Brochure Le Genie Genetique

download Brochure Le Genie Genetique

of 52

  • date post

    10-Aug-2015
  • Category

    Documents

  • view

    32
  • download

    3

Embed Size (px)

Transcript of Brochure Le Genie Genetique

Le gnie gntiqueNotions de base, applications, discussion

PrfaceAvez-vous t malade ces derniers temps et avez-vous d prendre des mdicaments? Portez-vous des vtements en coton? Etes-vous parti(e) rcemment en voyage, par exemple en Amrique du Nord? Mangez-vous des produits base de mas ou de soja? Alors, vous avez probablement t en contact direct avec le gnie gntique. Nous avons en effet constamment affaire des produits et des applications du gnie gntique dans notre vie de tous les jours. Le gnie gntique est entr de multiples faons dans notre vie quotidienne et pourtant, nombre dentre nous ne savent pas vritablement de quoi il sagit. Le gnie gntique sest impos comme un instrument de recherche incontournable au cours des trente dernires annes. Grce un travail intensif, les chercheurs sont parvenus dcrypter le gnome humain. Ils sefforcent maintenant de comprendre les interactions des gnes au sein de nos cellules. Ds lors, des questions fascinantes se posent: comment les gnes commandent-ils le dveloppement dun tre vivant? Comment des processus dfaillants aboutissent-ils des maladies et comment est-il possible de les prvenir? Lanalyse de ces interrelations complexes seffectue aujourdhui par la mise en rseau de nombreuses disciplines: biologie, mdecine, physique, chimie, mathmatiques et informatique. Les dveloppements survenus dans la recherche et les applications nouvelles qui en rsultent amnent se poser des questions thiques et juridiques. Il appartient conjointement la socit et au lgislateur dexaminer les possibilits du gnie gntique et de rpondre aux questions en suspens. Consciente du fait quil est possible de prvenir par des lois efcaces les abus en la matire, la Suisse mne dans ce domaine une recherche de pointe et introduit des mthodes de gnie gntique tant en mdecine que dans la production de biens de consommation courante. Quant la prsente brochure, elle a connu une volution parallle celle du gnie gntique et au dbat quil suscite. Cette troisime dition attrayante aborde le thme du gnie gntique en lillustrant par des photographies et des exemples vcus, tout en traitant avec exigence les aspects scientiques grce des infographies et des textes explicatifs dtaills. Des passages traitant de lthique et de la scurit incitent la rexion et la discussion. Lobjectif de cette brochure reste inchang: expliquer le gnie gntique an que lectrices et lecteurs puissent se faire par eux-mmes une ide de ses applications et des arguments quil suscite, de ses possibilits et de ses limites. Dcouvrez par vous-mme ce quest le gnie gntique. Nous vous souhaitons une agrable lecture.

Table des matiresNotions de base 1 Recherche 1.1 1.2 1.3 1.4 1.5 1.6 1.7 Comment fonctionne le gnie gntique Gnomique Transcriptomique Protomique Recherche sur les cellules souches Animaux transgniques Nanobiotechnologie Page 2/3 4 /5 6/7 8/9 10 / 11 12 12 / 13 14 / 15 15 16 / 17 18 / 19 19 20 / 21 22 / 23 23 24 25 26 / 27 27 28 / 29 30 31 32 / 33 34 35 36 37 38 / 39 39 40 40 41 41 42 / 43 43 43 44 45 46 48

2 Mdecine 2.1 2.2 2.3 2.4 2.5 2.6 2.7 2.8 2.9 Mdicaments Recherche chez ltre humain Thrapie gnique Vaccins et anticorps Mthodes de dpistage Hrdit Tests gntiques Mdecine de procration Mdecine lgale

3 Agriculture et alimentation 3.1 3.2 3.3 3.4 3.5 3.6 3.7 Obtentions vgtales Du laboratoire au plein champ Situation mondiale Denres alimentaires Un produit gntiquement modi pour la Suisse Autorisation, dclaration, valeurs seuils De nouveaux produits lhorizon

4 Biotechnologie blanche et protection de lenvironnement 4.1 4.2 4.3 4.4 4.5 Biocatalyse Biosynthse Bio-indicateurs Assainissement biologique Biocarburants

5 Lgislation 5.1 5.2 5.3 5.4 La Constitution fdrale suisse Accords internationaux Lois dans le domaine humain Lois dans le domaine non humain

6 Glossaire

Prof. Peter Gehr, prsident

Kurt Bodenmller, directeur

Notions de base

Tout tre vivant est compos de cellules Bactrie, tournesol, chat ou tre humain tous les tres vivants sont constitus de cellules. Les unicellulaires les bactries, par exemple sont forms dune seule cellule. En revanche, les plantes, les animaux et les tres humains sont pluricellulaires. Le corps humain est constitu dorganes, tels que le cur et le foie. Et les organes se composent eux-mmes de tissus qui se composent leur tour de cellules. En dehors de leur teneur en eau, les cellules sont constitues pour lessentiel de protines. Il existe de trs nombreuses formes de protines, lesquelles remplissent tant dans les cellules que dans lorganisme entier de nombreuses fonctions vitales.

Cellule vgtale

Cellule musculaire

Cellule nerveuse

Bactrie

G T 7. Synthse des protines la demande Les gnes sont copis dans chaque cellule la demande et commandent la production des protines dont la cellule a besoin pour crotre et remplir ses fonctions dans lorganisme. Chaque cellule comporte lensemble du gnome. Dans une cellule de la peau, dautres gnes sont copis que ceux qui sont copis dans une cellule de lintestin. Les cellules nerveuses, par exemple, copient un gne synthtisant une protine qui est envoye comme molcule de signalisation partir de la cellule. Et, dans les cellules musculaires conformment au plan de construction gntique sont synthtises des protines motrices, Traduction permettant aux cellules de rester en mouvement.

A

C

G U

A

C

A

C

T

G

Protine 6. Du gne la protine Les cellules possdent la facult de transcrire des gnes en une substance proche de lADN, appele ARN. Ce processus porte le nom de transcription et se produit au sein du noyau cellulaire. Les copies de gnes transcrites ARN partir de lARN migrent du noyau cellulaire dans le corps cellulaire. La plupart des molcules dARN y remplissent une fonction de plan directeur pour la construction des protines. Ce processus porte le nom de traduction.

2/3 1. Les gnes se situent dans le noyau cellulaire Une cellule individuelle est trop petite pour que lon puisse la voir lil nu. On ne peut lobserver quau microscope. Son aspect varie en outre selon la fonction quelle remplit. Une cellule nerveuse, dont la fonction spcique est de recevoir et de transmettre des signaux, est fortement ramie. Une cellule musculaire, en revanche, est allonge et a la facult de se rtracter. Toutes les cellules des tres pluricellulaires ont toutefois une chose en commun: elles possdent un noyau cellulaire au sein duquel se trouvent les gnes et ce la diffrence des bactries, qui nont pas de noyau cellulaire et dont les gnes forment une pelote au sein du corps cellulaire. 3. Lensemble des chromosomes constitue le gnome Pour des raisons de place, lADN est fortement enchevtr. Avant quune cellule se divise, la pelote se dmle. Il en rsulte des entits en forme de X, appeles chromosomes. Tous les tres vivants ne possdent pas le mme nombre de chromosomes dans leur noyau cellulaire. Un tre humain possde 46 chromosomes dans chaque cellule, un chat 38 et un chou-eur 18.

Corps cellulaire Gnome humain Noyau cellulaire

2. Les chromosomes se composent dADN Le noyau cellulaire contient le matriel gntique. Curieusement, le matriel gntique se compose Chromosome chez tous les tres vivants de la mme substance, lADN, abrviation dacide dsoxyribonuclique. On rencontre galement labrviation anglaise DNA. Le minuscule noyau cellulaire prsent dans chaque cellule humaine contient un lament dADN denviron deux mtres de long.

Gne ADN

4. Un gne est un fragment dADN LADN est une molcule en forme de lament, qui se compose de quatre constituants diffrents: les bases adnine, cytosine, guanine et thymine, dsignes en abrg par les initiales A, C, G et T. Un gne est un fragment de lament dADN. Un gne humain comporte entre 500 et plusieurs milliers de bases. Les bases forment donc un mot extrmement long. Si lon crit le code dun gne, cela donne par exemple ATGAAGTTTCAGCGTCCATGG, etc. Chacune de nos cellules compte environ 25 000 gnes.

Gne

Gne

G T Transcription T A A C

A T C

G A G T CT G A G A C T C

5. LADN est double brin On peut se reprsenter lADN comme une longue chelle enroule en spirale. Les chelons se composent de paires de bases. A et T se combinent toujours, ils peuvent saccrocher lun lautre et constituer un chelon, tout comme G et C. Cet appariement des bases est fondamental. Dune part, pour la cohsion des deux brins dADN, dautre part, pour la copie de lADN premire tape dans le processus de la synthse des protines.

1 Recherche

4/5

Aiguillonne par la curiosit humaine, la recherche fondamentale entend comprendre comment fonctionnent les tres vivants et la nature. Il sagit dlaborer des thories scientiques, de les passer au crible de lexprimentation et den dbattre au sein de la communaut scientique. Ce que cela signie en matire de gnie gntique, neuf lves lont vcu dans la pratique. Ils ont visit des laboratoires de recherche luniversit et ont discut avec des chercheuses et des chercheurs. Au laboratoire, les recherches portent principalement sur des donnes de base. Lun des chercheurs lexplique plus prcisment: Ici, nous analysons des protines qui jouent un rle dans la coagulation sanguine. Une colire frissonne lorsquil ouvre la porte de lincubateur elle ne supporte pas la vue du sang. Le chercheur en retire des rcipients plats qui contiennent une gele claire. Lorsquil ouvre les couvercles, on distingue des points sur la gele. Est-ce que ce sont les protines?, lance Marcel la cantonade. Pas directement. Les protines sont trop petites pour que lon puisse les voir lil nu. Les points correspondent des cellules de levure. Nous avons incorpor des gnes des protines de la coagulation sanguine dans ces cellules. Bien entendu, souligne le biologiste, la levure ne possde pas de circulation sanguine. Mais il est fascinant de voir co