Généralit és sur les voies de s .de la protéine Mutagénèse dirigée Production d’anticorps

download Généralit és sur les voies de s .de la protéine Mutagénèse dirigée Production d’anticorps

of 25

  • date post

    10-Sep-2018
  • Category

    Documents

  • view

    212
  • download

    0

Embed Size (px)

Transcript of Généralit és sur les voies de s .de la protéine Mutagénèse dirigée Production d’anticorps

  • 1O.Lascols / Nov2007

    GGnnralitralits sur les s sur les

    voies de signalisationvoies de signalisation

    Olivier LascolsOlivier LascolsFacult de Mdecine Pierre et Marie CurieFacult de Mdecine Pierre et Marie Curie

    2O.Lascols / Nov2007

    I.I. CaractCaractrisation drisation dune voie une voie

    de transduction dde transduction dun signalun signal

    Exemple du Signal Exemple du Signal MitogniqueMitognique de lEGFde lEGF

    1. Quel rcepteur ?1. Quel rcepteur ?2.2. Quels relais intracellulaires ?Quels relais intracellulaires ?33. . Spcificit de ces relais intracellulaires ?Spcificit de ces relais intracellulaires ?

    1. Interactions et transducteurs1. Interactions et transducteurs2.2. PlotropiePlotropie dun signaldun signal33. . Intgration de signaux par la celluleIntgration de signaux par la cellule

    II. Le rII. Le rseau de la signalisation cellulaireseau de la signalisation cellulaire

  • 3O.Lascols / Nov2007

    ????

    La transduction des signaux: gLa transduction des signaux: gnnralitralitss

    Dbut des annes 1980Dbut des annes 1980

    membrane R

    ligand

    Cibles cellulaires

    Systme damplificationSystme damplification

    arrive du signal

    transduction par rcepteur

    mission intracellulaire du signal

    quels seconds messagers ? quels relais ?

    effets biologiqueseffets biologiques

    4O.Lascols / Nov2007

    La transduction des signaux aujourdLa transduction des signaux aujourdhuihui

    R

    ligand 2

    NOYAU

    R

    ligand 3

    Transports

    Mtabolisme

    Etablissement de rseauxcomplexes par les progrsen biologie cellulaire etmolculaire :

    Directe : ligand 1

    Modles cellulaires : Modification

    dexpression de protines

    Mutagnsedirige

    Modles animaux : Souris Knock-out Souris Knock-in

    ligand 1

    R

    Stratgie de signalisation :

    Clonage de gnes

    Indirecte: ligand 2 ou 3

  • 5O.Lascols / Nov2007

    I.I. CaractCaractrisation drisation dune voie une voie

    de transduction dde transduction dun signalun signal

    Exemple du Signal Exemple du Signal MitogniqueMitognique de lEGF (de lEGF (EpidermalEpidermal GrowthGrowth FactorFactor))

    1. Quel rcepteur ?1. Quel rcepteur ?Mthodologie dtude des rcepteursMthodologie dtude des rcepteurs

    localisation, nature, spcificit, activit, clonage, structure/localisation, nature, spcificit, activit, clonage, structure/fonctionfonction

    2.2. Quels relais intracellulaires ?Quels relais intracellulaires ?a. Mthodes dtudea. Mthodes dtude

    test de protines connues, recherche de nouveaux partenaires, localisation

    b. La voie dactivation des MAP Kinases par lEGFb. La voie dactivation des MAP Kinases par lEGF

    33. . Spcificit de ces relais intracellulaires ?Spcificit de ces relais intracellulaires ?a. Mthodes dtudea. Mthodes dtude

    inhibiteurs pharmacologiques, stratgie antisens, inhibiteurs pharmacologiques, stratgie antisens, transgnsetransgnse

    b. Intgration des 3 dimensions : nature, lieu, tempsb. Intgration des 3 dimensions : nature, lieu, temps

    6O.Lascols / Nov2007

    MMthodologie dthodologie dtude des rtude des rcepteurscepteurs

    ETAPEETAPE MATERIELMATERIEL METHODESMETHODES RESULTATSRESULTATS

    Localisation . tissus . Test de liaison. cellules -autoradiographie

    - microscopie prolifrationlectronique diffrenciation

    . Effets biologiques apoptose

    Localisation .membranes . fractionnementCellulaire . cytosol subcellulaire capacit

    . test de liaison spcificit

    Slection . rcepteurs . chromatographiepurifis daffinit (Ab, ligand)

    . test de liaison

    Clonage . ADNc . Criblage de banque . Squence protique. Domaines spcialiss. Expression du rcepteur

    cystine

    transmb

    TKtyrosines

    Caractrisation protines . solubilisation . Structure . Activitsolubilises . test de liaison nature, taille enzyme

    . lectrophorse

    . immunoprcipitation

    . test dactivit

    Structure / . rcepteurs . Mutagnse dirige . Mode de transductionFonction muts . transfection

    . cellules

  • 7O.Lascols / Nov2007

    Interaction LigandInteraction LigandRRcepteurcepteur

    Rversible

    Saturable : nombre de site rcepteur dfini = Ro

    L + R LR

    *L + R *LRfixation spcifique

    LR Spcificit

    *L : ligand radioactif

    *L + R + X *LR + *LX

    *L + L + X *LX + LX

    L : excs de ligand froid

    fixation totale

    totale

    spcifique

    fixation non spcifique

    non spcifique

    8O.Lascols / Nov2007

    Etude de la structure du rEtude de la structure du rcepteurcepteur

    Structure fixant lEGF

    liaison de 125I-EGF

    125I-EGF + R 125I-EGF/R

    pontage covalent

    125I-EGF + R 125I-EGF/R

    DSS

    lectrophorse en SDS autoradiographie

    Identification par Western blot

  • 9O.Lascols / Nov2007

    Squence I en aade la protine

    Expression de la protine

    Mutagnse dirige

    Production danticorps

    Clonage dClonage dune protune protineine

    ARNm

    ADNc

    vecteur recombinant

    Banque dADNc

    Protine purifie

    squence nuclotidiqueAAGTCCTGCGGTGACAACGGTCG

    = SONDE

    squence partielleen acides amins

    Lys-prol-trp-tyr-asp-ser-cys-ala

    Criblage de la banque

    ADNc du gne

    Squence nuclotidique complte

    cellule

    10O.Lascols / Nov2007

    Etude structure fonctionEtude structure fonction

    Construction de mutants du rcepteur lEGF

    Autophosphorylation desmutants EGFR

    Rptitions richeen leucine

    Domaine riches en cystine

    Domaine Tyrosine Kinase

    Domaine C-terminal

  • 11O.Lascols / Nov2007

    Activation dActivation dun run rcepteur tyrosine kinase (TK)cepteur tyrosine kinase (TK)

    TK

    P

    ATP

    ADPY

    1. Autophosphorylationsur des rsidus tyrosinesdu rcepteur

    TK

    P

    ATP ADP

    Y

    substratY

    substratP

    Y

    2. Phosphorylationsur des rsidus tyrosinesde substrats endognes

    Mb

    12O.Lascols / Nov2007

    Activation par Activation par dimdimrisation risation et transphosphorylation et transphosphorylation

    a. Forme replie dEGFR:-faible affinit de liaison de lEGF- pas dactivit kinase

    Apport de la cristallographie et de la bioinformatique :Structure 3D

    b. Fixation de lEGF:- changement conformationnel du monomre (allostrie)

    - dmasquage de la boucle de dimrisation.

    b. Dimrisation:- dos dos- activation de la tyrosine kinase

  • 13O.Lascols / Nov2007

    I.I. CaractCaractrisation drisation dune voie une voie

    de transduction dde transduction dun signalun signal

    Exemple du Signal Exemple du Signal Mitognique Mitognique de lEGFde lEGF

    1. Quel rcepteur ?1. Quel rcepteur ?Mthodologie dtude des rcepteursMthodologie dtude des rcepteurs

    localisation, nature, spcificit, activit, clonage, structure/localisation, nature, spcificit, activit, clonage, structure/fonctionfonction

    2.2. Quels relais intracellulaires ?Quels relais intracellulaires ?a. Mthodes dtudea. Mthodes dtude

    test de protines connues, recherche de nouveaux partenaires, localisation

    b. La voie dactivation des MAP Kinases par lEGFb. La voie dactivation des MAP Kinases par lEGF

    33. . Spcificit de ces relais intracellulaires ?Spcificit de ces relais intracellulaires ?a. Mthodes dtudea. Mthodes dtude

    inhibiteurs pharmacologiques, stratgie antisens, inhibiteurs pharmacologiques, stratgie antisens, transgnsetransgnse

    b. Intgration des 3 dimensions : nature, lieu, tempsb. Intgration des 3 dimensions : nature, lieu, temps

    14O.Lascols / Nov2007

    Etude des interactions : entre molEtude des interactions : entre molcules connuescules connues

    Activation par le ligand

    Immunoprcipitation des complexes formsavec anticorps spcifique

    Sparation des constituants du complexe par lectrophorse

    Visualisation des protinespar immunoblot avec des anticorps spcifiques

  • 15O.Lascols / Nov2007

    ApplicationApplication

    Implication de Grb2 dans la voie de signalisation induite par EGImplication de Grb2 dans la voie de signalisation induite par EGFF

    1. Le rcepteur lEGF change de taille apparente

    3. Induction dune interaction entre EGFR et Grb2

    IP : immunoprcipitation

    IB : immunoblot

    2. Le rcepteur lEGF est phosphoryl sur une tyrosine

    Lors de lactivation par EGF:

    16O.Lascols / Nov2007

    Clonage dClonage dun nouveau partenaireun nouveau partenaire

    Expression de la protine

    Clones positifs radioactifs

    Squenage des ADN

    Banque dexpression dADNcFragment EGFR marqu

    Criblage de la banque

    Y-125I

    Production danticorps

    Immunoprcipitation Immunoblot

  • 17O.Lascols / Nov2007

    SystSystme double hybride me double hybride (1)(1)

    BD : Binding DomainAD : Activating Domain

    UAS : Upstream Activating Sequence

    18O.Lascols / Nov2007

    SystSystme double hybride me double hybride (2)(2)

    Criblage dCriblage dune librairie dune librairie dexpressionexpression

  • 19O.Lascols / Nov2007

    Etude de la localisation dEtude de la localisation dun relaisun relais

    stimulation par le ligand

    Localisation de la protine chimre

    si TAG non fluorescent

    Microscopie confocale en lumire fluorescente

    si TAG fluorescent

    Ex: GFPGreen Fluorescent Protein

    Ab fluorescent anti-TAG

    Expression de la protine chimre

    ADNc de protine relais ADNc de protine TAG

    ADNc de protine chimre

    20O.Lascols / Nov2007