Application of mesenchymal stem cells to enhance non-union bone

fracture healing

Mohammad Mousaei Ghasroldasht,1,2 Maryam M. Matin,1,2,3 Hossein Kazemi Mehrjerdi,4

Hojjat Naderi-Meshkin,2 Ali Moradi,5 Masoud Rajabioun,4 Faeze Alipour,4 Samaneh Ghasemi,4

Mohammad Zare,6 Mahdi Mirahmadi,2 Hamid Reza Bidkhori,2 Ahmad Reza Bahrami1,2,3

1Department of Biology, Faculty of Science, Ferdowsi University of Mashhad, Mashhad, Iran2Stem Cell and Regenerative Medicine Research Group, Iranian Academic Center for Education, Culture and Research (ACECR),

Khorasan Razavi Branch, Mashhad, Iran3Novel Diagnostics and Therapeutics Research Group, Institute of Biotechnology, Ferdowsi University of Mashhad, Mashhad, Iran4Department of Clinical Sciences, Faculty of Veterinary Medicine, Ferdowsi University of Mashhad, Mashhad, Iran5Department of Orthopedic Surgery, Orthopedic Research Center, Ghaem Hospital, Mashhad University of Medical Sciences,

Mashhad, Iran6Clinical Pathology, Social Security Organization, Mashhad, Iran

Received 18 December 2017; revised 27 February 2018; accepted 12 April 2018

Published online 12 November 2018 in Wiley Online Library (wileyonlinelibrary.com). DOI: 10.1002/jbm.a.36441

Abstract: ECM components include a number of osteoinduc-

tive and osteoconductive factors, which are involved in bone

fracture healing. In this study, a combination of adipose

derived mesenchymal stem cells (Ad-MSCs), cancellous bone

graft (CBG), and chitosan hydrogel (CHI) was applied to the

non-union bone fracture and healing effects were evaluated

for the first time. After creation of animal models with non-

union fracture in rats, they were randomly classified into seven

groups. Radiography at 0, 2, 4, and 8 weeks after surgery, indi-

cated the positive effects of Ad-MSCs + CBG + CHI and Ad-

MSCs + CBG in treatment of bone fractures as early as 2 weeks

after the surgery. These data were confirmed with both biome-

chanical and histological studies. Gene expression analyses of

Vegf and Bmp2 showed a positive effect of Ad-MSCs on

vascularization and osteogenic differentiation in all groups

receiving Ad-MSCs, as shown by real-time PCR. Immunofluo-

rescence analysis and RT-PCR results indicated existence of

human Ad-MSCs in the fractured region 8 weeks post-surgery.

In conclusion, we suggest that application of Ad-MSCs, CBG,

and CHI, could be a suitable combination for osteoinduction

and osteoconduction to improve non-union bone fracture heal-

ing. Further investigations are required to determine the exact

mechanisms involved in this process before moving to clinical

studies. © 2018 Wiley Periodicals, Inc. J. Biomed. Mater. Res. Part A:

107A: 301–311, 2019.

Key Words: mesenchymal stem cells, cancellous bone graft,

chitosan injectable hydrogel, non-union bone fracture

How to cite this article: Mousaei Ghasroldasht M, Matin MM, Kazemi Mehrjerdi H, Naderi-Meshkin H, Moradi A, Rajabioun M,

Alipour F, Ghasemi S, Zare M, Mirahmadi M, Bidkhori HR, Bahrami AR. 2019. Application of mesenchymal stem cells to enhance

non-union bone fracture healing. J. Biomed. Mater. Res. Part A 2019:107A:301–311.

INTRODUCTION

Bone diseases include some abnormalities in which patientshave defects in bone or bone-related metabolic reactions.Non-union fracture is one of the most common bone diseases.Despite advances in the science of orthopedics, annually over5–10% of bone fractures are not able to union (non-unionfractures).1 Bone remodeling requires three essential factorsincluding cells, osteoinduction and osteoconduction agents.Osteoinduction is the process that affects formation of newbone. Osteoconduction refers to a scaffold on which the cellscan grow and form the new bone. Thus, providing all neces-sary factors can be effective in non-union fracture healing.2

It has been shown that mesenchymal stem cells (MSCs)are suitable sources of cells for repair and tissue engineer-ing.3 Stem cell therapy and tissue engineering are among lat-est approaches for repair of damaged tissues.4 Manydifferent kinds of stem cells have been used in differentstudies up to now. Several characteristics of MSCs includinglack of immunogenicity in allografts, paracrine effects, lowtumorigenicity potential and developmental plasticity makethem a suitable candidate for clinical applications.5–7 MSCshave been isolated from various parts of the body, includingskin,8 blood,9 umbilical cord blood,10 dentine,11 pancreas,12

adipose tissue,13 liver,14 brain, heart, lung and kidney.15

Correspondence to: A. R. Bahrami; e-mail: ar-bahrami@um.ac.irContract grant sponsor: Ferdowsi University of Mashhad; contract grant number: 3/29446Contract grant sponsor: Iranian Academic Center for Education, Culture and Research (ACECR)

© 2018 WILEY PERIODICALS, INC. 301

Various studies have demonstrated that adipose tissue is abetter source of MSCs due to its large number of cells andeasier isolation.16 The first clinical trial using cultured MSCswas carried out in 1995 on patients with hematologic malig-nancies.17 Since then, MSCs have been used for treatment ofdifferent diseases such as heart and cardiovascular,18

autoimmune,19 neurodegenerative,20 liver,21 diabetes,22 can-cer23 and bone disease.7 Analyzing the literature, we showedthat the most frequent usage of MSCs in clinical trial studieswas on osteo-diseases.24

The traditional approach to manage the non-unions is toinduce bone formation using cancellous bone grafts at frac-ture sites.25 Studies have shown that allografts do not havethe proper bone formation induction characteristics26 andon the other hand, autograft transplantations may have com-plications such as donor site fracture, nerve injury, andinfections.27–30 Cancellous bone grafts have been used asboth osteoinduction and osteoconduction agents.31 Anyattempt to promote the efficacy of allograft bone induction,can make the allografts a better choice compared toautografts.

Recently, many kinds of natural and synthetic polymersare being used as scaffolds for bone tissue engineering.32,33

Chitosan is considered as a very attractive scaffold for bio-medical and industrial applications34,35 since it is biodegrad-able, biocompatible and non-toxic.36,37 Chitosan is thealkaline deacetylated product of chitin, derived from theshells of crustaceans, such as shrimp and crab.34 Combina-tion of chitosan (CH) with glycerol phosphate (GP) andhydroxyethyl cellulose (HEC), as a crosslinking agent, resultsin conversion of chitosan from sol to gel state at 37�C38 andtherefore, it is considered as a more appropriate candidatefor clinical studies.39

In this work, we aimed to study the interactions of differ-ent potential materials supposed to promote healing of un-united fractures; therefore, we investigated the impact ofcancellous bone graft with/without adipose derived MSCsand CH-GP-HEC hydrogel on animal model of non-union frac-ture with 8 weeks follow-up.

MATERIALS AND METHODS

Preparation of human adipose derived MSCsAd-MSCs were isolated from adipose tissue following thepreviously described methods with some changes.13,40–42

Human adipose aspirated wastes were obtained from threewomen using liposuction surgery after obtaining informedconsents at Razavi Hospital (Mashhad, Iran) in accordancewith the regulations of the hospital’s ethical committee. Theadipose tissue was washed two times with equal volume ofphosphate buffered saline (PBS; Gibco, Australia), anddigested with collagenase type I (Gibco, Australia). Collage-nase neutralization was carried out using Dulbecco’s Modi-fied Eagle’s Medium-Low Glucose (DMEM-LG; Gibco,Australia) containing 10% fetal bovine serum (FBS; Gibco,Australia). Subsequently, the mononuclear cells were washedwith DMEM-LG (800 g for 10 min), and plated in tissue cul-ture flasks containing DMEM/10%FBS (the cells from 15 mLlipoaspirate were transferred into one T75 flask). Non-

adherent cells and adipose tissue debris were removed after20 h and after that medium exchange was performed twice aweek. The stem cell characteristics of Ad-MSCs were con-firmed by differentiation assays and immunophenotyping asdescribed before.42

Surgical procedureTwo-month-old male Lewis rats weighing 250–300 g wereincluded in this study. All procedures, performed on rats,were approved by the animal ethics committee for labora-tory animals at Ferdowsi University of Mashhad. All animalswere anesthetized by intramuscular injection of a combina-tion of xylazine (10 mg/kg) and ketamine (50 mg/kg). Aftershaving the area, femoral fracture was first induced by usinghigh speed electromotor and non-union fracture was theninduced by cauterizing the two millimeters of periosteumaround the fracture sites as described by Kokubu et al.43

After inducing non-union, the fracture was aligned by pass-ing one intramedullary pin (1.25 mm diameter) in eachbone. In the next step and before closing the layers, the frac-ture site was filled by one or combination of cancellous boneallograft, CH-GP-HEC hydrogel or MSCs based on the groupclassifications. Finally, the fascia and skin were sutured by5/0 USP polyglactin 910 suture. 100,000 IU/kg intermuscu-lar penicillin were administrated before and 2 days afteroperation in all cases. The operated rats were divided intodifferent groups: Ad-MSCs (human adipose derived mesen-chymal stem cell, n = 12), CBG (cancellous bone graft,n = 12), CHI (chitosan hydrogel, n = 12), Ad-MSCs + CBG(human adipose derived mesenchymal stem cells implantedon cancellous bone graft, n = 12), Ad-MSCs + CHI (humanadipose derived mesenchymal stem cells injected in chitosanhydrogel, n = 12), Ad-MSCs + CBG + CHI (combination ofAd-MSCs, CBG and CHI, n = 12) and control (non-union frac-ture with FBS injection, n = 12).

Preparation of injectable chitosan hydrogelInjectable CH-GP-HEC hydrogel was prepared as describedin our previous study.38 Briefly, CH and GP solutions wereprepared by dissolving 150 mg of chitosan powder(Polysciences, Warrington, England, MW 1.5 × 104, degree ofdeacetylation 84%) and 324 mg β-GP disodium salt (tissueculture grade, Sigma Aldrich, Germany) in 8.5 mL 80 mMhydrochloric acid (Sigma Aldrich, Taufkirchen, Germany) and1 mL deionized water, respectively. The resulting solutionswere stirred on ice. HEC solution was prepared by dissolving250 mg HEC powder (Sigma Aldrich, Germany) in10 mL DMEM.

CELL IMPLANTATION

Immediately after creation of non-union bone fracture modelin rats, the cell pellet of Ad-MSCs (passage 3) was homoge-neously resuspended in 80 μL of CH-GP and then mixed with20 μL HEC (final concentration 1.5 × 107 cell/mL), andinjected into the fractured region. In the other two groups,1.5 × 106 Ad-MSCs (passage 3) were resuspended in 100 μL

302 MOUSAEI GHASROLDASHT ET AL. MSCS IN BONE FRACTURE HEALING

FBS and then injected into the surgery place directly or incancellous bone graft placed in the fractured site.

Radiological examinationRadiography was performed for each animal under anesthe-sia immediately, 2, 4, and 8 weeks after operation. Lateraland craniocaudal radiographs were taken by using mammog-raphy films while the X-ray beam was centered on the frac-ture location. Exposure factors and animal positioning wereconsidered similar in all rats.

To evaluate the healing process, each radiograph wasblindly scored by four specialists based on the protocoldeveloped by Cook et al.44 The mean score of cases in eachgroup was measured for further analysis.

Histological assessmentThree rats in each group were euthanized 8 weeks post-sur-gery by overdose of ketamine and xylazine, and harvestedfracture segments were washed with PBS. After fixation in4% paraformaldehyde for 2 days, the intramedullary pinswere removed from the bones and samples were decalcifiedin nitric acid (for 24h), and then dehydrated, embedded inparaffin and finally longitudinal sections of 5 μm thicknesswere prepared from fracture regions using a microtome(Leitz, Austria).

Slides were randomly selected and stained with hema-toxylin and eosin (H&E) (Novocastra, UK) for histologicalexaminations. The fracture healing was determined usingHuo et al. grading scale.45

Biomechanical testingBoth femoral bones (operated and intact femur) were har-vested from each rat 8 weeks after surgery and the diameter

of different parts around the middle of the bones were mea-sured using a caliper. Bone thickness for each animal wascalculated by comparing the measurement of the fracturedbone and the intact bone for each rat. Intramedullary pinswere removed from the fracture sites, before biomechanicaltesting. The specimens were placed on the three-pointmachine (Zwick/Z250, Load Cell 2KN, Germany) and forcewas applied at the speed of 2 mm/min until the bones werebroken. The ultimate load was computed as maximum loadon the operated bone rather than the intact bone. Extrinsicstiffness was calculated by ratio of ultimate load to move-ment for each operated rat compared to intact bone in thesame rat.

RNA isolation, RT-PCR, and real-time PCRBone and its associated callus, surrounding fracture region,were removed from each rat 8 weeks after surgery. TotalRNA was extracted using Tripure reagent (Roche, Germany)according to the manufacturer’s protocol. Integrity and con-centration of RNA was determined using Nanodrop (BioTek,Germany). 1 μg of total RNA sample was reverse transcribedto cDNA using M-MuLV reverse transcriptase (Fermentas,Germany). RT-PCR conditions were as follows: 94�C for5 min followed by 40 cycles of 30 s at 94�C, 30 s at 60�C,30 s at 72�C, and a final extension at 72�C for 10 min(SensQuest, Germany). Primer specifications are shown inTable I. Primers were designed specifically for one speciesand they had ability to attach to all variants. PCR productswere then analyzed by electrophoresis on a 1.5% agarose(Invitrogen) gel.

We employed real-time PCR method to determinewhether Bmp2 and Vegf, two informative genes related tobone fracture healing, are expressed in fracture region and

TABLE I. List of Primer Sequences Used for Real-Time PCR and RT-PCR

Gene Accession number Sequence Length of product Species

Bmp2 NM_017178.1 F GGGACCCGCTGTCTTCTA 156 bp Rat

R CAGCCTCAACTCAAACTCG

Vegfa NM_001287114.1 F GGACTTGAGTTGGGAGGAG 117 bp Rat

NM_001287113.1

NM_001287111.1

NM_001110334.2

NM_001110333.2 R GCAGGCAAACAGACTTCG

NM_031836.3

NM_001110336.1

NM_001110335.1

Tbp NM_001004198.1 F GACACTCAGTTACAGGTGGCA 135 bp Rat

R GCCCAAGTAGCAGCACAGAG

TBP NM_001172085.1 F TTGTGAGAAGATGGATGTTG 151 bp Human

NM_003194.4 R AGATAGCAGCACGGTATG

BGLAP NM_199173.4 F CTCACACTCCTCGCCCTATTG 134 bp Human

R CTCTTCACTACCTCGCTGCC

RUNX2 NM_001278478.1 F CTCACTGCCTCTCACTTG 163 bp Human

NM_001015051.3

NM_001024630.3 R ATGTATTAACCTGGATTCTGG

COL1A1 NM_000088.3 F GACGAAGACATCCCACCAAT 124 bp Human

R CGTCATCGCACAACACCTT

SPARK NM_003118.3 F CTGTATTCTGGTGTTCTCTTCTAC 170 bp Human

R AATGACTGAATGAGCCAATGC

JOURNAL OF BIOMEDICAL MATERIALS RESEARCH PART A | FEB 2019 VOL 107A, ISSUE 2 303

ORIGINAL ARTICLE

surrounding tissue. Expression of Bone morphogenetic pro-tein 2 (Bmp2) is important for fracture healing because it isthe responsible gene for bone reconstruction and MSCs dif-ferentiation toward osteoblast. We further examined theexpression of Vascular endothelial growth factor (Vegf ),widely recognized as a master regulator of angiogenesis. Inthis study we analyzed the expression of VEGF-A variant.

The real-time RT-PCR was carried out using the Bio-RadCFX-95 system (USA). Each reaction mixture contained 2 μLcDNA, 10 μL SYBR Green (GeNet Bio-Korea) and 1 μL of10 pmol/mL mixture of forward and reverse primers(Table I) in final reaction volume of 20 μL. The reactionswere performed in duplicate. The expression level of the tar-get genes was normalized to TBP (TATA-binding proteingene) and relative quantification of gene expression was cal-culated based on log 2−ΔΔCt formula.46

IMMUNOFLUORESCENCE

In order to verify the presence and maintenance of humancells (Ad-MSCs) at the site of injury, the fractured sites wereremoved from animals in all seven groups (8 weeks aftersurgery). After fixation with paraformaldehyde, the sampleswere decalcified in 14% EDTA (Ethylenediaminetetraaceticacid, Thomas scientific) solution for three weeks at 4ºC (theEDTA solution was changed once a week). Five micrometersections were then prepared from paraffin embedded sam-ples as described in histological assessment section. Forimmunofluorescence staining, sections were permeabilizedwith 0.1% triton X-100 for 30 min, and endogenous peroxi-dase was blocked with 3% hydrogen peroxide for 15 min.Non-specific antibody binding was reduced with PBS con-taining 5% FBS for 40 min before addition of primary anti-body. Then, sections were incubated for 2 h in mouse anti-human nuclei monoclonal antibody (1:100, Millipore Corpo-ration, MA), followed by incubation for 2 h with 1:600 dilu-tion of Alexa Fluor 594-streptavidin (Invitrogen, CA).Subsequently, hematoxylin was applied for 3–5 min fornuclear staining. Immunofluorescent cells were imaged on afluorescent microscope (Olympus, japan).

STATISTICAL ANALYSIS

The SPSS statistical program was used to analyze the data.All values were expressed as mean ± SD. Significance of thedata was considered statistically different at p < 0.05, usingthe one-way ANOVA.

RESULTS

Radiological assessment of non-union bone fracturehealingThe radiological analysis performed immediately after surgery,confirmed fracture accuracy. Immediate postoperative radio-graphs revealed that union healing grades were zero in allgroups based on Cook’s grading protocol [Fig. 1(a)]. Radiologi-cal analyses were performed for each group at all experimen-tal stages, and the results in all groups showed increasedmineralization during the 8-week period. The results of thesecond week, revealed that callus formation started at the

fractured sites, as shown in Figure 1(b), however healinggrades were higher in the Ad-MSCs + CBG + CHI, CBG and Ad-MSCs + CBG groups than that in control group (1.08 ± 0.22,1.07 ± 0.28, and 1.04 ± 0.17, respectively). At 4 weeks afterfracture, improvements in union grading were observed inseveral groups including Ad-MSCs + CBG, and CBG, whichshowed significantly higher scores as compared to controlgroup (2.47 ± 0.7 and 2.19 ± 0.31, respectively) (p < 0.05).However, slight increases in union grades were also observedin other groups in comparison with the control [Fig. 1(b)].Based on descriptive results, the volume of the callusincreased significantly at the end of the eight week period,especially in the Ad-MSCs + CBG group (3.93 ± 0.38) com-pared to the control group (p < 0.0001). Similarly, the gradesof fracture healing were significantly greater in the Ad-MSCs +CBG + CHI (3.3 ± 0.78), CBG (2.9 ± 0.48) and Ad-MSCs(2.8 ± 0.68) groups than control, as demonstrated in Figure 1(b) (p < 0.05).

In serial radiographic examinations, no sign of boneresorption, infections and inflammatory reactions wereobserved. Cancellous bone grafts remained in all radiographsin the CBG, Ad-MSCs + CBG and Ad-MSCs + CBG + CHIgroups and no reduced density of cancellous bone graftswas noticed subjectively.

Histological studyEight weeks post-surgery, histological studies were per-formed in different groups using hematoxylin-eosin in orderto evaluate the improvement of bone fracture healing andmineralization. The results of histological analyses are dem-onstrated in Figure 2. Histological assessment suggest thatall Ad-MSC-loaded groups were filled with hard callus andhad superior results compared to the groups without Ad-MSCs (control, CBG and CHI). It appears that Ad-MSCs pro-moted bone formation in the non-united femoral rat fracture,although Ad-MSCs + CBG + CHI showed the highest scoresin comparison with other groups.

Investigation of bone strength by biomechanical testingTo further investigate the strength of the newly healedbones, three-point test was carried out for all groups on bothoperated and intact bones. Since differences in callus diame-ter around the fracture site could affect their resistance, thediameters of native and fractured bones were measured inseveral places. The results of the thickness measurementsare shown in Figure 3. The maximum size reduction wasobserved in Ad-MSCs + CBG, however, no significantdecrease was observed in other treated groups.

The results of the three-point test in all seven groupswere compared in two perspectives: ultimate load andextrinsic stiffness, as shown in Figure 4. In all examined rats,the fractured bones supported a lower load than intactbones. Relative final load was increased in all groups com-pared to the control group, however greatest differenceswere observed in the Ad-MSCs + CBG and Ad-MSCs + CBG +CHI groups. Extrinsic stiffness analysis represented signifi-cant increases in both Ad-MSCs + CBG and Ad-MSCs + CBG +CHI compared to the control group (p < 0.0001). No

304 MOUSAEI GHASROLDASHT ET AL. MSCS IN BONE FRACTURE HEALING

significant differences were observed between other groupscompared to the controls.

Real-time PCR analysis of Bmp2 and vegfThe results of quantitative analysis of Bmp2 and Vegf (Vegf-Agene) expression are shown in Figure 5. We observed notice-able increase in Bmp2 gene expression in all groups as com-pared with the control group. The results representedsignificant over expression in Ad-MSCs + CBG + CHI, Ad-MSCs + CBG, Ad-MSCs and Ad-MSCs + CHI groups with3.32 ± 0.23, 3.17 ± 0.35, 2.1 ± 0.22 and 1.41 ± 0.21 foldsincrease, respectively, at the end of eight weeks. Ad-MSC-loaded groups showed highest expression rate for Bmp2gene among all. CHI group with 0.77 ± 0.11 fold increase incomparison to the control showed the lowest increaseamong all groups.

Similarly, the expression of Vegf was significantlyincreased in Ad-MSCs + CBG + CHI, Ad-MSCs + CBG, Ad-MSCs and Ad-MSCs + CHI groups compared to the control(4.1 ± 0.5, 3.58 ± 0.5, 2.34 ± 0.35 and 1.98 ± 0.2, respec-tively). Ad-MSCs + CBG + CHI and CHI groups had the high-est and the lowest Vegf gene expression among other groupsin comparison with the control, respectively.

Tracking of the injected cells by immunofluorescenceanalysisTo determine the contribution of the human implanted cellsin the animal models, eight weeks post-surgery, immunofluo-rescence analyses were performed using anti-human nuclearantibody. The presence of injected human Ad-MSCs in thefractured site and surrounding tissues was evaluated atweek 8 after surgery (Fig. 6). Human fluorescent cells weredetected in all Ad-MSC-loaded groups (Ad-MSCs, Ad-MSCs +

FIGURE 1. Radiological analysis of bone fracture healing. Radiological analysis was performed 0, 2, 4, and 8 weeks after surgery. (a) Representative

of bone fracture healing in different time points for 8-weeks. Fracture region is evident in all examination times for all operated groups. (b) Two

weeks after surgery, all CBG-loaded groups indicated higher scores than control. In 4th week, the result was similar to that of second week with

slight differences, and Ad-MSCs + CBG was significantly better than control group. At 8 weeks post-surgery, the callus became dense at the fracture

site, especially in CBG loaded groups and Ad-MSC groups. Different lower-case letters above each bar indicate a significant difference among differ-

ent groups, at p < 0.05. Ad-MSC: Mesenchymal stem cell derived adipose tissue. CBG: Cancellous bone graft, CHI: CH+GP+HEC.

JOURNAL OF BIOMEDICAL MATERIALS RESEARCH PART A | FEB 2019 VOL 107A, ISSUE 2 305

ORIGINAL ARTICLE

CBG, Ad-MSCs + CHI, and Ad-MSCs + CBG + CHI), and nopositive fluorescent signals were observed in the CBG, CHIand control groups.

In order to confirm the presence of human cells in thefractured region, the expression of specific genes involved inosteogenic differentiation was evaluated by PCR usinghuman specific primers. Expression of these genes in Ad-MSCs, Ad-MSCs + CBG, Ad-MSCs + CHI, and Ad-MSCs +CBG + CHI groups proved positive; however, no detectableexpression was observed in the CBG, CHI and controlgroups (Fig. 7).

DISCUSSION

Previous studies have indicated positive effects of MSCs,osteoinduction and osteoconduction factors in bone remo-deling. In this study, animal models with non-union fracturewere made by surgery and the effects of various factorswere investigated in bone repair. Our results demonstratedthat Ad-MSCs constituted the main factor in treatment ofbone fractures. Moreover, providing cancellous bone allo-grafts and chitosan as osteoinductive and osteoconductiveagents respectively, improved the effectiveness of bonehealing.

It has been proposed that required factors for bone for-mation constitute a triangle which is composed of cells,osteoinductive and osteoconductive factors.31 A contributionof various cell types including blood cells, osteoblasts, osteo-clasts, chondroblasts, chondrocytes, fibroblasts, endothelialcells and undifferentiated cells like mesenchymal stem cellsis necessary for bone fracture healing.2 Multi differentiationpotential of MSCs has made them more critical in this regardas they have the ability to differentiate to various cell typesrequired for bone formation.47 Studies have shown thatmigration, proliferation and differentiation of MSCs at thesite of injury are required for bone repair. For example,Taguchi et al. showed that migration of green fluorescentprotein (GFP)-labeled bone marrow cells to the site of injuryresulted to callus formation and bone fracture healing inmice.48 The positive effects of MSCs in the treatment of bonefractures have been demonstrated in several studies.49–53

Similarly, our results demonstrated that MSCs with or with-out cancellous bone graft, chitosan or cancellous bone graft/chitosan were effective in accelerating non-union bone frac-ture healing in rats.

MSCs are localized in different parts of the body, how-ever periosteum is known as a key source of MSCs whichplay an important role in bone regeneration.54–57 During thehealing process, only the periosteum around the injured areaparticipates in the bone reconstruction.58 So cauterizing theperiosteum surrounding the bone for producing an animalmodel of non-union bone fracture, causes the cells in thisarea not to have a role in bone restoration.59,60 However,stem cells residing in other tissues can migrate to the injurysite in response to specific signals.4 Therefore, local injectionof exogenous stem cells into the site of injury can play animportant role in reconstruction. Immunofluorescence andRT-PCR studies confirmed the presence and contribution ofthe human stem cells in the surgery region. This implies thatthe transplanted Ad-MSCs could survive in vivo for at least

FIGURE 2. Histological grades for fracture healing 8 weeks after surgery.

Histological analysis with H&E indicates better grades in all treated

groups compared with untreated group (control). Different lower-case

letters above each bar indicate a significant difference among different

groups, at p < 0.05. Ad-MSC: Mesenchymal stem cell derived adipose

tissue. CBG: Cancellous bone graft, CHI: CH+GP+HEC.

FIGURE 3. Diameter measurements of callus that formed around the

fractured regions 8 weeks post-surgery. CHI shows higher diameter,

compared to other groups. Ad-MSCs + CBG presented significant dif-

ference compared to the control. Different lower-case letters above

each bar indicate a significant difference among different groups, at

p < 0.05. Ad-MSC: Mesenchymal stem cell derived adipose tissue. CBG:

Cancellous bone graft, CHI: CH+GP+HEC.

306 MOUSAEI GHASROLDASHT ET AL. MSCS IN BONE FRACTURE HEALING

eight weeks and remained at the injected site, while some ofthem might have migrated to other areas.

Several studies have indicated positive effects of MSCtransplantation in bone healing without integration of thecells into the injured tissue.61–63 This phenomenon is proba-bly due to the paracrine effects of MSCs on vascularizationand osteogenesis which are critical factors for bone repair.62

In this regard, Kinnaird et al. indicated that MSCs causedrelease of several stem/progenitor cells recruitment chemo-kines like VEGF61 which is involved in vascularization. Gran-ero-Molto et al. proved that after injection of MSCs in an

injured area, they secrete specific factors which are effectivein survival of host cells in the area. Thus, mesenchymal stemcells have a key role in restoration of injured areas despitelittle or no differentiation.4

Osteoinduction is the second side of the essential triangleduring fracture healing. Osteoinduction is a process in whicha signal would affect the formation of new bone. Cancellousbone grafts are osteoinductive agents31 which can stimulatebone formation. Frost et al. indicated that pre-existing osteo-blasts are only part of the required cells for bone remodelingand other cells required for this process would be derived

FIGURE 4. Three point test for investigation on strength of newly formed bone. Ultimate load was computed as the ratio of maximum load on the

operated bone to intact bone [(N(operated bone)/N(intact bone))*100]. All groups are significantly able to withstand higher load than the control. Extrinsic

stiffness was calculated as the ratio of ultimate load to movement for each operated rat compared to the intact bone in the same rat {[(N(operated bone)/

mm (operated bone))/(N(intact bone)/mm (intact bone))]*100}. Different lower-case letters above each bar indicate a significant difference among different

groups, at p < 0.05. Ad-MSC: Mesenchymal stem cell derived adipose tissue. CBG: Cancellous bone graft, CHI: CH+GP+HEC.

FIGURE 5. Gene expression analysis of Vegf and Bmp2. Real-time PCR was performed on all operated rats, 8 weeks post-surgery. Expression

level of the target genes was normalized to TBP (TATA-binding protein gene) and relative quantification of gene expression was calculated using

log 2-ΔΔCt formula. Bmp2 and Vegf expression increased in the Ad-MSCs + CBG + CHI and Ad-MSCs + CBG groups when compared with the other

groups. Non-synonymous lower-case letters above each bar indicate a significant difference among different groups, at p < 0.05. Ad-MSC: Mesen-

chymal stem cell derived adipose tissue. CBG: Cancellous bone graft, CHI: CH+GP+HEC

JOURNAL OF BIOMEDICAL MATERIALS RESEARCH PART A | FEB 2019 VOL 107A, ISSUE 2 307

ORIGINAL ARTICLE

FIGURE 6. Tracking the human injected cells at the fracture site of the experimental animals. Each column represents samples as follows: stained

samples (left) immunofluorescence using anti-human nuclear antibody (middle) and merged micrographs (right). Intact bone of rat was used as a

negative control for immunofluorescence staining. The results indicated that Ad-MSCs survived and remained in the injected site, 8 weeks after

injection. Ad-MSC: Mesenchymal stem cell derived adipose tissue. CBG: Cancellous bone graft, CHI: CH+GP+HEC.

308 MOUSAEI GHASROLDASHT ET AL. MSCS IN BONE FRACTURE HEALING

from undifferentiated cells.64,65 Therefore osteoinduction isnecessary as a regulatory agent during the process. Theresults of our study confirmed that cancellous bone graftwas a good candidate for fracture healing. Furthermore,combination of cancellous bone grafts and MSCs, with orwithout chitosan, was more efficient in treatment of non-union bone fractures. At the first sight on ultimate load anal-ysis, it seems that increase in the load of the CBG trans-planted groups is due to the presence of cancellous bonegrafts, which can tolerate more load. However, comparingthese data with the results obtained by extrinsic stiffness, itmight be concluded that this difference is due to new bonereconstruction.

BMPs play a key role in osteoinduction process andBMP2 as an osteogenic growth factor is more important inbone regeneration.66 Baltzer et al. indicated that applicationof stem cells, transformed by BMP2 could increase bone frac-ture healing.67 BMPs are activated in response to trauma orbone regeneration and are known as the main bone remodel-ing inducers.68 During normal fracture healing, BMP2 isinvolved in proliferation and differentiation of MSCs intoosteoblasts.69 BMP2 also has a secondary role in bone remo-deling including stimulating osteoblast production of VEGFand attracting endothelial cells.70,71 The results of the currentstudy show a higher BMP2 gene expression happens in Ad-MSC-loaded groups compared to the other groups (Fig. 6).

Osteoconduction refers to the scaffold on which the newbone is formed.25 Cancellous bone graft is considered as

both osteoconduction and osteoinduction agent, since newlyforming bone can grow on its surface. Hence, bone healingwould be accelerated using just Ad-MSCs and cancellousbone grafts as they seem to provide all the three essentialfactors (stem cells, osteoinduction and osteoconductionagents) required for bone remodeling, as shown in thisstudy. Chitosan scaffold is also an osteoconduction agent.Spin-Neto et al. used chitosan with different molecularweights in critical size defects made in rat’s calvaria and sug-gested that chitosan was not significantly effective in pro-moting the formation of new bone.71 In this study, the use ofchitosan alone did not have a significant effect on boneremodeling, although it had positive effects when used incombination with Ad-MSCs. Oreffo suggested that using acombination of MSCs and scaffold for treatment of bonedefects, reduced the risk of morbidity.5

On the other hand, Spin-Neto et al. indicated that chito-san resulted in increased inflammation when used for treat-ment of critical size defects in rats.71 In measuring thediameter of the fractures in this study, we noticed that thediameter of the healing bones in chitosan group were morethan other groups, which might be due to increased inflam-mation in these samples. In another study, it was shown thatMSC transplantation into the stabilized tibia fracture mousemodels, had anti-inflammatory effects by decreasing theexpression of inflammatory factors such as interleukins.72

Similarly, in our study, the fracture diameters were reducedin the Ad-MSC-loaded groups. Comparison of data betweenCHI and CHI + Ad-MSC groups showed that stem cells mayhave reduced chitosan-inflammatory effects.

The major disadvantage of hydrogel is its low mechanicalstrength and therefore, it is not appropriate for use as high-load implantation. Furthermore, most hydrogels are not suit-able for specific cell types such as osteoblasts that need tobind on a surface with specific binding sites.36 For this rea-son, in this study we used chitosan hydrogel in combinationwith cancellous bone grafts as a solid scaffold.

Bone is a highly vascularized tissue, and vascularizationplays a key role in bone growth and remodeling.73,74 Studieshave shown that Vegf is necessary for bone repair as anangiogenic factor.75,76 It can induce proliferation and migra-tion of endothelial cells and is also involved in osteoblastdifferentiation.77–79 Our gene expression analysis revealedoverexpression of Vegf in Ad-MSC–injected groups, whichmay explain better healing effects observed in thesesamples.

CONCLUSION

The improved healing of bone fractures observed in thisstudy might be due to higher expression of the BMP2, VEGFand other growth factors by Ad-MSCs, and the followingeffects of these factors on engaging host osteoprogenitorcells in healing process. Moreover, existence of osteoinduc-tion (cancellous bone grafts) and osteoconduction (chitosan)agents for inducing differentiation of MSCs and generation ofosteoblasts in one hand and preparation of sufficient surfacefor cell attachment and growth on the other hand seem to be

FIGURE 7. Expression analysis of the osteogenic related genes. Human

cells express osteogenic related genes 8 weeks post-surgery. Electro-

phoresis graphs indicates positive expression of these genes in all Ad-

MSC injected groups. (a) Ad-MSCs + CBG + CHI, (b) Ad-MSCs + CBG,

(c) Ad-MSCs + CHI, (d), Ad-MSCs, (e) CBG, (f ) CHI, (g) Control.

JOURNAL OF BIOMEDICAL MATERIALS RESEARCH PART A | FEB 2019 VOL 107A, ISSUE 2 309

ORIGINAL ARTICLE

important factors involved in this process. Thus, providingall essential factors including stem cells with differentiationpotential and paracrine effects, cancellous bone grafts due totheir mechanical strength and osteoinduction property, andinjectable chitosan hydrogel might be responsible for accel-erating non-union bone fracture healing. The latter seems tobe responsible to increase cell trapping in the site of injuryand to provide better natural 3D structure in large pores ofcancellous bone grafts.

REFERENCES1. Fayaz HC, Giannoudis PV, Vrahas MS, Smith RM, Moran C,

Pape HC, Krettek C, Jupiter JB. The role of stem cells in fracture

healing and nonunion. Int Orthop 2011;35:1587–1597.

2. Sfeir C, Ho L, Doll BA, Azari K, Hollinger JO. Fracture repair. In:

Lieberman JR, Friedlander GE, editors. Bone Regeneration and

Repair: Biology and Clinical Applications. Totowa: Humana Press

Inc.; 2005.

3. Kumar S, Wan C, Ramaswamy G, Clemens TL, Ponnazhagan S.

Mesenchymal stem cells expressing osteogenic and angiogenic fac-

tors synergistically enhance bone formation in a mouse model of

segmental bone defect. Mol Ther 2010;18:1026–1034.

4. Granero-Molto F, Weis JA, Longobardi L, Spagnoli A. Role of mes-

enchymal stem cells in regenerative medicine: Application to bone

and cartilage repair. Expert Opin Biol Ther 2008;8:255–268.

5. Oreffo ROC, Cooper C, Mason C, Clements M. Mesenchymal stem

cells: Lineage, plasticity, and skeletal therapeutic potential. Stem

Cell Rev 2005;1:169–178.

6. Jaishankar A, Barthelery M, Freeman WM, Salli U, Ritty TM,

Vrana KE. Human embryonic and mesenchymal stem cells express

different nuclear proteomes. Stem Cells Dev 2009;18:793–802.

7. Undale AH, Westendorf JJ, Yaszemski MJ, Khosla S. Mesenchymal

stem cells for bone repair and metabolic bone diseases. Mayo Clin

Proc 2009;84:893–902.

8. Toma JG, McKenzie IA, Bagli D, Miller FD. Isolation and characteri-

zation of multipotent skin-derived precursors from human skin.

Stem Cells 2005;23:727–737.

9. Campagnoli C, Roberts IA, Kumar S, Bennett PR, Bellantuono I,

Fisk NM. Identification of mesenchymal stem/progenitor cells in

human first-trimester fetal blood, liver, and bone marrow. Blood

2001;98:2396–2402.

10. Rosada C, Justesen J, Melsvik D, Ebbesen P, Kassem M. The

human umbilical cord blood: a potential source for osteoblast pro-

genitor cells. Calcif Tissue Int 2003;72:135–142.

11. Perry BC, Zhou D, Wu X, Yang FC, Byers MA, Chu TM, Hockema JJ,

Woods EJ, Goebel WS. Collection, cryopreservation, and character-

ization of human dental pulp-derived mesenchymal stem cells for

banking and clinical use. Tissue Eng Part C Methods 2008;14:

149–156.

12. Seeberger KL, Eshpeter A, Korbutt GS. Isolation and culture of

human multipotent stromal cells from the pancreas. Methods Mol

Biol 2011;698:123–140.

13. Zuk P, Zhu M, Ashjian P. Human adipose tissue is a source of multi-

potent stem cells. Mol Biol Cell 2002;13:4279–4295.

14. Wenceslau CV, Miglino MA, Martins DS, Ambrósio CE, Lizier NF,

Pignatari GC, Kerkis I. Mesenchymal progenitor cells from canine

fetal tissues: yolk sac, liver, and bone marrow. Tissue Eng Part A

2011;17:2165–2176.

15. Salem HK, Thiemermann C. Mesenchymal stromal cells: current

understanding and clinical status. Stem Cells 2010;28:585–596.

16. Yoo KH, Jang IK, Lee MW, Kim HE, Yang MS, Eom Y, Lee JE,

Kim YJ, Yang SK, Jung HL, Sung KW, Kim CW, Koo HH. Comparison

of immunomodulatory properties of mesenchymal stem cells

derived from adult human tissues. Cell Immunol 2009;259:150–156.

17. Lazarus HM, Haynesworth SE, Gerson SL, Rosenthal NS, Caplan AI.

Ex vivo expansion and subsequent infusion of human bone mar-

row-derived stromal progenitor cells (mesenchymal progenitor

cells): implications for therapeutic use. Bone Marrow Transplant

1995;16:557–564.

18. Lopes JP, Fiarresga A, Silva Cunha P, Feliciano J, Cruz Ferreira R.

Mesenchymal stem cell therapy in heart disease. Rev Port Cardiol

2013;32:43–47.

19. Figueroa FE, Carrión F, Villanueva S, Khoury M. Mesenchymal stem

cell treatment for autoimmune diseases: A critical review. Biol Res

2012;45:269–277.

20. Joyce N, Annett G, Wirthlin L, Olson S, Bauer G, Nolta JA. Mesen-

chymal stem cells for the treatment of neurodegenerative disease.

Regen Med 2010;5:933–946.

21. Meier RPH, Müller YD, Morel P, Gonelle-Gispert C, Bühler LH.

Transplantation of mesenchymal stem cells for the treatment of

liver diseases, is there enough evidence? Stem Cell Res 2013;11:

1348–1364.

22. Pileggi A. Mesenchymal stem cells for the treatment of diabetes.

Diabetes 2012;61:1355–1356.

23. Shah K. Mesenchymal stem cells engineered for cancer therapy.

Adv Drug Deliv Rev 2012;64:739–748.

24. Ghasroldasht MM, Irfan-Maqsood M, Matin MM, Bidkhori HR,

Naderi-Meshkin H, Moradi A, Bahrami AR. Mesenchymal stem cell

based therapy for osteo-diseases. Cell Biol Int 2014;38:1081–1085.

25. Marino JT, Ziran BH. Use of solid and cancellous autologous bone

graft for fractures and nonunions. Orthop Clin North Am 2010;41:

15–26. table of contents.

26. Flierl MA, Smith WR, Mauffrey C, Irgit K, Williams AE, Ross E,

Peacher G, Hak DJ, Stahel PF. Outcomes and complication rates of dif-

ferent bone grafting modalities in long bone fracture nonunions: a ret-

rospective cohort study in 182 patients. J Orthop Surg Res 2013;8:33.

27. Hu RW, Bohlman HH. Fracture at the iliac bone graft harvest site

after fusion of the spine. Clin Orthop Relat Res 1994;309:208–213.

28. Arrington ED, Smith WJ, Chambers HG, Bucknell AL, Davino NA.

Complications of iliac crest bone graft harvesting. Clin Orthop Relat

Res 1996;329:300–309.

29. Goulet JA, Senunas LE, DeSilva GL, Greenfield ML. Autogenous

iliac crest bone graft. Complications and functional assessment.

Clin Orthop Relat Res 1997;(339:):76–81.

30. Al-Sayyad MJ, Abdulmajeed TM. Fracture of the anterior iliac crest

following autogenous bone grafting. Saudi Med J 2006;27:254–258.

31. Albrektsson T, Johansson C. Osteoinduction, osteoconduction and

osseointegration. Eur Spine J 2001;10: S96–S101.

32. Madihally SV, Matthew HW. Porous chitosan scaffolds for tissue

engineering. Biomaterials 1999;20:1133–1142.

33. Sanzherrera J, Garciaaznar J, Doblare M. On scaffold designing for

bone regeneration: A computational multiscale approach. Acta Bio-

mater 2009;5:219–229.

34. Rao SB, Sharma CP. Use of chitosan as a biomaterial: studies on its

safety and hemostatic potential. J BiomedMater Res 1997;34:21–28.

35. Croisier F, Jérôme C. Chitosan-based biomaterials for tissue engi-

neering. Eur Polym J 2013;49:780–792.

36. Fedorovich NE, Alblas J, de Wijn JR, Hennink WE, Verbout AJ,

Dhert WJA. Hydrogels as extracellular matrices for skeletal tissue

engineering: state-of-the-art and novel application in organ printing.

Tissue Eng 2007;13:1905–1925.

37. Spiller KL, Maher SA, Lowman AM. Hydrogels for the repair of

articular cartilage defects. Tissue Eng Part B Rev 2011;17:281–299.

38. Naderi-Meshkin H, Andreas K, Matin MM, Sittinger M, Bidkhori HR,

Ahmadiankia N, Bahrami AR, Ringe J. Chitosan-based injectable

hydrogel as a promising in situ forming scaffold for cartilage tissue

engineering. Cell Biol Int 2014;38:72–84.

39. Amini AA, Nair LS. Injectable hydrogels for bone and cartilage

repair. Biomed Mater 2012;7:024105.

40. Zuk PA, Zhu M, Mizuno H, Huang J, Futrell JW, Katz AJ,

Benhaim P, Lorenz HP, Hedrick MH. Multilineage cells from human

adipose tissue: implications for cell-based therapies. Tissue. Eng

2001;7:211–228.

41. Yoon E, Dhar S, Chun DE, Gharibjanian NA, Evans GRD. In vivo

osteogenic potential of human adipose-derived stem cells/poly lac-

tide-co-glycolic acid constructs for bone regeneration in a rat criti-

cal-sized calvarial defect model. Tissue Eng 2007;13:619–627.

42. Ahmadian Kia N, Bahrami AR, Ebrahimi M, Matin MM, Neshati Z,

Almohaddesin MR, Aghdami N, Bidkhori HR. Comparative analysis

of chemokine receptor’s expression in mesenchymal stem cells

derived from human bone marrow and adipose tissue. J Mol Neu-

rosci 2011;44:178–185.

310 MOUSAEI GHASROLDASHT ET AL. MSCS IN BONE FRACTURE HEALING

43. Kokubu T, Hak DJ, Hazelwood SJ, Reddi AH. Development of an

atrophic nonunion model and comparison to a closed healing frac-

ture in rat femur. J Orthop Res 2003;21:503–510.

44. Cook SD, Salkeld SL, Patron LP. Bone defect healing with an osteo-

genic protein-1 device combined with carboxymethylcellulose. J

Biomed Mater Res B Appl Biomater 2005;75:137–145.

45. Huo MH, Troiano NW, Pelker RR, Gundberg CM, Friedlaender GE.

The influence of ibuprofen on fracture repair: biomechanical, bio-

chemical, histologic, and histomorphometric parameters in rats. J

Orthop Res 1991;9:383–390.

46. Bustin SA. Absolute quantification of mRNA using real-time reverse

transcription polymerase chain reaction assays. J Mol Endocrinol

2000;25:169–193.

47. Knight MN, Hankenson KD. Mesenchymal Stem Cells in Bone

Regeneration. Adv Wound Care 2013;2:306–316.

48. Taguchi K, Ogawa R, Migita M, Hanawa H, Ito H, Orimo H. The role

of bone marrow-derived cells in bone fracture repair in a green

fluorescent protein chimeric mouse model. Biochem Biophys Res

Commun 2005;331:31–36.

49. Bruder SP, Kraus KH, Goldberg VM, Kadiyala S. The effect of

implants loaded with autologous mesenchymal stem cells on the

healing of canine segmental bone defects. J Bone Joint Surg Am

1998;80:985–996.

50. Kon E, Muraglia A, Corsi A, Bianco P, Marcacci M, Martin I, Boyde A,

Ruspantini I, Chistolini P, Rocca M, Giardino R, Cancedda R,

Quarto R. Autologous bone marrow stromal cells loaded onto

porous hydroxyapatite ceramic accelerate bone repair in critical-size

defects of sheep long bones. J Biomed Mater Res 2000;49:328–337.

51. Petite H, Viateau V, Bensaïd W, Meunier A, de Pollak C,

Bourguignon M, Oudina K, Sedel L, Guillemin G. Tissue-engineered

bone regeneration. Nat Biotechnol 2000;18:959–963.

52. Arinzeh TL, Peter SJ, Archambault MP, van den Bos C, Gordon S,

Kraus K, Smith A, Kadiyala S. Allogeneic mesenchymal stem cells

regenerate bone in a critical-sized canine segmental defect. J Bone

Joint Surg Am 2003;85: 1927–1935.

53. Viateau V, Guillemin G, Bousson V, Oudina K, Hannouche D,

Sedel L, Logeart-Avramoglou D, Petite H. Long-bone critical-size

defects treated with tissue-engineered grafts: A study on sheep. J

Orthop Res 2007;25:741–749.

54. Zhang X, Xie C, Lin ASP, Ito H, Awad H, Lieberman JR, Rubery PT,

Schwarz EM, O’Keefe RJ, Guldberg RE. Periosteal progenitor cell fate

in segmental cortical bone graft transplantations: implications for

functional tissue engineering. J Bone Miner Res 2005;20:2124–2137.

55. Xie C, Ming X, Wang Q, Schwarz EM, Guldberg RE, O’Keefe RJ,

Zhang X. COX-2 from the injury milieu is critical for the initiation of

periosteal progenitor cell mediated bone healing. Bone 2008;43:

1075–1083.

56. Kawanami A, Matsushita T, Chan YY, Murakami S. Mice expressing

GFP and CreER in osteochondro progenitor cells in the periosteum.

Biochem Biophys Res Commun 2009;386:477–482.

57. Colnot C. Skeletal cell fate decisions within periosteum and bone

marrow during bone regeneration. J Bone Miner Res 2009;24:

274–282.

58. Colnot C. Cell sources for bone tissue engineering: insights from

basic science. Tissue Eng. Part B Rev 2011;17:449–457.

59. Utvåg SE, Grundnes O, Reikeraos O. Effects of periosteal stripping

on healing of segmental fractures in rats. J Orthop Trauma 1996;10:

279–284.

60. Ozaki A, Tsunoda M, Kinoshita S, Saura R. Role of fracture hema-

toma and periosteum during fracture healing in rats: Interaction of

fracture hematoma and the periosteum in the initial step of the

healing process. J Orthop Sci 2000;5:64–70.

61. Kinnaird T, Stabile E, Burnett MS, Shou M, Lee CW, Barr S,

Fuchs S, Epstein SE. Local delivery of marrow-derived stromal cells

augments collateral perfusion through paracrine mechanisms. Cir-

culation 2004;109:1543–1549.

62. Tang YL, Zhao Q, Qin X, Shen L, Cheng L, Ge J, Phillips MI. Para-

crine action enhances the effects of autologous mesenchymal stem

cell transplantation on vascular regeneration in rat model of myo-

cardial infarction. Ann Thorac Surg 2005;80:229–237.

63. Zhang M, Mal N, Kiedrowski M, Chacko M, Askari AT, Popovic ZB,

Koc ON, Penn MS. SDF-1 expression by mesenchymal stem cells

results in trophic support of cardiac myocytes after myocardial

infarction. FASEB J 2007;21:3197–3207.

64. Frost HM. The biology of fracture healing. An overview for clini-

cians. Part II. Clin Orthop Relat Res 1989;294–309.

65. Frost HM. The biology of fracture healing. An overview for clini-

cians. Part I. Clin Orthop Relat Res 1989;283–293.

66. Urist MR, Strates BS. Bone morphogenetic protein. J Dent Res

1971;50:1392–1406.

67. Baltzer AW, Lattermann C, Whalen JD, Wooley P, Weiss K,

Grimm M, Ghivizzani SC, Robbins PD, Evans CH. Genetic enhance-

ment of fracture repair: healing of an experimental segmental

defect by adenoviral transfer of the BMP-2 gene. Gene Ther 2000;7:

734–739.

68. Lind M. Growth factors: possible new clinical tools. A review. Acta

Orthop Scand 1996;67:407–417.

69. Tseng SS, Lee MA, Reddi AH. Nonunions and the potential of stem

cells in fracture-healing. J Bone Joint Surg Am 2008;90 Suppl 1:

92–98.

70. Deckers MML, van Bezooijen RL, van der Horst G, Hoogendam J,

van Der Bent C, Papapoulos SE, Löwik CW. Bone morphogenetic

proteins stimulate angiogenesis through osteoblast-derived vascu-

lar endothelial growth factor A. Endocrinology 2002;143:1545–1553.

71. Spin-Neto R, de Freitas RM, Pavone C, Cardoso MB, Campana-

Filho SP, Marcantonio RA, Marcantonio E. Jr. Histological evalua-

tion of chitosan-based biomaterials used for the correction of criti-

cal size defects in rat’s calvaria. J Biomed Mater Res A 2010;93:

107–114.

72. Granero-Moltó F, Weis JA, Miga MI, Landis B, Myers TJ, O’Rear L,

Longobardi L, Jansen ED, Mortlock DP, Spagnoli A. Regenerative

effects of transplanted mesenchymal stem cells in fracture healing.

Stem Cells 2009;27:1887–1898.

73. Ferrara N. Role of vascular endothelial growth factor in regulation

of physiological angiogenesis. Am J Physiol Cell Physiol 2001;280:

C1358–C1366.

74. Maes C, Carmeliet P, Moermans K, Stockmans I, Smets N, Collen D,

Bouillon R, Carmeliet G. Impaired angiogenesis and endochondral

bone formation in mice lacking the vascular endothelial growth fac-

tor isoforms VEGF164 and VEGF188. Mech Dev 2002;111:61–73.

75. Gerber HP, Vu TH, Ryan AM, Kowalski J, Werb Z, Ferrara N. VEGF

couples hypertrophic cartilage remodeling, ossification and angio-

genesis during endochondral bone formation. Nat Med 1999;5:

623–628.

76. Street J, Bao M, deGuzman L, Bunting S, Peale FV, Jr, Ferrara N,

Steinmetz H, Hoeffel J, Cleland JL, Daugherty A, van Bruggen N,

Redmond HP, Carano RA, Filvaroff EH. Vascular endothelial growth

factor stimulates bone repair by promoting angiogenesis and bone

turnover. Proc Natl Acad Sci USA 2002;99:9656–9661.

77. Midy V, Plouët J. Vasculotropin/vascular endothelial growth factor

induces differentiation in cultured osteoblasts. Biochem Biophys

Res Commun 1994;199:380–386.

78. Deckers MM, Karperien M, van der Bent C, Yamashita T,

Papapoulos SE, Löwik CW. Expression of vascular endothelial

growth factors and their receptors during osteoblast differentiation.

Endocrinology 2000;141:1667–1674.

79. Hsiong SX, Mooney DJ. Regeneration of vascularized bone. Period-

ontol 2000 2006;41:109–122.

JOURNAL OF BIOMEDICAL MATERIALS RESEARCH PART A | FEB 2019 VOL 107A, ISSUE 2 311

ORIGINAL ARTICLE