Building with light2015.igem.org/files/poster/TU_Darmstadt.pdf · 2015. 10. 8. · yjhG yagG yqhD...

Click here to load reader

  • date post

    22-Jan-2021
  • Category

    Documents

  • view

    0
  • download

    0

Embed Size (px)

Transcript of Building with light2015.igem.org/files/poster/TU_Darmstadt.pdf · 2015. 10. 8. · yjhG yagG yqhD...

  • TU Darmstadt 2015Building with light

    Metabolic Engineering

    CadA

    Itaconic acid

    GlycolaldhydxylC

    xylB

    Ethylene glycol

    Xylonic acid 2-dehydro-3-deoxy-D-pentonate

    yjhGyagG

    yqhD

    TCA

    cis-Aconitat

    xylA

    Xylose

    PPP Glycolysis

    Glucose Xylitol

    GRE3

    XylosexylE

    in vivo

    XynA

    Silica-Tag

    GBD

    SH3

    PDZ

    RuXyn1

    aes

    in vitro

    Chemistry

    Policy & Practices Mechanical Part

    Xylitol

    Itaconic acidPolyethyleneglycol

    +

    Ethylene glycol Ethylene glycol

    Pre-polymer

    Monomer bricks

    BiosafetyRNA - Tech.

    Cell - Biology

    cis-repressing RNA (crRNA) blocks

    hokD-geneno trans-activating

    RNA (taRNA)

    Production of HokD

    Release into the environment

    Modeling

    Xylose

    OOH

    OH

    OH

    OH

    Mole

    cular - Biology

    Genetics

    Protein - Tech.

    Bio-Chemistry

    Polymer - Chemistry

    Scen

    ario

    Pane

    l Disc

    ussion

    Cons

    ulting

    Experts Materials Science

    Optics

    Engineering

    Xylan

    OO O

    O O

    O

    O

    OO

    OH

    -O2C

    H3COHO

    HO

    OH

    HO

    O

    H3C O

    n

    O

    OOH

    OHO

    O

    HO

    H3CO

    Prom ta

    crhokD

    RBS

    Constitutive transcription

    off

    Prom ta

    taRNA

    cr RBShokD

    crhokD

    RBS

    taRNA

    on

    hv

    ProblemApplication Scenario

    The iGEM Process

    Solution

    Other Teams

    Side Projects

    Experts

    Binary input layer

    Logistic output layer

    encoded base pair scorings

    score-matrix

    Results of the FACS-measurements GFP under the araC - promotor

    araC-pBAD-GFP + glucose

    araC-pBAD-GFP + arabinose

    Fluorescence (arbitary units)

    Cel

    l cou

    nts

    taRNA

    cr RBShokD

    HokD

    taRNA/ hokD mRNA

    taRNA binds the crRNA

    0.10

    0.05

    0.00

    -0.050 50 100 150 200

    - CadA

    + CadA

    Controlcis-Aconitat

    A260

    Reaction cycles

    Decarboxylic activity of cadA via pH indicator assay

    ����������������������������������������

    Polymer

    ����������������������������������������

    ����������������������������������������

    ����������������������������������������

    ����������������������������������������

    ����������������������������������������

    ����������������������������������������

    ����������������������������������������

    \\Thermo-8d83cadd\mat95 data\...\75503b 9/16/2015 17:17:36 Probe I 1 iGEM-TeamRT: 0.00 - 8.22

    0.0 0.5 1.0 1.5 2.0 2.5 3.0 3.54.0

    4.5 5.0 5.5 6.0 6.5 7.0 7.5 8.0Time (min)

    10

    20

    30

    40

    50

    60

    70

    80

    90

    100

    Re 

    ati 

    e  b

     nda

    nce

    6.30

    7.675.75 6.99

    5.213.700.96 2.601.37

      :8.88E7TI  M  75503b

    75503b  16-36 RT: 2.19-4.93   : 21   : 4.82E5T:   c EI      m   19.50-800.50 

    20 30 40 50 60 70 80 90 100 110 120 130 140 150m/ 

    0

    10

    20

    30

    40

    50

    60

    70

    80

    90

    100

    Re 

    ati 

    e  b

     nda

    nce

    90.0

    60.0

    41.0

    42.072.030.0

    36.044.031.0

    112.073.0 91.169.027.0 59.045.0 86.155.0 61.0

    75503a #9-28 RT: 1.36-3.96 AV: 20 NL: 1.56E6T: + c EI Full ms [19.50-800.50]

    20 30 40 50 60 70 80 90 100 110 120 130 140 150m/z

    0

    10

    20

    30

    40

    50

    60

    70

    80

    90

    100

    Rel

    ativ

    e Ab

    unda

    nce

    39.0

    41.0

    86.0

    112.045.0

    68.0

    58.0 85.0

    84.029.0

    57.038.0 69.0113.028.0 55.037.0 67.060.053.0 73.0 87.026.0 130.034.0

    GC MSItaconic acid molecule peak at 130u not detectable

    instable molecule, rapid decay biggest relative abundance at 41u

    washing with Tris-HCl

    Itaconic acid

    M+•

    Control

    gA

    AU

    U C GCGGCCGCUU C

    UAGA

    Gaac

    ua

    gaa

    uc

    acc

    uc

    uu

    gcu

    uu

    uggg

    u aa

    ga a

    ag

    ag

    ga g

    aUA C

    UA

    Gaugcg u a aag

    gaga

    aga

    ac u u u u ca c u

    g

    ga

    gu

    ug

    ucc

    ca

    au

    ucuu

    gu

    uga

    auuag

    auggugauguuaaugggc

    acaaauuuucugucaguggagagggugaaggugaugcaac

    au a c

    g ga a a

    a c uu a c

    c c uu

    aaa u u u

    au

    uu gc a c

    u a cug g a

    a a a c uac c u

    g u u cc a u g

    g c ca

    acac

    uu

    gu

    cac

    ua

    cu

    uu

    cg

    guu

    au

    gg

    ug

    uu

    caa

    ugc

    uu

    ugcga

    ga u a

    cccaga u

    caua u

    ga

    aa

    ca

    gca

    u ga

    cu u

    uuucaa

    gagugccaug c

    ccgaaggu u

    auguacaggaaagaac u

    auauuuu

    ucaaa

    ga u

    gacg

    gga

    a c uac

    aa

    g a ca

    cgu

    gcug

    aag

    uc

    aa

    guu

    ug

    aa gg

    ug a

    ua

    cc c u

    ug u

    uaaua

    ga

    au

    cg

    agu

    u a a aag

    guau

    ug

    au

    uu

    ua

    aaga

    ag

    a u gg a

    aac

    au

    ucu

    u ggaca c

    aaauugg a

    auacaacu a u a a

    c ucacacaa

    u gu

    au a

    c au c a u g

    g ca g

    ac a a a c a a

    a agaau g g

    aa

    u c aa a g u u

    aacuuca a a a

    u u agacacaacau

    u g a ag a

    u g g a ag c g u u

    ca

    acuagcaga

    ccauuaucaacaaaau

    acucca

    au u

    gg c

    ga

    ug

    g c ccu

    gu

    c c uuu

    uaccag

    ac

    aac

    ca

    uua

    ccu

    gu

    ccaca

    caaucugccc

    uu u

    cga

    aagaucccaacgaaaagag

    agacc

    acau

    gg

    uc

    cu

    uc

    uugagu

    uu

    gu

    aaca

    gc

    u g cugggauua

    cacau

    ggc

    a u g gaugaacuauac

    aaauaa

    uaaUAC

    UA

    GUA

    GC

    GG

    CC

    GC

    UGC

    AG

    Computational Design of RNA-Riboswitches

    1D

    2D

    3D

    W (i, j) = min

    W (i+ 1, j)

    W (i, j − 1)V (i, j)

    mini