1

Co-infection of Helicobacter pylori and Opisthorchis viverrini enhances the 1

severity of hepatobiliary abnormalities in hamsters 2

3

Rungtiwa Dangtakot1, 2, Somchai Pinlaor3, 4, Upsornsawan Itthitaetrakool5, Apisit Chaidee3, 4, 4

Chariya Chomvarin6, 4, Arunnee Sangka2, Chotechana Wilailuckana 2, Porntip Pinlaor2, 4* 5

6

1 Science Program in Medical Technology, Faculty of Associated Medical Sciences, Khon 7

Kaen University, Khon Kaen 40002, Thailand 8

2 Centre for Research and Development of Medical Diagnostic Laboratories, Faculty of 9

Associated Medical Sciences, Khon Kaen University, Khon Kaen 40002, Thailand 10

3 Department of Parasitology, Faculty of Medicine, Khon Kaen University, Khon Kaen 11

40002, Thailand 12

4 Liver Fluke and Cholangiocarcinoma Research Center, Khon Kaen University, Khon Kaen 13

40002, Thailand 14

5 Biomedical Science Program, Graduate School, Khon Kaen University, Khon Kaen, 15

Thailand 16

6 Department of Microbiology, Faculty of Medicine, Khon Kaen University, Khon Kaen 17

40002, Thailand 18

19

* Corresponding author at: Department of Microbiology, Faculty of Associated Medical 20

Science, Khon Kaen University, Khon Kaen, Thailand. Tel.: +66 43 202086, fax: +66 43 21

202086. 22

E-mail address:porawa@kku.ac.th (P. Pinlaor). 23

24

IAI Accepted Manuscript Posted Online 30 January 2017Infect. Immun. doi:10.1128/IAI.00009-17Copyright © 2017 American Society for Microbiology. All Rights Reserved.

on March 26, 2020 by guest

http://iai.asm.org/

Dow

nloaded from

http://iai.asm.org/

2

Running title: Co-infection of H. pylori and O. viverrini in liver. 25

26

ABSTRACT 27

Persistent infection with Opisthorchis viverrini causes hepatobiliary abnormalities, 28

predisposing infected individuals to cholangiocarcinoma (CCA). In addition, Helicobacter 29

pylori is highly prevalent in most countries and is a possible risk factor for CCA; however, its 30

role in enhancing hepatobiliary abnormality is unclear. Here, we investigated the effects of 31

co-infection of H. pylori and O. viverrini on hepatobiliary abnormality. Hamsters were 32

divided into four groups: (1) normal, (2) H. pylori-infected (HP), (3) O. viverrini-infected 33

(OV), and (4) O. viverrini plus H. pylori-infected (OV+HP). At 6 months post-infection, PCR 34

and immunohistochemistry were used to test for the presence of H. pylori in the stomach, 35

gallbladder and liver. In the liver, H. pylori was detected in the order of OV+HP (5 of 8, 36

62.5%), HP (2 of 5, 40%) and OV (2 of 8, 25%): H. pylori was not detected in normal 37

(control) liver tissues. Co-infection induced the most severe hepatobiliary abnormalities, 38

including periductal fibrosis, cholangitis and bile duct hyperplasia, leading to significantly 39

decreased survival rate of experimental animals. The greatest thickness of periductal fibrosis 40

was associated with a significant increase of fibrogenesis markers (expression of α-SMA and 41

TGF-β). qRT-PCR revealed that the highest expression levels of pro-inflammatory cytokine 42

genes (IL-1, IL-6 and TNF-α) were also observed in the OV+HP group. These results suggest 43

that co-infection of H. pylori and O. viverrini increased severity of hepatobiliary 44

abnormalities to a greater extent than either single infection. 45

46

Keywords: Helicobacter pylori, Opisthorchis viverrini, hepatobiliary disease, periductal 47

fibrosis, cholangitis, hepatic inflammation 48

49

on March 26, 2020 by guest

http://iai.asm.org/

Dow

nloaded from

http://iai.asm.org/

3

1. INTRODUCTION 50

Infection with the human liver fluke, Opisthorchis viverrini, causes opisthorchiasis, 51

which is endemic in the Greater Mekong Sub-region. In Thailand, approximately six million 52

people are currently infected by O. viverrini and the highest prevalence rate is found in the 53

northeastern regions (1, 2). This fluke is classified as a group 1 carcinogen by the 54

International Agency for Research on Cancer because of its role in the development of 55

cholangiocarcinoma (CCA) (3). Humans become infected after eating raw freshwater fish 56

contaminated with the infective stage, the metacercaria. Newly excysted juvenile worms in 57

the duodenum migrate into the hepatobiliary system and develop into adults within one 58

month, promoting hepatobiliary abnormalities including hepatic dysplasia, bile duct 59

hyperplasia, periductal fibrosis, and bile duct cancer (3). Fewer than 10 % of infected 60

individuals in the community develop CCA (1, 2). 61

Etiology of CCA is multifactorial. The importance of single risk factors, such as 62

bacterial infection, can be hard to gauge. A meta-analysis revealed that Helicobacter species 63

in the hepatobiliary system were associated with CCA globally, as well as in liver fluke-free 64

areas (4). One member of the genus, Helicobacter pylori, has also been classified as a group I 65

carcinogen and is common in the gastro-duodenal system (3). Recent reviews have reported 66

that H. pylori infection is associated with several diseases outside the gastrointestinal tract, 67

including in the hepatobiliary system (5, 6). The presence of H. pylori DNA in gallbladder 68

and gastric mucosa has been strongly associated with clinicopathological features of chronic 69

cholecystitis patients, a risk condition for CCA (7). More than fifty percent of the human 70

population worldwide is colonized by H. pylori. Prevalences are particularly high in 71

developing countries, including in the northeastern part of Thailand (8). Although H. pylori 72

has been detected in various organs and products such as liver, bile, gallbladder and gallstone 73

(9), its role in the development of hepatobiliary disease is unclear. 74

on March 26, 2020 by guest

http://iai.asm.org/

Dow

nloaded from

http://iai.asm.org/

4

In fluke-endemic areas in Thailand, H. pylori was found in 66.7% of the patients with 75

CCA and 41.5% of the patients with cholelithiasis. The presence of H. pylori in the liver and 76

gallbladder was associated with biliary inflammation and proliferation (10). Recently, H. 77

pylori infection was found to be more prevalent in O. viverrini-infected hamsters than in 78

normal hamsters, suggesting that the parasite in the bile duct is a reservoir of H. pylori and 79

Helicobacter-like bacteria (11). Taken together, these lines of evidence support the 80

hypothesis that H. pylori co-infection with O. viverrini synergistically increases the severity 81

of hepatobiliary abnormalities. 82

In order to test this hypothesis, the present study aims to clarify the effect of co-infection 83

of H. pylori and O. viverrini on hepatobiliary abnormalities in a hamster model. The outcome 84

of this study might help to explain the hepatobiliary changes in humans in fluke-endemic 85

areas. It might also be useful for suggesting modifications to the therapeutic approaches for 86

prevention and control of opisthorchiasis-associated CCA. 87

88

2. MATERIALS AND METHODS 89

Bacterial strains 90

The H. pylori strain DMST 20165 (cagA+, vacA+, ureA+), obtained from the 91

National Institute of Health, Department of Medical Sciences, Ministry of Public Health, 92

Thailand, was used in this study. Helicobacter pylori was grown on 10% sheep blood agar 93

and incubated for 48-72 h at 37 °C under microaerobic conditions (10% CO2, 5% O2, and 94

85% N2) using CampygenTM 3.5 L, Oxoid Ltd. Enrichment of bacterial growth on the plates 95

was confirmed by biochemical tests including catalase, oxidase, urease and Gram staining. 96

Next, H. pylori was subcultured in Brucella broth supplemented with 10% fetal bovine serum 97

for 24 hour at 37°C under microaerobic condition in an incubator shaker and then was 98

checked for urease, catalase and oxidase activity. After that, cells were suspended in 99

on March 26, 2020 by guest

http://iai.asm.org/

Dow

nloaded from

http://iai.asm.org/

5

phosphate-buffered saline (PBS) to an optical density at 600 nm of 1.000 (~109 colony-100

forming units) (12) under microaerobic condition and were ready for inoculation by gastric 101

intubation. 102

Preparation of O. viverrini metacercariae 103

The O. viverrini metacercariae were isolated from the naturally infected cyprinoid 104

fishes by artificial pepsin digestion (0.25% Pepsin A, BDH, USA) as previously described 105

elsewhere (13). Metacercariae of O. viverrini were identified under a stereo microscope. 106

Animals 107

Male Syrian golden hamsters (Mesocricetus auratus), 4-6 weeks old, were obtained 108

from the Animal Unit, Faculty of Medicine, Khon Kaen University, Khon Kaen, Thailand. 109

These animals were used in this study because the anatomical structure of the hamster 110

hepatobiliary system is similar to that of humans and it is a susceptible host for O. viverrini. 111

Animals were housed under conventional conditions and given food and water ad libitum. 112

The study protocol was reviewed and approved by the Animal Ethics Committee of Khon 113

Kaen University (Reference No. 0514.1.75/21). The standard guidelines of Ethics of Animal 114

Experimentation of the National Research Council of Thailand were followed in order to 115

ensure the health and well-being of our study animals. All animals enrolled in the experiment 116

were healthy and animal health status was monitored daily. Before use, cages were washed 117

with Dettol, a liquid antiseptic and disinfectant, then with washing-up liquid (Sunlight, a 118

cleaning product) and finally fully dried. Bedding was autoclaved before starting the 119

experiment. Cages and bedding were changed 1-2 time a week. 120

Experimental design 121

Forty animals were divided into four groups: (1) normal controls (Normal, n = 5), (2) 122

H. pylori-infected (HP, n = 10), (3) O. viverrini-infected (OV, n = 10) and (4) H. pylori plus 123

O. viverrini (OV+HP, n = 15). Metacercariae of O. viverrini and H. pylori were administered 124

on March 26, 2020 by guest

http://iai.asm.org/

Dow

nloaded from

http://iai.asm.org/

6

to hamsters via gastric intubation. For the H. pylori-infected groups, hamsters were infected 125

with 0.5 ml of H. pylori suspended in PBS (approximately 5x108 colony-forming units) 126

within one hour of preparing the bacteria in microaerophilic conditions. For the O. viverrini-127

infected groups, hamsters were infected with fifty fluke metacercariae in normal saline 128

solution. Usually, H. pylori colonizes the stomach. To maximize the chances of the bacterium 129

reaching the hepatobiliary system, H. pylori was administered to the hamsters one week 130

before and one month after O. viverrini infection (by which time worms have matured and 131

already produced inflammation-mediated bile-duct and liver injuries). 132

Specimen collection 133

At 6 months post-infection (p.i.), hamsters were sacrificed using sodium pentobarbital 134

anesthesia. For DNA isolation, stomach, liver and gallbladder tissues were collected, snap-135

frozen in liquid nitrogen and stored at -80 °C until used. For RNA isolation, livers were 136

collected in TRIZOL™ reagent and stored at -80 °C until used. For histopathological and 137

immunohistochemical studies, stomach and liver tissues were collected and fixed in 10% 138

buffered formalin. Blood samples were taken from the heart, centrifuged at 3,000 rpm for 10 139

min at 4°C, and serum was collected and divided into 400 µl aliquots and kept at -80°C until 140

used for biochemical analyses. 141

Histopathology and immunohistochemistry 142

Hamster liver and stomach samples were fixed in neutral buffered 10% formalin, 143

embedded in paraffin wax, sectioned at 5 µm, and stained with hematoxylin and eosin 144

(H&E). The grade of cholangitis visible in liver sections was scored according to the 145

infiltration of inflammatory cells as follows: grade 0, no cholangitis; grade 1, mild invasion 146

of inflammatory cells around the bile duct; grade 2, severe invasion of inflammatory cells 147

around the bile duct; grade 3, abscess formation in the liver (14). Deposition of collagen at 148

sites of hepatic and periductal fibrosis was stained using picrosirius red kit (Polysciences, 149

on March 26, 2020 by guest

http://iai.asm.org/

Dow

nloaded from

http://iai.asm.org/

7

Inc., Warrington, PA, USA) according to the manufacturer’s instructions. Periductal fibrosis 150

was graded under a bright-field microscope (Carl Zeiss, Jena, Germany) into five stages as 151

follows: grade 0, no fibrosis; grade 1, mild fibrous expansion of some portal areas; grade 2, 152

moderate fibrous expansion of most portal areas with short fibrous septa; grade 3, severe 153

fibrous expansion of most portal areas with occasional portal-to-portal bridging; grade 4: 154

more severe fibrous expansion of most portal areas with marked bridging (15). 155

Presence of H. pylori in stomach and liver samples was identified by immunostaining 156

with rabbit polyclonal anti-H. pylori (Abcam, Cambridge, MA, USA, ab7788; 1:10 dilution), 157

counterstained with Mayer’s hematoxylin and examined using a bright-field microscope. 158

Western blot analysis 159

Hepatic fibrosis was also confirmed by the expression of α-smooth muscle actin. The 160

concentration of protein extracted from a liver sample was determined using a Bio-Rad 161

protein assay kit (Bio-Rad, Hercules, CA, USA). Twenty micrograms of protein was used for 162

western blotting and stained with anti-α-smooth muscle actin (Abcam, ab5694, 1:1,000) and 163

β-Tubulin (9F3) Rabbit mAb (Cell Signaling Technology, USA, #2128, 1:100) solution at 164

4°C overnight. Immunostaining was detected using an ECL Prime Western Blotting 165

Detection kit (GE Healthcare, Maidstone, UK). Relative band density was quantified using 166

my Image Analysis v2.0 software (Life Technologies, Thermo Fisher Scientific, Carlsbad, 167

CA, USA). 168

DNA extraction 169

Using a QiAamp Tissue kit (Qiagen, Germany), DNA was extracted from pieces of 170

15-25 mg cut from frozen samples of stomach, liver and gallbladder tissues. DNA 171

concentration was measured using a NanoDrop 2000 spectrophotometer (NanoDrop 172

Technologies, Wilmington, DE, USA). The purity of DNA in individual samples was 173

on March 26, 2020 by guest

http://iai.asm.org/

Dow

nloaded from

http://iai.asm.org/

8

assessed by measuring absorbance at 260 and 280 nm: ratios of these values ranging from 1.7 174

to 2.1 were considered acceptable. 175

176

PCR amplification 177

Amplification of DNA extracted from the gastric, liver, and gallbladder tissues was 178

done using Helicobacter genus-specific 16S rRNA primers. Identification of H. pylori was 179

done by H. pylori ureA primers (primer sequences and PCR conditions in Table S1) (16). The 180

primers were checked for specificity using BLAST searches at https://blast.ncbi.nlm.nih.gov. 181

The 20 µl PCR reaction included 1x PCR buffer, 1 mM MgCl2, 0.3 mM dNTP, 0.25 µM each 182

primer, 1U platinum Taq DNA polymerase, and 300 ng of DNA template. Negative controls 183

without DNA template and positive controls with H. pylori DNA were run in parallel. The 184

PCR reactions were run in a thermal cycler and an Expand high-fidelity PCR system (Bio 185

Rad C1000TM Thermal cycler). The amplified PCR products were separated by 186

electrophoresis on 1.5 % agarose gels along with 100 bp plus DNA ladder and visualized by 187

UV light after staining by ethidium bromide. 188

Gene expression study 189

To determine mRNA expression of TNF-α, IL-1, IL-6 and TGF-β, total RNA was 190

extracted from frozen hamster liver tissues using Trizol (Invitrogen, Carlsbad, CA, USA). 191

The concentration of RNA was measured using a NanoDrop 2000 spectrophotometer 192

(NanoDrop Technologies, Wilmington, DE, USA). The purity of RNA in individual samples 193

was assessed by measuring absorbance at 260 and 280 nm: ratios of these values ranging 194

from 1.99 to 2.1 were considered acceptable. Complementary DNA (cDNA) was synthesized 195

using RevertAid reverse transcriptase (Thermo Scientific) and used for qRT-PCR. The 196

specific primer pairs IL-1: 5´GCCCATCTTCTGTGACTCCT3´-F; 197

5´TGGAGAACACCACTTGTTGG3´-R, IL-6: 5´GACTTCACAGAGGACACTAC3´-F; 198

on March 26, 2020 by guest

http://iai.asm.org/

Dow

nloaded from

http://iai.asm.org/

9

5´CACATAGTCATTGTCCATACAG3´-R, TNF-α: 5´GACGGGCTGTACCTGGTTTA3´-F; 199

5´GAGTCGGTCACCTTTCTCCA3´-R, TGF-β: 5´ACATCGACTTTCGCAAGGAC3´-F; 200

5´TGGTTGTAGAGGGCAAGGAC3´-R, and GAPDH: 201

5´AGAAGACTGTGGATGGCCCC3´-F; 5´TGACCTTGCCCACAGCCTT3´-R were used 202

for amplification of hamster genes. Relative mRNA expression was analyzed by 203

LightCycler® 480 II using LightCycler® 480 SYBR Green I Master. All data were analyzed 204

using LightCycler® 480 software and then processed using the 2−ΔΔCt method (17) relative to 205

GAPDH mRNA. 206

Biochemical analyses 207

Serum aspartate transferase (AST), alanine transferase (ALT) and alkaline 208

phosphatase (ALP), the indicators of liver and bile duct injury, were measured using an 209

automated spectrophotometer (automate RA100) using a commercial kit (Thermo Trace Ltd., 210

Melbourne, Australia). 211

Statistical analysis 212

To compare between two groups, non-parametric data were analyzed using Kruskal 213

Wallis and Mann-Whitney U tests and parametric data were analyzed using analysis of 214

variance. P values

10

hamsters infected with O. viverrini plus H. pylori. Thus, five hamsters of the normal group, 224

five hamsters of the HP group, and eight hamsters in both the OV group and the OV+HP 225

group were terminated at the designated time-point at 6 months. 226

The decreased survival rate in the OV+HP group was statistically significant 227

compared to the normal control group (P = 0.0105, Fig. 1), whereas either OV- or HP- 228

treatment alone decreased survival rate, but not to a statistically significant level relative to 229

controls. However, all normal hamsters were still alive at 6 months and did not show any 230

clinical signs. 231

Detection of H. pylori by PCR and immunohistochemistry 232

The prevalence of H. pylori in all gastric, gallbladder and liver samples, as detected 233

by PCR and immunohistochemistry, is summarized in Table 1. PCR analysis of liver samples 234

revealed H. pylori DNA in 2 of 8 (25%), 2 of 5 (40%) and 4 of 8 (50%) of the OV, HP, and 235

OV+HP groups, respectively: H. pylori DNA was not detected in any normal liver sample. 236

Immunohistochemistry demonstrated H. pylori in liver sections from the HP group (1 237

of 5, 20%) and from the OV+HP group (2 of 8, 25%), but not in the OV and normal groups 238

(Fig. 2). 239

Overall prevalences of H. pylori in gastric samples were 20%, 40%, 50% and 75% for 240

normal, HP, OV and OV+HP groups, respectively. Corresponding results for liver samples 241

were 25%, 40% and 62.5% for OV, HP and OV+HP groups, respectively. No H. pylori was 242

found in the liver tissues of normal group. 243

Histopathological finding 244

Gastric lesions including ulcers, mucosal hyperplasia and gland proliferation were 245

observed in one hamster of the HP group and one hamster of the OV+HP group. In contrast, 246

such lesions were not observed in normal or OV groups (Fig. S1). 247

on March 26, 2020 by guest

http://iai.asm.org/

Dow

nloaded from

http://iai.asm.org/

11

Cholangitis was not observed in any hamster in the normal control group (Fig. 3a). 248

Only one hamster of the HP group showed mild invasion of inflammatory cells around the 249

bile duct (Fig. 3b). Around the bile ducts containing adult worms (OV and OV+HP groups), 250

marked accumulations of inflammatory cells were evident (Fig. 3c and Fig. 3d). The most 251

severe histopathological changes were observed in the OV+HP group. These changes 252

included infiltration by inflammatory cells, thickening of periductal fibrosis, lymphoid 253

follicles, and cholangitis. Cholangitis was observed in hamsters of the OV and OV+HP 254

groups. The grade scores of cholangitis increased in the order HP group, OV group and 255

OV+HP group (Table 2). Although the OV and OV+HP groups exhibited similar cholangitis 256

grade scores, massive invasion of inflammatory cells around the bile duct, with abscess 257

formation in the liver and bile duct hyperplasia, were more evident in the OV+HP group than 258

in the OV group. 259

Fibrosis in the hamster livers 260

Liver collagen content was determined by picrosirius red staining (Fig. 4A), which 261

facilitated scoring of fibrosis. The grade scores of fibrosis increased in the order HP group, 262

OV group and OV+HP group (Table 2). All hamsters of the HP group exhibited mild fibrous 263

expansion of some portal areas and parenchyma. For the OV group, all hamsters developed 264

moderate to severe fibrous expansion of most portal areas with short fibrous septa or 265

occasional portal-to-portal bridging. For the OV+HP group, two hamsters developed 266

moderate fibrous expansion of most portal areas with short fibrous septa; four hamsters 267

developed severe fibrous expansion of most portal areas with occasional portal-to-portal 268

bridging, and two hamsters developed more severe fibrous expansion of most portal areas 269

with marked bridging. Interestingly, the most severe fibrosis was observed in the OV+HP 270

group, especially in individuals positive for H. pylori. No fibrosis was observed in the normal 271

group. 272

on March 26, 2020 by guest

http://iai.asm.org/

Dow

nloaded from

http://iai.asm.org/

12

Expression of α-SMA in hamster livers 273

To evaluate fibrosis, we investigated the expression level of α-SMA using western 274

blot (Fig. 4B). In the normal and HP groups, α-SMA was hardly detected by western blotting. 275

The greatest band intensity of α-SMA was observed in some of the OV group (2 of 8) and in 276

the OV+HP group (5 of 8). Interestingly, relative intensities of α-SMA were significantly 277

greater in the OV+HP group than in the OV group (p

13

where O. viverrini is endemic (8). Despite this, there have been no detailed studies of 298

hepatobiliary abnormalities in the H. pylori-infected opisthorchiasis hamster model: the 299

present study is the first to do this. As we know, in acute infection, O. viverrini releases 300

antigens which activate host-parasite interactions resulting in inflammatory cell infiltration, 301

excess of cytokines and free radical production, bile duct epithelial hyperplasia and injury of 302

epithelial and hepatic cells. In chronic infection, myofibroblasts become activated and 303

migrate into the damaged tissue and synthesize extracellular matrix (ECM) components 304

leading to increased periductal fibrosis, which might be one possible risk condition for CCA 305

development (2). 306

Herein, we demonstrated the effect of co-infection of H. pylori and O. viverrini on 307

histopathological changes in hamster liver. Co-infection promoted more severe hepatobiliary 308

abnormalities than did either single infection. Pathological changes included cholangitis and 309

periductal fibrosis, leading to decreased survival rate in hamsters. This was accompanied by 310

up-regulated expression of genes encoding IL-1, IL-6, TNF-α, the proinflamatory cytokines, 311

and TGF-β, the profibrotic cytokine, which showed the highest levels in the co-infected 312

group. Cholangitis, periductal fibrosis and bile duct hyperplasia were also found to be the 313

most severe in some hamster livers in the co-infected group. In addition, the expression of α-314

SMA protein, an indicator of myofibroblasts, increased significantly in the group co-infected 315

with both pathogens when compared to O. viverrini infection alone. 316

Previously, we have sequentially reported that O. viverrini infection induces 317

inflammation-mediated oxidative stress (18), leading to accumulated periductal fibrosis 318

increasing with time (13) and that the fibrotic lesion plays an important role in CCA genesis 319

in hamsters (19). In this study, periductal fibrosis was most prominent in hamsters co-320

infected with H. pylori and O. viverrini, suggesting that H. pylori may also accelerate the 321

fibrogenesis occurring during O. viverrini infection. 322

on March 26, 2020 by guest

http://iai.asm.org/

Dow

nloaded from

http://iai.asm.org/

14

The enhanced periductal fibrosis seen in the co-infected group was associated with increased 323

expression of inflammatory genes such as IL-1, IL-6 and TNF-α, in addition to any IL-17 and 324

IFN-gamma response that might occur due to H. pylori in gastric lesions (20). Upregulated 325

expression of IL-6 has been noted previously in O. viverrini (21) and H. pylori single 326

infections (22), which might synergistically induce inflammation-mediated liver injury 327

through oxidative stress (18, 22). As a result of this, the lipopolysaccaride (LPS) of bacteria, 328

including H. pylori, can induce TGF-β signaling through a toll-like receptor 4 (TLR4) (23), 329

contributing to fibrogenesis. Synergistic induction of TGF-β induces activation of 330

myofibroblasts, leading to synthesis of large amounts of extracellular component proteins to 331

restore injured tissues. Finally, the excessive accumulation of ECM components promotes the 332

formation of the most prominent periductal fibrosis during O. viverrini and H. pylori co-333

infection. Relevantly, a combination of H. pylori and carbon tetrachloride treatment can 334

enhance severity of hepatic fibrosis in animals (24). Also, in chronic hepatitis-C patients, co-335

infection with H. pylori can enhance liver fibrosis and cirrhosis (25). 336

It is notable that not all animals in the H. pylori-treated groups (HP and OV+HP 337

groups) exhibited severe hepatobiliary abnormalities. Most of the individuals exhibiting 338

abnormalities returned positive tests for H. pylori in the liver. In the HP group, two hamsters 339

positive for H. pylori showed mild fibrous expansion of some portal areas and parenchyma, 340

and one of them had highly elevated ALT and AST levels. In the OV+HP group, among five 341

hamsters positive for H. pylori, severe periductal fibrosis with marked bridging was seen in 342

four. Among those with severe hepatic lesions, three hamsters showed intense α-SMA protein 343

expression and one hamster had highly increased serum levels of ALT and AST. In contrast, 344

one hamster in the co-infection group was negative for H. pylori, but exhibited increased 345

plasma ALT level and cholangitis, suggesting that other bacterial infections could not be 346

excluded as an explanation. Similarly, two hamsters in the OV group with moderate to severe 347

on March 26, 2020 by guest

http://iai.asm.org/

Dow

nloaded from

http://iai.asm.org/

15

periductal fibrosis were negative for H. pylori and exhibited slightly increased levels of ALT 348

and AST. 349

The question arises as to whether other Helicobacter species might play a role in 350

hepatobiliary disease. Hamsters have been found naturally infected in various tissues with 351

several novel Helicobacter spp. (26-29) belonging to the H. bilis cluster, which is known to 352

be involved in hepatobiliary lesions (26, 30). To support this, H. bilis could be detected in 353

14.9% and 9.4% of patients with CCA and cholelithiasis, respectively, and was absent in the 354

control group (10). On the other hand, H. pylori, a group 1 carcinogen, was detected in a 355

higher prevalence (66.7% in the patients with CCA, 41.5% in patients with cholelithiasis and 356

25.0% in control groups) than that of H. bilis (10). Therefore, we strongly believe that H. 357

pylori is involved in the pathogenesis of hepatobiliary diseases rather than H. bilis in Thai 358

patients (31). 359

DNA of H. pylori has been detected in the liver tissue, bile, gallbladder and gallstones 360

in patients with hepatobiliary diseases. It is not clear how H. pylori enters the hepatobiliary 361

system. In mice inoculated orally with H. pylori, the stomach was the most common site 362

(86%), but infection rate in the hepatobiliary system was only 40% (32). In the present study, 363

in the HP group, H. pylori was detected in 40 % of liver samples, a prevalence similar to that 364

in the gastric samples. In hamsters infected with O. viverrini alone, H. pylori was detected in 365

50% of gastric tissues, but was less prevalent in the hepatobiliary system (25%) than in the 366

HP group, suggesting that oral inoculation with H. pylori permits its transmission to the 367

biliary system with or without the presence of flukes. There appears to be a background level 368

of natural infection of gastric tissue (but not liver tissue) with H. pylori in our hamsters, 369

which was similar to findings in a previously study (11, 16). Inoculation with additional H. 370

pylori and/or the presence of worms was associated with presence of H. pylori in the biliary 371

system. 372

on March 26, 2020 by guest

http://iai.asm.org/

Dow

nloaded from

http://iai.asm.org/

16

Moreover, our results showed that when H. pylori was orally inoculated with O. 373

viverrini, detection rates of H. pylori in gastric and liver tissues increased to 75 % and 62.5%, 374

respectively. The colonization rate of H. pylori was higher in the co-infected group than in 375

either of the single-infection groups. Helicobacter pylori may reach the liver in three possible 376

ways: i) by causing gastric injury facilitating transport to the liver via the blood stream (33), 377

ii) when inoculated with O. viverrini, H. pylori may be carried into the hepatobiliary system 378

directly by the worms (11), or iii) physical obstruction of the bile ducts by O. viverrini 379

infection (34) may lead to increased pressure and low pH within the biliary tract, which might 380

permit influx of H. pylori from the gastrointestinal tract into the hepatobiliary system. 381

In addition, H. pylori was detected by PCR but not by immunostaining in two 382

hamsters inoculated with O. viverrini alone. This may have represented natural infection. 383

Alternatively, H. pylori DNA in the stomach may have been passively carried to the 384

hepatobiliary system (35). In some individual hamsters inoculated with H. pylori, the 385

bacterium could be detected in the liver sample using PCR or immunohistochemical staining, 386

but not in the gastric sample. This might be due to low numbers of bacteria colonizing the 387

gastric site. Prevalences of H. pylori were similar in the gall bladder in the OV and OV+HP 388

groups. This may be due to a limitation in this study that we couldn’t collect bile because of a 389

significant decrease in bile production from as early as one month post-infection. Moreover, 390

the status of our hamsters with regard to Helicobacter infection was not determined before 391

starting the experiment. Nor did we determine the genetic profile of H. pylori (e.g. with 392

respect to cagA and vacA genes) in the samples. However, we did inoculate our experimental 393

animals with a virulent H. pylori strain (DMST20165), which is cagA+ and vacA+. These 394

virulence genes are likely to enhance severity of hepatobiliary diseases (36) and peptic ulcers 395

(37). We believe that a virulent strain of H. pylori is more likely to accelerate induction of 396

hepatobiliary diseases in addition to O. viverrini infection alone. 397

on March 26, 2020 by guest

http://iai.asm.org/

Dow

nloaded from

http://iai.asm.org/

17

In summary, this study showed that H. pylori orally inoculated could cause not only 398

gastric lesions but also could reach the hepatobiliary system, enhancing severity of 399

hepatobiliary abnormalities such as periductal fibrosis and cholangitis, leading to 400

significantly decreased survival rates in experimental opisthorchiasis. Longitudinal studies 401

using a larger number of animals and extensive studies of H. pylori virulence gene profiles 402

should be performed for risk assessment of opisthorchiasis-associated CCA to confirm this 403

finding. This provides greater understanding of the effect of H. pylori not only in 404

experimental opisthorchiasis, but also in co-infection of H. pylori with other helminth-related 405

hepatobiliary diseases. In addition, it might be useful when considering relevant therapeutic 406

approaches in human opisthorchiasis-associated CCA. 407

408

AUTHOR CONTRIBUTIONS 409

PP, SP, CC, AS and CW contributed to the experimental design of the study. RD, UI 410

and AC performed the experiments, data analysis, and drafted the manuscript. PP and SP read 411

and corrected the manuscript. 412

413

COMPETING INTERESTS: the authors have no competing interests. 414

415

ACKNOWLEDGEMENTS 416

This work was supported by a grant of The Thailand Research Fund (TRG5680032), 417

and Khon Kaen University Research Fund (KKU590302). Miss Rungtiwa Dangtakot was 418

supported by Centre for Research and Development of Medical Diagnostic Laboratories, 419

Faculty of Associated Medical Sciences, KhonKaen University. We thank The National 420

Institute of Health, Department of Medical Sciences, Ministry of Public Health, Thailand, for 421

on March 26, 2020 by guest

http://iai.asm.org/

Dow

nloaded from

http://iai.asm.org/

18

providing Helicobacter pylori strain DMST20165. We also thank Prof. David Blair at the 422

publication clinic for his advice and English presentation. 423

424

REFERNCES 425

1. Sithithaworn P, Yongvanit P, Duenngai K, Kiatsopit N, Pairojkul C. 2014. Roles of 426

liver fluke infection as risk factor for cholangiocarcinoma. J. Hepatobiliary Pancreat. Sci. 427

21:301-308. 428

2. Sripa B, Brindley PJ, Mulvenna J, Laha T, Smout MJ, Mairiang E, Bethony JM, 429

Loukas A. 2012. The tumorigenic liver fluke Opisthorchis viverrini--multiple pathways 430

to cancer. Trends Parasitol. 28:395-407. 431

3. IARC. 2012. Biological agents. A review of human carcinogens. IARC Monogr. Eval. 432

Carcinog. Risks Hum. 100(B):1-441. 433

4. Xiao M, Gao Y, Wang Y. 2014. Helicobacter species infection may be associated with 434

cholangiocarcinoma: a meta-analysis. Int. J. Clin. Pract. 68:262-270. 435

5. Franceschi F, Zuccala G, Roccarina D, Gasbarrini A. 2014. Clinical effects of 436

Helicobacter pylori outside the stomach. Nat. Rev. Gastroenterol. Hepatol. 11:234-242. 437

6. Roubaud Baudron C, Franceschi F, Salles N, Gasbarrini A. 2013. Extragastric 438

diseases and Helicobacter pylori. Helicobacter 18 Suppl 1:44-51. 439

7. Zhou D, Guan WB, Wang JD, Zhang Y, Gong W, Quan ZW. 2013. A comparative 440

study of clinicopathological features between chronic cholecystitis patients with and 441

without Helicobacter pylori infection in gallbladder mucosa. PLoS One 8:e70265. 442

8. Uchida T, Miftahussurur M, Pittayanon R, Vilaichone RK, Wisedopas N, 443

Ratanachu-Ek T, Kishida T, Moriyama M, Yamaoka Y, Mahachai V. 2015. 444

Helicobacter pylori Infection in Thailand: A Nationwide Study of the CagA Phenotype. 445

PLoS One 10:e0136775. 446

on March 26, 2020 by guest

http://iai.asm.org/

Dow

nloaded from

http://iai.asm.org/

19

9. Lee JW, Lee DH, Lee JI, Jeong S, Kwon KS, Kim HG, Shin YW, Kim YS, Choi 447

MS, Song SY. 2010. Identification of Helicobacter pylori in Gallstone, Bile, and Other 448

Hepatobiliary Tissues of Patients with Cholecystitis. Gut Liver 4:60-67. 449

10. Boonyanugomol W, Chomvarin C, Sripa B, Bhudhisawasdi V, Khuntikeo N, 450

Hahnvajanawong C, Chamsuwan A. 2012. Helicobacter pylori in Thai patients with 451

cholangiocarcinoma and its association with biliary inflammation and proliferation. HPB 452

(Oxford) 14:177-184. 453

11. Deenonpoe R, Chomvarin C, Pairojkul C, Chamgramol Y, Loukas A, Brindley PJ, 454

Sripa B. 2015. The carcinogenic liver fluke Opisthorchis viverrini is a reservoir for 455

species of Helicobacter. Asian Pac. J. Cancer Prev. 16:1751-1758. 456

12. Lee CW, Rao VP, Rogers AB, Ge Z, Erdman SE, Whary MT, Fox JG. 2007. Wild-457

type and interleukin-10-deficient regulatory T cells reduce effector T-cell-mediated 458

gastroduodenitis in Rag2-/- mice, but only wild-type regulatory T cells suppress 459

Helicobacter pylori gastritis. Infect. Immun. 75:2699-2707. 460

13. Prakobwong S, Pinlaor S, Yongvanit P, Sithithaworn P, Pairojkul C, Hiraku Y. 461

2009. Time profiles of the expression of metalloproteinases, tissue inhibitors of 462

metalloproteases, cytokines and collagens in hamsters infected with Opisthorchis 463

viverrini with special reference to peribiliary fibrosis and liver injury. Int. J. Parasitol. 464

39:825-835. 465

14. Kitajima T, Tajima Y, Matsuzaki S, Kuroki T, Fukuda K, Kanematsu T. 2003. 466

Acceleration of spontaneous biliary carcinogenesis in hamsters by bilioenterostomy. 467

Carcinogenesis 24:133-137. 468

15. Goodman ZD. 2007. Grading and staging systems for inflammation and fibrosis in 469

chronic liver diseases. J. Hepatol. 47:598-607. 470

on March 26, 2020 by guest

http://iai.asm.org/

Dow

nloaded from

http://iai.asm.org/

20

16. Itthitaetrakool U, Pinlaor P, Pinlaor S, Chomvarin C, Dangtakot R, Chaidee A, 471

Wilailuckana C, Sangka A, Lulitanond A, Yongvanit P. 2016. Chronic Opisthorchis 472

viverrini Infection Changes the Liver Microbiome and Promotes Helicobacter Growth. 473

PLoS One 11:e0165798. 474

17. Livak KJ, Schmittgen TD. 2001. Analysis of relative gene expression data using real-475

time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods 25:402-408. 476

18. Pinlaor S, Hiraku Y, Ma N, Yongvanit P, Semba R, Oikawa S, Murata M, Sripa B, 477

Sithithaworn P, Kawanishi S. 2004. Mechanism of NO-mediated oxidative and 478

nitrative DNA damage in hamsters infected with Opisthorchis viverrini: a model of 479

inflammation-mediated carcinogenesis. Nitric Oxide 11:175-183. 480

19. Prakobwong S, Yongvanit P, Hiraku Y, Pairojkul C, Sithithaworn P, Pinlaor P, 481

Pinlaor S. 2010. Involvement of MMP-9 in peribiliary fibrosis and 482

cholangiocarcinogenesis via Rac1-dependent DNA damage in a hamster model. Int. J. 483

Cancer 127:2576-2587. 484

20. Bhuiyan TR, Islam MM, Uddin T, Chowdhury MI, Janzon A, Adamsson J, Lundin 485

SB, Qadri F, Lundgren A. 2014. Th1 and Th17 responses to Helicobacter pylori in 486

Bangladeshi infants, children and adults. PLoS One 9:e93943. 487

21. Sripa B, Mairiang E, Thinkhamrop B, Laha T, Kaewkes S, Sithithaworn P, 488

Tessana S, Loukas A, Brindley PJ, Bethony JM. 2009. Advanced periductal fibrosis 489

from infection with the carcinogenic human liver fluke Opisthorchis viverrini correlates 490

with elevated levels of interleukin-6. Hepatology 50:1273-1281. 491

22. Piao JY, Lee HG, Kim SJ, Kim DH, Han HJ, Ngo HK, Park SA, Woo JH, Lee JS, 492

Na HK, Cha YN, Surh YJ. 2016. Helicobacter pylori Activates IL-6-STAT3 Signaling 493

in Human Gastric Cancer Cells: Potential Roles for Reactive Oxygen Species. 494

Helicobacter 21:405-416. 495

on March 26, 2020 by guest

http://iai.asm.org/

Dow

nloaded from

http://iai.asm.org/

21

23. Seki E, De Minicis S, Osterreicher CH, Kluwe J, Osawa Y, Brenner DA, Schwabe 496

RF. 2007. TLR4 enhances TGF-β signaling and hepatic fibrosis. Nat. Med. 13:1324-497

1332. 498

24. Goo MJ, Ki MR, Lee HR, Yang HJ, Yuan DW, Hong IH, Park JK, Hong KS, Han 499

JY, Hwang OK, Kim DH, Do SH, Cohn RD, Jeong KS. 2009. Helicobacter pylori 500

promotes hepatic fibrosis in the animal model. Lab. Invest. 89:1291-1303. 501

25. Sakr SA, Badrah GA, Sheir RA. 2013. Histological and histochemical alterations in 502

liver of chronic hepatitis C patients with Helicobacter pylori infection. Biomed 503

Pharmacother. 67:367-374. 504

26. Fox JG, Shen Z, Muthupalani S, Rogers AR, Kirchain SM, Dewhirst FE. 2009. 505

Chronic hepatitis, hepatic dysplasia, fibrosis, and biliary hyperplasia in hamsters 506

naturally infected with a novel Helicobacter classified in the H. bilis cluster. J. Clin. 507

Microbiol. 47:3673-3681. 508

27. Patterson MM, Schrenzel MD, Feng Y, Xu S, Dewhirst FE, Paster BJ, Thibodeau 509

SA, Versalovic J, Fox JG. 2000. Helicobacter aurati sp. nov., a urease-positive 510

Helicobacter species cultured from gastrointestinal tissues of Syrian hamsters. J. Clin. 511

Microbiol. 38:3722-3728. 512

28. Simmons JH, Riley LK, Besch-Williford CL, Franklin CL. 2000. Helicobacter 513

mesocricetorum sp. nov., A novel Helicobacter isolated from the feces of Syrian 514

hamsters. J. Clin. Microbiol. 38:1811-1817. 515

29. Zenner L. 1999. Pathology, diagnosis and epidemiology of the rodent Helicobacter 516

infection. Comp. Immunol. Microbiol. Infect. Dis. 22:41-61. 517

30. Woods SE, Ek C, Shen Z, Feng Y, Ge Z, Muthupalani S, Whary MT, Fox JG. 2016. 518

Male Syrian Hamsters Experimentally Infected with Helicobacter spp. of the H. bilis 519

on March 26, 2020 by guest

http://iai.asm.org/

Dow

nloaded from

http://iai.asm.org/

22

Cluster Develop MALT-Associated Gastrointestinal Lymphomas. Helicobacter 21:201-520

217. 521

31. Matsukura N, Yokomuro S, Yamada S, Tajiri T, Sundo T, Hadama T, Kamiya S, 522

Naito Z, Fox JG. 2002. Association between Helicobacter bilis in bile and biliary tract 523

malignancies: H. bilis in bile from Japanese and Thai patients with benign and malignant 524

diseases in the biliary tract. Jpn. J. Cancer Res. 93:842-847. 525

32. Huang Y, Tian XF, Fan XG, Fu CY, Zhu C. 2009. The pathological effect of 526

Helicobacter pylori infection on liver tissues in mice. Clin. Microbiol. Infect. 15:843-527

849. 528

33. Huang Y, Fan XG, Tang ZS, Liu L, Tian XF, Li N. 2006. Detection of Helicobacter 529

pylori DNA in peripheral blood from patients with peptic ulcer or gastritis. APMIS 530

114:851-856. 531

34. Kimura Y, Takada T, Kawarada Y, Nimura Y, Hirata K, Sekimoto M, Yoshida M, 532

Mayumi T, Wada K, Miura F, Yasuda H, Yamashita Y, Nagino M, Hirota M, 533

Tanaka A, Tsuyuguchi T, Strasberg SM, Gadacz TR. 2007. Definitions, 534

pathophysiology, and epidemiology of acute cholangitis and cholecystitis: Tokyo 535

Guidelines. J. Hepatobiliary Pancreat. Surg. 14:15-26. 536

35. Shukla HS, Tewari M. 2012. Discovery of Helicobacter pylori in gallbladder. Indian J. 537

Gastroenterol. 31:55-56. 538

36. Boonyanugomol W, Chomvarin C, Sripa B, Chau-In S, Pugkhem A, Namwat W, 539

Wongboot W, Khampoosa B. 2012. Molecular analysis of Helicobacter pylori virulent-540

associated genes in hepatobiliary patients. HPB (Oxford) 14:754-763. 541

37. van Doorn LJ, Figueiredo C, Sanna R, Plaisier A, Schneeberger P, de Boer W, 542

Quint W. 1998. Clinical relevance of the cagA, vacA, and iceA status of Helicobacter 543

pylori. Gastroenterol. 115:58-66. 544

on March 26, 2020 by guest

http://iai.asm.org/

Dow

nloaded from

http://iai.asm.org/

23

545

FIGURES AND LEGENDS 546

FIG. 1. Survival rate of animals in the H. pylori-infected (HP) group, O. viverrini-infected 547

(OV) group and in the group co-infected with O. viverrini and H. pylori (OV+HP), compared 548

to normal hamsters. 549

550

FIG. 2. Representative images of immunohistochemistry using antibody against H. pylori 551

demonstrating the bacterium in gastric and liver tissues. No colonization of H. pylori in 552

gastric (a, e) and in liver tissues (b, f) was found in control hamsters (Normal) or in O. 553

viverrini-infected hamsters (OV). Colonization of H. pylori was observed in a gastric pit (c 554

and d) and in the liver tissues (g, h) of H. pylori-infected hamsters (HP) and in H. pylori plus 555

O. viverrini-infected hamsters (OV+HP). Arrows indicate positive signal. Scale bar, 10 μm. 556

557

FIG. 3. Representative images of hepatobiliary abnormalities in H&E-stained sections. Panel 558

(a), normal liver and hepatocytes; (b), liver tissue after H. pylori infection; (c), (e), (g), liver 559

tissues of O. viverrini-infected hamsters. Panels (c) and (e) show inflammatory cell 560

infiltration around the bile duct with and without O. viverrini inside. Panel (g) shows 561

inflammatory cell infiltration in liver tissues. Panels (d), (f), (h), liver tissues of O. viverrini 562

plus H. pylori-infected hamsters; panel (d) shows inflammatory cell infiltration around the 563

bile duct within which is an adult O. viverrini. Panel (f) shows massive inflammatory cell 564

infiltration and bile duct hyperplasia in an O. viverrini plus H. pylori-infected hamster. Panel 565

(h) shows liver abscess formation. Scale bar 100 µm. 566

567

FIG. 4. Representative images of fibrosis in liver tissue visualized using picrosirius red 568

staining (A) and expression of α-SMA protein in liver tissues (B) and its abundance relative 569

on March 26, 2020 by guest

http://iai.asm.org/

Dow

nloaded from

http://iai.asm.org/

24

to β-tubulin (C). Twenty six samples were run in two gels at the same time. Pooled sample 570

was included in both gels. Each group of experiment was separated into different image. 571

Western blot image of OV group was obtained from two different gels as indicated by thin 572

line (B, the third set of images-between OV3 and OV4). *P

25

TABLE 1. The prevalence of H. pylori in gastric, liver and gallbladder samples, as detected 582

by PCR and immunohistochemistry. 583

584

585

586

587

588

589

590

591

592

593

594

595

596

597

598

ND = Not determined 599

600

Group Specimen H. pylori

positive by

PCR

H. pylori

positive by

IHC

Total H.

pylori

positive

Normal

(n = 5)

Stomach 20%(1/5) 0%(0/5) 20%(1/5)

Liver 0%(0/5) 0%(0/5) 0%(0/5)

Gallbladder 0%(0/5) ND 0%(0/5)

HP

(n = 5)

Stomach 40%(2/5) 20%(1/5) 40%(2/5)

Liver 40%(2/5) 20%(1/5) 40%(2/5)

Gallbladder 0%(0/5) ND 0%(0/5)

OV

(n = 8)

Stomach 50%(4/8) 0%(0/8) 50%(4/8)

Liver 25%(2/8) 0%(0/8) 25%(2/8)

Gallbladder 12.5%(1/8) ND 12.5%(1/8)

OV+HP

(n = 8)

Stomach 62.5%(5/8) 62.5%(5/8) 75%(6/8)

Liver 50%(4/8) 25%(2/8) 62.5%(5/8)

Gallbladder 12.5%(1/8) ND 12.5%(1/8)

on March 26, 2020 by guest

http://iai.asm.org/

Dow

nloaded from

http://iai.asm.org/

26

TABLE 2. Effects of co-infection with H. pylori and O. viverrini on fibrosis grade, 601

cholangitis grade, and serum biochemical factors in experimental animals. 602

603

604

605

Experimental

group

Fibrosis

grade

(Mean±SD)

Cholangitis

grade

(Mean±SD)

ALT (U/L)

(Mean±SD)

AST (U/L)

(Mean±SD)

ALP (U/L)

(Mean±SD)

Normal 0.17

±0.19

0.00

±0.00

41.60

±2.07

47.20

±4.32

55.00

±16.54

HP 1.07

±0.36*

0.20

±0.44

52.40

±39.16

60.80

±28.93

54.40

±11.65

OV 2.79

±0.43*,†

2.18

±0.26*

57.63

±17.32

59.75

±12.22

58.75

±3.88

OV+HP 3.29

±0.60*,†

2.56

±0.50*,†

74.13

±46.08

68.75

±17.96

55.63

±18.63

on March 26, 2020 by guest

http://iai.asm.org/

Dow

nloaded from

http://iai.asm.org/

27

606

607

on March 26, 2020 by guest

http://iai.asm.org/

Dow

nloaded from

http://iai.asm.org/

on March 26, 2020 by guest

http://iai.asm.org/

Dow

nloaded from

http://iai.asm.org/

on March 26, 2020 by guest

http://iai.asm.org/

Dow

nloaded from

http://iai.asm.org/

on March 26, 2020 by guest

http://iai.asm.org/

Dow

nloaded from

http://iai.asm.org/

on March 26, 2020 by guest

http://iai.asm.org/

Dow

nloaded from

http://iai.asm.org/

on March 26, 2020 by guest

http://iai.asm.org/

Dow

nloaded from

http://iai.asm.org/