

synergides et attirent le tube pollinique (Okuda et al., 2009); chez Arabidopsis thaliana,

LTP5 pour Lipid Transfer Protein 5, est un régulateur de la croissance du tube pollinique

(Chae et al., 2009); les transcrits de la famille GASA s’accumulent dans les structures

54

reproductives (Aubert et al., 1998) et AtGASA4 influence le développement de la graine

(Roxrud et al., 2007); chez les solanacées, STIG1 contrôle les sécrétions au niveau du

stigmate (Verhoeven et al., 2005) et SCR/SP11 permet la réponse d’auto-incompatibilité

chez les brassicacées (Shiba et al., 2001; Takayama et al., 2000; Takayama et al., 2001). Ce

sont tous autant d’exemples qui démontrent le rôle actif des CRPs dans la régulation de la

reproduction, et ce, dans diverses familles taxonomiques.

FIGURE 8 STRUCTURE DE LA PRÉPROPROTÉINE NTRALF.

RALF a un peptide signal de 23 acides aminés en N-terminal clivé lors de la synthèse/translocation

au niveau de la membrane du réticulum endoplasmique. La proprotéine est repliée dans le

réticulum endoplasmique par la formation de 2 ponts disulfures, possiblement avant le clivage

protéolytique. Ces ponts disulfures sont spécifiques (C18-C28; C41-C47) et essentiels à l’activité du

peptide. La proprotéine subit une maturation post-traductionnelle, possiblement dans le golgi ou

l’apoplaste, libérant le peptide mature de 49 acides aminés, situés en C-terminal de la

proprotéine.

55

Parmi les CRPs, on retrouve notamment les peptides de type RALF, Rapid

Alcalinization Factor (Figure 8, p.54). NtRALF (Nicotiana tabacum) a d’abord été isolé pour

sa capacité à éliciter une réponse d’alcalinisation rapide et prononcée dans une

suspension cellulaire. Son orthologue chez la tomate inhibe le développement des racines

émergentes des graines de tomates et d’Arabidopsis thaliana (Pearce et al., 2001b).

L’inhibition de la division cellulaire semble être la cause, l’incorporation par les cellules

racinaires de H3-thymidine étant fortement réduite en présence du peptide (Moura et al.,

2006). Évaluer à près de 40 chez Arabidopsis thaliana (Jones-Rhoades et al., 2007; Lease

and Walker, 2006; Olsen et al., 2002; Proost et al., 2009; Silverstein et al., 2007), les gènes

de type RALF se retrouvent dans plusieurs banques d’ESTs et sont répandus dans tout le

règne végétal (Pearce et al., 2001b). Chez Medicago truncatula, MtRALFL1 est induit par

les facteurs NOD et sa surexpression affecte négativement les étapes précoces de

formation du nodule (Combier et al., 2008); chez Nicotiana attenuata, l’interférence du

gène NaRALF bloque le développement normal des poils racinaires et favorise

l’élongation de la racine primaire (Wu et al., 2007); chez la canne à sucre (Saccharum

spp.), SacRALF1 affecte l’élongation des cellules de cals et SacRALF1 est exprimé dans les

zones d’élongation des racines et des feuilles (Mingossi et al., 2010) ; chez Arabidopsis

thaliana, la surexpression de AtRALF1 et AtRALF23 cause un phénotype de semi-nanisme

(Matos et al., 2008; Srivastava et al., 2009). Ainsi, les gènes RALFs sont très diversifiés et

semblent avoir divergés pour contrôler des mécanismes cellulaires précis.

Les gènes de type RALF sont également surreprésentés dans les structures

reproductives (Silverstein et al., 2007). Très présents dans le transcriptome du pollen de

plusieurs espèces, dont le brocoli (BoRALF1)(Zhang et al., 2010), Glycine max (Haerizadeh

et al., 2009), Arabidopsis thalina (Becker et al., 2003; Pina et al., 2005; Zhang et al., 2010),

et Brassica napus (Whittle et al., 2010), les peptides RALF semblent de bons candidats

pour réguler l’élongation du tube pollinique (Covey et al., 2010). De plus, lors du

développement de l’ovule, les gènes de type RALF sont exprimés dans différents types

56

cellulaires. La transcriptomique comparative entre les ovules de type sauvage et ino

(inner-no-outer, manque le tégument externe) suggère que AtRALF18 soit présent dans

les téguments externes (Skinner and Gasser, 2009) ; la comparaison des transcriptomes

d’ovules matures et dépourvus de sac embryonnaire (dif1, spl & coa) révèle l’expression

plus spécifique au sac embryonnaire de 4 gènes de type RALF (AtRALF14/18/28 &

at1g52970) et de deux gènes sporophytiques (AtRALF32/33) dont la régulation de

l’expression est dépendante de la présence ou non du sac embryonnaire (Johnston et al.,

2007; Steffen et al., 2007; Yu et al., 2005). Cependant, ces études ont été réalisées à l’aide

de puce ATH1, lesquelles ne couvrent pas tout le génome et principalement manque

beaucoup de petits gènes. D’ailleurs, par « Whole-Genome Tiling microarrays », l’analyse

comparative du transcriptome des ovules de type sauvage et dif1 a permis de mettre en

évidence l’expression plus spécifique au sac embryonnaire de neufs gènes de type RALF

(AtRALF5/10/14/28/29 & at1g52970, at4g09462, at5g19175, at5g27238), dont

AtRALF5/29 semblent plus spécifiques aux synergides par leur absence dans le

transcriptome des ovules myb98 (mutant sans synergides). Alors qu’AtRALF14 et

AtRALF18 sont des gènes ovules spécifiques, AtRALF18 n’est pas modulé par l’absence du

sac embryonnaire (Jones-Rhoades et al., 2007), ce qui confirme les résultats obtenus avec

le mutant ino. Toutefois, Wuest et al. (Wuest et al., 2010) ont montré que le promoteur

de RALF18 est actif dans la cellule centrale, et à un moindre niveau dans les synergides et

la cellule œuf. Ceci met en évidence les limites d’interprétation des résultats apportés par

la génomique comparative, qui souvent ne tiennent pas compte de l’interaction entre les

tissus. Malgré tout, les peptides RALF semblent d’importants régulateurs lors de la

reproduction, et semblent posséder à la fois des rôles communs et spécifiques.

57

1.3.2 Régulation transcriptomique, post-traductionnelle et voie de signalisation

Les gènes de type RALF sont non seulement régulés par leur localisation dans

différents tissus, mais répondent également à plusieurs stimulis. Chez Nicotiana

attenuata, NaRALF est stimulé par des éliciteurs et les UVs, bien qu’aucun phénotype de

sensibilité soit associé aux plantes d’interférence (Wu et al., 2007); chez le peuplier,

ptdRALF2 est inhibé par des traitements au méthyl jasmonate (Haruta and Constabel,

2003). Chez Arabidopsis thaliana, AtRALF23 est inhibé par les brassinostéroïdes

(Srivastava et al., 2009); d’ailleurs, les brassinostéroïdes stimulent la croissance, alors

qu’AtRALF23 inhibe la croissance.

RALF est un petit peptide mature d’environ 5 kDa; cependant, les gènes de type

RALF code pour la plupart pour des préproprotéines qui sont la cible d’endoprotéase

(Figure 8, p.48). AtRALF23 a été montré comme clivé par la subtilase S1P résidente du

golgi. Dans le mutant s1p, la surexpresion d’AtRALF23 ne cause pas de phénotype,

suggérant que le prodomaine inhibe l’activité de la protéine mature (Srivastava et al.,

2009). Cette observation corrèle avec la purification biochimique des peptides actifs

NtRALF, AtRALF1 et SacRALF1 sous forme mature (Haruta et al., 2008; Mingossi et al.,

2010; Pearce et al., 2001b). L’ajout de NtRALF et SacRALF1 à une suspension cellulaire

induit une réponse d’alcalinisation (Mingossi et al., 2010; Pearce et al., 2001b), alors

qu’AtRALF1 permet le relâchement de Ca2+ cytosolique (Haruta et al., 2008). De plus, bien

que AtRALF1 est reconnu et induit un relâchement de Ca2+ cytosolique au niveau de

l’épiderme des racines, ce dernier est exprimé par le tissu vasculaire, ce qui suggère un

mode de communication cellule-cellule (Haruta et al., 2008). Plusieurs évidences laissent

croire que l’effet de RALF est causé suite à la perception par la cellule de ce ligand et

l’activation de plusieurs voies de signalisation. En effet, il a été montré que LeRALF lie

deux protéines membranaires de 120 kDa et 25 kDa; la nature de ces protéines demeure

toutefois inconnue (Scheer et al., 2005). NtRALF active également une voie MAPK et l’effet

d’AtRALF1 sur le Ca2+cyt semble être, en partie, IP3-dépendant. Bien que RALF ne soit pas

58

capable d’induire la transcription des gènes de défense comme la systémine, RALF, tout

comme la systémine et les HypSys, alcalinise le milieu extracellulaire et cause l’activation

d’une MPK de 48 kDa (Felix and Boller, 1995; Pearce et al., 2001a, b; Pearce and Ryan,

2003). Chez Solanum lycopersicon, il s’agit de LeMPK1/LeMPK2 (Holley et al., 2003;

Kandoth et al., 2007). Dans le cas de la systémine, il a été démontré à l’aide de la

fusicoccine, activateur de la H+-ATPase de la membrane plasmique (PMA), que l’inhibition

de la PMA et l’activation de la voie MAPK était deux voies parallèles; la variation de pH

n’active pas la voie MAPK et l’activation de celle-ci ne modifie pas le potentiel

membranaire (Higgins et al., 2007). La ressemblance entre la systémine et RALF nous

incite à proposer un modèle (Figure 9, p.60) dans lequel RALF est perçu par un récepteur

membranaire, lequel conduit i) à l’activation d’une voie MAPK et ii) au relâchement du

Ca2+cyt via la voie du phosphatidylinositol, lequel pourrait être l’investigateur de l’inhibition

de la PMA, comme c’est la cas dans les cellules de garde des stomates (Kinoshita et al.,

1995). L’analyse des racines de plantes d’interférence pour NaRALF montre une

diminution dans l’accumulation de ROS, lequel inhibe l’élongation racinaire (Dunand et al.,

2007), suggérant également la participation de ce second messager dans la transduction

des signaux (Wu et al., 2007).

L’analyse de plantes d’interférence pour le gène NaRALF (irRALF) a révélé une

dynamique intéressante du contrôle de NaRALF sur le pH apoplastique à l’apex des poils

racinaires. Les plantes irRALF présente non seulement une croissance accrue de la racine

primaire, mais une incapacité pour les poils racines de s’allonger correctement. D’une

part, les germes irRALF ne sont pas capables d’acidifier le milieu (pHinitial=6,8),

contrairement aux germes sauvages. De plus, les oscillations de pH à l’apex des poils

racinaires des germes irRALF ont des périodes deux fois plus longues que les germes

sauvages, et l’alcalinisation est plus prononcée. Cette perturbation dans le contrôle du pH

apoplastique résulte au phénotype observé, puisque les germes sauvages montrent le

même phénotype que les germes irRALF lorsqu’ils croîent sur un milieu tamponné à

59

pH=6,8; sur milieu tamponné à pH=5,8, les germes irRALF ont un phénotype plus similaire

au type sauvage. Dans le même ordre d’idée, l’interférence de NaRALF affecte sévèrement

la croissance de N. attenuata dans les sols basiques, et les plantes transgéniques perdent

la compétition lorsqu’elles poussent avec une plante de type sauvage (Wu et al., 2007). À

l’opposé, la surexpression de AtRALF23 chez A.thaliana empêche également celle-ci

d’acidifier le milieu de croissance (Srivastava et al., 2009). Ensemble, ces résultats

montrent que RALF contrôle le pH apoplastique et qu’une dérégulation de RALF empêche

le potentiel membranaire de s’établir correctement et bloque l’acidification du milieu et

perturbe la croissance de la plante.

1.3.3 RALF et la reproduction : un projet de doctorat

RALF est une hormone peptidique importante qui régule diverses voies de

signalisation. Cependant, bien que surreprésentés dans les tissus reproducteurs, les

peptides de type RALF ne sont pas très bien caractérisés au niveau de ceux-ci. Le but de

mon projet de doctorat est d’investiguer le rôle potentiel de plusieurs gènes de type RALF

lors de la reproduction chez Solanum chacoense et Arabidopsis thaliana. L’identification

des gènes de type RALF présents dans la banque d’ESTs d’ovaires de Solanum chacoense

sera suivie par une analyse d’expression exhaustive pour cibler les meilleurs candidats. Par

la suite, la fonction des homologues potentiels chez Solanum chacoense et Arabidopsis

thaliana, de même que certains gènes intéressants selon la littérature et les bases de

données informatiques sera analysée via des mutants. Des analyses physiologiques et

moléculaires seront combinées pour proposer un modèle d’action des peptides RALF lors

de la reproduction.

60

FIGURE 9 MODÈLE DE VOIES DE SIGNALISATION POTENTIELLES POUR LES PEPTIDES RALF.

RALF, via son interaction avec deux protéines membranaires, (a). inhibe une pompe H+-ATPase

causant une alcalinisation du milieu. (b). Parallèlement, l’activation du complexe membranaire

active une voie MAPK qui potentiellement régule la transcription de gènes impliqués dans la

croissance cellulaire. (c). La libération de Ca2+cyt est partiellement contrôlée par une voie de

signalisation IP3-dépendante, possiblement via l’action de la phospholipase C sur PIP2. (d) La

libération de Ca2+cyt est également régulé par une voie IP3-indépendante. (e) La libération de Ca2+

cyt

peut entraîner l’inhibition de la H+-ATPase, régulant le flux de protons au travers de la membrane

plasmique et du coup, la croissance cellulaire.

2. CINQ GÈNES DE TYPE RALF CHEZ SOLANUM CHACOENSE

2.1 LA CARACTÉRISATION DE CINQ GÈNES DE TYPE RALF CHEZ SOLANUM

CHACOENSE APPUIE UN RÔLE DANS LE DÉVELOPPEMENT

Eric Chevalier

Institut de Recherche en Biologie Végétale, Département de Sciences Biologiques,

Université de Montréal, 4101 rue Sherbrooke est, Montréal, QC, Canada, H1X 2B2

2.1.1 Préambule

Ayant comme objectif premier de vérifier si des gènes de type RALF pouvaient

potentiellement réguler la reproduction chez Solanum chacoense, la banque d’EST

disponbile dans le laboratoire de Daniel P. Matton a été criblée. Les gènes de type RALF

extraits de la banque ont par la suite été analysés pour leur patron d’expression respectif

dans différents tissus et suivant le traitement de différentes hormones.

2.1.2 Sommaire

Cinq gènes de type RALF (Rapid Alkalinization Factor), nommés ScRALF1-5, ont été

isolés d’une librairie d’ADNc d’ovules et d’ovaires fécondés de Solanum chacoense. La

séquence peptidique associée à chacun d’eux montrent une grande similarité avec le

peptide RALF identifié chez Nicotiana tabacum, et partagent les caractéristiques

structurelles des polypeptides RALF. Tous les ScRALFs sont modérément à hautement

exprimés à différents stades de la maturation des fruits. ScRALF1 et ScRALF3 sont

exprimés plus spécifiquement dans les ovaires et les fruits en développement, alors que

ScRALF2, ScRALF4 et ScRALF5 sont aussi exprimés dans plusieurs autres tissus. Ainsi,

certains ScRALFs peuvent être impliqués dans la maturation des fruits, et d’autres peuvent

être impliqués dans divers processus développementaux. Les blessures et les traitements

avec différents régulateurs de croissance associés aux mécanismes de défense n’ont pas

d’impact significatif sur l’accumulation des transcrits respectifs des ScRALFs. Ces résultats

suggèrent et supportent d’autres résultats précédents sur le rôle des peptides RALF dans

le contrôle du développement de la plante plutôt que dans la réponse de défense.

62

2.2 CHARACTERIZATION OF F IVE RALF-L IKE GENES FROM SOLANUM

CHACOENSE SUPPORT A ROLE IN DEVELOPMENT

Germain, Hugo; Chevalier, Eric; Caron, Sébastien; and Matton, Daniel P.

Institut de Recherche en Biologie Végétale, Département de Sciences Biologiques,

Université de Montréal, 4101 rue Sherbrooke est, Montréal, QC, Canada, H1X 2B2

Publié dans : Planta (2005) 220: 447-454.

GenBank accession numbers: ScRALF1, AY422824; ScRALF2, AY422825; ScRALF3,

AY422826; ScRALF4, AY422827; ScRALF5, AY655141.

2.2.1 Apport original

Hugo Germain est l’instigateur principal du papier. Il a proposé et réalisé les expériences,

et a écrit la majeure partie du papier. Eric Chevalier l’a soutenu dans la réalisation de bons

nombres d’expériences, et a consacré du temps à refaire plusieurs figures pour assurer la

qualité souhaitée pour une publication, notamment pour les southerns et les northerns.

Eric Chevalier a rédigé ScRALF isolation and sequence analysis, et a suggéré des pistes de

discussion. Ainsi, Hugo Germain et Eric Chevalier sont considérés comme premiers auteurs

à part égal pour cette publication.

Sébastien Caron a participé à la création de la banque d’EST.

Daniel P. Matton a supervisé et subventionné les travaux. Il a de plus contribué à la

correction du papier.

2.2.2 Abstract

Five RALF (Rapid Alkalinization Factor)-like genes, named ScRALF1 to 5, were

isolated from fertilized ovule and ovary cDNA libraries of Solanum chacoense. They

showed high sequence similarities with the RALF protein sequence from Nicotiana

tabacum, and exhibited the characteristic architecture of RALF polypeptides. All ScRALFs

were moderately to highly expressed at some stage of fruit maturation. ScRALF1 and

ScRALF3 were predominantly expressed in ovaries and larger fruits, while ScRALF2,

63

ScRALF4, and ScRALF5 were also expressed in other tissues, indicating that while some

RALFs may be involved in fruit maturation, others could be involved in other

developmental processes. Wounding or treatment of plants with growth regulators

involved in plant defense responses had no significant impact on the mRNA level of any of

these genes. These results suggest and support previous data showing that RALF peptides

are more likely to act as a small peptide involved in plant development than in defense

responses.

2.2.3 Introduction

The extracellular domains of plant receptor kinases confer extreme specificity to

their binding partners (Kajava, 1998; Kobe and Deisenhofer, 1994). Only a few binding

partners, most commonly referred to as ligands, have been isolated in plants, but they

already appear to be very diverse in nature: ethylene is a very small gaseous molecule;

brassinolide is a steroid molecule; cytokinin, one of the classical plant hormones, is a small

molecule derived from a nucleic acid precursor, and others, which appear to account for a

large number of these signaling molecules, are small polypeptide hormones that can

originate from the plant itself (Takayama and Sakagami, 2002) or are of pathogenic (Asai

et al., 2002) or parasitic (Olsen and Skriver, 2003) origin. Some ligands, although very

different in nature, like brassinolide and systemin, might even bind to similar receptors to

trigger different responses (Szekeres, 2003).

Some of these predicted peptides seem to be part of large putative ligand families.

The CLE (CLAVATA3- ESR related) polypeptides appear to be such a family. All CLE

polypeptides have a signal peptide, most are intronless, and all share a highly conserved

carboxyterminal domain composed of 14 amino acids (Cock and McCormick, 2001). Other

families involved in various processes, such as abscission [IDA (inflorescence deficient in

abscission); (Butenko et al., 2003)], sporophytic self-incompatibility [SCR (S-locus cysteine-

rich protein); (Schopfer et al., 1999; Shiba et al., 2001)], or gametophytic self-

64

incompatibility [the small asparagine-rich HT protein; (O'Brien et al., 2002)] have also

been identified. Families of small peptides having either pleiotropic developmental roles

[DVL (Devil); (Wen et al., 2004)] or a nodule-specific expression pattern [NCR (nodule

cysteine- rich); (Mergaert et al., 2003)] were also recently uncovered. The Rapid

Alkalinization Factor (RALF)-like peptides also form such a large family (Olsen et al., 2002).

RALF is a small 5 kDa polypeptide that causes alkalinization of the medium, can stop root

growth, and activates intracellular MAPKs (Pearce et al., 2001b). It was found as a 49

amino acid peptide, but is processed from a larger precursor peptide of 115 amino acids.

Proteolytic processing from a longer precursor was also found to occur in other plant

polypeptide hormones such as phytosulfokine (Yang et al., 1999a) and systemin (Pearce et

al., 2001a). Following N-terminal cleavage of the signal peptide, further N-terminal

processing would occur at well conserved dibasic residues just upstream of the mature

polypeptide. According to a recent review, tobacco RALF binds a 120 kDa protein

concomitantly with a 25 kDa protein (Ryan et al., 2002). An apoplastic localization has also

been recently determined using a RALF-GFP fusion expressed in Nicotiana benthamiana

cells (Escobar et al., 2003). In recent database searches, 34 RALF-like genes were found in

the Arabidopsis thaliana genome (Olsen et al., 2002; Ryan and Pearce, 2001).

Because it has the property of inducing rapid alkalinization of the cell culture

medium, as well as the ability to induce MAPK activation (like tobacco systemin, with

which it was concomitantly isolated), RALF was originally associated with plant wound or

defense responses. This was counterbalanced by the fact that, unlike systemin, it could

not induce the synthesis of tobacco trypsin inhibitor in leaves treated with the purified

peptide. The only biological activity associated with RALF was its ability to arrest root

growth (Pearce et al., 2001b). Furthermore, recent experiments have shown that a poplar

RALF could not be induced by chitosan or Phytophtora megasperma elicitors, and the

expression of one RALF was decreased following addition of methyl jasmonate (MeJA) to

the culture medium (Haruta and Constabel, 2003). In addition, results obtained by Olsen

65

et al. (2002) showed no alteration in the expression level of seven RALFs in a mpk4

background (constitutive systemic acquired resistance), nor in the ctr1 (constitutive

ethylene response) mutant. Although alkalinization of the medium is often related to

defense responses (Bolwell, 1995), the inability to induce RALF by defense response

elicitors suggested that RALF could play other roles in planta, such as a developmental

role, as pointed out by Pearce et al. (2001b).

A Blast search for RALF-like peptides against our internal EST database generated

from ovary tissues from S. chacoense (a close relative of tomato and potato) and enriched

for rare mRNAs, allowed us to find five new members of the RALF peptide family. RNA gel

blots were used to gain further insight into the expression profiles of these putative

peptides in various tissues, and to established if their expression profiles were altered

when the plant was submitted to various plant growth regulators, stress treatments, or

following developmental cues. We provide evidence that expression of the RALF peptide

cDNAs is not modulated by wounding or stress hormones, and that expression is tissue-

specific, thus suggesting that these peptides most probably play a developmental role in

plants.

2.2.4 Materials and methods

cDNA library construction and sequence analysis

Solanum chacoense RALF sequences (ScRALF) were found using both the complete

tobacco original RALF peptide (NtRALF) sequence, and highly conserved short amino acid

sequence motifs found in published RALF sequences in a Blast search (Altschul et al.,

1990) against our internal S. chacoense EST database. This EST database was generated by

a modified selection screen based on a virtual subtraction procedure (Li and Thomas,

1998), using fertilized ovary tissues as the starting material. Briefly, the cDNA libraries

were prepared from 2- to 6-day post-pollination depericarped ovaries and hand-dissected

ovules from 7 to 17 days-after-pollination ovaries in the Uni-ZAP vector following the

66

manufacturer’s instruction (Stratagene, La Jolla, Calif.). The phage libraries were

converted to plasmid cDNA library by mass excision. Colonies (50,000) were transferred to

positively charged nylon membranes and denatured in 0.5 N NaOH and 1.5 M NaCl. The

resulting membranes were hybridized with a probe derived from α-32P dATP random-

labeled cDNA leftovers (library target tissues) obtained during the library construction

procedure, and were exposed at -8 C with one intensifying screen on Kodak Biomax MR

film (Interscience, Markham, ONT, Canada). The cDNA probes produced correspond

exactly to the abundance of each mRNA species found in the tissue tested. Rare mRNA

species are underrepresented and thus, make poor probes. This enabled selection of

weakly expressed genes. Of the 50,000 colonies plated, only the lowest fifth in expression

level (as determined by densitometric scans and visual inspection) were selected for

sequencing on an automated sequencer (ABI DNA analyzer 3700). RALF sequences were

aligned using ClustalX and phylogenetic trees were inferred using neighbor-joining (and

parsimony) in PAUP 4.0b10 (Swofford, 2002). RALF homologues, according to Olsen’s

classification (Olsen et al., 2002), were assigned to the neighbor(s) on the closest branch.

Phytohormone and wounding treatments

All plant material was collected from S. chacoense Bitt. genotype G4 (self-

incompatibility alleles S12S14). For fertilization-related events, S. chacoense genotype V22

(self-incompatibility alleles S11S13) was used as the pollen donor. These genotypes were

obtained from crosses between line PI 458314 (self-incompatibility alleles S11S12) and

line PI 230582 (self-incompatibility alleles S13S14) originally obtained from the Potato

Introduction Station (Sturgeon Bay, Wis.) (Sint Jan et al., 1996). Phytohormone treatments

were performed as described previously (Lantin et al., 1999) with the following

compounds: Tween (control), abscisic acid (ABA), jasmonic acid (JA), salicylic acid (SA),

methanol (control), MeJA and trans-2-hexenal (HEX). Briefly, flowers and leaves were

sprayed with an aqueous solution (in 0.05% Tween) of either 50 mM ABA, 50 mM JA

(mixed isomers), 5 mM SA, or 0.05% Tween. Tissues were collected 48 h post-treatment.

67

For wounding, forceps were used to slightly tweeze leaves. For volatile treament, MeJA or

HEX were first diluted to 0.1 M in ice-cold methanol and 250 µL of the compound

(equivalent to 10mL/L air space) was added to a piece of Whatman paper that was placed

in an air tight container along with the plant. As a control, 250 µL methanol was applied in

the same way. Treatment with each volatile compound was applied to distinct plants and

tissues were collected after 6 h and 48 h.

Isolation and gel blot analysis of RNA and DNA

Total RNA was isolated as described previously (Jones et al., 1985). RNA from

tissues that were wounded or treated with phytohormones was extracted using the

RNeasy Plant Mini Kit (Qiagen; Mississauga, ONT, Canada). The RNA concentration was

determined by measuring its absorbance at 260 nm and verified by agarose gel

electrophoresis and ethidium bromide staining. Equal loading of total RNA on RNA gel

blots was verified with a S. chacoense 18S RNA probe. Genomic DNA was extracted using a

modified version of the protocol of Murray and Thompson (Murray and Thompson, 1980).

RNA and DNA gel blot analyses were performed as described previously (O'Brien et al.,

2002). Probes for RNA and DNA blots were synthesized using a random-labeled PCR kit

(Ambion, Austin, Tex.). Membranes were exposed at room temperature on an europium

screen and scanned on a Typhoon 9200 Phosphorimager (Amersham, Baie d’Urfé, QC,

Canada).

2.2.5 Results

ScRALF isolation and sequence analysis

Using a negative selection procedure, we produced a small EST database of weakly

expressed genes in S. chacoense ovules or ovaries after fertilization; 7,741 ESTs were

sequenced and annotated, and statistical analysis of our data set showed that our

subtraction procedure highly enriched our EST pool for unique sequences (82% unigenes).

We used the RALF peptide sequence from N. tabacum for a Blast search against our EST

68

database and retrieved five distinct homologues from S. chacoense, hereafter named

ScRALF1, ScRALF2, ScRALF3, ScRALF4 and ScRALF5 (Figure 10, p.69). According to

phylogenetic analysis performed using both neighbor-joining and parsimony methods with

the full-length protein or the putative mature polypeptide, ScRALF proteins 1–3 are

related to A. thaliana AtRALF 24/31, AtRALF 22/23/33, and AtRALF 34 respectively, while

ScRALF4 and 5 are related to AtRALF 27 (Figure 11, p.70).

The ScRALF1 clone (731 bp) codes for a predicted open reading frame of 174

amino acids, with two putative in-frame translation start sites found at position 23 and 40,

with no stop codon found upstream. A similar situation is found in the tobacco RALF

cDNA, where 44 in-frame amino acids are found before the first methionine identified.

Although both putative ScRALF1 starting methionines are in non-optimal translation

initiation context (Joshi et al., 1997; Kozak, 1999), an analysis for the presence of a signal

peptide (predicted in all RALF-like proteins described so far) strongly suggests the

presence of such a signal immediately downstream of the second methionine. If this

methionine is taken as the translation start site, the deduced ScRALF1 protein has the

characteristic length of most other RALF sequences (this shorter RALF sequence was thus

used for the sequence alignment shown in Figure 10, p.69). ScRALF1 has all the features

typical of RALF peptides, including an acidic region preceding the dibasic residues, an YIXY

motif, and four conserved cysteines involved in disulfide bridges in the mature protein.

ScRALF2, our closest homologue to NtRALF (Figure 11, p.70), encompasses 789 bp

and showed 56% identity (69% similarity) with PtdRALF1 and 52% identity (65% similarity)

with PtdRALF2 from hybrid poplar (Haruta and Constabel, 2003). Its signal peptide is 87%

identical to that found in NtRALF. The overall identity between ScRALF2 and NtRALF is 87%

(93% similarity) and they share 94% identity (99% similarity) in the highly charged C-

terminal domain. All domains found in RALFs are present, including the YIXY motif, which

for three of the five ScRALFs analyzed was YISY. Based on this very high amino acid

sequence similarity, ScRALF2 is most probably the true orthologue of NtRALF.

69

Furthermore, the phylogenetic analysis (Figure 11, p.70) also showed that ScRALF2 is more

closely related to NtRALF and PtdRALF1 and 2 than to any AtRALFs.

ScRALF3 encodes a cDNA of 688 bp. This ScRALF is different from the preceding

ScRALFs since it does not have the dibasic residues suspected to be involved in

polypeptide maturation. This motif is shared by 59% (20/34) of AtRALFs (Olsen et al.,

2002). ScRALF3 has GR residues instead of RR, which could be the result of an A ⟶ G

point mutation. The spacing between the conserved cysteines also differs from the

conserved consensus sequence. Identity with NtRALF C-terminal domain is 76% (87%

similarity) and other features such as the signal peptide, the acidic sequence and the YIXY

motif are present.

FIGURE 10 SEQUENCE ALIGNMENT OF THE FIVE DEDUCED RAPID ALCALINIZATION FACTOR (RALF)-LIKE PROTEINS

FROM SOLANUM CHACOENSE (SCRALF1 TO 5) WITH THE ORIGINAL NICOTIANA TABACUM RALF (NTRALF).

Location of conserved motifs found in RALF sequences are identified. Arrowhead (topped with the

corresponding RALF name), predicted signal peptide cleavage sites; dashed line, acidic region;

scissors, putative mono- or dibasic cleavage site where further N-terminal processing would occur;

chevrons, conserved YIXY motif; solid line, highly conserved C-terminal domain; asterisks,

conserved cysteine residues involved in the formation of disulfide bridges.

70

FIGURE 11 PHYLOGENETIC DISTANCE ANALYSIS (NEIGHBOR-JOINING) OF RALFS.

Amino acid sequences from the predicted mature RALF peptide were aligned using ClustalX and

the tree was inferred using PAUP 4.0b10; 1,000-bootstraps were used to calculate branch support.

AtRALF21 was used as an outgroup as it was the most distantly related to all our ScRALFs. The

bootstrap support values are indicated on the left.

71

ScRALF4 and 5 are by far our least similar ScRALFs when compared to the original

NtRALF sequence (Figure 10, p.69), and clearly group together in the phylogenetic analysis

(Figure 11, p.70). ScRALF4 codes for a small cDNA (532 bp) and has a signal peptide, the

acidic region, and a single basic residue. The YIXY motif (present in 56% of AtRALFs) is

replaced by KLSY and it has the four conserved cysteines. Finally, it shares only 23% overall

amino acid sequence identity (42% similarity) with NtRALF. ScRALF5 codes for an EST of

517 bp and shares 75% identity with ScRALF4 (20% overall amino acid sequence identity

and 35% similarity with NtRALF). ScRALF5 shares the same features found in ScRALF4,

except that the YIXY motif is replaced by KLNY.

All of the ScRALFs found share four universal motifs found in RALFs: an N-terminal

signal peptide sequence; an acidic region; a highly charged C-terminal tail; and the

presence of four conserved cysteines in the predicted mature peptide. Other domains,

such as the dibasic residues located immediately upstream of the predicted mature

peptide, and the YIXY motif are present in our ScRALF sequences in proportions similar to

the situation found in the AtRALFs (Olsen et al., 2002).

ScRALF1–5 are single-copy genes in S. chacoense

The full-length clone of each ScRALF was used as a probe to hybridize digested

genomic DNA in order to obtain information about their gene copy number in the S.

chacoense genome (Figure 12a, p.74). For ScRALF1, one hybridizing fragment was

detected with EcoRI, and two fragments were detected with the restriction enzymes

EcoRV and HindIII. Since the ScRALF1 cDNA contained no EcoRI site and one HindIII site,

one and two fragments, respectively, were expected for these enzymes. Since no EcoRV

site was found in the ScRALF1 cDNA, the two fragments observed with the EcoRV

digestion could result from the presence of a restriction site in a putative intron. For

ScRALF2, no restriction sites for the three enzymes tested are present in the cDNA

sequence. As expected, only one hybridizing fragment was detected with EcoRI and

EcoRV. For HindIII, two bands were observed. As in the case of ScRALF1, this second

72

unexpected fragment could be explained by the presence of a restriction site in a putative

intron. Cross-hybridization with a highly related member of the family could also explain

this hybridization pattern, although this is quite unlikely since a similar pattern would have

been obtained for the other two restriction enzymes. For ScRALF3, 4 and 5, only one

hybridizing fragment was detected in EcoRI-, EcoRV- and HindIII-digested genomic DNA, as

expected from the absence of these restriction sites in the corresponding cDNA

sequences. Although ScRALF4 and 5 showed an identical banding pattern on DNA gel blot

analysis, the size of the bands were consistently different, being slightly shorter for

ScRALF5. Furthermore, in RNA gel blot analyses (Figure 12b, p.74), no crosshybridization

was detected between ScRALF4 and ScRALF5 and they migrated at different sizes. This,

combined with the phylogenetic analysis, suggests that these genes could be the result of

a recent duplication event. These results strongly suggest that all five ScRALFs are single

copy genes in S. chacoense. Furthermore, the lack of cross-hybridization between our five

ScRALFs under the hybridization and washing conditions used, indicates that the mRNA

expression patterns obtained (see below) are also specific to each ScRALF tested.

ScRALF1–5 mRNA expression in mature tissues

ScRALF1 is expressed exclusively in ovary tissues, particularly in the placenta during

later stages of fruit development (Figure 12b, p.74). No expression profile comparison

could be established for this clone, since its closest Arabidopsis homologues, AtRALF24

and AtRALF31, have not yet been analyzed at this level (Olsen et al., 2002). ScRALF2

showed expression in all tissues tested (Figure 12b, p.74). It was most strongly expressed

in roots, stems and petals. Strong expression could also be detected during fruit

development. AtRALF33 (one of the ScRALF2 homologs) also showed strongest expression

in stems and roots. ScRALF3 was expressed mainly in ovaries following fertilization

(fertilization takes place from 36 h to 48 h post-pollination in S. chacoense). Expression in

young fruits gradually declined after 8 days after pollination. Weaker expression levels

could also be detected in leaf, petal, style and pollen. Since S. chacoense is a self-

73

incompatible species, we took advantage of this reproductive barrier to determine if

ScRALF3 was fertilization-induced or if its expression level was modulated by pollination.

After a self-incompatible pollination, no strong increase in ScRALF3 mRNA levels could be

observed in ovaries, 24 h, 48 h or 96 h after pollination (data not shown), confirming that

the strong increase observed was fertilization-induced. The Arabidopsis ScRALF3 putative

homologue (AtRALF34) was shown by RT-PCR to be expressed in various tissues including

stem, leaf, and root, but no expression was detected in flowers or siliques containing

mature seeds (Olsen et al., 2002). These differences might be explained by the low

expression observed in nonfertilized flowers in S. chacoense and the gradual decrease in

ScRALF3 expression observed in maturing fruit. ScRALF4 showed strong expression in

floral organs, including style and petals, with a peak accumulation in ovaries and young

fruits (Figure 12b, p.74). ScRALF5 showed a similar expression pattern, albeit

weaker(Figure 12b, p.74). Strong expression in leaf was also detected for these two

ScRALFs. ScRALF4 mRNA has an apparent size of 541 nt whereas that of ScRALF5 is 710 nt.

Therefore, the expression profile determined for these two highly similar ScRALFs was

specific. Their almost identical expression pattern also suggests that these genes are the

result of a recent duplication event and that their respective promoter regions have not

significantly diverged.

Is ScRALF expression modulated by wounding or growth regulator treatments?

In order to establish if ScRALFs could be induced by stress-related hormones,

mRNA was extracted from tissues that had been submitted to wounding or various

phytohormone and stress hormone treatments. The different treatments tested were:

wounding, ABA, JA, SA, and at 6 h or 48 h post-treatment, the two volatile compounds

used were HEX and MeJA (Tween, methanol 6 h and methanol 48 h were used as

controls). ScRALF1 showed induction following treatment with MeJA in all tissues tested

as well as following HEX treatment in leaves (Figure 13a–c, p.75). ScRALF2 is induced in

styles by wounding (Figure 13b, p.75). Although Haruta and Constabel (2003) tested MeJA

74

with PtdRALF1 and PtdRALF2, we cannot compare their results with ours due to

differences in the experimental set-up (treated cell cultures compared to whole plants in

this study). ScRALF3, already very weak in RNA gel blot analyses, could not be detected in

any of the blots with RNA from treated plants. ScRALF4 and ScRALF5 expression was

mostly unaffected by these treatments in leaves or styles, but was slightly induced in

ovaries following HEX or MeJA, as early as 6 h after treatment (Figure 13c, p.75).

FIGURE 12 (A) DNA GEL BLOT ANALYSIS AND (B) RNA GEL BLOT ANALYSIS OF THE FIVE SCRALF GENES.

(a) Genomic DNA (10 ug) was digested with EcoRI, EcoRV or HindIII. Membranes were exposed for

2 days as describeb in Materials and methods and stripped with Ambion StripEZ. (b) Total RNA (10

ug) was used for each tissue. Full-length cDNA clones were used as probes. 18S-1 was used as a

control for loading of ScRALF1,3 and 4, and 18S-2 for ScRALF2 and 5. ScRALF1,2,4 and 5 were

exposed for 2 days, ScRALF3 was exposed 4 days on a europium phosphoscreen. Calculated sizes

for ScRALF1, ScRALF2, ScRALF3, ScRALF4 and ScRALF5 were 801, 766, 680, 541 and 710 nucleotides

respectively.

75

FIGURE 13 EFFECT OF WOUNDING AND VARIOUS STRESS-RELATED HORMONES ON MRNA LEVELS OF FOUR SCRALF

IN (A) LEAF, (B) STYLE AND (C) OVARY.

Total RNA (10 ug) was probeb with full-length ScRALF clones. 18S-1 was used as a control for RNA

loading of ScRALF1 and 2, and 18S-2 for ScRALF4 and 5. ScRALF3 is not shown, since it was barely

detectable on RNA gel blots.

76

2.2.6 Discussion

RALF polypeptides were initially isolated along with systemin in a search for media-

alkalinization inducing peptides (Pearce et al., 2001b). Because it was found to cause very

rapid alkalinization of the medium (faster than systemin) and since, like systemin, it could

trigger a MAPK response, RALF was first associated with the plant defense response. Later,

it was shown that RALF could not induce the synthesis of the tobacco trypsin inhibitors

when supplied to tobacco plants (Ryan et al., 2002). In poplar, a RALF homologue was also

able to induce medium alkalinization faster than other elicitors, but could not induce the

defense response gene PHENYLALANINE AMMONIA LYASE (PAL) (Haruta and Constabel,

2003). For these reasons it was suggested that RALF is most probably not involved in plant

defense responses. We have identified five RALF-like genes that share a similar

architecture with previously described RALFs from Nicotiana and Arabidopsis (Olsen et al.,

2002): an amino terminal signal peptide followed by an acidic region located upstream of

monobasic or dibasic residues. Although the presence of a pair of basic residues was

hypothesized to be important for the proteolytic cleavage of the RALF preprotein (Pearce

et al., 2001b), closer examination of RALF sequences found in A. thaliana, as well as of our

ScRALFs, indicates that only 59% of AtRALFs and 40% of the ScRALFs described here share

this motif. Monobasic cleavage sites have also been found in proteins from vertebrates

and insects (Veenstra, 2000), suggesting that other motif(s) surrounding the mono- or

dibasic amino acid residues might be important for cleavage site selection. These remain

to be determined in plants. One such motif might be the presence of an acidic region

found immediately upstream of the basic residues as well as the YIXY motif found

immediately downstream of the predicted cleavage site.

Conserved domains of the putative active polypeptide are a YIXY domain followed

by a highly conserved C-terminal domain composed of a stretch of amino acids ending 2

residues after the last conserved cysteine (Figure 10, p.69). The mature polypeptide also

contains two conserved cysteine pairs involved in the formation of disulfide bridges. The

77

ScRALFs share high sequence similarity with the mature tobacco RALF peptide and contain

most of the classic features associated with RALF amino acid sequences. In addition, we

noticed that the conserved C-terminal tail was composed mainly of charged and polar

amino acids, which may affect the tertiary structure of the polypeptide. This region is

presumably exposed to the surrounding environment and therefore available for protein-

protein interactions.

Modulation of the expression level of ScRALFs following treatment with stress-

related hormones or wounding was very subtle. The weak variation observed over a wide

array of treatments supports the idea that RALF-like peptides play a developmental role

rather than a defense-related role, a hypothesis suggested previously by other authors

(Haruta and Constabel, 2003; Olsen et al., 2002; Pearce et al., 2001b). Expression of the

five ScRALFs seemed to be more influenced by physiological or developmental cues. One

interesting finding in our analysis is that while expression of the ScRALFs is rather weak at

the time of pollination and fertilization (corresponding to 0 h and 48 h, respectively) it is

induced to strong levels at various times during the fruit maturation process. In the case

of ScRALF1 and ScRALF2, the peak in expression in fruit seems to occur in the placenta

between 8 and 12 days after pollination, while ScRALF3 peaks at an earlier timepoint (96h

to 8 days), and ScRALF4 and ScRALF5 do not actually exhibit a defined peak in expression

but have a broader expression pattern, being strong from 96 h and later. Interestingly,

some ScRALFs, e.g., ScRALF1 and ScRALF3, appear to be expressed almost exclusively in

ovary tissues and fruits while the two others, ScRALF2, ScRALF4, together with ScRALF5,

showed expression in other tissues. Expression in fruits sometimes appears identical as in

the case for ScRALF1 and ScRALF2 (Figure 12b, p.74), but remains different in other

tissues, indicating that function may overlap in fruits but may differ in vegetative and

other reproductive structures. Another noteworthy observation is that ScRALF2, our

closest homolog to N. tabacum RALF (87% identity, 93% similarity), is the only one of our

ScRALFs to show expression in roots. The NtRALF peptide was shown to stop root growth

78

when supplemented to the medium (Pearce et al., 2001b). Therefore ScRALF2 could also

potentially act in roots as a negative regulator of root growth.

Although no bona fide receptor has been found to interact with the small RALF

peptides, they have all the characteristic features to be added to a growing pool of small

putative peptide ligands in plants. Interestingly, one RALF peptide was recently found to

interact with the leucine-rich repeat domain of a pollen-specific PEX protein (Bedinger et

al., 2003). The leucine-rich repeat domain is also the most common motif found in

ectodomains of plant protein receptor kinases (Shiu and Bleecker, 2001), with which many

small ligands might interact. The fact that all RALFs tested display different expression

patterns suggests that each RALF peptide will exert a different physiological or

developmental role, as determined for some members of the CLE peptide family, such as

the CLV3 peptide active in shoot apical meristem development (Fletcher et al., 1999) and

the CLE19 peptide active in root meristem growth (Casamitjana-Martinez et al., 2003).

Assignment of specific roles to each member of the RALF peptide family awaits the

production and screening of transgenic plants modulated in their expression level, either

through overexpression or silencing.

2.2.7 Acknowledgements

Hugo Germain and Eric Chevalier contributed equally to this work. This work was

supported by the Natural Sciences and Engineering Research Council of Canada (NSERC).

H. Germain and E. Chevalier are the recipients of a Ph. D. and an M. Sc. fellowship award,

respectively, from NSERC. This work was also supported by the Canadian Foundation for

Innovation and by the Canada Research Chair program (D.P. Matton). We also thank

Gabriel Teodorescu for plant care and maintenance, Simon Joly for phylogenetic analysis,

and Homère Ménard-Lamarre and François Major (Université de Montréal) for setting up

our bioinformatic facility.

3. Implication de ScRALF3 dans la reproduction

3.1 COMMUNICATION CELLULE -CELLULE ENTRE LE SPOROPHYTE ET LE

GAMETOPHYTE FEMELLE VIA LA SÉCRÉTION D ’UN PEPTIDE RALF

Eric Chevalier

Institut de Recherche en Biologie Végétale, Département de Sciences Biologiques,

Université de Montréal, 4101 rue Sherbrooke est, Montréal, QC, Canada, H1X 2B2

3.1.1 Préambule

Germain et al. (2005) ont précédemment démontré que les cinq gènes ScRALFs,

bien que tous présents dans les ESTs d’ovaires fécondés de Solanum chacoense, ont

potentiellement des rôles distincts dans les différents processus physiologiques des

végétaux. Deux gènes, ScRALF1 et ScRALF3, se démarquent par leur patron d’expression

exclusif aux tissus femelles et aux ovaires fécondés. Puisque les intérêts du laboratoire de

recherche se concentrent essentiellement aux événements de signalisation entourant la

double fécondation, des plantes transgéniques interférant avec leurs transcrits respectifs,

de même que les surexprimant, ont été analysées. Le chapitre suivant sera consacré aux

résultats obtenus suite à l’analyse physiologique des mutants pour le gène ScRALF3.

3.1.2 Sommaire

Dans le but d’identifier un rôle potentiel des peptides RALF lors de la reproduction

et de l’embryogénèse, des plantes transgéniques d’interférence et de surexpression pour

le gène ScRALF3 ont été analysés. ScRALF3 est un gène dont les transcrits s’accumulent

suivant la fécondation, et pour lequel l’expression est dépendante de l’auxine et

indépendante de la gibérelline. La régulation négative des transcrits ScRALF3 par

interférence cause un phénotype de petits fruits chez près de 60% des plantes

transgéniques. L’absence du développement des graines semble responsable de ce

phénotype. Les analyses cellulaires montrent que le développement du gamétophyte

femelle est grandement perturbé et n’atteint la maturité que dans 40% des cas. Le

positionnement des noyaux, tout comme l’asynchronicité des divisions, semblent

80

responsables du blocage observé lors de la progression de la mégagamétogénèse.

L’expression de 35S ::ScRALF3 :GFP dans des cellules d’oignon montrent que la

préproprotéine passe par la voie vacuolaire centrale, et qu’elle subit un clivage

protéolytique, tel qu’observé chez des transgéniques de S.chacoense. L’isolement du

promoteur de ScRALF3, combiné à des analyses d’expression, northern et in situ, et via

des transgéniques ScRALF3 ::GUS, révèle une localisation tissulaire des transcrits

principalement au niveau du sporophyte. Le peptide ScRALF3 est donc un candidat

potentiel pour réguler les communications cellule-cellule entre le sporophyte et le

gamétophyte.

3.2 CELL-CELL COMMUNICATION BETWEEN THE SPOROPHYTE AND THE

FEMALE GAMETOPHYTE THROUGH A SECRETED RALF-L IKE PEPTIDE

Chevalier, Eric; Loubert-Hudon, Audrey; and Matton, Daniel P.

Institut de Recherche en Biologie Végétale, Département de Sciences Biologiques,

Université de Montréal, 4101 rue Sherbrooke est, Montréal, QC, Canada, H1X 2B2

En préparation pour : The Plant Journal

Keywords: ScRALF3, female gametophyte, sporophyte, cell-cell communication, signalling

Abbreviations: RALF: Rapid alkalinization factor

3.2.1 Apport original

Daniel P. Matton est le directeur du laboratoire. Il a subventionné les recherches et

participer à la discussion et au suivi de celles-ci, sans oublier la correction du papier.

Audrey Loubert-Hudon a collaboré avec Eric Chevalier dans l’analyse phénotypique des

mutants. Elle a isolé le promoteur de ScRALF3 et créer les plantes transgéniques

exprimant la β-glucoronidase sous contrôle du promoteur de ScRALF3. Elle a participé aux

analyses d’expression in situ. En ce qui a trait à la rédaction, Audrey Loubert-Hudon a

apporté sa contribution en écrivant l’introduction.

81

Eric Chevalier est l’instigateur principal de ce projet de recherche. Il est responsable de

toutes les plantes transgéniques créées dans le cadre de ce projet (à l’exception de celles

mentionnées précédemment); il est responsable de l’analyse des résultats et de

l’interprétation de ceux-ci; il a guidé de façon presque totalement autonome ses

recherches en tentant de créer des liens entre les analyses d’expression, les analyses

biochimiques et le rôle physiologique de ScRALF3; il a supervisé en grande partie les

travaux réalisés par Audrey Loubert-Hudon. La rédaction du papier a été effectuée en

majeure partie par Eric Chevalier.

3.2.2 Abstract

Small peptides have been shown to regulate numerous aspects of plant

development through cell–cell communication. These signaling events are particularly

important during reproduction, regulating gamete development and embryogenesis.

Rapid alkalinization factor (RALF)-like genes, a large gene family that encodes secreted

peptides, have specific or ubiquitous expression patterns. Previously, five RALF-like genes

with potential involvement during reproduction were isolated from Solanum chacoense.

Here, we show that ScRALF3 is an important peptide regulator of female gametophyte

development. Its expression, which is auxin-inducible, is strictly regulated before and after

fertilization. Down-regulation of ScRALF3 expression by RNA interference leads to the

production of smaller fruits that produce fewer seeds, due to improper development of

the embryo sacs. Defects include loss of embryo sac nuclei polarization, as well as an

increase in asynchronous division, accounting for cellular dysfunctions and premature

embryo sac development arrest during megagametogenesis. ScRALF3 is expressed in the

sporophytic tissue surrounding the embryo sac, the integument and the nucellus, as

revealed by in situ hybridization and GUS staining. As expected for a secreted peptide,

fluorescence from an ScRALF3–GFP fusion construct is detected throughout the secretory

pathway. Therefore, the ScRALF3 secreted peptide may be directly involved in the

82

regulation of multiple aspects of cell–cell communication between the female

gametophyte and its surrounding sporophytic tissue during ovule development.

3.2.3 Introduction

Coordination of development by cell–cell communication is essential to ensure the

integrity of the plant and to make possible the production of a viable progeny. Stem cell

maintenance, cell differentiation, stomatal development, recognition of pathogens and

nodulation, pollen–pistil interactions, and numerous aspects of reproductive development

rely heavily on intercellular communications (Chevalier et al., 2011; Higashiyama, 2010;

Katsir et al., 2011; Marshall et al., 2011; Matsubayashi and Sakagami, 2006). Many

interesting molecules, including small RNAs, reactive oxygen species, peptides and plant

hormones, are involved in cellular signaling (reviewed by (Santner et al., 2009; Van

Norman et al., 2011). Therefore, cell–cell communication may occur via long-distance

signaling between organs or between cell layers, as within the same cell layers, to specify

cellular identity and function.

During plant sexual reproduction, the pollen tube penetrates the ovule through the

micropyle to reach the female gametophyte (FG) or embryo sac (ES). To allow double

fertilization, the ES must have a precise organization, and intercellular communications

are therefore essential during its development. The Polygonum-type developmental

pattern, the most frequent within flowering plant species (Friedman and Ryerson, 2009;

Maheshwari, 1950), may be separated in two major steps: megasporogenesis and

megagametogenesis (Christensen et al., 1997). Megasporogenesis produces one

functional megaspore (FM) within the nucellus cells after two meiotic divisions and

programmed cell death of haploid spores. Concomitantly, integument(s) grow from the

first and second layers of the primordium to cover/protect the nucellus and the ES

(Robinson-Beers et al., 1992; Smyth et al., 1990). Megagametogenesis starts when the FM

undergoes three successive rounds of mitosis within a syncytium to produce eight nuclei.

83

The first mitotic division occurs in a chalaza/micropyle axis, leading to an equal number of

nuclei at both ends of the ES. After repositioning of the nuclei, cellularization starts and

the ES becomes a mature seven-cell structure with three antipodals (1n) at the chalazal

end, a central cell (2n), and two synergids (1n) and the egg cell (1n) at the micropylar end.

The antipodals degenerate in most cases before or after fertilization (Christensen et al.,

1997). This architecture allows double fertilization with the two sperm cells to create a

diploid zygote and a triploid endosperm to produce viable seeds.

In recent years, genetic studies in Arabidopsis thaliana have provided supporting

evidence for a dynamic interplay between the ES cells. Degeneration of the central cell in

agamous-like61/diana disrupts the identity of all gametophytic cells, showing that

intercellular interactions are an important aspect in the regulation of FG development

(Bemer et al., 2008). Programmed cell death of the antipodals appears to be regulated in

part by this interaction with the central cell (Kagi et al., 2010). The egg cell also appears to

be essential for the fate of all gametophytic cells. Originally, both gametic cells (egg and

central cell) were thought to control cell fate maintenance within the ES through the

LACHESIS (LIS)-dependent RNA processing pathway (Gross-Hardt et al., 2007; Moll et al.,

2008). However, only specific down-regulation of LIS in the egg cell by RNAi affects cell

fate maintenance of all the gametophytic cells, revealing a predominant role for the egg

cell in this process (Volz et al., 2012).

According to the structure/function relationship between the ES and the ovule in

double fertilization, the development of one is dependent on that of the other. Small

RNAs are produced within the L1 cell layer of the primordium and transported

symplastically into the internal layers to prevent differentiation of an additional FM from

sporophytic tissue (Olmedo-Monfil et al., 2010). Moreover, in A. thaliana, an auxin

gradient appears to control cell differentiation within the ES, with the highest

concentration associated with synergid cell fate (Pagnussat et al., 2009). The eostre

mutant supports this position-dependent signaling pathway, whereby a nucleus that is

84

slightly mis-positioned with respect to the center of the ES after the eight-nucleate stage

results in the development of two egg cells and one synergid (Pagnussat et al., 2007).

Interestingly, auxin accumulates first at the tip of the nucellus (Pagnussat et al., 2009),

suggesting possible cross-talk between the FG and the sporophytic tissue.

Despite the fact that few signal molecules have been identified, intercellular

interactions appear to occur between the ES and the surrounding maternal tissue.

Comparative transcriptomic analysis of A. thaliana mutants lacking an ES (sporocyteless

and coatlique) revealed up-regulation of 527 genes in the integuments, implying

communication from the ES toward the sporophyte (Johnston et al., 2007). Signaling in

the other direction (cross-talk) is also essential, as sporophytic mutations affecting the

integuments result in ES developmental arrest. Mutants such as bel1, aintegumenta (ant)

and inner no outer (ino), lacking both integuments (bel1 or ant) or only one (ino), show an

arrest of ES development at the FM or eight-nucleate stage (Baker et al., 1997;

Christensen et al., 1997; Robinson-Beers et al., 1992; Schneitz et al., 1997). So far,

approximately 20 ovule sporophytic mutants with ES defects have been characterized,

mostly with primary integument defects (Bencivenga et al., 2011).

Cysteine-rich peptides are an important class of small peptides that are abundant

in reproductive tissues and mediate diverse aspects of cell–cell communication in plant

reproduction and development, such as pollen-tube guidance (Kanaoka et al., 2011;

Marshall et al., 2011; Okuda et al., 2009; Silverstein et al., 2007). Rapid alkalinization

factor (RALF)-like peptides are also cysteine-rich peptides, and constitute a large

multigenic family that is expressed in all tissues, with greater or lesser specificity

depending on the gene (Olsen et al., 2002). Mature RALF peptides are processed from a

precursor via subtilase activity near a dibasic site (Matos et al., 2008; Srivastava et al.,

2009). Although some RALF-like genes are specifically expressed in the FG (Johnston et al.,

2007; Yu et al., 2005), most currently described RALFs appear to be involved in plant

growth processes. Incubation of tomato roots (Solanum lycopersicum) or A. thaliana

85

seedlings with NtRALF from Nicotiana tabacum results in root growth arrest (Pearce et al.,

2001b), while silencing of NaRALF from Nicotiana attenuata leads to an increase in root

growth (Wu et al., 2007). Similarly, over-expression of AtRALF1 in A. thaliana causes a

semi-dwarf phenotype (Matos et al., 2008), and AtRALF23 over-expression inhibits

hypocotyl elongation in seedlings, resulting in shorter and bushier plants (Srivastava et al.,

2009). At the cellular level, some RALFs are involved in cell elongation, with the pollen-

specific tomato SlPRALF regulating pollen tube elongation (Covey et al., 2010) and the

sugarcane (Saccharum spp.) SacRALF1 inhibiting cell elongation of microcalli in cell

suspension cultures (Mingossi et al., 2010). However, other RALFs, such as NtRALF, appear

to block cell division, as labeling with 3H-thymidine is strongly inhibited in the tips of roots

treated with exogenous RALF peptide (Moura et al., 2006). Most importantly, RALFs

appear to act in a receptor-dependent pathway: (i) tobacco RALF accumulates in the cell

wall (Escobar et al., 2003); (ii) tomato RALF binds to two transmembrane proteins of 25

and 120 kDa (Scheer et al., 2005); and (iii) AtRALF1 induces a Ca2+ increase and potentially

act through an inositol triphosphate signaling pathway (Haruta et al., 2008).

In Solanum chacoense, five RALF-like genes have been isolated from fertilized

ovules (Germain et al., 2005). In the present study, we present evidence for direct

communication between the sporophyte and the female gametophyte through the action

of a secreted ScRALF3 peptide that regulates various aspects of ES development. Although

the gene is normally expressed within the sporophytic tissue of the ovule, ScRALF3

interference mutants displayed ES development delay or arrest. Therefore, a model is

proposed in which ScRALF3 may act as a sporophytically expressed gene that regulates, at

least in part, the architecture of the ES in a receptor-dependent signaling pathway.

86

3.2.4 Experimental Procedures

Material

All plant material has been described previously Germain et al. (2005). The primers

used are listed in Table I (p.88). Differential interference contrast and fluorescence

microscopy were performed using a Zeiss Axio Imager M1 microscope; pictures were

taken using a Zeiss AxiocamHRc camera (ZEISS, http://www.zeiss.ca). Confocal microscopy

was performed using a Zeiss LSM 510 META microscope with an argon ion laser emitting

at 488 nm and an LP 505 emission filter.

RNA extraction and Northern Hybridization

Total RNA was extracted using TRIzol reagent (INVITROGEN,

http://www.invitrogen.com). RNA preparation, transfer and hybridization were performed

as described previously by Germain et al. (2005). Radioactive probes were produced using

a High Prime DNA labeling kit (ROCHE, http://www.roche-applied-science.com) and dATP

[α-P32] (PERKIN ELMER, http://www.perkinelmer.ca).

Hormone treatment

Treatments consisted of pipetting 2 μl of the appropriate solution on top of the

ovary at anthesis (method adapted from (de Jong et al., 2009; Vriezen et al., 2008).

Approximately 20 flowers were treated. Ovaries were dissected from 6h to 3 days after

the initial treatment for RNA extraction. Some treated flowers were left on the plant to

monitor the production of a parthenocarpic fruit.

Genome Walking and allele isolation

Solanum chacoense genomic DNA was isolated using a plant DNA extraction kit

(QIAGEN, http://www.qiagen.com). The promoter region was isolated using a Clontech

genome walker kit (http://www.clontech.com). Dra1 and EcoRV were used to create the

genomic library. The secondary PCR products were cloned into pCR4-TOPO using a TOPO

TA cloning kit (INVITROGEN). Sequencing reactions were performed at the Université de

87

Montréal Genomic Platform (IRIC, Montréal, Canada). Primers were designed based on

the longest DNA sequence obtained to isolate the various alleles. The sequences were

cloned into pDONRtm/Zeo (INVITROGEN). The Genbank accession number for the ScRALF3

promoter is KC222019.

Plants Transformation and selection

Transgenic plants were obtained by leaf agroinfiltration and callus regeneration as

described previously (Matton et al., 1997) using Agrobacterium tumefaciens strain

LBA4404 carrying the RNAi vector pK7GWIWG2(I)-ScRALF3. GATEWAY® technology using

pDONRtm/Zeo (INVITROGEN) as an entry vector and pK7GWIWG2(I) (Karimi et al., 2002)

as a destination vector were used for cloning. Fifteen independent shoots were chosen

and grown until maturity in a greenhouse. Twelve plants showing no signs of tetraploidy

were chosen for phenotype analysis. Semi-quantitative RT-PCR was performed using

600ng RNA from 4 days post-pollination ovaries using the M-MLV reverse transcriptase kit

(INVITROGEN) according to the manufacturer’s intructions. Forty-two cycles of PCR were

required to amplify ScRALF3 and UBIQUITIN using the HOTSTART Taq polymerase

(BIOSHOP CANADA INC., http://www.bioshopcanada.com). Statistical analyses were

performed using the GraphPad SOFTWARE t-test calculator (GRAPHPAD SOFTWARE INC.,

http://www.graphpad.com).

Ovules Clearing

Bud size measurements were taken at the baseline of the buds for developmental

classification. Ovaries without the pericarp were fixed in FAA overnight (1%

formaldehyde/0,5% glacial acetic acid/50% ethanol) (FISHER SCIENTIFIC,

http://www.fishersci.ca). The ovaries were incubated in 100% ethanol for 1h, and

transferred into methyl salicylate/EtOH solutions with increasing ratios of methyl

salicylate/EtOH for 30 min each (1:3, 1:1 and 3:1). The tissues were kept in 100% methyl

salicylate(SIGMA-ALDRICH, http://www.sigmaaldrich.com) at room temperature until

observation.

88

TABLE I LIST OF PRIMERS.

Projects Gene/name Sequence

Northern

ScRALF1 GCAATGGATGGAATTGGTAA TTGGCAACATTGGTTACCTT

ScRALF2 ATGCAAGGGGAGTATTGCAG AGCTCCAGGTTTGCAGTTGT

ScRALF3 GGAGTCTCCAATACTTTTCTTCC GCAACGAGTGATAGCAGAGC

ScRALF4 TGTACAAGTCTCCAAGGGTATCA TTTCTTCAACAAGAGTAGACGATG

ScRALF5 CAAGTCTCCAAGGGTCTCAA CTTTCAATTTACTATAAAAATCAAGCA

Genome Walking

Adaptor 1 GTAATACGACTCACTATAGGGC

Nested Adaptor 2

ACTATAGGGCACGCGTGGT

Gene Specific 1

GCCATTGGCAACTCAAAATCTTCACTCA

Gene Specific 2

CACAATTGCATTGTTGGTGATGGTGAA

Allele Isolation

P11-F GAGACCATGGGGGGTAACATTTTGATTTTCCA

P272-F GAGACCATGGAAAGGTGTGAATGGAAATGAAGA

P591-F GAGACCATGGTGGAACTAATTTTTCTGGACTTCTT

P693-F GAGACCATGGCGATACACCGGTAAATAAGATCG

P984-F GAGACCATGGCATGCATTAGCACAAAATTAAGG

P1152-F GAGACCATGGGATGGACCCCTACAAACACG

Reverse GAGACCATGGTGTTGGTGATGGTGAATAAGA

RNAi ScRALF3 GGGGACAAGTTTGTACAAAAAAGCAGGCTATGTGGCACAAATTCAAGTACTAC GGGGACCACTTTGTACAAGAAAGCTGGGTCTACGGCAACGAGTGATAGCA

RT-PCR

ScRALF3 TTTGCATACAACCTATGGAGTC CCATTTCCATCTAACTGCATC

UBIQUITIN GCTGGCAAGCAGTTGGAAGAT TGGATGTTGTAGTCCGCCAGA

GUS

PromoR3 GGGGACAAGTTTGTACAAAAAAGCAGGCTGCATGAACCATTCGGAGGTA GGGGACCACTTTGTACAAGAAAGCTGGGTTAGGTTGTATGCAAAAAAAAATGGTG

HYG ATTTGTGTACGCCCGACAGT GAATTCAGCGAGAGCCTGAC

GFP

ScRALF3 GGGGACAAGTTTGTACAAAAAAGCAGGCTACCATGGAGTCTCCAATACTT

SP GGGGACAAGTTTGTACAAAAAAGCAGGCTATGATTGTGATCGAA

Reverse GGGGACCACTTTGTACAAGAAAGCTGGGTCTCTACGGCAACGAGTGATA

SP reverse GGGGACCACTTTGTACAAGAAAGCTGGGTCTGCATTGTTGGTGATGGTGAAT

89

In situ hybridization

The method used for in situ hybridization was adapted from (Lantin et al., 1999).

(1) VistaVision HistoBond microscope slides (VWR, http://ca.vwr.com) were used with

10µm tissue sections. (2) The riboprobes were synthesized from the ScRALF3 cDNA

(Germain et al., 2005) with digoxigenin-11-UTP and a MAXIscript T7/T3 Kit (INVITROGEN).

GUS staining

Transgenic plants were obtained like described above. GATEWAY® technology,

using pDONRtm/Zeo (INVITROGEN) as an entry vector and pMDC162 (Curtis and

Grossniklaus, 2003) as a destination vector, was used for cloning. The transgenic plants

were selected by PCR screening for the hygromycin resistance gene. Ten independent

lines were carefully examined using the GUS staining protocol describeb by (Weigel and

Glazebrook, 2002). Ovule clearing was performed to observe GUS expression within the

ovules. The tissues were kept in methyl salicylate (SIGMA-ALDRICH) at 4˚C for less than 2

days to avoid fading of the GUS stain.

Onion cell bombardment

GATEWAY® technology, using pDONRtm/Zeo (INVITROGEN) as an entry vector and

pMDC83 or pMDC201 (Curtis and Grossniklaus, 2003), containing a GFP and a GFP6HDEL

marker, respectively, as the destination vector, was used for cloning. Onion cells were

transiently transformed by microparticle bombardment (Germain et al., 2008).

Western blot

Leaf proteins were extracted using 100 mM Tris/HCl, pH 8, 0.1% SDS, 2% β-

mercaptoethanol and 1× Roche Complete mini protease inhibitor, then quantified by the

Bradford assay. Protein samples (25 μg) were denatured in Laemmli sample buffer at

95°C/5 min, subjected to 12.5% SDS–PAGE as described by Laemmli (Laemmli, 1970), then

transferred to a polyvinyldene fluoride (PVDF) membrane (GE HEALTHCARE,

http://www.gelifesciences.com). Signal detection using anti-GFP (1:1000) (Roche) and

90

anti-mouse IgG antibodies conjugated with horseradish peroxidase (1:5000) (Sigma) was

performed using Amersham™ ECL™ Plus (GE Healthcare) detection reagents according to

the manufacturer's instructions, and exposed on a BioflexEcono film (MANDEL,

http://www.interscience.com).

3.2.5 Results

ScRALF3 transcripts are induced during fruit initiation

ScRALF3 was previously showed to be preferentially expressed in fertilized ovaries,

with a sharp increase 2 days after pollination (Germain et al., 2005). To assess whether

ScRALF3 expression correlates with fertilization or whether it may also be pollination-

induced, an extended time-course analysis was performed (Figure 14a, p.91). Precise

pollination timing was accomplished by manual pollination using pollen from a fully

compatible S. chacoense genotype on the day of anthesis. ScRALF3 expression was not

detected before 48 h, i.e. after fertilization, which occurs between 36 and 42 h post-

pollination (Chantha et al., 2006; Tebbji et al., 2010). To determine whether ScRALF3

expression is regulated by fertilization or by fruit initiation, steady-state mRNA levels were

compared in ovaries between 1 and 3 days after pollination or gibberellin treatment.

Gibberellins are known to stimulate fruit development without fertilization in numerous

plants, including solanaceous species (de Jong et al., 2009; Vriezen et al., 2008).

Application of a 1 mM GA3 solution directly onto the ovary led to development of small

parthenocarpic fruit (data not shown). However, ScRALF3 mRNA levels were not increased

by GA3 treatment (Figure 14b, p.91), leading to the conclusion that ScRALF3 expression

correlates with post-fertilization events. Auxins are also known to initiate fruit

development (de Jong et al., 2009). Various concentrations of naphthaleneacetic acid

(NAA) were tested for their ability to produce parthenocarpic fruit and to stimulate

ScRALF3 expression. Only external treatments with 100 μm NAA (very weak expression) or

a higher concentration (1 mm NAA, stronger expression) increased ScRALF3 expression

(Figure 14b, p.91), and also led to initiation of fruit development in a concentration-

91

dependent manner. An increase in ScRALF3 mRNA levels was observed 24 h after the first

application of 1 mM NAA, and the level peaked after 3 days (Figure 14b, p.91). Therefore,

we associate ScRALF3 expression with early post-fertilization events under the control of

auxin.

FIGURE 14 SCRALF3 IS AN AUXIN-RESPONSIVE GENE DURING FRUIT INITIATION.

(a) Time-course analysis of ScRALF3 expression around fertilization (36-42h). (b) Sensitivity of

ScRALF3 expression to externally applied auxin and gibberellin. Hybridization with a ribosomal 18S

probe shows equal loading. EtOH, ethanol control; GA3, gibberellin A3; NAA, naphthaleneacetic

acid; h, hours after pollination; d, days after applied treatment.

ScRALF3 promoter contains auxin regulatory elements

A 1.2 kb fragment of the ScRALF3 promoter was isolated by genome walking. We

previously showed that ScRALF3 is a single-copy gene in S. chacoense (Germain et al.,

2005). To assess allelic variation between ScRALF3 promoters, six amplicons of various

lengths were cloned from the wild-type (WT) S. chacoense diploid genotype used (G4;

S12S14 self-incompatibility alleles). Six primer pairs were used to amplify six overlapping

lengths of the promoter (Table I, p.88). Sequencing of five independent clones for each

amplicon revealed two slightly different sequences in comparison with the original 1.2 kb

promoter obtained by genome walking. The two allelic promoters shared 89.7% identity,

with the differences being found mainly in repeated sequences.

92

TABLE II SELECTED REGULATORY ELEMENTS WITHIN THE SCRALF3 PROMOTER.

Motifs Sequence localization Direction

Auxin

Response

Element

Partial AuxRE TGTC -524 -521 reverse

Partial AuxRE TGTCCC -419 -414 reverse

Partial AuxRE TGTC -91 -88 reverse

Partial AuxRE TGTCT -64 -60 reverse

AuxRR ATGGACC -44 -38 forward

DOF binding site (NtBBF1) ACTTTA -550 -545 forward

DOF binding site (NtBBF1) ACTTTA -291 -286 forward

GA-inducible

CARE CAACTC -1006 -1001 forward

Pyrimidine box CCTTTT -926 -921 reverse

CARE CAACTC -904 -899 reverse

CARE CAACTC -885 -880 reverse

CARE CAACTC -847 -842 reverse

CARE CAACTC -809 -804 reverse

CARE CAACTC -790 -785 reverse

Pyrimidine box TCTTTT -717 -712 reverse

CARE TCTGTTT -645 -639 forward

CARE TCTGTTT -353 -347 forward

ABA-

responsive

RY repeat CATGCA -1111 -1106 reverse

RY repeat CATGCA -213 -208 forward

ABRE ACGTG -29 -25 reverse

93

Comparison with ScRALF3 orthologous sequences found in the genomes of S.

tuberosum and S. lycopersicum showed a high degree of sequence identity and colinearity,

except for an insertion in the S. chacoense RALF3 promoter. The ScRALF3 promoter was

analysed for known cis-regulatory elements (Table II, p.92), especially auxin regulatory

elements (Berendzen et al., 2012; Nemhauser et al., 2004). Although the canonical

sequence for the AuxRE element (TGTCTC) was not found in the ScRALF3 promoter, four

AuxRE variants (core TGTC elements and the AuxRE-related sequence AUX2) were found

in the proximal promoter region, and two such variants were also found in the sequence

shared by the two other Solanum species analyzed. Nemhauser et al. (2004) have shown

that 42% of Arabidopsis auxin responsive promoters contain at least one pair of TGTC

elements interspaced by 50 bp, which is the case in the ScRALF3 proximal promoter

region. Other studies also revealed the requirement for a core TGTC element for ARF

transcription factor binding (Ulmasov et al., 1997; Ulmasov et al., 1995). One AuxRR core

element (GGTCCAT), an auxin enhancer element (Sakai et al., 1996), was also found in the

proximal promoter region. In addition to these specific auxin response elements, an

extended DOF core motif (ACTTTA motif), which is the binding site of the NtBBF1 DOF

factor that has been shown to be involved in auxin-induced gene expression in Nicotiana

tabacum (Baumann et al., 1999), as well as Arabidopsis (Nemhauser et al., 2004), is found

twice in the ScRALF3 promoter. Other motifs that have been recently shown to be

enriched in auxin-regulated promoters (Berendzen et al., 2012) are also present in the

ScRALF3 proxi- mal promoter region (Table II, p.92). As slightly divergent AuxRE elements

have been found to confer auxin responsiveness in the presence of other elements,

forming bipartite or tripartite modules (Nemhauser et al., 2004; Walcher and Nemhauser,

2012), and exogenously applied auxin regulates ScRALF3 expression (Figure 14, p.91), the

results suggest that ScRALF3 expression is under auxin control.

94

ScRALF3-silenced Solanum plants display a severe reduction in seed set

The region used for the RNAi construct (150 bp long) shared 24–51% nucleic acid

identity between the five ScRALF members previously isolated (Germain et al., 2005), as

well as eight RALFs newly identified by deep transcriptomic sequencing of S. chacoense

tissues (Loubert-Hudon, 2012), with no conserved stretches of more than 11 nt. When

taking into account only the ScRALF genes expressed in ovule tissues, the size of these

stretches is limited to 9 nt, further limiting a non-specific interference effect. Twelve

plants had lower or non-detectable levels of ScRALF3 steady-state mRNAs in T1 plants, as

determined by semi-quantitative RT-PCR analyses (Figure 15a, p.95). To determine wether

expression of other members of the RALF family may have been affected by the ScRALF3

RNAi construct, three lines (lines 7, 11 and 12) were analysed for the expression of RALF-

like genes in various tissues (Figure 16, p.96). None of the RALF-like genes tested showed

signs of downregulation that may have been caused by the ScRALF3 RNAi construct. A

DNA gel blot analysis was also performed using genomic DNA from four transgenic plants

(lines 7, 11, 12 and 14) showing that these four RNAi lines derived from independant and

unique tranformation events (Figure 17, p.97).

95

FIGURE 15 DOWNREGULATION OF SCRALF3 BY RNAI CAUSES PRODUCTION OF SMALL FRUITS WITH FEWER SEEDS.

(a) ScRALF3 mRNA levels in selected RNAi lines determined by semi-quantitative RT-PCR and mean

diameter (cm) of 24-day-old fruit. n=10-15 fruits per lines. (b) Cross-sections of 30-day-old fruits

from wild-type (G4) and selected transgenic plants taken together. (c) Time-course analysis (d,

days) of fruit size development following pollination (n=25-30 fruits). (d) Seed number in 25-day-

old fruits (n=15 fruits). Asterisks indicate statistically significicant difference compared with wild-

type (* pvalue<0,05; **: pvalue<0,0001). Values in (c) and (d) are means ± the standard deviation.

96

FIGURE 16 SPECIFIC DOWNREGULATION OF SCRALF3 IN TRANSGENIC PLANTS.

ScRALF1,2,4,5 are not downregulated in plants expressing a transgene interfering with the

ScRALF3 RNA (line 7,11,12) in root, leaf, buds, ovary (at anthesis) and stamen. The 18S probe was

used as a quality and quantity RNA control. Ten ug of total RNA were loaded on denaturing gel.

97

FIGURE 17 DNA GEL BLOT ANALYSIS OF THE FOUR INDEPENDENT SCRALF3 TRANSGENIC LINES USED.

The transgenic lines are showing different restriction patterns confirming independent lineages.

Genomic DNA was extracted from wild-type (G4) and ScRALF3 RNAi leaves (line 7,11,12 and 14).

Ten micrograms were digested with EcoRI or HindIII (HdIII). HindIII has a cleavage site within the

transgene and a 1757 pb fragment is expected, overlapping the 35S promoter and the hairpin

construct.

To assess whether ScRALF3 is required for reproductive development, fruit size

was compared between wild-type (WT) non-transformed plants (G4) and the 12 RNAi

lines, 24 days after pollination. Seven plants had significantly smaller fruits than WT

(pvalue<0,05), with a sampling of 10-15 fruits per lines (Figure 15a-b, p.95). To further

characterize this phenotype, we performed a time-course analysis on three independant

transgenic plants (lines 11, 12 and 14) with a sample of 25-30 fruits per line. In these lines,

ScRALF3 expression was not detected by RT-PCR analysis (Figure 15a, p.95). RNAi

downregulation of ScRALF3 slowed down development of the fruit, mainly between 10

and 15 days post-pollination (Figure 15c, p.95), and resulted in a marked seed set

reduction of 65-80% compared to WT plants (Figure 15d, p.95). In comparison, all plants

carrying an empty vector with a kanamycin resistance gene showed normal seed set (data

not shown). Therefore, ScRALF3 is required for normal seed development.

98

Female gametophyte development is impaired in mutant ovules

Reduced seed set may result from a defective ES or from early zygotic

developmental defects. Clearing analyses of ovules at anthesis was performed to detect

possible defects during ES development, which follows the Polygonum-type pattern in WT

S. chacoense ovules (Figure 18a-k, p.100). In WT plants, a four-cells structure (two

synergids, one egg cell and one central cell) characterizes the mature FG. Within the egg

apparatus, the synergids can be distinguished from the egg cell as their nuclei are in close

proximity to the micropyle, while the egg cell nucleus is close to the central cell nucleus,

with a vacuole reaching to the micropyle entry (Figure 18j-k, p.100). However, in the RNAi

lines, 61-77% of ovules showed premature arrest of their ES (Table III, p.98), consistent

with the number of missing seeds. In ES that continued their development, the embryos

were viable (data not shown), indicating no disruption of zygote development in mutant

fruits. Thus, defects detected during ES development appear to be solely responsible for

the reduced seed set observed. Of the four RNAi lines analyzed, lines 7, 11 and 12 had

approximately 50% of ovules arrested during the mitosis steps. In lines 11 and 12, 19-24%

of ovules had a collapsed or empty ES, and this percentage increased to 50% for line 14.

Together, these data suggest that ScRALF3 is required for progression through

megagametogenesis, or to complete megasporogenesis.

TABLE III IMMATURE EMBRYO SAC AT ANTHESIS IN DOWN-REGULATED SCRALF3 PLANTS.

Genotype Abn. FM MI MII MIII ES UPN ES

G4 6 - - - - 2 92

RNAi3-7 2 2 12 36 6 9 33

RNAi3-11 24 10 15 17 5 2 27

RNAi3-12 19 4 18 29 6 1 23

RNAi3-14 50 4 5 - 1 1 39

Percentage of ES arrested at various developmental stages at anthesis. n= 100 ovules per line.

Abn: Abnormal sacs comprise collapsed or empty embryo sac; FM: Functional Megaspore; MI-II-III:

Mitosis I-II-III; ES UPN: Embryo Sac with Unfused Polar Nuclei; ES: Embryo Sac;.

99

As anomalies in the sporophytic tissue of the ovule strongly affect FG development

(reviewed by (Bencivenga et al., 2011), cleared ovules were carefully examined. No major

developmental defect of the sporophytic tissue surrounding the ES was observed by

differential interference contrast microscopy. Therefore, the phenotype is directly linked

to a dysfunctional genetic and/or signaling pathway in the ES of the mutant lines.

In WT plants, ovule maturation is highly synchronous, and gametophyte

development stages correlate well with bud size (Table IV, p.101). In 3-4 mm buds, the FG

is progressing through megasporogenesis. A megaspore mother cell (MMC) has

differentiated in the nucellus from an archeosporal cell (Figure 18a, p.100). At this stage,

the integument is at the level of the MMC (solanaceous plants are unitegmic). As the

integument continues to grow and reaches the upper part of the MMC, the MMC

elongates, with a nucleus at the tip of the primordium (Figure 18b, p.100). The integument

has almost covered all the nucellus when the FG starts its first meiosis, resulting in two

tear-shaped cells that characterize this step (Figure 18c, p.100). When meiosis is

complete, the integument fully covers the FG (Figure 18d, p.100) and degeneration of the

three megaspores nearer to the micropylar pole occurs (data not shown). The remaining

cell will eventually differentiate into an FM (Figure 18e, p.100). The FM nucleus relocates

slowly toward the middle of the cell and a first division on the chalaza/micropyle axis

occurs when the flower buds reach 4-5 mm. The two nuclei then move, one to each pole

of the ES (Figure 18f, p.100), followed by a second (Figure 18g, p.100) and a third (Figure

18h, p.100) mitosis in 5-6 mm flower buds. Cellularization starts in flower buds of 6-7 mm.

The three nuclei located at the chalazal pole that give rise to the antipodals degenerate

almost concomitantly with cellularization; thus, as for other Solanum spp., antipodals are

ephemeral and rarely observed (Estrada-Luna et al., 2004). The polar nuclei then move

closer to each other and the vacuoles develop inside the synergids and the egg cell (7-8

mm buds, Figure 18i, p.100). The two polar nuclei, often in close vicinity of the egg cell

nucleus, fuse to form a mature ES (Figure 18j-k, p.100).

100

FIGURE 18 EMBRYO SAC DEVELOPMENT WITHIN WILD-TYPE SOLANUM CHACOENSE OVULES.

a-k, cleared ovules. (a) Archeosporial cell. (b) Megaspore mother cell. (c) Two haploid spores. (d)

Tetrad of haploid spores. (e) Functional megaspore. (f) Two-nucleate stage. (g) Four-nucleate

stage. (h) Eight-nucleate stage. (i) Cellularized ES with unfused polar nuclei. (j) Mature embryo sac.

(k) Mature embryo sac. Gray: maternal sporophytic tissue; Yellow: central cell; Green: synergids;

Blue: egg cell. n: nucellus; i: integument; c: chalaza; m: micropyle.

101

TABLE IV MEGASPOROGENESIS AND MEGAGAMETOGENESIS IN WILD-TYPE (G4) AND MUTANT PLANTS (RNAI).

Genotype Buds Size

(mm) Prim MMC MeI MeII FM MI MII MIII 5N

ES UPN

ES Abn

3-<4 7 50 23 13 7 - - - - - - - 4-<5 - - 4 6 57 25 8 - - - - -

G4 5-<6 - - - - 5 17 39 9 15 12 3 - 6-<7 - - - - - - 17 21 44 15 3 - 7-<8 - - - - - - 2 1 10 48 39 -

3-<4 19 60 10 11 - - - - - - - - 4-<5 - - 8 18 53 16 5 - - - - -

RNAi3-7 5-<6 - - 2 7 20 33 19 5 10 3 1 - 6-<7 - - 3 4 14 33 23 3 5 12 3 - 7-<8 - - - - 4 24 25 - 4 27 16 -

3-<4 8 33 7 12 28 1 1 - - - - 10 4-<5 - 1 4 8 55 15 3 - - - - 14

RNAi3-11 5-<6 - 4 - 2 29 22 19 - 2 - - 22 6-<7 3 2 3 2 25 25 17 2 3 2 - 16 7-<8 - 1 1 2 19 25 15 2 8 5 7 16

3-<4 - 17 22 33 16 1 - - - - - 11 4-<5 - 2 3 16 36 3 1 - - - - 39

RNAi3-14 5-<6 - - 1 6 30 11 9 1 2 - - 40 6-<7 - - 1 2 21 6 12 6 6 5 - 41 7-<8 - - 1 1 12 4 3 6 12 12 3 46

Percentage of ES developmental stages observed per flower bud size. n = 100 ovules per bud size

and plant line. Prim: Primordium; MMC: Megaspore Mother Cell; MeI-II: Meisosi I (two-cells) and –

II (tetrad); FM: Functional Megaspore; MI-II-III: Mitosis I (two nuclei) –II (four nuclei) –III (eigth

nuclei); 5N: Five nuclei w/o migration of the polar nuclei; ES UPN: Embryo Sac with Unfused Polar

Nuclei; ES: mature embryo sac. Shaded areas for each bud size show the distribution of ES

develpmental stages observed in ≥9 % of WT ovules.

102

The same analysis was performed to assess at which stage the defect occurs in

ScRALF3 interference lines. We selected line 7 on the basis of its low percentage of

degenerated ES, as well as line 11 on the basis of its lack of ScRALF3 expression and its

similar phenotype to line 12. Early megasporogenesis appears to occur normally in mutant

ovules; in 3-4 mm buds, the distribution of developing ES is within 95% of the one

observed for WT ovules (Table IV, p.101). However, early on, irregularities are observed in

the mutant FGs. Although 33% of the WT FGs began their mitotic cycle, only 21% (line 7)

and 18% (line 11) of the mutant FGs proceeded beyond the FM stage in 4-5 mm buds.

Slower progression at the end of megasporogenesis is observed in line 7, while more

degenerated ES are observed in line 11. Later on, although 62% of the WT FGs began

cellularization, only 20% (line 7) and 5% (line 11) of the mutant FGs had reached this step

in 6-7 mm buds (Table IV, p.101). In fact, only 33% (line 7) and 27% (line 11) of the mutant

ES became fully mature at anthesis (Table III, p.98). Therefore, the ES from these mutant

lines are having difficulty progressing through the mitotic cycles, and are more likely to

arrest earlier during megagametogenesis or to degenerate. The results are slightly

different for line 14, in which degenerated ES clearly correlate with abnormal FM

differentiation. Several shape abnormalities were observed, and their nucleus appears

fractionated (Figure 19a-b, p.104). Also, in 5-6 mm buds, only 23% of the mutant FGs

began the mitotic cycles against 95% for the WT ovules. In these buds, the mutant ES are

either stopped at the FM, or have degenerated (Table IV, p.101). In summary, ScRALF3 is

important during all stages of megagametogenesis, but appears to play a key role early on,

either to regulate proper differentiation of the FM and/or to prime the FM for the mitotic

cycles.

The embryo sac of ScRALF3-silenced plants display abnormal nuclear distribution and asynchronous nuclear divisions

Organization of the ES was not necessarily normal in arrested or developing

mutant ovules. Instead of having an equal number of nuclei at each pole, the nuclei were

103

either aligned (Figure 19c-h, p.104) or clustered (Figure 19i-m, p.104) within the syncytium

following mitosis I, II or III. These observations suggest that the mitotic divisions are

disorganized, and that the ES is no longer polarized in a chalazal/micropylar axis. To

further characterize the lack of polarization inside the ES in mutant ovules, localization of

nuclei was assessed within the syncytium of 100 ovules at mitosis II for the WT and two

mutants (line 7 and 12). This stage was selected for the analysis for two reasons: (i) there

was still a sufficient number of FGs reaching this stage even in mutant ovules and (ii)

fewer misinterpretations may occur as the result of incomplete nuclei migration from a

first mitosis in progress. In WT plants, 95% of the FGs showed a normal segregation

pattern (two nuclei at each pole). In mutant lines 7 & 12, only approximately 35% of the

FGs showed a normal nuclear segregation. Instead, the four nuclei were either localized

on the chalazal or the micropylar side, or clustered in the middle of the syncytium,

without any preference (Figure 19n, p.104). This random nuclei distribution appeared to

be closely related to a lack of ES polarization, as the nucleus of the FM in some mutant

ovules divided perpendicularly to the chalazal/micropylar axis (Figure 19c, p.104); this was

not observed in WT ovules. Furthermore, abnormal numbers of nuclei (5-7) within the

syncytium were more frequent than in WT plants, also suggesting an effect on mitotic

division synchronicity. For example, in Figure 20 (a-e, p.105), only two nuclei had

progressed through the third mitosis, leading to a syncytium containing six nuclei. When

comparing one hundred ovules in WT versus mutant plants with FGs containing 5-8 nuclei

(Figure 20f, p.105), 26% of the WT ovules showed asynchrony (5-7 nuclei); this percentage

reached 53% (line 12) and 70% (line 7) in mutant ovules. Loss of molecular regulation of

divisions or an indirect consequence of the abnormal nuclei distribution may explain the

increased asynchrony in mutant FGs. Nevertheless, these data suggest that ScRALF3 is

involved in the polarization of the syncytium, influencing the migration, distribution and

division of the nuclei.

104

FIGURE 19 LOST OF EMBRYO SAC POLARIZATION IN MUTANT OVULES IS ASSOCIATED WITH A WIDE RANGE OF

NUCLEI DISTRIBUTION.

a-m, cleared ovules. (a) Degenerated embryo sac. (b) Degeneration of the functional megaspore

(FM). (c) Division of the FM perpendicularly to the micropylar-chalazal axis (dash line) (d)

Abnormal nuclei positioning at the four-nucleate stage (d: stacked image; e-h: individual focal

plane). (i) Clustered nuclei at the eight-nucleate stage (i: stacked image; j-m: individual focal

plane). (n) Phenotypical analysis of mutant embryo sacs (four-nucleate stage) showed no

preference in nuclei positioning (n=100). False colors are used to emphasize the nuclei in different

focal planes. Scale bar = 10 μm.

105

FIGURE 20 ASYNCHRONOUS DIVISIONS WITHIN THE SYNCYTIUM OF MUTANT OVULES.

(a-e) Six-nucleate syncytium clustered on one side of the ES: (a) stacked image; (b-e) individual

focal plane. False colors are used to emphasize the nuclei from different focal planes. Scale bar =

10 μm. (f) Phenotypical analysis of mutant embryo sacs proceeding through the last mitosis

showed an abnormal number (5-7) of nuclei (n=50). Color conding refers to the nuclei number and

their positioning. Mycropylar (M), central (Ct), chalazal (Ch), normal (N).

106

ScRALF3 is mostly expressed in the sporophytic tissue of the ovule

To assess how down-regulation of ScRALF3 transcript affects FG development, an

RNA expression analysis on ovaries from various developmental stages was performed

(Figure 21a, p.107). Steady-state ScRALF3 mRNA levels are high in young buds and slowly

decrease until anthesis, concomitant with the progression of megagametogenesis. As

previously described (Germain et al., 2005), ScRALF3 expression is then up-regulated after

fertilization. RNA in situ analyses revealed that the ScRALF3 mRNA is mostly localized in

the sporophytic tissue of the ovule, mainly in the integument, but also in the placenta

vasculature (Figure 21b-e;g-I, p.107). In smaller buds (≤4mm), ScRALF3 expression was

observed in the young primordium (Figure 21b, p.107), then throughout the growing

integument around immature ES (Figure 21c, p.107). As ovules grew (buds >4mm),

ScRALF3 expression became restricted to few structures, notably the tip of the integument

(Figure 21d-e, p.107). However, lower ScRALF3 expression remained throughout the

integument, as revealed by the use of a higher probe concentration (Figure 21i, p.107).

Therefore, a gradient in ScRALF3 expression is established within the developing ovules,

with a higher concentration at the tip of the integument. Analysis of transgenic plants

harbouring a ScRALF3 promoter-GUS fusion confirmed the results obtained by in situ

hybridization. Down-regulation of ScRALF3 expression gradually occurs as the ovules get

closer to anthesis (Figure 22a-f, p.108). ScRALF3 is expressed in the chalaza of the

primordium (Figure 22a, p.108), then within the integument (Figure 22b-d, p.108).

ScRALF3 is also expressed within the nucellus cells near the micropyle, during

degeneration of the non-functional megaspores (Figure 22d, p.108). Subtle expression

remained during megagametogenesis, mostly at the tip of the integument and in the

funiculus (Figure 22e, p.108), disappearing at anthesis (Figure 22f, p.108). Together, this

suggests that ScRALF3 is a sporophytically expressed gene, with an apparent polarized

expression around the developing embryo sac. Peak expression of ScRALF3 occurs early

during ovule development, mostly during megasporogenesis and preceding the

appearance of any visible phenotype.

107

FIGURE 21 REGULATION OF SCRALF3

EXPRESSION WITHIN THE SPOROPHYTIC TISSUE

DURING OVULE DEVELOPMENT.

(a) RNA gel blot of ScRALF3 transcripts in

depericarped ovaries during ovule and fruit

development. mm, buds size; DAP, Days

after pollination. (b-e) In situ localization of

ScRALF3 transcripts using an ScRALF3

antisense probe (50ng) for ovaries from (b)

3mm, (c) 4 mm, (d) 5 mm and (e) 6 mm

buds. (f) In situ localization of ScRALF3

transcripts using an ScRALF3 sense probe

(50ng) for ovaries from 5 mm buds. (g-h)

Close-up of ovules of 5-6 mm buds. (i-j) In

situ localization using (i) an ScRALF3

antisense probe (200ng) and (j) its

corresponding sense probe for ovaries

from 4 to 5 mm buds. Scale bar = 100 μm.

108

FIGURE 22 EXPRESSION OF SCRALF3 IN THE SPOROPHYTIC TISSUE OF THE OVULE AS REVEALED BY GUS STAINING.

(a) Staining in the chalaza of developing primordium. (b-c) Relocalization of ScRALF3 expression

within the integuments during megasporogenesis. (d) Expression in the integument, and partially

in the nucellus, as the haploid spores degenerate. (e) Subtle expression at the tip of the

integument and in the chalaza during megagametogenesis (FM shown here). (f) ScRALF3

expression decreases over the mature stage. Scale bar = 20 μm. n, nucellus; I, integument; c,

chalaza; m, micropyle; MMC, megaspore mother cell; FM, functional megaspore.

109

FIGURE 23 SCRALF3 PASS THROUGH THE SECRETORY PATHWAY IN ONION CELL TRANSIENT EXPRESSION ASSAY.

(a) The ScRALF3 signal peptide (SP) restricts GFP to the mesh network of the ER. (b) Without the

SP, a blurred signal in the cytoplasm is observed, with strong fluorescence within the nucleus. (c;f)

The presence of the ER retention signal HDEL increases fluorescence in the ER. (d) ScRALF3 in Golgi

bodies (arrow) moving along ER strand. The numbers in yellow indicate time in seconds (s). (e)

ScRALF3 in the ER. (g) ER marker and (h) Golgi marker (Nelson et al., 2007). (i) Chimeric proteins

used in the transient expression assay. Images were taken either with an epifluorescent

microscope (a-d) or a confocal microscope (e-h).

ScRALF3 is a secreted peptide

To assess whether the ScRALF3 peptide acts as a signal molecule between the

sporophyte and the gametophyte, we determined its subcellular localization by

fluorescence microscopy following transient expression in onion cells (Figure 23, p.109).

110

As expected from the presence of a signal peptide at the ScRALF3 N-terminus [Figure 23a-

b, p.109; (Germain et al., 2005)], cells transformed with the full ScRALF3-GFP construct

showed tangled lines or a meshed network of GFP fluorescence, as well as fluorescent

dots moving along the mesh (Figure 23d-e, p.109). This pattern is reminiscent of Golgi

bodies moving along ER strands (Hawes et al., 1998; Nelson et al., 2007), as revealed using

ER and Golgi markers (Figure 23g-h, p.109; Nelson et al., 2007). Transient expression of an

ScRALF3-GFPHDEL construct also confirmed its translocation to the ER (Figure 23c;f,

p.109). Stably transformed S. chacoense plants were also produced using these constructs,

but it was impossible to clearly observed the GFP signal due to high auto-fluorescence

background in leaves.

FIGURE 24 SCRALF3 IS PROCESSED WITHIN THE SECRETORY PATHWAY IN S. CHACOENSE.

(a) ScRALF3 is constitutively secreted in the apoplast as revealed with accumulation of core GFP

(approximately 29 kDa). (b) The ER retention signal stabilizes the unprocessed (44 kDa) and

processed (36 kDa) ScRALF3 chimeric protein. Three independant transgenic plants were analysed

for each construct. Coomassie blue staining was used has a loading control. See also Movies S1-S4.

111

Nonetheless, these transgenic lines constitutively expressing ScRALF3 (R3) or

ScRALF3-HDEL (R3-HDEL), were used for fusion protein analyses using an anti-GFP

antibody (Figure 24, p.110). A very weak signal at approximately 44 kDa was associated

with the full chimeric protein (42 kDa), and revealed a possible constitutive secretion of

the protein in the R3 leaf protein extract (Figure 24a, p.110). In line with this, there is a

strong accumulation of an approximately 30 kDa protein, often associated with the core

GFP, a fragment of the protein that is released after partial digestion within the vacuole or

the apoplast (Batoko et al., 2000; Jung et al., 2011). In contrast, in the R3-HDEL leaf

extracts, the full protein accumulated to higher levels than the core GFP, with an

additional signal around 35 kDa (Figure 24b, p.110). This approximately 35 kDa band is

consistent with processing of the ScRALF3 pro-region through the action of subtilisin-

related proteases (Germain et al., 2005), and corresponds well with the expected

approximately 36 kDa mature peptide. Concomitant with the decrease in core GFP

accumulation, the chimeric protein is stabilized when kept within the secretory pathway.

These results support those obtained by transient expression in onion cells, in which a

better signal to background ratio was observed in the R3-HDEL cells. Also, we suspect that

ScRALF3 is processed within the median- or trans-Golgi apparatus, as the HDEL retention

signal is used to return proteins to the ER from the cis-Golgi and thus, fewer proteins

would be processed. In summary, ScRALF3 is associated with the secretory pathway.

3.2.6 Discussion

Cell-cell communication is essential during ovule and early fruit development to

ensure a viable progeny (reviewed by (Chevalier et al., 2011; Nowack et al., 2010).

ScRALF3, a small secreted peptide for which transcripts are down-regulated in the ovule

until anthesis and up-regulated after fertilization, is thus a good candidate for contribution

to these signaling events.

112

A small-fruit phenotype was observed following down-regulation of the ScRALF3

transcript in transgenic plants. Recently, Bonghi et al. (2011) used a microarray approach

to analyse the peach transcriptome, revealing that auxin, cytokinin and gibberellin are

good signaling candidates, acting directly or indirectly on the cross-talk between the seed

and the pericarp regulating fruit growth (Bonghi et al., 2011). In line with this, cis-

regulatory elements found in the ScRALF3 promoter suggested that ScRALF3 expression is

directly or indirectly driven by auxin, as shown in Figure 14 (p.91). ScRALF3 expression

following pollination is similar to the pattern of auxin accumulation observed in young

tomato fruit (Mapelli et al., 1978), which mainly stimulates cell division (Bünger-Kibler and

Bangerth, 1983). The phenotype, which appeared 10-15 days after pollination, may be

caused by the inhibition of cell division in the first 10-14 days, preceding the 6-7 weeks of

cell expansion that are typical of many solanaceous fruits (de Jong et al., 2009; Gillaspy et

al., 1993). However, fewer seeds are also produced within the growing fruit, and a positive

correlation between final fruit size and seed set is well established (Varga and Bruinsma,

1976). Production of hormones by the embryo (seed) is required to stimulate fruit growth,

explaining the small-fruit phenotype in parthenocarpic fruits (Mapelli et al., 1978; Sjut and

Bangerth, 1983), and probably also in the ScRALF3 mutant lines.

Cellular analysis of ScRALF3 mutant ovules revealed a high proportion of arrested

ES during megagametogenesis, accounting for the lower seed set observed. The mutant

syncytia showed abnormal segregation of their nuclei and asynchronous division, cellular

defects that are partially reminiscent of cytoskeleton disruption. In maize, the abnormal

microtubular organization within indeterminate gametophyte1 mutant ES is not

associated with cell division arrest (Huang and Sheridan, 1994, 1996). In Arabidopsis,

kinesin mutants cause mis-positionning of nuclei that occur during megagametogenesis

(FG5 stage) (Tanaka et al., 2004). Thus, microtubules are important for FG organization,

and ScRALF3 may be required for cell organization within the developing ES. The arrest in

gametophyte development may also be explained by other general cell mechanism

113

defects affecting cell signaling and/or DNA remodeling. In Arabidopsis, mutations in a

transcription factor (agl23), a histone acetyltransferase (ham1ham2) or an E3 ligase

(rhf1a/rhf2a) also lead to a partial arrest at the FG1 stage (Colombo et al., 2008; Latrasse

et al., 2008; Liu et al., 2008).

The gradual down-regulation of ScRALF3 expression during FG development and

the various phenotypes observed suggest that ScRALF3 may effectively regulate a general

cell mechanism affecting progression through cell division, rather than a stage transition.

For example, the CKI1 signaling pathway regulates vacuole development within the

syncytium, indirectly regulating the organization of the ES at several steps of

megagametogenesis; mutations affecting the pathway lead to a latter arrest at stage FG5

(Hejatko et al., 2003; Pischke et al., 2002). Also, a mutation in a lysophosphatidyl

acyltransferase causes mis-development of the ER within the FG; differences in the

mutant ovule are apparent ath the four-cell stage (FG7), and dominant expression of the

gene occurs during the four- and eight-nucleate stages (FG3-FG5) (Kim et al., 2005). Over-

expression of ScRALF3 had no effect on seed set and FG maturation (data not shown):

ScRALF3 expression during megasporogenesis is therefore more important than its down-

regulation during megagametogenesis, and may be required to prime the FM for future

divisions.

ScRALF3 may act in a non-cell autonomous pathway to regulate FG development.

Recently, a sporophytic cytokinin receptor has been shown to regulate FG development,

which suggests an interesting dialog between the sporophyte and the gametophyte

(Kinoshita-Tsujimura and Kakimoto, 2011). Moreover, it was shown that auxin could be

produced first in the sporophyte, and then synthesized within the FG in a concentration-

depenent manner, regulating the cell fate of the ES (Pagnussat et al., 2009). Tissue

localization of the ScRALF3 transcript showed a strong accumulation in the sporophytic

tissue surrounding the FG. H, this strong sporophytic signal may mask a fainter

gametophytic signal. ScRALF3 is also a secreted peptide that is processed within the

114

secretory pathway. ScRALF3 may therefore act like a signaling peptide between the

sporophyte and the gametophyte, especially as the observed FG phenotype is similar to

that observed in mutants lacking integuments (Bencivenga et al., 2011).

In a proposed model, ScRALF3 is a sporophytically expressed signaling factor

regulating gametophytic cell organization in a receptor-dependent signaling pathway.

Outward signaling has already been shown to have a predominant role on cell

architecture. The ROPs (Rho of plants) represent one such principal regulator that control

cytoskeletal organization in plants (Mucha et al., 2011), and are thought to act

downstream of receptor-like kinases, especially during pollen tube growth (Kaothien et al.,

2005; Zhang and McCormick, 2007). Moreover, brassinosteroids control plant growth by

modulating microtubular organization, possibly through transcriptional regulation

(Catterou et al., 2001; Vert et al., 2005). In addition, characterization of a dynamin mutant

supports a model in which external signals may be important to regulate the FG

development, in line with our model. The mutant shows arrest prior to the first divison,

without abnormalities of the membrane, supporting a signaling defect rather than a

structural defect, two processes that are regulated by dynamins (Backues et al., 2010).

In summary, the ScRALF3 secreted peptide, for which the gene is transcribed

within the sporophytic tissue surrounding the young ES, affects FG development. Cellular

analysis of the mutant revealed an abnormal organization within the syncytium, with

aberrant cell division, mis-positionning of the nuclei and lost of polarity. As suggested in a

previous comparative transcriptomic analysis (Johnston et al., 2007), ScRALF3 may thus be

a potential candidate peptide regulating cell-cell communication between the sporophyte

and the gametophyte. The search for interacting partners, as well as the development of

biochemical tool and advanced microscopic staining techniques in Solanum chacoense will

strengthen this model and help to better understand the mechanism of action of RALF-like

peptides in reproduction.

115

3.2.7 Acknowledgements

This work was supported by the Natural Sciences and Engineering Research Council

of Canada (NSERC) and the Canada Research Chair program. E.C. is a recipient of PhD

fellowship from NSERC and from Le Fonds Québécois de la Recherche sur la Nature et les

Technologies (FQRNT);A.L-H. is a recipient of an MSc fellowship from FQRNT. The authors

have no conflict of interest.

4. Implication des gènes AtRALF-Like lors de la reproduction chez Arabidopsis

thaliana

4.0.1 Préambule

Les gènes de type RALF se regroupent au sein d’une grande famille présente dans

plusieurs espèces végétales. Chez Arabidopsis, près de 40 membres ont d’ailleurs été

isolés. Suivant la caractérisation de ScRALF3 chez Solanum chacoense, un modèle a été

proposé sur l’implication des peptides RALFs dans les communications cellulaires lors de

développement du gamétophyte femelle. Dans le but de mieux comprendre l’évolution

fonctionnelle des peptides RALFs lors de la reproduction, la recherche et la caractérisation

de gènes de type RALFs chez Arabidopsis thaliana ont été entreprises. Comme nous nous

intéressons au rôle potentiel des peptides RALF lors de la reproduction, et plus

particulièrement ceux impliqués dans le développement du gamétophyte femelle, nous

avons privilégié une étude d’une part de l’orthologue potentiel de ScRALF3, AtRALF34, et

de gènes plus ou moins spécifiques au tissu femelle. Afin de cibler des candidats

potentiels, des outils bioinformatiques, lesquels nous permettent de prédire l’expression

de plusieurs gènes, ont été scrutés, et une revue littérature exhaustive a été effectuée, qui

a été présentée en partie dans le chapitre I.

4.1 ANALYSE FONCTIONNELLE DE L ’ORTHOLOGUE POTENTIEL DE SCRALF3

CHEZ ARABIDOPS IS THALIANA , ATRALF34

Eric Chevalier

Institut de Recherche en Biologie Végétale, Département de Sciences Biologiques,

Université de Montréal, 4101 rue Sherbrooke est, Montréal, QC, Canada, H1X 2B2

4.1.1 Identification de l’orthologue potentiel de ScRALF3, AtRALF34

Des gènes de différentes espèces sont dits orthologues lorsqu’ils originent d’un

même gène appartenant à un ancêtre commun (Fitch, 1970). Une similarité de séquence

significative et des domaines fonctionnels partagés indiquent que deux gènes sont des

orthologues (Falciatore et al., 2005). L’orthologie est donc défini strictement en terme

d’ancestre, lequel peut-être difficile à définir dû à la duplication génétique et les

117

événements de réarrangement génomique. L’évidence la plus forte entre deux gènes

similaires de l’orthologie est habituellement trouvée en faisant une analyse

phylogénétique de la lignée génétique. Les orthologues ont donc souvent, mais pas tout le

temps, la même fonction (Fang et al., 2010).

Dans le but d’identifier l’orthologue de ScRALF3 pour effectuer des analyses

génétiques chez Arabidopsis thaliana, une analyse par Neighbor joining a été réalisé

contre tous les AtRALFs (Germain et al., 2005). La relation entre ScRALF3 et AtRALF34 est

fortement supportée par un Bootstrap de 100. D’ailleurs, un arbre de distance utilisant

BLAST Pairwise Alignment suivant un DELTA-BLAST confirme la forte relation entre la

séquence de ScRALF3 et celle de AtRALF34; un maximum d’identité de 4% caractérise

l’alignement (Figure 25a, p.118)()http://blast.ncbi.nlm.nih.gov/BLAST.cgi). Ces 2 peptides

possèdent également des motifs en commun, et également essentiels à la fonction des

peptides RALFs. On y retrouve une séquence acide, suivi d’un domaine très conservé

contenant 4 cystéines, et une queue basique, tel qu’identifiée par le programme MEME

(http://meme.sdsc.edu/) en comparant la séquence peptidique de AtRALF34 et ScRALF3

(Figure 25b, p.118). De plus, la recherche de motifs conservés, avec le même programme

MEME contre tous les peptides de type RALF cette fois-ci, révèle un arrangement

particulier à AtRALF34 et ScRALF3; ces derniers sont les seuls à partager un arrangement

unique de 4 des 6 motifs plus ou moins présents dans les séquences peptidiques de type

RALF (Figure 26-27, p.119-20). Quant à leur extrémité N-terminale, elle se caractérise par

la présence d’un peptide signal, tel que prédit par SignalP4.0 (http://www.cbs.dtu.dk/).

D’ailleurs, une analyse récente fait par Cao J. et Shi F. (Cao and Shi, 2012) classe AtRALF34

dans un clade unique spécifique aux dicotylédones et dont aucun autre représentant de A.

thaliana y appartient. Ainsi, AtRALF34 et ScRALF3 rencontre les caractéristiques

d’orthologues, soit une similarité de séquences et des domaines conservés, et semblent

partagés un ancestre commun récent ayant évolué au sein des dicotylédones.

118

FIGURE 25 ARBRE DE DISTANCE RÉALISÉ À PARTIR DE LA SÉQUENCE PEPTIDIQUE DE SCRALF3 ET LE PROGRAMME

BLAST.

(a) L’arbre de distance réalisé avec les séquences peptidiques AtRALFs retrouvé suite à un DELTA-

BLAST (Domain Enhanced Lookup time Accelerated BLAST) effectué avec la séquence de ScRALF3

dans la banque de donnée de séquences protéiques non-redondantes d’Arabidopsis thaliana

(taxid :3702). La méthode d’arbre utilisée est le Neigbor Joining et la matrice de distance est

Grishin. (b) L’alignement protéique montre une forte similarité entre ScRALF3 et AtRALF34. Les

motifs identifiés par le programme MEME sont surlignés en mauve (domaine acide), vert

(séquence fonctionnelle), et rouge (queue basique). (*) : identique; ( :) similaire.

119

FIG

UR

E 2

6 P

RÉD

ICTI

ON

DE

MO

TIFS

AU

SEI

N D

ES P

EPTI

DES

RA

LFS

AV

EC L

E P

RO

GR

AM

ME

MEM

E.

ScR

ALF

3 et

AtR

ALF

34 o

nt

un

arr

ange

emen

t d

ans

la s

équ

ence

pri

mai

re s

tru

ture

llem

ent

iden

tiq

ue

en p

arta

gean

t le

s m

oti

fs 3

(ro

uge

),

4 (

rose

), 2

(b

leu

) et

1 (

ble

u c

lair

). P

arm

is le

s au

tres

RA

LFs,

leu

rs s

éq

uen

ces

pri

mai

res

peu

ven

t co

nte

nir

éga

lem

ent

le m

oti

f6 (

vert

) et

5

(jau

ne)

. La

des

crip

tio

n d

es m

oti

fs e

st s

chém

atis

ée à

la f

igu

re s

uiv

ante

.

120

FIGURE 27 SÉQUENCES DES MOTIFS

RETROUVÉS AU SEIN DES PEPTIDES

RALFS.

Ces motifs sont représentés sur

l’alignement peptidique de la figure

précédente. On peut remarquer la

prépondérance des motifs

importants comme YISYGAL (Motif

2), des résidus acides (Motif 4), et

du site de clivage RRIL (Motif 4)

(Pearce et al., 2010; Srivastava et

al., 2009).

121

4.1.2 Expression de AtRALF34 lors du développement

FIGURE 28 EXPRESSION DE ATRALF34 DANS DIFFÉRENTS TISSUS CHEZ ARABIDOPSIS THALIANA SELON LES

RÉSULTATS DES MICROPUCES À ADN PAR (A) TILING OU (B) TRADITIONNEL (ATH1).

(a) AtRALF34 est fortement exprimé dans tous les tissus de la plante. Root 7 days; Seedling, aerial

parts, 7 days; EXLeaf, Expanding Leaf, 10 days; SELeaf, Senescing leaf, 35 days; Stem, 2nd

internode; VSM, Vegetative Shoot Meristem, 7 days; ISM, Inflorescence shoot meristem, 21 days;

WIN, Whole inflorescence to floral stage 9, 21 days; Flower stage 15, 21+ days; Fruit, carpel stage

15, 21+days. (b) Forte expression de AtRALF34 dans les jeunes bourgeons en développement et

régulation negative suivant l’atteinte de la maturité florale. INF apex, Shoot Apex Inflorescence;

Seed3, globular embryo; Seed4-5, heart embryo; Seed6, torpedo embryo; Seed7, Walking-stick

embryo; Seed8, curled embryo; Seed9, cotyledons embryo; Seed10; Green cotyledons embryo.

Source: The Bio-Array Resorce for Plant Biology, http://bar.utoronto.ca.

Plusieurs outils bioinformatiques sont mis à notre disposition pour connaître la

génomique et en partie la protéomique fonctionnelle de Arabidopsis thaliana. Dans le but

de connaître le patron d’expression de AtRALF34 et de confirmer ou infirmer son rôle

potentiel lors de la reproduction, une recherche sur le BIO-Array Ressource for Plant

Biology (BAR; http://bar.utoronto.ca/) a été effectuée. Selon les résultats de Tiling qui y

sont présentés, AtRALF34 est un gène exprimé dans plusieurs tissus, tout en ayant une

forte abondance dans le carpelle (Figure 28a, p.121). Grâce aux nombreux résultats

obtenus sur les puces ATH1 et qui sont partagés sur les banques de données, nous

pouvons suivre de plus près le patron d’expression de AtRALF34 lors du développement

de l’ovule et de la graine (Figure 28b, p.121). AtRALF34 est fortement exprimé dans les

122

jeunes bourgeons, et son expression est plutôt stable entre le stade floral 9 et 12; une

chute marquée entre le stade floral 12 et le stade floral 15 survient. De même, bien que

l’expression diminue dans le carpelle avec le développement floral, on remarque malgré

tout une prédominante expression dans ce tissu. Après fécondation, l’expression dans les

graines chute progressivement lors de son développement, avec une légère induction

dans les graines au stade 6, soit au stade torpille embryonnaire. Pour supporter ces

résultats, un RT-PCR semi-quantitatif a été effectué, confirmant l’ubiquité du gène

AtRALF34 et son expression au niveau des bourgeons floraux (Figure 29, p.122).

FIGURE 29 ANALYSE SEMI-QUANTITATIVE PAR RT-PCR DE L'EXPRESSION DE ATRALF34 DANS DIFFÉRENTS TISSUS

CHEZ ARABIDOPSIS THALIANA.

La M-MLV reverse transcriptase (Invitrogen) a été utilisé pour créer une banque d’ADNc sur

laquelle 36 cyles d’amplification en chaîne par polymérisation a été effectué pour monitorer

l’expression de AtRALF34. Le gène de l’actine a été utilisé comme contrôle.

Dans le but de préciser le lieu d’expression tissulaire et/ou cellulaire de AtRALF34,

des plantes transgéniques exprimant le gène de la β-glucuronidase (GUS) ou de la « yellow

fluorescent protein (YFP)» ont été obtenus. Trois différentes populations ont été

analysées : 1) GUS sous le contrôle du promoteur (-1000nt) et du ’UTR de AtRALF34; 2)

YFP sous le contrôle du promoteur (-1000nt) et du ’UTR de AtRALF34; 3) YFP fusionné en

3’ de AtRALF34 en aval de son promoteur (-1000nt) et de son ’UTR. Dès le 1er jour suivant

la germination de la graine, AtRALF34 est exprimé au niveau des cotylédons (Figure 30a,

p.123); son expression se précise à l’extrémité des cotylédons en croissance dans les jours

suivants, et une forte expression s’installe au niveau du méristème végétatif et des

nouvelles feuilles (Figure 30b-f;p;u, p.124). Le tissu vasculaire exprime parfois, mais pas

123

tout le temps, le gène AtRALF34. Toutefois, de façon stable et répétitive, AtRALF34

s’exprime fortement dans les cellules initiant les racines latérales (Figure 30g-j;r-t, p.124).

Cette expression débute dans les cellules du péricycle initiant le développement des

racines latérales (Figure 30g;t, p.124), et demeure pendant toutes les étapes de division et

de différentiation cellulaire conduisant à l’apparition du primordium (Figure 30h-j;r-s,

p.124). L’expression de AtRALF34 s’installe à l’extrémité de la racine latérale lorsque celle-

ci commence son processus d’élongation (Figure 30e-f, p.124). Cependant, l’extrémité de

la racine primaire n’exprime jamais AtRALF34 (Figure 30k, p.124), ce qui suggère un

mécanisme de régulation de croissance légèrement différent entre la racine primaire et

les racines latérales. Au niveau des bourgeons floraux, AtRALF34 s’accumule dans les

jeunes bourgeons, principalement entre le stade 9 (initiation des pétales) et le stade 13

(anthèse) (Figure 30l-m, p.124). L’expression est très marquée au niveau du carpelle

(Figure 30n, p.124), et plus précisément au niveau des ovules en développement (Figure

30o, p.124). D’ailleurs, l’expression est très évidente dans les ovules entre le stade floral

10 et 12 (pétales jusqu’à la hauteur des étamines) (Figure 30m-n, p.124). C’est d’ailleurs

durant ces mêmes étapes que le sac embryonnaire se développe. Les pétales en

croissance expriment également AtRALF34. Dès l’ouverture des fleurs, la régulation

négative de AtRALF34 survient, l’expression est complètement, sinon presque totalement,

abolie. Ainsi, AtRALF34 demeure toujours un bon candidat pour contrôler le

développement de l’ovule et du gamétophyte femelle chez A. thaliana comme ScRALF3

chez S. chacoense. De plus, dans les plantes qui expriment AtRALF34-YFP sous contrôle du

promoteur natif, on remarque que la protéine chimérique s’accumule dans l’apoplaste, le

contour cellulaire est mieux délimité (Figure 30t-u, p.124) que la GFP cytosolique exprimé

avec ce même promoteur (Figure 30 p;r, p.124), et ce tant lors de l’initiation des racines

latérales qu’au niveau de l’apex végétatif. En somme, AtRALF34 est un gène possiblement

impliqué dans la croissance et/ou la différentiation cellulaire, via la production d’un

peptide sécrété dans les régions tissulaires se divisant très fortement.

124

Figure 30 Analyse fonctionnelle du promoteur de AtRALF34. (a-o) Analyse du promoteur par coloration GUS. (p-s) Analyse du promoteur par fluoresence YFP. (t-u) Analyse du

promoteur et de la localisation cellulaire de AtRALF34-YFP. Expression des les pousses (a) 1 jour, (b) 2 jours, (c) 3 jours,

(d) 4 jours, (e) 6 jours et (f) 9 jours après germination (DAG). (g-j;r-t) Expression dans le primordium des racines latérales.

(l) Expression dans les bourgeons floraux. (m-n) Agrandissement sur les fleurs au stade floral 12. (o) Expression dans les

ovules (éclaircissement au méthyl salicylate) au stade floral 10-11. (p;u) Expression dans le méristème végétatif et (q)

dans les stomates. (t-u) Sécrétion de AtRALF34 dans l’apoplaste.

125

4.1.3 Analyse de lignées mutantes pour le gène AtRALF34

Dans le but de préciser la fonction de AtRALF34 lors de la reproduction,

notamment lors du développement de l’ovule et du gamétophyte femelle, une lignée

d’insertion a été caractérisée provenant du Salk Institute Genomic Analysis Laboratory

(SIGnAL; http://signal.salk.edu/). À l’aide d’une paire d’amorces permettant d’amplifier le

gène complet et/ou d’une paire d’amorce à la fois spécifique au T-DNA et à AtRALF34, un

criblage a été effectué sur la lignée SALK004441 (Figure 31a, p.127). Après séquençage de

l’amplicon, cette lignée, que l’on appellera ralf34-1, possède un T-DNA dans le 5’UTR,

quinze nucléotides en amont du codon d’initiation de AtRALF34 (Figure 31b, p.127). Des

lignées hétérozygotes ont d’abord été identifiées, puis des lignées homozygotes ont pu

être sélectionnées dans la seconde génération. Aucun problème de transmission de la

mutation dans les analyses de ségrégation à la kanamycine s’est manifesté, suggérant

aucune anomalie gamétophytique. Néanmoins, ceci nous a permis d’obtenir une

population ralf34-1 homozygote, dont le transgène est fixé à travers les générations.

La croissance et le développement de ralf34-1 avec le type sauvage Col-0 ont été

analysés pour détecter une différence entre les deux populations, laquelle peut être

interprétée comme une perte de fonction associée au gène muté. Aucun délai dans le

temps de germination, aucun organe évident est absent, aucun délai dans le temps de

floraison et aucun problème dans la croissance racinaire apparaissent (données non

montrées). Néanmoins, bien que les siliques aient une apparence, à première vue,

similaire à celles de type sauvage, celles-ci (x=1,5±0,1cm) sont légèrement plus courtes

que celles de type sauvage (x=1,6±0,1cm) (Figure 31c-e, p.127). Néanmoins, cette

différence est minime, bien que statistiquement significative (pvalue0,05). Une légère

diminution dans le nombre de graines semble être la cause première de cette perte de

croissance au niveau du fruit (Col-0 :x=57±4; ralf34-1 :x=51±6; pvalue0,05) (Figure 31f,

p.127). L’arrangement des graines à l’intérieur des siliques ralf34-1 n’est toutefois pas

différente de celui retrouvé dans les siliques Col-0; autrement dit, il n’y a pas de saut dans

126

l’arrangement linéaire, ce qui suggère qu’aucun ovule ait avorté. Ainsi, ces évidences

suggèrent que moins de primordia d’ovule ont été initiés lors du développement du

carpelle dans le mutant ralf34-1. L’origine de cette anomalie n’est toutefois pas connue.

La surexpression du gène AtRALF34 a également été investiguée sur la croissance

et le développement d’A. thaliana. Pour ce faire, le gène a été inséré en aval du

promoteur de la mosaïque du chou-fleur CaMV35S; une population témoin ayant été

transformée avec le vecteur vide a été obtenue parallèlement, tout comme une

population surexprimant AtRALF34 avec un épitope MYC (Figure 32, p.128). Dans tous les

cas, aucune différence notable a été observée sur le phénotype, et ce, à tous les stades de

développement. Ainsi, la surexpression du gène AtRALF34 n’altère pas le développement

général de la plante.

4.1.4 AtRALF34 joue-t-il un rôle dans la reproduction?

Suite aux analyses d’expression et fonctionnelles qui ont été effectuées sur le gène

AtRALF34, nous ne pouvons pas rejeter l’hypothèse que AtRALF34 puisse jouer un rôle

dans la reproduction, et ce, même quant au développement de l’ovule et du gamétophyte

femelle. En effet, bien que les mutants de surexpression et ralf34-1 soient dépourvus de

phénotype affectant le développement du gamétophyte femelle, il reste néanmoins que

c’est un gène fortement régulé lors du développement floral. Le promoteur (-1000nt) est

fonctionnel, et ces résultats s’accordent avec l’identification des transcrits dans les mêmes

tissus, et ce via les analyses de Tiling et de puces ATH1. Une analyse globale de son

expression révèle une prédominance dans les tissus en forte division et différentiation

cellulaire, soit les méristèmes à l’apex de chaque organe. De plus, AtRALF34-YFP est une

protéine stable qui s’accumule dans l’apoplaste des cellules favorisant son expression.

Ainsi, tout comme ScRALF3, AtRALF34 est un candidat potentiel pour réguler la division

et/ou la différentiation cellulaire via une voie de signalisation récepteur dépendant.

127

FIGURE 31 LE MUTANT RALF34-1 NE

PRÉSENTE PAS D'ANOMALIE DU

DÉVELOPPEMENT DU GAMÉTOPHYTE

FEMELLE.

(a) Criblage de la lignée T-DNA avec

des amorces spécifiques au gène

AtRALF34 intact (G) et avec des

amorces à la fois spécifique à

AtRALF34 et au T-DNA (T). (b) Le

séquençage de l’amplicon a révélé

la présence du T-DNA (rouge) à

l’intérieur du ’UTR du gène. Vert :

séquence codante. Bleu : gène non-

traduite. (c) Silique de type sauvage

éclaircit au méthyl salicylate. (d)

Siliques ralf34-1 éclaircit au méthyl

salicylate. (e) Légère diminution

dans la taille des siliques ralf34-1.

(f) Légère diminution du nombre de

graines dans le mutant ralf34-1. ** :

pvalue<0,05.

128

FIGURE 32 LA SUREXPRESSION DE ATRALF34 N'AFFECTE PAS LE DÉVELOPPEMENT CHEZ ARABIDOPSIS THALIANA.

(Haut) La surexpression de AtRALF34 sous contrôle du promoteur viral de la mosaïque du chou-

fleur. (Centre) La surexpression de AtRALF34 avec un épitope myc. (Bas) Des plants Col-0

transformés avec un vecteur vide de surexpression, pMDC32 (Curtis and Grossniklaus, 2003).

L’absence de phénotype majeur peut sous-entendre une plus grande dynamique

régulatrice derrière la fonction du gène. Autrement dit, AtRALF34 peut avoir été recruté

pour apporter un contrôle fin lors des mécanismes de division/différentiation cellulaires.

Sur ce, la fonction de AtRALF34 peut possiblement être mise en évidence selon le contexte

environnemental dans lequel la plante croît. D’ailleurs, le léger phénotype apparu au

niveau des siliques supportent cette affirmation; à savoir qu’un phénotype plus évident

peut apparaître selon la rigueur des conditions de croissance, tel que l’emplacement, la

température, l’humidité ambiante, la compaction et la richesse du sol… C’est une

129

hypothèse qui demeure à investiguer, mais cohérente compte tenu du haut niveau

d’expression qui est observé dans les régions en développement et la présence

d’éléments de régulation très variés dans le promoteur de AtRALF34. En effet, à l’aide du

progamme PROMOMER (http://bar.utoronto.ca/) nous pouvons retrouver des éléments

cis de régulation pour les facteurs de transcription de type AGAMOUS, impliqués tant dans

le développement floral que dans les réponses à la lumière et à la voie de signalisation de

la gibbérelline. De même, il y a des éléments de régulation qui semblent impliqués dans la

voie de signalisation du sucre, dans la réponse face aux éliciteurs, l’éthylène et le méthyl-

jasmonate, entre autres. D’ailleurs, puisque les récents développements en signalisation

cellulaire démontrent la complexité des interactions des voies de signalisation (Durbak et

al., 2012), il est justifié de penser que la mutation de AtRALF34 peut démontrer un

phénotype particulier selon la condition environnementale.

Ce peut-il que AtRALF34 ne soit pas l’orthologue potentiel de ScRALF3? En effet,

beaucoup de RALFs chez A. thaliana sont apparus suite à des événements de duplications

et semble avoir divergé en fonction (Cao and Shi, 2012; Olsen et al., 2002). Or, selon toute

évidence, AtRALF34 est, en terme d’ancêtre, l’orthologue de ScRALF3. Que présent chez

les dicotylédones, AtRALF34 partage 4% d’identité avec ScRALF3 et une architecture

structurellement identique. Leur fonction semble cependant avoir divergé ou subdivisé en

partie. En effet, selon une analyse récente, parmi les gènes AtRALFs, il y a eu, récemment,

de la néo-fonctionnalisation et de la sous-fonctionnalisation qui sont apparues,

notamment au sein des gènes dupliqués (Cao and Shi, 2012). Bien que AtRALF34 ne soit

pas un gène dupliqué, les RALFs partagent malgré tout les mêmes motifs fonctionnels en

C-terminal. L’identification d’autres gènes exprimés dans le tissu sporophytique de l’ovule

pourrait être une approche intéressante pour vérifier le rôle des gènes de type RALF dans

le développement du gamétophyte femelle chez Arabidopsis thaliana. Ainsi, il se pourrait

que chez les solanacées, celles-ci ont eu recours aux gènes de type RALF, dont ScRALF3,

pour utiliser leurs propriétés biochimiques afin d’avoir un contrôle plus fin sur le

130

développement du gamétophyte femelle. Or, chez Arabidopsis thaliana, la néo-

fonctionnalisation qui est apparue chez les gènes dupliqués peut avoir causer de la

redondance fonctionnelle au sein de la famille des gènes RALFs. L’analyse de mutants

multiples serait donc à privilégier selon les candidats cibles basés sur leur patron

d’expression.

4.2 AUTRES GÈNES DE TYPE RALF POUVANT POSSIBLEMENT ÊTRE

IMPLIQUÉS DANS LA REPRODUCTION

4.2.1 Plusieurs gènes de type RALF sont exprimés au niveau du carpelle

L’absence de phénotype dans les mutants T-DNA ralf34-1 peut suggérer, entre

autres, la participation d’autres gènes de type RALF dans le développement du

gamétophyte femelle. Dans cette perspective, les outils bioinformatiques ont été scrutés

pour retrouver des candidats exprimés lors de la mégagamétogénèse. Chez Arabidopsis

thaliana, les stades floraux ont été bien caractérisés (Smyth et al., 1990). Puisque la

mégagamétogénèse se déroule principalement lors du stade floral 12, BAR a été utilisé

pour retrouver les gènes AtRALFs qui présentent une expression dans le carpelle à ce

stade précis. Sur les 20 gènes disponibles sur la banque de donnée, 9 d’entre-eux

présentent un niveau d’expression acceptable, soit supérieur au seuil limite de 100 (Figure

33, p.131).

Parmis les gènes d’intérêts, At5g67070 (AtRALF34) est celui qui présente la plus

forte expression au niveau du carpelle. At4g15800 (AtRALF33) est le deuxième gène en

importance, suivi de très près par At3g16570 (AtRALF23) et At3g23805 (AtRALF24). Puis, à

un niveau d’expression sensiblement équivalent, on retrouve At1g61563 (AtRALF8),

At1g61566 (AtRALF9), At3g05490 (AtRALF22), At4g13950 (AtRALF31) et At4g14010

(AtRALF32). Bien entendu, ces résultats dérivent d’analyse de puces ATH1 sur lesquels les

petits gènes sont sous-représentés (Jones-Rhoades et al., 2007), et pour lesquels la

131

similarité séquentielle entre les gènes de type RALF peut causer de faux résultats

d’expression.

Par exemple, AtRALF8 et AtRALF9 ont exactement le même patron d’expression

selon les résultats des puces ATH1, ce qui peut vouloir dire qu’il y a eu une hybridation

croisée des transcrits. De plus, l’analyse fonctionnelle du promoteur de AtRALF9 révèle

une expression très spécifique liée au développement du pollen (Figure 34a, p.132).

L’expression est extrêmement forte dans le pollen gagnant en maturité ; ainsi, la présence

d’expression au niveau du carpelle, détectée par les analyses des biopuces ATH1,

dériverait de pollen contaminant sur le carpelle qui a affecté son abondance relative dans

ce tissu. L’analyse fonctionnelle des promoteurs de AtRALF24 et AtRALF31 confirme par

contre l’expression dans les bourgeons floraux, et notamment au niveau du carpelle

(Figure 34b-e, p.132). AtRALF31 est de plus exprimé dans les sépales, alors que AtRALF24

présente une expression au niveau du pollen et des sépales.

FIGURE 33 EXPRESSION DE PLUSIEURS GÈNES DE TYPE RALF DANS LE CARPELLE AU STADE FLORAL 12.

Le niveau d’expression est normalisé et les résultats viennent des résultats de micropuces à ADN ATH1.

132

FIGURE 34 ANALYSE FONCTIONNELLE DE CERTAINS PROMOTEURS DES GÈNES DE TYPE RALFS DANS LES ORGANES

REPRODUCTEURS.

(a) pAtRALF9 ::GUS, coloration du pollen. (b) pAtRALF31 ::GUS, coloration des bourgeons floraux.

(c) L’agrandissement d’un bourgeon floral au stade 12 montre l’expression dans le carpelle. (d)

pAtRALF24 ::GUS, coloration des bourgeons floraux. (e) L’agrandissement montre l’expression

dans le pollen et le carpelle de plusieurs bourgeons à différents stades floraux. (f)

pAtRALF14 ::GUS, coloration dans le carpelle. (g-h) AtRALF14 est exprimé dans l’appareil

gamétique du sac embryonnaire, et plus fortement dans les synergides.

133

4.2.2 Candidats pouvant assurer une communication sporophytique-gamétophytique

Pour permettre une coordination du développement entre le sac embryonnaire et

le tissu sporophytique maternel, une communication réciproque doit s’établir entre ces

deux structures de l’ovule. Pour qu’un peptide puisse permettre une communication

sporophyte-gamétophyte tel que proposé pour le peptide ScRALF3 chez Solanum

chacoense, et ainsi réguler la coordination du développement au sein de l’ovule, ce

dernier doit être exprimé par le tissu sporophytique, et ce, à un stade floral précoce, soit

entre le stade 10 et 12. Dans cette perspective, les études de transcriptomique

comparative ont été analysées pour retrouver des candidats potentiels répondant à ces

critères.

Pour rappeler certains résultats mentionnés dans le chapitre I, la transcriptomique

comparative entre les ovules de type sauvage et des mutants présentant un

développement anormal des téguments ou du sac embryonnaire révèle l’expression plus

ou moins spécifique de certains gènes de type RALF lors du développement de l’ovule. Les

différentes expériences, réalisés soit sur des puces ATH1 ou via Tiling, s’entendent sur

l’expression spécifique à l’ovule de AtRALF18, spécifique au tissu sporophytique pour

AtRALF32/33, et plus spécifique au sac embryonnaire pour les gènes AtRALF14/28,

at1g52970, et possiblement AtRALF5/10/29, at4g09462, at5g19175, at5g27238 (Johnston

et al., 2007; Jones-Rhoades et al., 2007; Skinner and Gasser, 2009; Steffen et al., 2007;

Wuest et al., 2010; Yu et al., 2005). Une analyse fonctionnelle du promoteur de AtRALF18

révèle une expression au niveau de la cellule centrale, et un peu plus faible au niveau des

synergides et de la cellule œuf, dans le sac embryonnaire mature (Wuest et al., 2010).

AtRALF14 est par contre beaucoup plus spécifique à l’appareil gamétique selon notre

analyse suite au clonage du promoteur devant le gène de la β-glucuronidase (Figure 34e-g,

p.132). Or, outre les résultats présentés par Yu et al. (200 ) confirmant l’expression plus

spécifique au sac embryonnaire de AtRALF14 et AtRALF18, et ce, tant lors du

développement du sac embryonnaire que dans le sac mature, les résultats des autres

134

groupes de recherche ont été réalisés avec des transcrits prélevés de fleurs matures, soit

entre le stade floral 13 et 15 (Johnston et al., 2007; Jones-Rhoades et al., 2007; Steffen et

al., 2007). Il faut se rappeler que selon Smyth et al. (1990), le développement du sac

embryonnaire a lieu entre le stade floral 10 et 12, avec la mégagamétogénèse se

déroulant principalement lors du stade floral 12. Ainsi, les résultats peuvent être difficiles

à interpoler pour ce qui est de ceux venant des études de transcriptomique comparative.

Par exemple, selon BAR, At1g52970 présente une faible expression dans le carpelle au

stade floral 12 (16,93±3,6), qui devient significative (105,41±13,12) dans le carpelle au

stade floral 15 contenant des ovules matures. Bien que les résultats de transcriptomique

comparative ne dérivent pas de transcrits associés au stade floral d’intérêt, combiné avec

les analyses transcriptomiques développementales précédemment présentées, les gènes

AtRALF32 et AtRALF33 sont des candidats intéressants pouvant potentiellement agir

comme molécule de signalisation entre le sporophyte et le gamétophyte femelle lors du

développement de l’ovule. Néanmoins, l’absence de spécificité d’expression de d’autres

gènes de type RALF n’exclut pas leur rôle actif dans le développement du gamétophyte

femelle, comme en fait foi le mutant feronia ; FERONIA est un récepteur ubiquitairement

exprimé dans la plante, mais possède un rôle spécifique dans la réception du tube

pollinique lors de la double fécondation (Duan et al., 2010; Escobar-Restrepo et al., 2007).

Enfin, si on retrouve sur l’arbre de distance les gènes cibles (exprimés dans le

carpelle au stade floral 12), on remarque que ce sont pour la plupart ceux se regroupant le

plus près de AtRALF34. En effet, si on localise les peptides AtRALF22/23/24/31/32/33/34,

outre AtRALF32, ils se regroupent tous dans la première branche ayant le plus récemment

divergée de AtRALF34/ScRALF3 (Figure 25a, p.118). Ainsi, de toute évidence, de la

redondance fonctionnelle peut survenir au sein de la famille des peptides RALFs pour

réguler le développement du gamétophyte femelle chez Arabidopsis thaliana. D’ailleurs,

la redondance fonctionnelle est couramment rencontrée dans les familles de peptide,

135

comme il a été constaté, par exemple chez les peptides ROTUNDIFOLIA (Narita et al.,

2004) et les CLAVATA3/ESR (CLEs)(Strabala et al., 2006).

En somme, nous pouvons conclure que d’autres gènes de type RALF peuvent

participer aux événements de signalisation régulant les interactions entre le gamétophyte

femelle et le sporophyte pour assurer un contrôle fin de leur développement respectif

chez Arabidopsis thaliana. AtRALF33 apparaît être un candidat très intéressant, possédant

une très courte distance phylogénétique avec AtRALF34 et possédant la seconde plus

forte expression au niveau du carpelle parmis les candidats sélectionnés et une expression

potentielle dans le tissu sporophytique. L’obtention de lignées transgéniques mutées pour

plusieurs gènes est donc essentielle pour bien comprendre le rôle des petits peptides de

type RALF lors de la reproduction chez Arabidopsis thaliana.

5. Discussion générale

5.1 RALF comme projet de doctorat

Le but de la présente thèse était de mettre en évidence le rôle des petits peptides

sécrétés lors de la reproduction. Pour ce faire, une banque d’ESTs d’ovaires fécondés a été

criblé pour retrouver des gènes de type RALF. Ceux-ci ont été caractérisés

transcriptionnellement afin de cibler des gènes plus ou moins spécifiques aux tissus

reproducteurs. Le gène ScRALF3 a été retenu pour des analyses fonctionnelles pour sa

régulation spécifique lors des événements post-fécondation au sein de l’ovule de cette

solanacée. Les plantes d’interférence pour le gène ScRALF3 ont cependant révélé

l’implication de ce peptide dans la maturation du sac embryonnaire. La caractérisation

approfondie du gène ScRALF3 lors de la mégagamétogénèse nous a amené à proposer que

ScRALF3, membre de la famille des CRPs, participe dans les communications

intercellulaires permettant la coordination du développement entre le sporophyte et le

gamétophyte femelle dans l’ovule en croissance. La caractérisation fonctionnelle de

l’orthologue potentiel chez Arabidopsis thaliana, AtRALF34, suggère que de la redondance

fonctionnelle au sein de la famille des RALFs s’est possiblement développée pour

contrôler l’organisation du sac embryonnaire. En somme, un nouveau rôle des CRPs a été

identifié lors de la reproduction, bien que leur abondance relative dans les tissus

reproducteurs suggère une complexité fonctionnelle et régulatrice qui demeure à

explorer.

5.2 Les petits peptides sécrétés lors de la reproduction

Les peptides sont généralement définis comme des petites chaînes

polypeptidiques de moins de 100 résidus d’acides aminées. Bien que lontemps sous-

représentés dans les banques génomiques, les petits peptides forment aujourd’hui des

classes très abondantes et riches en membres. Les signaux peptidiques sécrétés peuvent

être catégorisés en deux groupes structurellement distincts en fonction de la voie de

biosynthèse empruntée : (1) les peptides subissant des modifications post-

137

traductionnelles complexes suivies d’une maturation protéolytique extensive et (2) les

peptides subissant la formation de liaisons disulfures intramoléculaires avec ou sans

clivage protéolytique (Matsubayashi, 2011). Le premier groupe, que l’on appelle les «small

post-translationally modified peptides», inclut la phytosulfokine (PSK), le facteur

inhibiteur de différentiation de l’élement trachéaire (TDIF), CLAVATA3 (CLV3) et le facteur

de croissance du méristème racinaire (RGF). Le second groupe, reconnu sous le terme «les

peptides riches en cystéines (CRPs)» regroupe notamment les peptides RALF, LURE,

SCR/SP11, STOMAGEN, EPF1, EPF2. La composition en acides aminées des CRPs est

hautement divergente entre les groupes et à travers les différentes espèces, mais ils

partagent tous trois éléments en commun : i) une petite taille, soit moins de 160 acides

aminées, ii) une région N-terminale conservée qui inclut un peptide signal de sécrétion et

iii) un domaine riche en cystéines en C-terminal, contenant entre 4 et 16 cystéines

(Marshall et al., 2011). Très nombreux, les CRPs comptent pour environ 2-3% du

répertoire génétique chez Arabidopsis thaliana et Oryza sativa (Silverstein et al., 2007).

Les récentes analyses génétiques, biochimiques et bioinformatiques ont révélés que les

petits peptides sécrétés sont des composants importants des communications

intercellulaires qui coordinent et spécifient les fonctions cellulaires chez les plantes,

comme chez les animaux (Matsubayashi, 2011).

La caractérisation des gènes de type RALF chez Solanum chacoense a permis

d’étendre le rôle des CRPs lors de la reproduction. En effet, les CRPs sont nombreux à être

exprimés au niveau des tissus reproducteurs, et y sont même surreprésentés (Silverstein

et al., 2007), et leur fonction, quoique d’apparence diverses, sont pour la plupart

méconnue. Chez Solanum chacoense, cinq gènes de type RALF ont été isolés d’une banque

d’ESTs provenant de transcrits d’ovaires fécondés (Germain et al., 2005). Bien que la

fonction physiologique de ces peptides n’ait pas été investigué lors du développement de

la graine, il est à noter que les communications intercellulaires lors de développement de

l’endosperme et de l’embryon apparaissent nombreuses (Nowack et al., 2010). D’ailleurs,

138

chez le maïs, d’autres membres des CRPs sont spécifiquement et exclusivement exprimés

dans différents domaines de l’albumen. Certains, comme par exemple ZmESR-6, sont

exprimés dans la région entourant l’embryon et peuvent avoir un rôle dans la régulation

des transferts de nutriments et des signaux de croissance vers l’embryon en

développement (Balandin et al., 2005; Magnard et al., 2000). D’ailleurs, Marshall et al.

(2011) proposent que certains CRPs spécifiques aux cellules de transferts, comme MEG1

(Gutierrez-Marcos et al., 2004), altèrent le potentiel membranaire pour augmenter le flux

de nutriments et de signaux vers la graine en croissance. Certains CRPs quant à eux

possèdent également des propriétés anti-fongiques anti-bactériennes, et leur fonction

peut être lié à la défense de l’embryon contre les pathogènes lors de cette phase

vulnérable du cycle de vie végétal (Balandin et al., 2005; Serna et al., 2001). En somme,

bien que les évidences du rôle des CRPs, et plus spécialement de l’implication des

peptides RALFs, dans le développement de la graine sont minimes, il est vraisemblable

qu’ils soient des facteurs importants dans la coordination de la croissance et du

développement de l’embryon et de l’albumen au sein de la graine en formation.

Les analyses d’expression effectuées chez Solanum chacoense et Arabidopsis

thaliana ont révélé la diversité d’expression des peptides RALFs à différents stades de

développement floral. Que ce soit l’expression de AtRALF9 dans le pollen, ou encore celle

de AtRALF14 dans le sac embryonnaire, ou l’expression plus ou moins précise de AtRALF24

et AtRALF31 au sein de l’ovule, les peptides RALFs sont ubiquitairement présents dans les

différentes structures florales. Outre le rôle démontré de SlRALF dans l’élongation du tube

pollinique chez la tomate (Covey et al., 2010), leur présence dans les tissus reproducteurs

est incomprise. Néanmoins, la reproduction sexuée chez les plantes est un processus

hautement orchestré qui requiert de nombreuses interactions entre les tissus mâles et

femelles, ainsi qu’au sein même des tissus et entre les cellules gamétiques (Chevalier et

al., 2011). D’ailleurs, plusieurs CRPs ont des rôles connus à ce jour jouant un rôle dans la

reproduction, et notamment lors de la double fécondation. D’abord, dès la réception du

139

pollen sur le stigmate, certains CRPs, comme SCR/SP11, produit par le pollen médie la

réponse d’auto-incompatibilité chez les brassicacées (Schopfer et al., 1999; Suzuki et al.,

1999). Chez le coquelicot, c’est le stigmate qui produit le peptide sécrété (Wheeler et al.,

2009), lequel est perçu au niveau du tube pollinique dans lequel une voie de signalisation

activera le programme de mort cellulaire (Wheeler et al., 2010). LAT52 et LeSTIG1, isolés

du pollen et d’une banque de style respectivement, interagissent avec un ou des

récepteur(s) kinase(s), LePRK1/LePRK2, pour réguler la germination du pollen et/ou

l’élongation du tube pollinique (Muschietti et al., 1994; Tang et al., 2002; Tang et al.,

2004). De même, LTP5, une «Lipid-transfer protein» et membre des «Small Cystein

Adhesion» chez Arabidopsis est exprimé par le tissu transmissif du style et permet de

rendre le tube pollinique compétent à la perception de signaux de guidage par le sac

embryonnaire (Mollet et al., 2000; Park et al., 2000). Ce résultat sous-entend qu’il active

une voie de signalisation qui modifie le patron d’expression et la localisation des protéines

du tube pollinique. Plus récemment, deux CRPs, LURE1 et LURE2, ont été identifiés

comme sécrétés par les synergides et sont des molécules de guidage du tube pollinique,

possiblement en créant un gradient d’attraction vers le sac embryonnaire (Okuda et al.,

2009). De même, chez le maïs, un petit peptide membre des CRPs, ZmES4, s’accumule

dans les cellules de l’appareil gamétique et, in vitro, est capable de médier la rupture du

tube pollinique (Amien et al., 2010). En somme, ces résultats permettent de constater

que les possibilités de rôles potentiels pour les peptides RALFs lors de la reproduction sont

nombreuses. Cependant, il s’agit avant tout d’une accumulation d’évidences que les CRPs

peuvent agir comme des peptides sécrétés de signalisation, et ce via possiblement la

production d’un gradient, pour médier plusieurs aspects de la biologie végétale.

5.3 Le rôle des peptides RALFs dans l’organisation du sac embryonnaire

La caractérisation de ScRALF3 a permis de mettre en évidence le rôle des peptides

RALFs lors du développement du sac embryonnaire. Dans cette perspective, un modèle

est proposé dans lequel le peptide est sécrété par les cellules sporophytiques de l’ovule

140

pour réguler l’organisation du gamétophyte femelle, notamment au sein du syncytium.

Certaines évidences transcriptionnelles supportent un modèle dans lequel un gradient de

concentration de peptides RALF puisse s’établir au sein de l’ovule en développement, ce

qui pourrait permettre au sac embryonnaire de s’orienter dans l’ovule via une voie de

signalisation récepteur-dépendant. Ce modèle explique comment la coordination entre la

maturation de l’ovule et du sac embryonnaire peut s’établir.

Bien qu’à première vue distinct, la participation de CRPs dans le développement

des stomates supporte le modèle que l’on propose, i) d’une part, par leur capacité à

contrôler et diriger les divisions cellulaires, et ii) d’autre part, en mettant en évidence le

rôle proéminent des CRPs comme petites molécules diffusibles dans les communications

cellulaires de courtes distances (Torii, 2012). Pour bien comprendre le rôle des CRPs, il

faut d’abord savoir que le développement des stomates suit une séquence de divisions

cellulaires et de transition cellulaire très stéréotypée (Peterson et al., 2010; Serna and

Fenoll, 2000). D’abord, suite à la différentiation des cellules protodermales en cellules

mères du méristémoïde (CMM), celles-ci entreprennent une division asymétrique pour ne

générer qu’une seule lignée stomatale, le méristémoïde, et régénérer une cellule

protodermale. Le méristémoïde se différencie par la suite en cellule de garde mère (CGM),

qui subit une division symétrique pour générer les deux cellules de garde du stomate.

Pour que le stomate puisse bien réguler les échanges gazeux, il est important qu’il y ait

toujours une cellule en pavée entre chacun d’eux pour éviter des contraintes structurelles.

Ainsi, lorsqu’une cellule protodermale acquérant l’identité du CMM se trouve voisine

d’une cellule méristémoïde ou d’un CGM, celles-ci libèrent le peptide EPF1 pour orienter

la division asymétrique et empêcher la différentiation stomatale dans la cellule adjacente

pour respecter la règle d’une cellule d’espace (Hara et al., 2007). De même, EPF2 est

produit par les CMMs pour empêcher l’acquisition d’une identité cellulaire stomatale par

les cellules voisines (Hara et al., 2009; Hunt and Gray, 2009). D’autre part, un régulateur

positif du développement des stomates, EPFL9 ou STOMATOGEN, est produit par la

141

couche sous-jacente de tissus, soit par les cellules du mésophylle (Hunt et al., 2010; Kondo

et al., 2010; Sugano et al., 2010). Ces résultats suggèrent un modèle particulier dans

lequel les couches internes, qui se différentie en tissus photosynthétique, émettent des

signaux vers l’épiderme pour induire la différentiation des stomates pour assurer

l’efficacité de la photosynthèse. En somme, la caractérisation des EPFs appuie notre

modèle du rôle de ScRALF3 dans l’organisation du sac embryonnaire, lequel stipule un

contrôle de l’orientation spatiale médié par des CRPs via une communication

intercellulaire entre différentes couches de tissus.

5.4 Contrôle de qualité dans le réticulum endoplasmique et la maturation peptidique

La communication cellule-cellule requiert souvent la reconnaissance entre des

peptides signaux sécrétés et leurs récepteurs pour activer une cascade de signalisation

conduisant à une réponse cellulaire désirée. Avec plus de 600 gènes encodant des

récepteurs de type kinase (Shiu and Bleecker, 2001) et plus de 1000 gènes encodant des

peptides potentiellement sécrétés (Lease and Walker, 2006), déjà plusieurs couples

récepteurs-ligands ont été caractérisés, et ce, dans plusieurs processus régulant

l’architecture florale (De Smet et al., 2009). Pour qu’une telle reconnaissance soit possible,

les protéines qui entrent dans la voie cellulaire de sécrétion doivent être structurellement

bien repliées. Le réticulum endoplasmique est responsable de l’assemblage/repliement

des polypeptides avant que ceux-ci atteignent leur site fonctionnel de même que de

l’élimination des protéines mal repliées via la voie ERAD (Li and Yang, 2012; Vembar and

Brodsky, 2008). Dans le cas des CRPs comme RALF, non seulement le peptide doit être

correctement replié, mais un clivage protéolytique doit avoir lieu pour libérer le peptide

actif du prodomaine (Pearce et al., 2001b), souvent, au niveau de l’appareil de golgi

(Srivastava et al., 2009) ou possiblement dans l’apoplaste. Ainsi, non seulement

l’expression des peptides RALFs peut être régulé transcriptionnellement, mais une

142

dynamique régulatrice au niveau de la maturation peptidique peut contrôler l’activité de

ces peptides sécrétés et limiter leur action.

Le contrôle de qualité dans le réticulum endoplasmique permettant de suivre le

repliement et l’état de glycosylation des protéines sécrétées est assuré par trois systèmes

moléculaire : la rétention des protéines médiée par BiP (Jin et al., 2008), la rétention

médiée par les groupements thiols/ponts disulfures (Anelli et al., 2003) et le cycle

calnexin/calreticulin des glycoprotéines (Ellgaard and Helenius, 2001). Les peptides RALFs

doivent être structurellement bien repliés pour permettre leur action, et ce, via la

formation de deux ponts disulfures impliquant 4 résidus cystéines (Pearce et al., 2001b).

Les protéines isomérases disulfures (PDI) catalyzent la formation de ponts disulfures, la

réduction ou l’isomérisation, tous étant importants pour la maturation et le repliement

adéquat des protéines sécrétées et transmembranaires (Gruber et al., 2006; Wilkinson

and Gilbert, 2004). Chez Arabidopsis thaliana, 22 protéines de type PDI ont été identifiées

(Houston et al., 2005), parmis lesquels la PDIL2 affecte la maturation du sac

embryonnaire. En effet, l’expression d’une forme tronquée de la PDIL2 cause un délai

dans la maturation du sac embryonnaire causant une perte de guidage du tube pollinique

(Wang et al., 2008a). Ces sacs embryonnaires sont partiellement arrêtés au stade bi-,

tétra- ou octo-nucléé, empêchant la formation d’un sac embryonnaire mature pouvant

attirer le tube pollinique. Ce phénotype rappelle largement les plantes d’interférence pour

le gène ScRALF3, dans lesquels plusieurs ovules présentaient des sacs embryonnaires

arrêtés à différentes étapes de la mégagamétogénèse. De plus, PDIL2, résidente du

réticulum endoplasmique, s’accumule dans le tissu sporophytique de l’ovule, et

principalement à l’extrémité micropylaire des téguments (Wang et al., 2008a). Ces

résultats supportent et enrichissent notre modèle, à savoir qu’un contrôle fin de la

sécrétion de CRPs par le tissu sporophytique de l’ovule régule le développement du

gamétophyte femelle, et ce, par localisation asymétrique des peptides autour du sac

embryonnaire. De même, ce niveau de régulation explique parfaitement l’absence

143

d’anomalie dans l’organisation du sac embryonnaire dans les mutants de surexpression de

ScRALF3. Il est intéressant de noter que la forme tronquée de la PDIL2 est active et que le

phénotype peut être causé par une perte de spécificité de substrats, ouvrant la voie à une

régulation complexe du contrôle de qualité des petits peptides sécrétés.

Une fois replié, les peptides RALFs doivent être clivés, la grande majorité

possédant un prodomaine jamais retrouvé sur les peptides actifs purifiés (Haruta et al.,

2008; Mingossi et al., 2010; Pearce et al., 2001b). Chez Arabidopsis thaliana, la

caractérisation de AtRALF23 a permis de mettre en évidence le rôle de la subtilase AtS1P

dans l’activation et la maturation du peptide. En effet, la surexpression de AtRALF23 dans

un génotype sauvage cause une perte d’élongation de l’hypocotyl résultant au

développement de plantes naines. Or, si le gène de AtS1P est muté, le phénotype sauvage

est récupéré et le peptide n’est pas clivé, confirmant que AtRALF23 et AtS1P appartienne

génétiquement à une même voie de signalisation (Srivastava et al., 2009). Le motif

reconnu par la AtS1P est RRIL, lequel n’est pas partagé par tous les membres de la famille

RALF. Chez Arabidopsis, plus de 50 subtilases sont encodés dans le génome, et la création

de mutants perte-de-fonction pour chacun d’eux n’a pas révélé de phénotypes évidents

(Rautengarten et al., 2005). Ces résultats suggérent la présence de recoupement dans

leurs fonctions respectives et démontre la grande redondance fonctionnelle qui peut

exister parmis les membres d’une famille protéique. Néanmoins, récemment, l’implication

de la subtilase AtSBT1.1 dans le clivage et l’activation de la phytosulfokine AtPSK4 a été

démontré in vitro (Srivastava et al., 2008) et la surexpression de AtSBT5.4 cause un

phénotype ressemblant à clavata, bien qu’in vitro, AtSBT5.4 ne semble pas cliver le

peptide CLV3 (Liu et al., 2009). Ainsi, les subtilases sont nombreuses et semblent avoir été

recrutées pour participer dans la maturation des voies de signalisation régulées par les

petits peptides sécrétés.

144

FIGURE 35 MODÈLE PROPOSÉ DE LA RÉGULATION DE SCRALF3 SUR LE DÉVELOPPEMENT ET L'ORGANISATION DU

SAC EMBRYONNAIRE.

Un gradient d’auxine est d’abord créé dans le nucelle, avec le maxima au pôle micropylaire, via le

positionnement des protéines de transport de l’auxine PIN1 (flèche rouge). L’auxine stimule

transcriptionnellement l’expression de ScRALF3 dans le tissu sporophytique entourant le micropyle

(flèche jaune gauche). ScRALF3 peut ou non stabiliser le maxima d’auxine au pôle micropylaire (flèche

jaune droite), de façon similaire au peptide GOLVEN dans la réponse gravitropique. ScRALF3, de

concert avec l’auxine, permet d’orienter le sac embryonnaire par rapport aux différentes structures de

l’ovule en activant une voie de signalisation au sein du syncytium (flèche bleue). Cette voie de

signalisation permet d’orienter la division de la mégaspore fonctionnelle dans l’axe micropyle-chalaze

et assurer le développement adéquat du sac embryonnaire. Un contrôle fin de l’activité de ScRALF3

peut être assuré par un gradient de protéine disulfide isomérase qui permet le repliement adéquat du

peptide (tel PDIL-2 chez Arabidopsis thaliana; barre orangée).

145

5.5 Interactions entre les phytohormones et les peptides sécrétés

Les phytohormones et les petits peptides ont une influence importante sur le

développement de la plante. Malgré tout, les interactions entre les voies de signalisation

des phytohormones et des peptides sécrétés sont encore très peu connues. Néanmoins,

chez Arabidopsis thaliana, la voie de signalisation des brassinostéroïdes et celle de

AtRALF23 se recoupent pour potentiellement réguler la croissance et le développement

de la plante. AtRALF23 est négativement régulé par les brassinostéroïdes, et le peptide

inhibe la croissance stimulée par l’application de brassinolides (Srivastava et al., 2009).

Nous avons montré que certains gènes de type RALF pouvait être légèrement modulés

suite à différents traitements phytohormonaux. Plus spécifiquement, l’auxine stimule

l’expression de ScRALF3 et en faisant un parallèle avec les patrons d’accumulation de

l’auxine lors du développement de l’ovule et du fruit chez la tomate, ScRALF3 et l’auxine

semblent hautement co-régulés (Mapelli et al., 1978). Chez Arabidopsis thaliana, un

gradient d’auxine qui s’établit dans le syncytium du sac embryonnaire en développement,

dont le maxima se situe du côté micropylaire, participe à la différentiation des cellules

gamétiques (Pagnussat et al., 2009). Bien que le rôle spécifique de l’auxine et de ScRALF3

dans la maturation du gamétophyte femelle semble différent a priori, il est à noter que

26/399 sacs embryonnaires du mutant quadruple des récepteurs de l’auxine, tir1 afb1

afb2 afb3, présentent un phénotype similaire à ce qui est observé dans les plantes

d’interférence pour ScRALF3, soit un arrêt prématuré au stade de la mégaspore

fonctionnelle (FG1) (Pagnussat et al., 2009). Or, au niveau des racines, une dynamique

intéressante entre les petits peptides de la classe des «facteurs de croissance racinaire»,

les RCFs ou GOLVEN, et l’auxine a été caractérisée. Les peptides sécrétés GOLVEN sont

stimulés par l’auxine et, de leur côté, régulent le flux d’auxine dans la réponse

gravitropique en médiant la relocalisation des PIN2 qui participent au transport polaire de

l’auxine (Whitford et al., 2012). Pagnussat et al. (2009) ont noté la présence de PIN1 dans

le nucelle sporophytique entourant le sac embryonnaire lors de la mégasporogénèse et du

stade FG1, ce qui nous amène à se poser la question sur l’interaction des voies de

146

signalisation de l’auxine et de ScRALF3 dans le développement du sac embryonnaire et du

possible rôle que peut avoir ScRALF3 dans la relocalisation des protéines médiant le flux

d’auxine. Ou encore, un modèle intéressant serait que l’auxine aurait recours aux peptides

de type RALF, dont ScRALF3 chez Solanum chacoense, pour permettre à celle-ci de

diversifier et spécifier ses actions lors du développement du sac embryonnaire; ceci lui

permettant d’organiser d’une part le syncytium via une communication gamétophyte-

sporophyte dépendante, et d’autre part, de contrôler la différentiation cellulaire par la

production d’un gradient moléculaire.

5.6 La redondance fonctionnelle et les couples ligand-récepteur

La facilité à faire des croisements génétiques nous incite fortement à étudier la

fonction de gènes d’intérêts chez la plante modèle Arabidopsis thaliana. En effet, en

caractérisant un phénotype, celui-ci peut nous permettre d’étudier les interactions

génétiques en combinant différents mutants et permet de caractériser des voies de

signalisation, comme celle des brassinostéroïdes (Kim and Wang, 2010) et de CLAVATA

(Clark, 2001). C’est dans cette perspective que la caractérisation de AtRALF34 a été

amorcée, afin de mieux cerner le rôle des peptides RALFs dans le développement du sac

embryonnaire.

Le mutant insertionnel ralf34-1 n’a pas révélé de phénotype en ce qui a trait au

développement du gamétophyte femelle. Bien que nous ayons prouvé que AtRALF34 soit

l’orthologue de ScRALF3 de par les évidences structurelles et transcriptionnelles et les

analyses phylogénétiques, l’absence de phénotype peut s’expliquer par la redondance

fonctionnelle au sein de la famille des peptides RALFs. Il y a en effet eu beaucoup

d’événements de duplications génomiques qui ont amplifié la présence des peptides

RALFs chez Arabidopsis thaliana. Ceux-ci ont de toute évidence nouvellement acquis ou

partagé leurs fonctions (Cao and Shi, 2012; Olsen et al., 2002). Autrement dit, comme les

peptides RALFs appartiennent à une famille peptidique, la redondance fonctionnelle

complique les approches mutationnelles pour identifier la fonction de ces peptides.

147

Les gènes encodant des composants de voies de transduction de signaux sont

abondants chez les plantes et les familles multigéniques nombreuses, l’effet d’une

mutation est souvent masqué par la redondance génétique. D’ailleurs, cette redondance

fonctionnelle au sein des familles de protéines ralentissent beaucoup les découvertes et la

caractérisation des voies de signalisation (Butenko et al., 2009). Huit voies de signalisation

seulement se caractérisent par une paire de ligands-récepteurs supportée par des

évidences biochimiques ou génétiques, malgré plus de 400 gènes encodant les récepteurs

de type kinase (Shiu and Bleecker, 2001) et plus de 1000 gènes encodant des peptides

sécrétés (Lease and Walker, 2006). Par exemple, parmis les 32 gènes paralogues

appartenant à la famille des CLEs chez Arabidopsis, une seule publication fait référence à

un phénotype perte-de-fonction (Jun et al., 2008). Et même, le phénotype associé à l’allèle

nulle cle40 est très subtil en comparaison de l’effet sévère sur la terminaison du

méristème racinaire causée par la surexpression ectopique de ce même peptide (Hobe et

al., 2003). La perte de fonction de CLE40 doit être compensée par les membres

redondants de la famille CLE qui ont des patrons d’expression chevauchant celui de CLE40

(Sharma et al., 2003). La redondance fonctionnelle existe également au niveau des

récepteurs, comme c’est le cas dans la voie de signalisation impliquant le petit peptide IDA

(INFLORESCENCE DEFICIENT IN ABSCISSION) et les récepteurs de type kinase

HAESA/HAESA-LIKE2. Seul le double mutant montre un phénotype de fleurs non-

abscissées (Cho et al., 2008; Stenvik et al., 2008). De son côté, IDA est un petit peptide

appartement à une famille multigénique, et dont sa surexpression, tout comme celle de

IDA-LIKE1-5, cause l’abscission précoce des fleurs et l’abscission ectopique de d’autres

organes végétales démontrant la double redondance fonctionnelle dans cette voie de

signalisation (Butenko et al., 2003; Stenvik et al., 2008). De façon similaire, AtPEP1

interagit avec un récepteur kinase PEPR; 5 des 7 peptides homologues à AtPEP1 peut

induire l’alcalinisation cellulaire et compétitionner pour le même récepteur (Yamaguchi et

al., 2006). Dans ce contexte, des phénotypes intéressants pour à la fois les récepteurs et

les ligands peptidiques peuvent seulement émerger suite à des combinaisons de mutants

148

perte-de-fonction pour tous les gènes redondants homologues. De même, ceci suggère

que les fonctions cellulaires des peptides avec des activités similaires sont contrôlées par

la spécificité de l’expression cellulaire et tissulaire. Les gènes AtRALFs exprimés dans le

tissu sporophytique femelle sont donc des candidats intéressants dans la coopération qui

peut exister entre les membres de la famille des RALFs pour réguler le développement du

gamétophyte femelle.

Les familles multigéniques sont souvent associées avec la redondance

fonctionnelle comme discuté ci-haut. Cependant, le fait qu’il y ait pleins de peptides

similaires fait en sorte que la plante peut également bénéficier d’un haut niveau de

régulation. En effet, dans le cas de EPF2 et EPFL9/STOMAGEN, ces deux CRPs

compétitionnent pour réguler le développement des stomates, le premier est un

régulateur négatif, le second, un régulateur positif (Ohki et al., 2011). Selon Keiko U. torii

(Torii, 2012), un modèle intéressant serait que ces 2 peptides compétitionnent pour le

même site de liaison, pouvant possiblement réguler la dimérisation des récepteurs et

moduler le niveau d’activité des voies de signalisation. Ainsi, par la présence de signaux

moléculaires, l’épiderme peut assurer un contrôle adéquat de la différentiation des

stomates lié à la fois aux contraintes structurales et au besoin énergétique de la plante.

Autrement dit, les familles de gènes peuvent également avoir évolué non seulement pour

protéger certains processus biologiques contre l’apparition de mutations, mais également

pour apporter une régulation fine de ces mêmes processus biologiques.

Conclusion

Ce projet de recherche avait pour but de mettre en évidence l’implication des

peptides RALFs dans les événements de reproduction. Ce but a été accompli en

recherchant la présence de gènes de type RALF dans une librairie établie à partir de

transcrits d’ovules fécondées. Suite à une analyse transcriptionnelle, nous avons émis

l’hypothèse que les gènes de type RALF plus spécifiques aux tissus femelles étaient fort

probablement importants dans la régulation de la reproduction. Cette hypothèse a été

confirmé en caractérisant le gène ScRALF3 par des analyses mutationnelles,

transcriptionnelles et biochimiques. Un orthologue a été identifié parmis les membres de

la famille des peptides RALF chez Arabidopsis thaliana, AtRALF34. L’absence de phénotype

démontre cependant la redondance fonctionnelle qu’il peut y avoir entre les membres de

cette famille multigénique.

Ce projet de recherche a permis des avancées très intéressantes en peptidomique.

Non seulement la caractérisation de ScRALF3 apporte des connaissances fondamentales

sur le rôle des peptides riches en cystéines lors de la reproduction, mais vient établir les

bases d’un nouveau type de communication cellule-cellule qui peut exister au sein de

l’ovule. En effet, bien que certaines évidences suggèraient la présence d’interactions entre

le gamétophyte femelle et le sporophyte, aucun composant de signalisation venait

appuyer ce modèle. Ce projet de recherche vient donc nourrir notre intérêt à vouloir

percer les voies de signalisation qui peuvent régir ce type de communication. L’interaction

de la voie de signalisation des peptides RALFs avec celle de l’auxine est à investiguer plus

en profondeur, et peut bénéficier d’une meilleure connaissance des protéines impliquées

dans la cascade de transduction médiée par les peptides RALFs. La famille multigénique

des peptides de type RALF crée de la redondance fonctionnelle, bien qu’il serait

intéressant de mieux cerner l’interaction entre chacun des membres de cette famille pour

avancer éventuellement des modèles poussées de régulation du développement.

Bibliographie

Acosta-Garcia, G. and Vielle-Calzada, J.P. (2004) A classical arabinogalactan protein is essential for the initiation of female gametogenesis in Arabidopsis. Plant Cell, 16, 2614-2628. Altschul, S., Gish, W., Miller, W., Myers, E. and Lipman, D. (1990) Basic local alignment search tool. J Mol Biol, 215, 403-410. Amien, S., Kliwer, I., Marton, M.L., Debener, T., Geiger, D., Becker, D. and Dresselhaus, T. (2010) Defensin-like ZmES4 mediates pollen tube burst in maize via opening of the potassium channel KZM1. PLoS Biol, 8, e1000388. Anelli, T., Alessio, M., Bachi, A., Bergamelli, L., Bertoli, G., Camerini, S., Mezghrani, A., Ruffato, E., Simmen, T. and Sitia, R. (2003) Thiol-mediated protein retention in the endoplasmic reticulum: the role of ERp44. Embo J, 22, 5015-5022. Asai, T., Tena, G., Plotnikova, J., Willmann, M.R., Chiu, W.L., Gomez-Gomez, L., Boller, T., Ausubel, F.M. and Sheen, J. (2002) MAP kinase signalling cascade in Arabidopsis innate immunity. Nature, 415, 977-983. Aubert, D., Chevillard, M., Dorne, A.M., Arlaud, G. and Herzog, M. (1998) Expression patterns of GASA genes in Arabidopsis thaliana: the GASA4 gene is up-regulated by gibberellins in meristematic regions. Plant Mol Biol, 36, 871-883. Aw, S.J., Hamamura, Y., Chen, Z., Schnittger, A. and Berger, F. (2010) Sperm entry is sufficient to trigger division of the central cell but the paternal genome is required for endosperm development in Arabidopsis. Development, 137, 2683-2690. Backues, S.K., Korasick, D.A., Heese, A. and Bednarek, S.Y. (2010) The Arabidopsis dynamin-related protein2 family is essential for gametophyte development. Plant Cell, 22, 3218-3231. Baker, S.C., Robinson-Beers, K., Villanueva, J.M., Gaiser, J.C. and Gasser, C.S. (1997) Interactions among genes regulating ovule development in Arabidopsis thaliana. Genetics, 145, 1109-1124. Balandin, M., Royo, J., Gomez, E., Muniz, L.M., Molina, A. and Hueros, G. (2005) A protective role for the embryo surrounding region of the maize endosperm, as evidenced by the characterisation of ZmESR-6, a defensin gene specifically expressed in this region. Plant Mol Biol, 58, 269-282. Batoko, H., Zheng, H.Q., Hawes, C. and Moore, I. (2000) A rab1 GTPase is required for transport between the endoplasmic reticulum and golgi apparatus and for normal golgi movement in plants. Plant Cell, 12, 2201-2218. Baumann, K., De Paolis, A., Costantino, P. and Gualberti, G. (1999) The DNA binding site of the Dof protein NtBBF1 is essential for tissue-specific and auxin-regulated expression of the rolB oncogene in plants. Plant Cell, 11, 323-334. Bayer, M., Nawy, T., Giglione, C., Galli, M., Meinnel, T. and Lukowitz, W. (2009) Paternal control of embryonic patterning in Arabidopsis thaliana. Science, 323, 1485-1488.

151

Becker, J.D., Boavida, L.C., Carneiro, J., Haury, M. and Feijo, J.A. (2003) Transcriptional profiling of Arabidopsis tissues reveals the unique characteristics of the pollen transcriptome. Plant Physiol, 133, 713-725. Bedinger, P., Parsons, R., Clark, M., Covey, P.A. and Arthur-Asmah, R. (2003) PEX proteins, pollen specific LRX (Leucine-Rich Repeat Extensin Chimera) proteins. In Proceedings of the 7th International Congress on Plant Molecular Biology. Barcelona, Spain, pp. S20-S69. Bemer, M., Wolters-Arts, M., Grossniklaus, U. and Angenent, G.C. (2008) The MADS domain protein DIANA acts together with AGAMOUS-LIKE80 to specify the central cell in Arabidopsis ovules. Plant Cell, 20, 2088-2101. Bencivenga, S., Colombo, L. and Masiero, S. (2011) Cross talk between the sporophyte and the megagametophyte during ovule development. Sexual Plant Reproduction, 24, 113-121. Berendzen, K.W., Weiste, C., Wanke, D., Kilian, J., Harter, K. and Droge-Laser, W. (2012) Bioinformatic cis-element analyses performed in Arabidopsis and rice disclose bZIP- and MYB-related binding sites as potential AuxRE-coupling elements in auxin-mediated transcription. BMC Plant Biol, 12, 125. Bhat, R.A., Miklis, M., Schmelzer, E., Schulze-Lefert, P. and Panstruga, R. (2005) Recruitment and interaction dynamics of plant penetration resistance components in a plasma membrane microdomain. Proc Natl Acad Sci U S A, 102, 3135-3140. Boisson-Dernier, A., Frietsch, S., Kim, T.H., Dizon, M.B. and Schroeder, J.I. (2008) The peroxin loss-of-function mutation abstinence by mutual consent disrupts male-female gametophyte recognition. Curr Biol, 18, 63-68. Boisson-Dernier, A., Roy, S., Kritsas, K., Grobei, M.A., Jaciubek, M., Schroeder, J.I. and Grossniklaus, U. (2009) Disruption of the pollen-expressed FERONIA homologs ANXUR1 and ANXUR2 triggers pollen tube discharge. Development, 136, 3279-3288. Bolwell, J. (1995) Role of active oxygen species and NO in plant defence responses. Curr Opin Plant Biol, 2, 287-294. Bonghi, C., Trainotti, L., Botton, A., Tadiello, A., Rasori, A., Ziliotto, F., Zaffalon, V., Casadoro, G. and Ramina, A. (2011) A microarray approach to identify genes involved in seed-pericarp cross-talk and development in peach. BMC Plant Biol, 11, 107. Bowman, J. (1994) Ovules. In Arabidopsis: An Atlas of Morphology and Development (Springer-Verlag, ed), pp. 299-301. Bünger-Kibler, S. and Bangerth, F. (1983) Relationship between cell number, cell size and fruit size of seeded fruits of tomato (Lycopersicon esculentum Mill.) and those induced parthenocarpically by the application of plant growth regulators. Plant Growth Regulation, 1, 143-154. Butenko, M.A., Patterson, S.E., Grini, P.E., Stenvik, G.E., Amundsen, S.S., Mandal, A. and Aalen, R.B. (2003) Inflorescence deficient in abscission controls floral organ abscission in

152

Arabidopsis and identifies a novel family of putative ligands in plants. Plant Cell, 15, 2296-2307. Butenko, M.A., Vie, A.K., Brembu, T., Aalen, R.B. and Bones, A.M. (2009) Plant peptides in signalling: looking for new partners. Trends Plant Sci, 14, 255-263. Cao, J. and Shi, F. (2012) Evolution of the RALF Gene Family in Plants: Gene Duplication and Selection Patterns. Evol Bioinform Online, 8, 271-292. Capron, A., Gourgues, M., Neiva, L.S., Faure, J.E., Berger, F., Pagnussat, G., Krishnan, A., Alvarez-Mejia, C., Vielle-Calzada, J.P., Lee, Y.R., Liu, B. and Sundaresan, V. (2008) Maternal control of male-gamete delivery in Arabidopsis involves a putative GPI-anchored protein encoded by the LORELEI gene. Plant Cell, 20, 3038-3049. Casamitjana-Martinez, E., Hofhuis, H.F., Xu, J., Liu, C.M., Heidstra, R. and Scheres, B. (2003) Root-specific CLE19 overexpression and the sol1/2 suppressors implicate a CLV-like pathway in the control of Arabidopsis root meristem maintenance. Curr Biol, 13, 1435-1441. Catterou, M., Dubois, F., Schaller, H., Aubanelle, L., Vilcot, B., Sangwan-Norreel, B.S. and Sangwan, R.S. (2001) Brassinosteroids, microtubules and cell elongation in Arabidopsis thaliana. II. Effects of brassinosteroids on microtubules and cell elongation in the bul1 mutant. Planta, 212, 673-683. Chae, K., Kieslich, C.A., Morikis, D., Kim, S.C. and Lord, E.M. (2009) A gain-of-function mutation of Arabidopsis lipid transfer protein 5 disturbs pollen tube tip growth and fertilization. Plant Cell, 21, 3902-3914. Chantha, S.C., Emerald, B.S. and Matton, D.P. (2006) Characterization of the plant Notchless homolog, a WD repeat protein involved in seed development. Plant Mol Biol, 62, 897-912. Chen, Y.H., Li, H.J., Shi, D.Q., Yuan, L., Liu, J., Sreenivasan, R., Baskar, R., Grossniklaus, U. and Yang, W.C. (2007) The central cell plays a critical role in pollen tube guidance in Arabidopsis. Plant Cell, 19, 3563-3577. Chen, Z., Tan, J.L., Ingouff, M., Sundaresan, V. and Berger, F. (2008) Chromatin assembly factor 1 regulates the cell cycle but not cell fate during male gametogenesis in Arabidopsis thaliana. Development, 135, 65-73. Cheung, A.Y., Wang, H. and Wu, H.M. (1995) A floral transmitting tissue-specific glycoprotein attracts pollen tubes and stimulates their growth. Cell, 82, 383-393. Chevalier, D., Batoux, M., Fulton, L., Pfister, K., Yadav, R.K., Schellenberg, M. and Schneitz, K. (2005) STRUBBELIG defines a receptor kinase-mediated signaling pathway regulating organ development in Arabidopsis. Proc Natl Acad Sci U S A, 102, 9074-9079. Chevalier, E., Loubert-Hudon, A., Zimmerman, E.L. and Matton, D.P. (2011) Cell-cell communication and signalling pathways within the ovule: from its inception to fertilization. New Phytol, 192, 13-28.

153

Cho, S.K., Larue, C.T., Chevalier, D., Wang, H., Jinn, T.L., Zhang, S. and Walker, J.C. (2008) Regulation of floral organ abscission in Arabidopsis thaliana. Proc Natl Acad Sci U S A, 105, 15629-15634. Christensen, C.A., Gorsich, S.W., Brown, R.H., Jones, L.G., Brown, J., Shaw, J.M. and Drews, G.N. (2002) Mitochondrial GFA2 is required for synergid cell death in Arabidopsis. Plant Cell, 14, 2215-2232. Christensen, C.A., King, E.J., Jordan, J.R. and Drews, G.N. (1997) Megagametogenesis in Arabidopsis wild type and the Gf mutant. Sexual Plant Reproduction, 10, 49-64. Clark, S.E. (2001) Cell signalling at the shoot meristem. Nat Rev Mol Cell Biol, 2, 276-284. Cock, J.M. and McCormick, S. (2001) A large family of genes that share homology with CLAVATA3. Plant Physiol, 126, 939-942. Colombo, M., Masiero, S., Vanzulli, S., Lardelli, P., Kater, M.M. and Colombo, L. (2008) AGL23, a type I MADS-box gene that controls female gametophyte and embryo development in Arabidopsis. Plant J, 54, 1037-1048. Combier, J.P., Kuster, H., Journet, E.P., Hohnjec, N., Gamas, P. and Niebel, A. (2008) Evidence for the involvement in nodulation of the two small putative regulatory peptide-encoding genes MtRALFL1 and MtDVL1. Mol Plant Microbe Interact, 21, 1118-1127. Covey, P.A., Subbaiah, C.C., Parsons, R.L., Pearce, G., Lay, F.T., Anderson, M.A., Ryan, C.A. and Bedinger, P.A. (2010) A pollen-specific RALF from tomato that regulates pollen tube elongation. Plant Physiol, 153, 703-715. Curtis, M.D. and Grossniklaus, U. (2003) A gateway cloning vector set for high-throughput functional analysis of genes in planta. Plant Physiol, 133, 462-469. de Jong, M., Wolters-Arts, M., Feron, R., Mariani, C. and Vriezen, W.H. (2009) The Solanum lycopersicum auxin response factor 7 (SlARF7) regulates auxin signaling during tomato fruit set and development. Plant J, 57, 160-170. De Smet, I., Voss, U., Jurgens, G. and Beeckman, T. (2009) Receptor-like kinases shape the plant. Nat Cell Biol, 11, 1166-1173. Deng, Y., Dong, H., Mu, J., Ren, B., Zheng, B., Ji, Z., Yang, W.C., Liang, Y. and Zuo, J. (2010) Arabidopsis histidine kinase CKI1 acts upstream of histidine phosphotransfer proteins to regulate female gametophyte development and vegetative growth. Plant Cell, 22, 1232-1248. Duan, Q., Kita, D., Li, C., Cheung, A.Y. and Wu, H.M. (2010) FERONIA receptor-like kinase regulates RHO GTPase signaling of root hair development. Proc Natl Acad Sci U S A, 107, 17821-17826. Dunand, C., Crevecoeur, M. and Penel, C. (2007) Distribution of superoxide and hydrogen peroxide in Arabidopsis root and their influence on root development: possible interaction with peroxidases. New Phytol, 174, 332-341. Durbak, A., Yao, H. and McSteen, P. (2012) Hormone signaling in plant development. Curr Opin Plant Biol, 15, 92-96.

154

Ellgaard, L. and Helenius, A. (2001) ER quality control: towards an understanding at the molecular level. Curr Opin Cell Biol, 13, 431-437. Elliott, R.C., Betzner, A.S., Huttner, E., Oakes, M.P., Tucker, W.Q., Gerentes, D., Perez, P. and Smyth, D.R. (1996) AINTEGUMENTA, an APETALA2-like gene of Arabidopsis with pleiotropic roles in ovule development and floral organ growth. Plant Cell, 8, 155-168. Escobar-Restrepo, J.M., Huck, N., Kessler, S., Gagliardini, V., Gheyselinck, J., Yang, W.C. and Grossniklaus, U. (2007) The FERONIA receptor-like kinase mediates male-female interactions during pollen tube reception. Science, 317, 656-660. Escobar, N.M., Haupt, S., Thow, G., Boevink, P., Chapman, S. and Oparka, K. (2003) High-throughput viral expression of cDNA-green fluorescent protein fusions reveals novel subcellular addresses and identifies unique proteins that interact with plasmodesmata. Plant Cell, 15, 1507-1523. Estrada-Luna, A.A., Garcia-Aguilar, M. and Vielle-Calzada, J.P. (2004) Female reproductive development and pollen tube growth in diploid genotypes of Solanum cardiophyllum Lindl. Sex Plant Reprod, 17, 117-124. Evans, M.M. (2007) The indeterminate gametophyte1 gene of maize encodes a LOB domain protein required for embryo Sac and leaf development. Plant Cell, 19, 46-62. Falciatore, A., Merendino, L., Barneche, F., Ceol, M., Meskauskiene, R., Apel, K. and Rochaix, J.D. (2005) The FLP proteins act as regulators of chlorophyll synthesis in response to light and plastid signals in Chlamydomonas. Genes Dev, 19, 176-187. Fang, G., Bhardwaj, N., Robilotto, R. and Gerstein, M.B. (2010) Getting started in gene orthology and functional analysis. PLoS Comput Biol, 6, e1000703. Felix, G. and Boller, T. (1995) Systemin induces rapid ion fluxes and ethylene biosynthesis in Lycopersicon peruvianum cells. Plant J, 7, 381-389. Fitch, W.M. (1970) Distinguishing homologous from analogous proteins. Systematic zoology, 19, 99-113. Fletcher, J.C., Brand, U., Running, M.P., Simon, R. and Meyerowitz, E.M. (1999) Signaling of cell fate decisions by CLAVATA3 in Arabidopsis shoot meristems. Science, 283, 1911-1914. Frank, A.C. and Johnson, M.A. (2009) Expressing the diphtheria toxin A subunit from the HAP2(GCS1) promoter blocks sperm maturation and produces single sperm-like cells capable of fertilization. Plant Physiol, 151, 1390-1400. Friedman, W.E. and Ryerson, K.C. (2009) Reconstructing the ancestral female gametophyte of angiosperms: Insights from Amborella and other ancient lineages of flowering plants. Am J Bot, 96, 129-143. Fulton, L., Batoux, M., Vaddepalli, P., Yadav, R.K., Busch, W., Andersen, S.U., Jeong, S., Lohmann, J.U. and Schneitz, K. (2009) DETORQUEO, QUIRKY, and ZERZAUST represent novel components involved in organ development mediated by the receptor-like kinase STRUBBELIG in Arabidopsis thaliana. PLoS Genet, 5, e1000355.

155

Fulton, L., Vaddepalli, P., Yadav, R.K., Batoux, M. and Schneitz, K. (2010) Inter-cell-layer signalling during Arabidopsis ovule development mediated by the receptor-like kinase STRUBBELIG. Biochem Soc Trans, 38, 583-587. Germain, H., Chevalier, E., Caron, S. and Matton, D.P. (2005) Characterization of five RALF-like genes from Solanum chacoense provides support for a developmental role in plants. Planta, 220, 447-454. Germain, H., Gray-Mitsumune, M., Lafleur, E. and Matton, D.P. (2008) ScORK17, a transmembrane receptor-like kinase predominantly expressed in ovules is involved in seed development. Planta, 228, 851-862. Gillaspy, G., Ben-David, H. and Gruissem, W. (1993) Fruits: A Developmental Perspective. Plant Cell, 5, 1439-1451. Gray-Mitsumune, M., O'Brien, M., Bertrand, C., Tebbji, F., Nantel, A. and Matton, D.P. (2006) Loss of ovule identity induced by overexpression of the fertilization-related kinase 2 (ScFRK2), a MAPKKK from Solanum chacoense. J Exp Bot, 57, 4171-4187. Gross-Hardt, R., Kagi, C., Baumann, N., Moore, J.M., Baskar, R., Gagliano, W.B., Jurgens, G. and Grossniklaus, U. (2007) LACHESIS restricts gametic cell fate in the female gametophyte of Arabidopsis. PLoS Biol, 5, e47. Gruber, C.W., Cemazar, M., Heras, B., Martin, J.L. and Craik, D.J. (2006) Protein disulfide isomerase: the structure of oxidative folding. Trends Biochem Sci, 31, 455-464. Gusti, A., Baumberger, N., Nowack, M., Pusch, S., Eisler, H., Potuschak, T., De Veylder, L., Schnittger, A. and Genschik, P. (2009) The Arabidopsis thaliana F-box protein FBL17 is essential for progression through the second mitosis during pollen development. PLoS One, 4, e4780. Gutierrez-Marcos, J.F., Costa, L.M., Biderre-Petit, C., Khbaya, B., O'Sullivan, D.M., Wormald, M., Perez, P. and Dickinson, H.G. (2004) maternally expressed gene1 Is a novel maize endosperm transfer cell-specific gene with a maternal parent-of-origin pattern of expression. Plant Cell, 16, 1288-1301. Haerizadeh, F., Wong, C.E., Bhalla, P.L., Gresshoff, P.M. and Singh, M.B. (2009) Genomic expression profiling of mature soybean (Glycine max) pollen. BMC Plant Biol, 9, 25. Hamamura, Y., Saito, C., Awai, C., Kurihara, D., Miyawaki, A., Nakagawa, T., Kanaoka, M.M., Sasaki, N., Nakano, A., Berger, F. and Higashiyama, T. (2011) Live-Cell Imaging Reveals the Dynamics of Two Sperm Cells during Double Fertilization in Arabidopsis thaliana. Curr Biol, 21, 497-502. Han, Y.Z., Huang, B.Q., Zee, S.Y. and Yuan, M. (2000) Symplastic communication between the central cell and the egg apparatus cells in the embryo sac of Torenia fournieri Lind. before and during fertilization. Planta, 211, 158-162. Hara, K., Kajita, R., Torii, K.U., Bergmann, D.C. and Kakimoto, T. (2007) The secretory peptide gene EPF1 enforces the stomatal one-cell-spacing rule. Genes Dev, 21, 1720-1725. Hara, K., Yokoo, T., Kajita, R., Onishi, T., Yahata, S., Peterson, K.M., Torii, K.U. and Kakimoto, T. (2009) Epidermal cell density is autoregulated via a secretory peptide,

156

EPIDERMAL PATTERNING FACTOR 2 in Arabidopsis leaves. Plant Cell Physiol, 50, 1019-1031. Haruta, M. and Constabel, C.P. (2003) Rapid alkalinization factors in poplar cell cultures. Peptide isolation, cDNA cloning, and differential expression in leaves and methyl jasmonate-treated cells. Plant Physiol, 131, 814-823. Haruta, M., Monshausen, G., Gilroy, S. and Sussman, M.R. (2008) A cytoplasmic Ca2+ functional assay for identifying and purifying endogenous cell signaling peptides in Arabidopsis seedlings: identification of AtRALF1 peptide. Biochemistry, 47, 6311-6321. Hawes, C., Oparka, K., Cruz, S.S. and Boevink, P. (1998) Green fluorescent protein to study endomembrane dynamics in plant cells. Biologiy of the Cell, 90, 247-290. Hejatko, J., Pernisova, M., Eneva, T., Palme, K. and Brzobohaty, B. (2003) The putative sensor histidine kinase CKI1 is involved in female gametophyte development in Arabidopsis. Mol Genet Genomics, 269, 443-453. Higashiyama, T. (2010) Peptide signaling in pollen-pistil interactions. Plant Cell Physiol, 51, 177-189. Higashiyama, T., Inatsugi, R., Sakamoto, S., Sasaki, N., Mori, T., Kuroiwa, H., Nakada, T., Nozaki, H., Kuroiwa, T. and Nakano, A. (2006) Species preferentiality of the pollen tube attractant derived from the synergid cell of Torenia fournieri. Plant Physiol, 142, 481-491. Higashiyama, T., Kuroiwa, H., Kawano, S. and Kuroiwa, T. (1998) Guidance in vitro of the pollen tube to the naked embryo sac of torenia fournieri. Plant Cell, 10, 2019-2032. Higashiyama, T., Yabe, S., Sasaki, N., Nishimura, Y., Miyagishima, S., Kuroiwa, H. and Kuroiwa, T. (2001) Pollen tube attraction by the synergid cell. Science, 293, 1480-1483. Higgins, R., Lockwood, T., Holley, S., Yalamanchili, R. and Stratmann, J.W. (2007) Changes in extracellular pH are neither required nor sufficient for activation of mitogen-activated protein kinases (MAPKs) in response to systemin and fusicoccin in tomato. Planta, 225, 1535-1546. Hobe, M., Muller, R., Grunewald, M., Brand, U. and Simon, R. (2003) Loss of CLE40, a protein functionally equivalent to the stem cell restricting signal CLV3, enhances root waving in Arabidopsis. Dev Genes Evol, 213, 371-381. Holley, S.R., Yalamanchili, R.D., Moura, D.S., Ryan, C.A. and Stratmann, J.W. (2003) Convergence of signaling pathways induced by systemin, oligosaccharide elicitors, and ultraviolet-B radiation at the level of mitogen-activated protein kinases in Lycopersicon peruvianum suspension-cultured cells. Plant Physiol, 132, 1728-1738. Houston, N.L., Fan, C., Xiang, J.Q., Schulze, J.M., Jung, R. and Boston, R.S. (2005) Phylogenetic analyses identify 10 classes of the protein disulfide isomerase family in plants, including single-domain protein disulfide isomerase-related proteins. Plant Physiol, 137, 762-778. Huang, B.-Q. and Russell, S.D. (1992) Female Germ Unit: Organization, Isolation, and Function. International Review of Cytology, 140, 233-293.

157

Huang, B.Q. and Sheridan, W.F. (1994) Female Gametophyte Development in Maize: Microtubular Organization and Embryo Sac Polarity. Plant Cell, 6, 845-861. Huang, B.Q. and Sheridan, W.F. (1996) Embryo Sac Development in the Maize indeterminate gametophyte1 Mutant: Abnormal Nuclear Behavior and Defective Microtubule Organization. Plant Cell, 8, 1391-1407. Huck, N., Moore, J.M., Federer, M. and Grossniklaus, U. (2003) The Arabidopsis mutant feronia disrupts the female gametophytic control of pollen tube reception. Development, 130, 2149-2159. Hulskamp, M., Schneitz, K. and Pruitt, R.E. (1995) Genetic Evidence for a Long-Range Activity That Directs Pollen Tube Guidance in Arabidopsis. Plant Cell, 7, 57-64. Hunt, L., Bailey, K.J. and Gray, J.E. (2010) The signalling peptide EPFL9 is a positive regulator of stomatal development. New Phytol, 186, 609-614. Hunt, L. and Gray, J.E. (2009) The signaling peptide EPF2 controls asymmetric cell divisions during stomatal development. Curr Biol, 19, 864-869. Hwang, I. and Sheen, J. (2001) Two-component circuitry in Arabidopsis cytokinin signal transduction. Nature, 413, 383-389. Iwakawa, H., Shinmyo, A. and Sekine, M. (2006) Arabidopsis CDKA;1, a cdc2 homologue, controls proliferation of generative cells in male gametogenesis. Plant J, 45, 819-831. Jin, Y., Awad, W., Petrova, K. and Hendershot, L.M. (2008) Regulated release of ERdj3 from unfolded proteins by BiP. Embo J, 27, 2873-2882. Johnston, A.J., Meier, P., Gheyselinck, J., Wuest, S.E., Federer, M., Schlagenhauf, E., Becker, J.D. and Grossniklaus, U. (2007) Genetic subtraction profiling identifies genes essential for Arabidopsis reproduction and reveals interaction between the female gametophyte and the maternal sporophyte. Genome Biol, 8, R204. Jones-Rhoades, M.W., Borevitz, J.O. and Preuss, D. (2007) Genome-wide expression profiling of the Arabidopsis female gametophyte identifies families of small, secreted proteins. PLoS Genet, 3, 1848-1861. Jones, J.D., Dunsmuir, P. and Bedbrook, J. (1985) High level expression of introduced chimaeric genes in regenerated transformed plants. Embo J, 4, 2411-2418. Joshi, C.P., Zhou, H., Huang, X. and Chiang, V.L. (1997) Context sequences of translation initiation codon in plants. Plant Mol Biol, 35, 993-1001. Jun, J.H., Fiume, E. and Fletcher, J.C. (2008) The CLE family of plant polypeptide signaling molecules. Cell Mol Life Sci, 65, 743-755. Jung, C., Lee, G.J., Jang, M., Lee, M., Lee, J., Kang, H., Sohn, E.J. and Hwang, I. (2011) Identification of sorting motifs of AtbetaFruct4 for trafficking from the ER to the vacuole through the Golgi and PVC. Traffic, 12, 1774-1792. Kagi, C., Baumann, N., Nielsen, N., Stierhof, Y.D. and Gross-Hardt, R. (2010) The gametic central cell of Arabidopsis determines the lifespan of adjacent accessory cells. Proc Natl Acad Sci U S A, 107, 22350-22355.

158

Kajava, A.V. (1998) Structural diversity of leucine-rich repeat proteins. J Mol Biol, 277, 519-527. Kakimoto, T. (1996) CKI1, a histidine kinase homolog implicated in cytokinin signal transduction. Science, 274, 982-985. Kanaoka, M.M., Kawano, N., Matsubara, Y., Susaki, D., Okuda, S., Sasaki, N. and Higashiyama, T. (2011) Identification and characterization of TcCRP1, a pollen tube attractant from Torenia concolor. Ann Bot, 108, 739-747. Kandoth, P.K., Ranf, S., Pancholi, S.S., Jayanty, S., Walla, M.D., Miller, W., Howe, G.A., Lincoln, D.E. and Stratmann, J.W. (2007) Tomato MAPKs LeMPK1, LeMPK2, and LeMPK3 function in the systemin-mediated defense response against herbivorous insects. Proc Natl Acad Sci U S A, 104, 12205-12210. Kaothien, P., Ok, S.H., Shuai, B., Wengier, D., Cotter, R., Kelley, D., Kiriakopolos, S., Muschietti, J. and McCormick, S. (2005) Kinase partner protein interacts with the LePRK1 and LePRK2 receptor kinases and plays a role in polarized pollen tube growth. Plant J, 42, 492-503. Karimi, M., Inze, D. and Depicker, A. (2002) GATEWAY vectors for Agrobacterium-mediated plant transformation. Trends Plant Sci, 7, 193-195. Kasahara, R.D., Portereiko, M.F., Sandaklie-Nikolova, L., Rabiger, D.S. and Drews, G.N. (2005) MYB98 is required for pollen tube guidance and synergid cell differentiation in Arabidopsis. Plant Cell, 17, 2981-2992. Katsir, L., Davies, K.A., Bergmann, D.C. and Laux, T. (2011) Peptide signaling in plant development. Curr Biol, 21, R356-364. Kessler, S.A., Shimosato-Asano, H., Keinath, N.F., Wuest, S.E., Ingram, G., Panstruga, R. and Grossniklaus, U. (2010) Conserved molecular components for pollen tube reception and fungal invasion. Science, 330, 968-971. Kim, H.J., Oh, S.A., Brownfield, L., Hong, S.H., Ryu, H., Hwang, I., Twell, D. and Nam, H.G. (2008) Control of plant germline proliferation by SCF(FBL17) degradation of cell cycle inhibitors. Nature, 455, 1134-1137. Kim, H.U., Li, Y. and Huang, A.H. (2005) Ubiquitous and endoplasmic reticulum-located lysophosphatidyl acyltransferase, LPAT2, is essential for female but not male gametophyte development in Arabidopsis. Plant Cell, 17, 1073-1089. Kim, S., Mollet, J.C., Dong, J., Zhang, K., Park, S.Y. and Lord, E.M. (2003) Chemocyanin, a small basic protein from the lily stigma, induces pollen tube chemotropism. Proc Natl Acad Sci U S A, 100, 16125-16130. Kim, T.W. and Wang, Z.Y. (2010) Brassinosteroid signal transduction from receptor kinases to transcription factors. Annu Rev Plant Biol, 61, 681-704. Kinoshita-Tsujimura, K. and Kakimoto, T. (2011) Cytokinin receptors in sporophytes are essential for male and female functions in Arabidopsis thaliana. Plant Signal Behav, 6, 66-71.

159

Kinoshita, T., Nishimura, M. and Shimazaki, K. (1995) Cytosolic Concentration of Ca2+ Regulates the Plasma Membrane H+-ATPase in Guard Cells of Fava Bean. Plant Cell, 7, 1333-1342. Klucher, K.M., Chow, H., Reiser, L. and Fischer, R.L. (1996) The AINTEGUMENTA gene of Arabidopsis required for ovule and female gametophyte development is related to the floral homeotic gene APETALA2. Plant Cell, 8, 137-153. Kobe, B. and Deisenhofer, J. (1994) The leucine-rich repeat: a versatile binding motif. Trends Biochem Sci, 19, 415-421. Kondo, T., Kajita, R., Miyazaki, A., Hokoyama, M., Nakamura-Miura, T., Mizuno, S., Masuda, Y., Irie, K., Tanaka, Y., Takada, S., Kakimoto, T. and Sakagami, Y. (2010) Stomatal density is controlled by a mesophyll-derived signaling molecule. Plant Cell Physiol, 51, 1-8. Kozak, M. (1999) Initiation of translation in prokaryotes and eukaryotes. Gene, 234, 187-208. Krysan, P.J., Jester, P.J., Gottwald, J.R. and Sussman, M.R. (2002) An Arabidopsis mitogen-activated protein kinase kinase kinase gene family encodes essential positive regulators of cytokinesis. Plant Cell, 14, 1109-1120. Laemmli, U.K. (1970) Cleavage of structural proteins during the assembly of the head of bacteriophage T4. Nature, 227, 680-685. Lafleur, E. (2010) Rôle de la protéine ScFRK1 dans le développement du sac embryonnaire et son impact sur le guidage des tubes polliniques. In Sciences Biologiques. Montréal, Canada: Université de Montréal, http://hdl.handle.net/1866/3617. Lantin, S., O'Brien, M. and Matton, D.P. (1999) Pollination, wounding and jasmonate treatments induce the expression of a developmentally regulated pistil dioxygenase at a distance, in the ovary, in the wild potato Solanum chacoense Bitt. Plant Mol Biol, 41, 371-386. Latrasse, D., Benhamed, M., Henry, Y., Domenichini, S., Kim, W., Zhou, D.X. and Delarue, M. (2008) The MYST histone acetyltransferases are essential for gametophyte development in Arabidopsis. BMC Plant Biol, 8, 121. Lease, K.A. and Walker, J.C. (2006) The Arabidopsis unannotated secreted peptide database, a resource for plant peptidomics. Plant Physiol, 142, 831-838. Li, H.J. and Yang, W.C. (2012) Emerging role of ER quality control in plant cell signal perception. Protein Cell, 3, 10-16. Li, Z. and Thomas, T.L. (1998) PEI1, an embryo-specific zinc finger protein gene required for heart-stage embryo formation in Arabidopsis. Plant Cell, 10, 383-398. Liu, J., Zhang, Y., Qin, G., Tsuge, T., Sakaguchi, N., Luo, G., Sun, K., Shi, D., Aki, S., Zheng, N., Aoyama, T., Oka, A., Yang, W., Umeda, M., Xie, Q., Gu, H. and Qu, L.J. (2008) Targeted degradation of the cyclin-dependent kinase inhibitor ICK4/KRP6 by RING-type E3 ligases is essential for mitotic cell cycle progression during Arabidopsis gametogenesis. Plant Cell, 20, 1538-1554.

160

Liu, J.X., Srivastava, R. and Howell, S. (2009) Overexpression of an Arabidopsis gene encoding a subtilase (AtSBT5.4) produces a clavata-like phenotype. Planta, 230, 687-697. Loubert-Hudon, A. (2012) Implication du peptide ScRALF3 dans le développement du gamétophyte femelle chez Solanum chacoense. In Sciences Biologiques. Montréal: Université de Montréal, http://hdl.handle.net/1866/8972. Lu, Y., Chanroj, S., Zulkifli, L., Johnson, M.A., Uozumi, N., Cheung, A. and Sze, H. (2011) Pollen tubes lacking a pair of k+ transporters fail to target ovules in Arabidopsis. Plant Cell, 23, 81-93. Lukowitz, W., Roeder, A., Parmenter, D. and Somerville, C. (2004) A MAPKK kinase gene regulates extra-embryonic cell fate in Arabidopsis. Cell, 116, 109-119. Ma, J., Duncan, D., Morrow, D.J., Fernandes, J. and Walbot, V. (2007) Transcriptome profiling of maize anthers using genetic ablation to analyze pre-meiotic and tapetal cell types. Plant J, 50, 637-648. Magnard, J.L., Le Deunff, E., Domenech, J., Rogowsky, P.M., Testillano, P.S., Rougier, M., Risueno, M.C., Vergne, P. and Dumas, C. (2000) Genes normally expressed in the endosperm are expressed at early stages of microspore embryogenesis in maize. Plant Mol Biol, 44, 559-574. Maheshwari (1950) An Introduction to the Embryology of Angiosperms. New York: McGraw-Hill. Mano, S., Nakamori, C., Nito, K., Kondo, M. and Nishimura, M. (2006) The Arabidopsis pex12 and pex13 mutants are defective in both PTS1- and PTS2-dependent protein transport to peroxisomes. Plant J, 47, 604-618. Mapelli, S., Frova, C., Torti, G. and Soressi, G.P. (1978) Relationship between set, development and activities of growth regulators in tomato fruits. Plant Cell Physiol, 19, 1281-1288. Marshall, E., Costa, L.M. and Gutierrez-Marcos, J. (2011) Cysteine-rich peptides (CRPs) mediate diverse aspects of cell-cell communication in plant reproduction and development. J Exp Bot, 62, 1677-1686. Marton, M.L., Cordts, S., Broadhvest, J. and Dresselhaus, T. (2005) Micropylar pollen tube guidance by egg apparatus 1 of maize. Science, 307, 573-576. Maruyama, D., Endo, T. and Nishikawa, S. (2010) BiP-mediated polar nuclei fusion is essential for the regulation of endosperm nuclei proliferation in Arabidopsis thaliana. Proc Natl Acad Sci U S A, 107, 1684-1689. Matos, J.L., Fiori, C.S., Silva-Filho, M.C. and Moura, D.S. (2008) A conserved dibasic site is essential for correct processing of the peptide hormone AtRALF1 in Arabidopsis thaliana. FEBS Lett, 582, 3343-3347. Matsubayashi, Y. (2011) Small post-translationally modified Peptide signals in Arabidopsis. Arabidopsis Book, 9, e0150. Matsubayashi, Y. and Sakagami, Y. (2006) Peptide hormones in plants. Annu Rev Plant Biol, 57, 649-674.

161

Matton, D.P., Maes, O., Laublin, G., Xike, Q., Bertrand, C., Morse, D. and Cappadocia, M. (1997) Hypervariable Domains of Self-Incompatibility RNases Mediate Allele-Specific Pollen Recognition. Plant Cell, 9, 1757-1766. Mergaert, P., Nikovics, K., Kelemen, Z., Maunoury, N., Vaubert, D., Kondorosi, A. and Kondorosi, E. (2003) A novel family in Medicago truncatula consisting of more than 300 nodule-specific genes coding for small, secreted polypeptides with conserved cysteine motifs. Plant Physiol, 132, 161-173. Mingossi, F.B., Matos, J.L., Rizzato, A.P., Medeiros, A.H., Falco, M.C., Silva-Filho, M.C. and Moura, D.S. (2010) SacRALF1, a peptide signal from the grass sugarcane (Saccharum spp.), is potentially involved in the regulation of tissue expansion. Plant Mol Biol, 73, 271-281. Miyazaki, S., Murata, T., Sakurai-Ozato, N., Kubo, M., Demura, T., Fukuda, H. and Hasebe, M. (2009) ANXUR1 and 2, sister genes to FERONIA/SIRENE, are male factors for coordinated fertilization. Curr Biol, 19, 1327-1331. Moll, C., von Lyncker, L., Zimmermann, S., Kagi, C., Baumann, N., Twell, D., Grossniklaus, U. and Gross-Hardt, R. (2008) CLO/GFA1 and ATO are novel regulators of gametic cell fate in plants. Plant J, 56, 913-921. Mollet, J.C., Park, S.Y., Nothnagel, E.A. and Lord, E.M. (2000) A lily stylar pectin is necessary for pollen tube adhesion to an in vitro stylar matrix. Plant Cell, 12, 1737-1750. Mori, T., Kuroiwa, H., Higashiyama, T. and Kuroiwa, T. (2006) GENERATIVE CELL SPECIFIC 1 is essential for angiosperm fertilization. Nat Cell Biol, 8, 64-71. Motamayor, J.C., Vezon, D., Bajon, C., Sauvanet, A., Grandjean, O., Marchand, M., Bechtold, N., Pelletier, G. and Horlow, C. (2000) Switch (swi1), an Arabidopsis thaliana mutant affected in the female meiotic switch. Sexual Plant Reproduction, 12, 209-218. Moura, D.S., Pearce, G. and Ryan, C.A. (2006) RALF Peptides. In Handbook of Biologically Active Peptides (Kastin, A.J., ed). Burlington: Elsevier, pp. 33-36. Mucha, E., Fricke, I., Schaefer, A., Wittinghofer, A. and Berken, A. (2011) Rho proteins of plants--functional cycle and regulation of cytoskeletal dynamics. Eur J Cell Biol, 90, 934-943. Murray, M.G. and Thompson, W.F. (1980) Rapid isolation of high molecular weight plant DNA. Nucleic Acids Res, 8, 4321-4325. Muschietti, J., Dircks, L., Vancanneyt, G. and McCormick, S. (1994) LAT52 protein is essential for tomato pollen development: pollen expressing antisense LAT52 RNA hydrates and germinates abnormally and cannot achieve fertilization. Plant J, 6, 321-338. Narita, N.N., Moore, S., Horiguchi, G., Kubo, M., Demura, T., Fukuda, H., Goodrich, J. and Tsukaya, H. (2004) Overexpression of a novel small peptide ROTUNDIFOLIA4 decreases cell proliferation and alters leaf shape in Arabidopsis thaliana. Plant J, 38, 699-713. Nelson, B.K., Cai, X. and Nebenfuhr, A. (2007) A multicolored set of in vivo organelle markers for co-localization studies in Arabidopsis and other plants. Plant J, 51, 1126-1136.

162

Nemhauser, J.L., Mockler, T.C. and Chory, J. (2004) Interdependency of brassinosteroid and auxin signaling in Arabidopsis. PLoS Biol, 2, E258. Nishihama, R., Soyano, T., Ishikawa, M., Araki, S., Tanaka, H., Asada, T., Irie, K., Ito, M., Terada, M., Banno, H., Yamazaki, Y. and Machida, Y. (2002) Expansion of the cell plate in plant cytokinesis requires a kinesin-like protein/MAPKKK complex. Cell, 109, 87-99. Nonomura, K., Miyoshi, K., Eiguchi, M., Suzuki, T., Miyao, A., Hirochika, H. and Kurata, N. (2003) The MSP1 gene is necessary to restrict the number of cells entering into male and female sporogenesis and to initiate anther wall formation in rice. Plant Cell, 15, 1728-1739. Nonomura, K., Morohoshi, A., Nakano, M., Eiguchi, M., Miyao, A., Hirochika, H. and Kurata, N. (2007) A germ cell specific gene of the ARGONAUTE family is essential for the progression of premeiotic mitosis and meiosis during sporogenesis in rice. Plant Cell, 19, 2583-2594. Nowack, M.K., Grini, P.E., Jakoby, M.J., Lafos, M., Koncz, C. and Schnittger, A. (2006) A positive signal from the fertilization of the egg cell sets off endosperm proliferation in angiosperm embryogenesis. Nat Genet, 38, 63-67. Nowack, M.K., Ungru, A., Bjerkan, K.N., Grini, P.E. and Schnittger, A. (2010) Reproductive cross-talk: seed development in flowering plants. Biochem Soc Trans, 38, 604-612. O'Brien, M., Bertrand, C. and Matton, D.P. (2002) Characterization of a fertilization-induced and developmentally regulated plasma-membrane aquaporin expressed in reproductive tissues, in the wild potato Solanum chacoense Bitt. Planta, 215, 485-493. Ohki, S., Takeuchi, M. and Mori, M. (2011) The NMR structure of stomagen reveals the basis of stomatal density regulation by plant peptide hormones. Nat Commun, 2, 512. Okuda, S., Tsutsui, H., Shiina, K., Sprunck, S., Takeuchi, H., Yui, R., Kasahara, R.D., Hamamura, Y., Mizukami, A., Susaki, D., Kawano, N., Sakakibara, T., Namiki, S., Itoh, K., Otsuka, K., Matsuzaki, M., Nozaki, H., Kuroiwa, T., Nakano, A., Kanaoka, M.M., Dresselhaus, T., Sasaki, N. and Higashiyama, T. (2009) Defensin-like polypeptide LUREs are pollen tube attractants secreted from synergid cells. Nature, 458, 357-361. Olmedo-Monfil, V., Duran-Figueroa, N., Arteaga-Vazquez, M., Demesa-Arevalo, E., Autran, D., Grimanelli, D., Slotkin, R.K., Martienssen, R.A. and Vielle-Calzada, J.P. (2010) Control of female gamete formation by a small RNA pathway in Arabidopsis. Nature, 464, 628-632. Olsen, A.N., Mundy, J. and Skriver, K. (2002) Peptomics, identification of novel cationic Arabidopsis peptides with conserved sequence motifs. In Silico Biol, 2, 441-451. Olsen, A.N. and Skriver, K. (2003) Ligand mimicry? Plant-parasitic nematode polypeptide with similarity to CLAVATA3. Trends Plant Sci, 8, 55-57. Pagnussat, G.C., Alandete-Saez, M., Bowman, J.L. and Sundaresan, V. (2009) Auxin-dependent patterning and gamete specification in the Arabidopsis female gametophyte. Science, 324, 1684-1689.

163

Pagnussat, G.C., Yu, H.J. and Sundaresan, V. (2007) Cell-fate switch of synergid to egg cell in Arabidopsis eostre mutant embryo sacs arises from misexpression of the BEL1-like homeodomain gene BLH1. Plant Cell, 19, 3578-3592. Palanivelu, R., Brass, L., Edlund, A.F. and Preuss, D. (2003) Pollen tube growth and guidance is regulated by POP2, an Arabidopsis gene that controls GABA levels. Cell, 114, 47-59. Palanivelu, R. and Preuss, D. (2006) Distinct short-range ovule signals attract or repel Arabidopsis thaliana pollen tubes in vitro. BMC Plant Biol, 6, 7. Park, S.Y., Jauh, G.Y., Mollet, J.C., Eckard, K.J., Nothnagel, E.A., Walling, L.L. and Lord, E.M. (2000) A lipid transfer-like protein is necessary for lily pollen tube adhesion to an in vitro stylar matrix. Plant Cell, 12, 151-164. Pearce, G., Moura, D.S., Stratmann, J. and Ryan, C.A. (2001a) Production of multiple plant hormones from a single polyprotein precursor. Nature, 411, 817-820. Pearce, G., Moura, D.S., Stratmann, J. and Ryan, C.A., Jr. (2001b) RALF, a 5-kDa ubiquitous polypeptide in plants, arrests root growth and development. Proc Natl Acad Sci U S A, 98, 12843-12847. Pearce, G. and Ryan, C.A. (2003) Systemic signaling in tomato plants for defense against herbivores. Isolation and characterization of three novel defense-signaling glycopeptide hormones coded in a single precursor gene. J Biol Chem, 278, 30044-30050. Pearce, G., Yamaguchi, Y., Munske, G. and Ryan, C.A. (2010) Structure-activity studies of RALF, Rapid Alkalinization Factor, reveal an essential--YISY--motif. Peptides, 31, 1973-1977. Peterson, K.M., Rychel, A.L. and Torii, K.U. (2010) Out of the mouths of plants: the molecular basis of the evolution and diversity of stomatal development. Plant Cell, 22, 296-306. Pina, C., Pinto, F., Feijo, J.A. and Becker, J.D. (2005) Gene family analysis of the Arabidopsis pollen transcriptome reveals biological implications for cell growth, division control, and gene expression regulation. Plant Physiol, 138, 744-756. Pischke, M.S., Jones, L.G., Otsuga, D., Fernandez, D.E., Drews, G.N. and Sussman, M.R. (2002) An Arabidopsis histidine kinase is essential for megagametogenesis. Proc Natl Acad Sci U S A, 99, 15800-15805. Portereiko, M.F., Lloyd, A., Steffen, J.G., Punwani, J.A., Otsuga, D. and Drews, G.N. (2006) AGL80 is required for central cell and endosperm development in Arabidopsis. Plant Cell, 18, 1862-1872. Proost, S., Van Bel, M., Sterck, L., Billiau, K., Van Parys, T., Van de Peer, Y. and Vandepoele, K. (2009) PLAZA: a comparative genomics resource to study gene and genome evolution in plants. Plant Cell, 21, 3718-3731. Punwani, J.A., Rabiger, D.S. and Drews, G.N. (2007) MYB98 positively regulates a battery of synergid-expressed genes encoding filiform apparatus localized proteins. Plant Cell, 19, 2557-2568.

164

Rautengarten, C., Steinhauser, D., Bussis, D., Stintzi, A., Schaller, A., Kopka, J. and Altmann, T. (2005) Inferring hypotheses on functional relationships of genes: Analysis of the Arabidopsis thaliana subtilase gene family. PLoS Comput Biol, 1, e40. Ravi, M., Marimuthu, M.P. and Siddiqi, I. (2008) Gamete formation without meiosis in Arabidopsis. Nature, 451, 1121-1124. Reiser, L., Modrusan, Z., Margossian, L., Samach, A., Ohad, N., Haughn, G.W. and Fischer, R.L. (1995) The BELL1 gene encodes a homeodomain protein involved in pattern formation in the Arabidopsis ovule primordium. Cell, 83, 735-742. Robinson-Beers, K., Pruitt, R.E. and Gasser, C.S. (1992) Ovule Development in Wild-Type Arabidopsis and Two Female-Sterile Mutants. Plant Cell, 4, 1237-1249. Rotman, N., Gourgues, M., Guitton, A.E., Faure, J.E. and Berger, F. (2008) A dialogue between the SIRENE pathway in synergids and the fertilization independent seed pathway in the central cell controls male gamete release during double fertilization in Arabidopsis. Mol Plant, 1, 659-666. Rotman, N., Rozier, F., Boavida, L., Dumas, C., Berger, F. and Faure, J.E. (2003) Female control of male gamete delivery during fertilization in Arabidopsis thaliana. Curr Biol, 13, 432-436. Roxrud, I., Lid, S.E., Fletcher, J.C., Schmidt, E.D. and Opsahl-Sorteberg, H.G. (2007) GASA4, one of the 14-member Arabidopsis GASA family of small polypeptides, regulates flowering and seed development. Plant Cell Physiol, 48, 471-483. Russell, S.D. (1992) Double Fertilization. International Review of Cytology, 140, 357-388. Russell, S.D. (1996) Attraction and transport of male gametes for fertilization. Sexual Plant Reproduction, 9, 337-342. Ryan, C.A. and Pearce, G. (2001) Polypeptide hormones. Plant Physiol, 125, 65-68. Ryan, C.A., Pearce, G., Scheer, J. and Moura, D.S. (2002) Polypeptide hormones. Plant Cell, 14 Suppl, S251-264. Sakai, T., Takahashi, Y. and Nagata, T. (1996) Analysis of the promoter of the auxin-inducible gene, parC, of tobacco. Plant Cell Physiol, 37, 906-913. Sandaklie-Nikolova, L., Palanivelu, R., King, E.J., Copenhaver, G.P. and Drews, G.N. (2007) Synergid cell death in Arabidopsis is triggered following direct interaction with the pollen tube. Plant Physiol, 144, 1753-1762. Santner, A., Calderon-Villalobos, L.I. and Estelle, M. (2009) Plant hormones are versatile chemical regulators of plant growth. Nat Chem Biol, 5, 301-307. Scheer, J.M., Pearce, G. and Ryan, C.A. (2005) LeRALF, a plant peptide that regulates root growth and development, specifically binds to 25 and 120 kDa cell surface membrane proteins of Lycopersicon peruvianum. Planta, 221, 667-674. Schiott, M., Romanowsky, S.M., Baekgaard, L., Jakobsen, M.K., Palmgren, M.G. and Harper, J.F. (2004) A plant plasma membrane Ca2+ pump is required for normal pollen tube growth and fertilization. Proc Natl Acad Sci U S A, 101, 9502-9507.

165

Schneitz, K., Hulskamp, M., Kopczak, S.D. and Pruitt, R.E. (1997) Dissection of sexual organ ontogenesis: a genetic analysis of ovule development in Arabidopsis thaliana. Development, 124, 1367-1376. Schopfer, C.R., Nasrallah, M.E. and Nasrallah, J.B. (1999) The male determinant of self-incompatibility in Brassica. Science, 286, 1697-1700. Scott, R.J., Armstrong, S.J., Doughty, J. and Spielman, M. (2008) Double fertilization in Arabidopsis thaliana involves a polyspermy block on the egg but not the central cell. Mol Plant, 1, 611-619. Serna, A., Maitz, M., O'Connell, T., Santandrea, G., Thevissen, K., Tienens, K., Hueros, G., Faleri, C., Cai, G., Lottspeich, F. and Thompson, R.D. (2001) Maize endosperm secretes a novel antifungal protein into adjacent maternal tissue. Plant J, 25, 687-698. Serna, L. and Fenoll, c. (2000) Stomatal development and patterning in Arabidopsis leaves. Physiol. Plant, 109, 351-358. Sharma, V.K., Ramirez, J. and Fletcher, J.C. (2003) The Arabidopsis CLV3-like (CLE) genes are expressed in diverse tissues and encode secreted proteins. Plant Mol Biol, 51, 415-425. Sheridan, W.F., Avalkina, N.A., Shamrov, II, Batygina, T.B. and Golubovskaya, I.N. (1996) The mac1 gene: controlling the commitment to the meiotic pathway in maize. Genetics, 142, 1009-1020. Shiba, H., Takayama, S., Iwano, M., Shimosato, H., Funato, M., Nakagawa, T., Che, F.S., Suzuki, G., Watanabe, M., Hinata, K. and Isogai, A. (2001) A pollen coat protein, SP11/SCR, determines the pollen S-specificity in the self-incompatibility of Brassica species. Plant Physiol, 125, 2095-2103. Shimizu, K.K., Ito, T., Ishiguro, S. and Okada, K. (2008) MAA3 (MAGATAMA3) helicase gene is required for female gametophyte development and pollen tube guidance in Arabidopsis thaliana. Plant Cell Physiol, 49, 1478-1483. Shimizu, K.K. and Okada, K. (2000) Attractive and repulsive interactions between female and male gametophytes in Arabidopsis pollen tube guidance. Development, 127, 4511-4518. Shiu, S.H. and Bleecker, A.B. (2001) Plant receptor-like kinase gene family: diversity, function, and signaling. Sci STKE, 2001, re22. Silverstein, K.A., Moskal, W.A., Jr., Wu, H.C., Underwood, B.A., Graham, M.A., Town, C.D. and VandenBosch, K.A. (2007) Small cysteine-rich peptides resembling antimicrobial peptides have been under-predicted in plants. Plant J, 51, 262-280. Sint Jan, V.v., Laublin, G., Birhman, R.K. and Cappadocia, M. (1996) Genetic analysis of leaf explant regenerability in Solanum chacoense. Plant Cell Tissue Org. Cult., 47, 9-13. Sjut, V. and Bangerth, F. (1983) Induced parthenocarpy: a way of changing the levels of endogenous hormones in tomato fruits (Lycopersicon esculentum Mill.). 1. Extractable Hormones. Plant Growth Regulation, 1, 243-251.

166

Skinner, D.J. and Gasser, C.S. (2009) Expression-based discovery of candidate ovule development regulators through transcriptional profiling of ovule mutants. BMC Plant Biol, 9, 29. Skinner, D.J., Hill, T.A. and Gasser, C.S. (2004) Regulation of ovule development. Plant Cell, 16 Suppl, S32-45. Smyth, D.R., Bowman, J.L. and Meyerowitz, E.M. (1990) Early flower development in Arabidopsis. Plant Cell, 2, 755-767. Soyano, T., Nishihama, R., Morikiyo, K., Ishikawa, M. and Machida, Y. (2003) NQK1/NtMEK1 is a MAPKK that acts in the NPK1 MAPKKK-mediated MAPK cascade and is required for plant cytokinesis. Genes Dev, 17, 1055-1067. Spielman, M., Preuss, D., Li, F.L., Browne, W.E., Scott, R.J. and Dickinson, H.G. (1997) TETRASPORE is required for male meiotic cytokinesis in Arabidopsis thaliana. Development, 124, 2645-2657. Srivastava, R., Liu, J.X., Guo, H., Yin, Y. and Howell, S.H. (2009) Regulation and processing of a plant peptide hormone, AtRALF23, in Arabidopsis. Plant J, 59, 930-939. Srivastava, R., Liu, J.X. and Howell, S.H. (2008) Proteolytic processing of a precursor protein for a growth-promoting peptide by a subtilisin serine protease in Arabidopsis. Plant J, 56, 219-227. Steffen, J.G., Kang, I.H., Macfarlane, J. and Drews, G.N. (2007) Identification of genes expressed in the Arabidopsis female gametophyte. Plant J, 51, 281-292. Steffen, J.G., Kang, I.H., Portereiko, M.F., Lloyd, A. and Drews, G.N. (2008) AGL61 interacts with AGL80 and is required for central cell development in Arabidopsis. Plant Physiol, 148, 259-268. Stenvik, G.E., Tandstad, N.M., Guo, Y., Shi, C.L., Kristiansen, W., Holmgren, A., Clark, S.E., Aalen, R.B. and Butenko, M.A. (2008) The EPIP peptide of INFLORESCENCE DEFICIENT IN ABSCISSION is sufficient to induce abscission in arabidopsis through the receptor-like kinases HAESA and HAESA-LIKE2. Plant Cell, 20, 1805-1817. Strabala, T.J., O'Donnell P, J., Smit, A.M., Ampomah-Dwamena, C., Martin, E.J., Netzler, N., Nieuwenhuizen, N.J., Quinn, B.D., Foote, H.C. and Hudson, K.R. (2006) Gain-of-function phenotypes of many CLAVATA3/ESR genes, including four new family members, correlate with tandem variations in the conserved CLAVATA3/ESR domain. Plant Physiol, 140, 1331-1344. Sugano, S.S., Shimada, T., Imai, Y., Okawa, K., Tamai, A., Mori, M. and Hara-Nishimura, I. (2010) Stomagen positively regulates stomatal density in Arabidopsis. Nature, 463, 241-244. Suzuki, G., Kai, N., Hirose, T., Fukui, K., Nishio, T., Takayama, S., Isogai, A., Watanabe, M. and Hinata, K. (1999) Genomic organization of the S locus: Identification and characterization of genes in SLG/SRK region of S(9) haplotype of Brassica campestris (syn. rapa). Genetics, 153, 391-400.

167

Swofford, D. (2002) PAUP*: phylogenetic analysis using parsimony (*and other methods). Massachusette: Sinauer, Sunderland. Szekeres, M. (2003) Brassinosteroid and systemin: two hormones perceived by the same receptor. Trends Plant Sci, 8, 102-104. Takahashi, Y., Soyano, T., Kosetsu, K., Sasabe, M. and Machida, Y. (2010) HINKEL kinesin, ANP MAPKKKs and MKK6/ANQ MAPKK, which phosphorylates and activates MPK4 MAPK, constitute a pathway that is required for cytokinesis in Arabidopsis thaliana. Plant Cell Physiol, 51, 1766-1776. Takayama, S. and Sakagami, Y. (2002) Peptide signalling in plants. Curr Opin Plant Biol, 5, 382-387. Takayama, S., Shiba, H., Iwano, M., Shimosato, H., Che, F.S., Kai, N., Watanabe, M., Suzuki, G., Hinata, K. and Isogai, A. (2000) The pollen determinant of self-incompatibility in Brassica campestris. Proc Natl Acad Sci U S A, 97, 1920-1925. Takayama, S., Shimosato, H., Shiba, H., Funato, M., Che, F.S., Watanabe, M., Iwano, M. and Isogai, A. (2001) Direct ligand-receptor complex interaction controls Brassica self-incompatibility. Nature, 413, 534-538. Tanaka, H., Ishikawa, M., Kitamura, S., Takahashi, Y., Soyano, T., Machida, C. and Machida, Y. (2004) The AtNACK1/HINKEL and STUD/TETRASPORE/AtNACK2 genes, which encode functionally redundant kinesins, are essential for cytokinesis in Arabidopsis. Genes Cells, 9, 1199-1211. Tang, W., Ezcurra, I., Muschietti, J. and McCormick, S. (2002) A cysteine-rich extracellular protein, LAT52, interacts with the extracellular domain of the pollen receptor kinase LePRK2. Plant Cell, 14, 2277-2287. Tang, W., Kelley, D., Ezcurra, I., Cotter, R. and McCormick, S. (2004) LeSTIG1, an extracellular binding partner for the pollen receptor kinases LePRK1 and LePRK2, promotes pollen tube growth in vitro. Plant J, 39, 343-353. Tebbji, F., Nantel, A. and Matton, D.P. (2010) Transcription profiling of fertilization and early seed development events in a solanaceous species using a 7.7 K cDNA microarray from Solanum chacoense ovules. BMC Plant Biol, 10, 174. Torii, K.U. (2012) Mix-and-match: ligand-receptor pairs in stomatal development and beyond. Trends Plant Sci. Tsukamoto, T., Qin, Y., Huang, Y., Dunatunga, D. and Palanivelu, R. (2010) A role for LORELEI, a putative glycosylphosphatidylinositol-anchored protein, in Arabidopsis thaliana double fertilization and early seed development. Plant J, 62, 571-588. Ulmasov, T., Hagen, G. and Guilfoyle, T.J. (1997) ARF1, a transcription factor that binds to auxin response elements. Science, 276, 1865-1868. Ulmasov, T., Liu, Z.B., Hagen, G. and Guilfoyle, T.J. (1995) Composite structure of auxin response elements. Plant Cell, 7, 1611-1623. Van Norman, J.M., Breakfield, N.W. and Benfey, P.N. (2011) Intercellular communication during plant development. Plant Cell, 23, 855-864.

168

Varga, A. and Bruinsma, J. (1976) Roles of seeds and auxins in tomato fruit growth. Zeitschrift für Pflanzenphysiologie, 80, 95-104. Vaucheret, H. (2006) Post-transcriptional small RNA pathways in plants: mechanisms and regulations. Genes Dev, 20, 759-771. Veenstra, J.A. (2000) Mono- and dibasic proteolytic cleavage sites in insect neuroendocrine peptide precursors. Arch Insect Biochem Physiol, 43, 49-63. Vembar, S.S. and Brodsky, J.L. (2008) One step at a time: endoplasmic reticulum-associated degradation. Nat Rev Mol Cell Biol, 9, 944-957. Verhoeven, T., Feron, R., Wolters-Arts, M., Edqvist, J., Gerats, T., Derksen, J. and Mariani, C. (2005) STIG1 controls exudate secretion in the pistil of petunia and tobacco. Plant Physiol, 138, 153-160. Vert, G., Nemhauser, J.L., Geldner, N., Hong, F. and Chory, J. (2005) Molecular mechanisms of steroid hormone signaling in plants. Annu Rev Cell Dev Biol, 21, 177-201. Volz, R., von Lyncker, L., Baumann, N., Dresselhaus, T., Sprunck, S. and Gross-Hardt, R. (2012) LACHESIS-dependent egg-cell signaling regulates the development of female gametophytic cells. Development, 139, 498-502. von Besser, K., Frank, A.C., Johnson, M.A. and Preuss, D. (2006) Arabidopsis HAP2 (GCS1) is a sperm-specific gene required for pollen tube guidance and fertilization. Development, 133, 4761-4769. Vriezen, W.H., Feron, R., Maretto, F., Keijman, J. and Mariani, C. (2008) Changes in tomato ovary transcriptome demonstrate complex hormonal regulation of fruit set. New Phytol, 177, 60-76. Walcher, C.L. and Nemhauser, J.L. (2012) Bipartite promoter element required for auxin response. Plant Physiol, 158, 273-282. Wang, H., Boavida, L.C., Ron, M. and McCormick, S. (2008a) Truncation of a protein disulfide isomerase, PDIL2-1, delays embryo sac maturation and disrupts pollen tube guidance in Arabidopsis thaliana. Plant Cell, 20, 3300-3311. Wang, H., Liu, Y., Bruffett, K., Lee, J., Hause, G., Walker, J.C. and Zhang, S. (2008b) Haplo-insufficiency of MPK3 in MPK6 mutant background uncovers a novel function of these two MAPKs in Arabidopsis ovule development. Plant Cell, 20, 602-613. Wang, H., Ngwenyama, N., Liu, Y., Walker, J.C. and Zhang, S. (2007) Stomatal development and patterning are regulated by environmentally responsive mitogen-activated protein kinases in Arabidopsis. Plant Cell, 19, 63-73. Weigel, D. and Glazebrook, J. (2002) Whole-mount GUS Staining. In Arabidopsis: A Laboratory Manual (Press, C.S.H.L., ed). New York, pp. 243-248. Wen, J., Lease, K.A. and Walker, J.C. (2004) DVL, a novel class of small polypeptides: overexpression alters Arabidopsis development. Plant J, 37, 668-677. Wheeler, M.J., de Graaf, B.H., Hadjiosif, N., Perry, R.M., Poulter, N.S., Osman, K., Vatovec, S., Harper, A., Franklin, F.C. and Franklin-Tong, V.E. (2009) Identification of the pollen self-incompatibility determinant in Papaver rhoeas. Nature, 459, 992-995.

169

Wheeler, M.J., Vatovec, S. and Franklin-Tong, V.E. (2010) The pollen S-determinant in Papaver: comparisons with known plant receptors and protein ligand partners. J Exp Bot, 61, 2015-2025. Whitford, R., Fernandez, A., Tejos, R., Perez, A.C., Kleine-Vehn, J., Vanneste, S., Drozdzecki, A., Leitner, J., Abas, L., Aerts, M., Hoogewijs, K., Baster, P., De Groodt, R., Lin, Y.C., Storme, V., Van de Peer, Y., Beeckman, T., Madder, A., Devreese, B., Luschnig, C., Friml, J. and Hilson, P. (2012) GOLVEN secretory peptides regulate auxin carrier turnover during plant gravitropic responses. Dev Cell, 22, 678-685. Whittle, C.A., Malik, M.R., Li, R. and Krochko, J.E. (2010) Comparative transcript analyses of the ovule, microspore, and mature pollen in Brassica napus. Plant Mol Biol, 72, 279-299. Wilkinson, B. and Gilbert, H.F. (2004) Protein disulfide isomerase. Biochim Biophys Acta, 1699, 35-44. Wong, J.L., Leydon, A.R. and Johnson, M.A. (2010) HAP2(GCS1)-dependent gamete fusion requires a positively charged carboxy-terminal domain. PLoS Genet, 6, e1000882. Wu, J., Kurten, E.L., Monshausen, G., Hummel, G.M., Gilroy, S. and Baldwin, I.T. (2007) NaRALF, a peptide signal essential for the regulation of root hair tip apoplastic pH in Nicotiana attenuata, is required for root hair development and plant growth in native soils. Plant J, 52, 877-890. Wuest, S.E., Vijverberg, K., Schmidt, A., Weiss, M., Gheyselinck, J., Lohr, M., Wellmer, F., Rahnenfuhrer, J., von Mering, C. and Grossniklaus, U. (2010) Arabidopsis female gametophyte gene expression map reveals similarities between plant and animal gametes. Curr Biol, 20, 506-512. Yadav, R.K., Fulton, L., Batoux, M. and Schneitz, K. (2008) The Arabidopsis receptor-like kinase STRUBBELIG mediates inter-cell-layer signaling during floral development. Dev Biol, 323, 261-270. Yamada, H., Suzuki, T., Terada, K., Takei, K., Ishikawa, K., Miwa, K., Yamashino, T. and Mizuno, T. (2001) The Arabidopsis AHK4 histidine kinase is a cytokinin-binding receptor that transduces cytokinin signals across the membrane. Plant Cell Physiol, 42, 1017-1023. Yamaguchi, Y., Pearce, G. and Ryan, C.A. (2006) The cell surface leucine-rich repeat receptor for AtPep1, an endogenous peptide elicitor in Arabidopsis, is functional in transgenic tobacco cells. Proc Natl Acad Sci U S A, 103, 10104-10109. Yang, H., Matsubayashi, Y., Nakamura, K. and Sakagami, Y. (1999a) Oryza sativa PSK gene encodes a precursor of phytosulfokine-alpha, a sulfated peptide growth factor found in plants. Proc Natl Acad Sci U S A, 96, 13560-13565. Yang, W.C., Ye, D., Xu, J. and Sundaresan, V. (1999b) The SPOROCYTELESS gene of Arabidopsis is required for initiation of sporogenesis and encodes a novel nuclear protein. Genes Dev, 13, 2108-2117.

170

Yu, H.J., Hogan, P. and Sundaresan, V. (2005) Analysis of the female gametophyte transcriptome of Arabidopsis by comparative expression profiling. Plant Physiol, 139, 1853-1869. Zeng, Q., Chen, J.G. and Ellis, B.E. (2011) AtMPK4 is required for male-specific meiotic cytokinesis in Arabidopsis. Plant J. Zhang, G.Y., Wu, J. and Wang, X.W. (2010) Cloning and expression analysis of a pollen preferential rapid alkalinization factor gene, BoRALF1, from broccoli flowers. Mol Biol Rep, 37, 3273-3281. Zhang, Y. and McCormick, S. (2007) A distinct mechanism regulating a pollen-specific guanine nucleotide exchange factor for the small GTPase Rop in Arabidopsis thaliana. Proc Natl Acad Sci U S A, 104, 18830-18835. Zhao, X., de Palma, J., Oane, R., Gamuyao, R., Luo, M., Chaudhury, A., Herve, P., Xue, Q. and Bennett, J. (2008) OsTDL1A binds to the LRR domain of rice receptor kinase MSP1, and is required to limit sporocyte numbers. Plant J, 54, 375-387. Zheng, B., Deng, Y., Mu, J., Ji, Z., Xiang, T., Niu, Q.-W., Chua, N.-H. and Zuo, J. (2006) Cytokinin affects circadian-clock oscillation in a phytochrome B- and arabidopsis response regulator 4-dependant manner. Physiologia Plantarum, 127, 277-292.

i