a

Aalborg Academy Journal of Medical Sciences

Volume 3 Issue 3; August 2020 Contents

SN Title Author (s) Pages 1 Coronavirus-2019 (COVID-

19): A Novel Pandemic Disease with Global Health Care Burden

Abdulghani Alsamarai

1-19

2 Association of Breast Cancer with EBV and CMV Infection: Histological Types and Risk Factors

Sheylan Salah Abdulla et al.

20-63

3 E-Health and Big Data Analyzing

Suhiar M. Zeki 64-69

4 Biotyping of Acinetobacter baumannii Iraqi Isolates

Nadira S. Mohamed et al

70-81

5 Seroprevalence of Helicobacter Pylori among Human in Erbil and Rania City, Kurdistan Region, Iraq

Sawsan M. Sorchee et al.

82-92

6 INSR and PLIN Polymorphism in Women with Poly Cystic Ovary Syndrome (PCOS) and Its Correlation with Insulin Resistance

Mustafa Abd-alkareem; Hadeel Abdulhadi Omear

93-110

7 Cough Variant Asthma: Case Report

Suzan Saraj Zainab Aljumaili

111-131

b

8 Non Chlorophyll Accessory Pigments in Cyanobacteria: Simultaneous Extraction, Seperation and Maximization

Mohammed Fadhil Hameed Hadad

132-135

9 Immunological and Molecular Study of IL-33 and ST2 Receptor in a Sample of Iraqi Patients with Breast Cancer

Zainab Jalil Abdulkareem

136-138

10 Assessment of the Psychomotor Domain: Proposal of Innovative Methods

Amina Hamed Alobaidi

139-158

11 SARS-CoV-2: Treatment and Therapeutic Approaches

Abdulghani Alsamarai et al.

159-190

12 Book Review Mohamed Almustafa

191-197

13 Letter to editor Nabeel Najib Fadhil

198-204

14 Instructions to authors Editor-in-Chief 205-212

c

ISSN:2522-7386

DOI: https://doi.org/10.32441/ijms

Aalborg Academy of Science Aalborg Academy of Science is registered in the Danish Business

Authority, in Accordance with the Danish Law Member of International Union of Arab Academics

Address: Silovej 8, 2. MF, DK-9900 Frederikshavn - CVR / SE No. 29 09 47 48

Website: www.aalborgaos.dk – E-Mail Address: Info@aalborgaos.dk

Tlf: 004 528 475 349 – 004 525 752 548

d

Published by Aalborg Academy of Sciences and International Union of Arab Academics

AAJMS [Formerly IJMS] 2020; August 3(3):1-2

Email: ms@aaosjournal.com; ijms.iuaa18@gmail.com

e

INFORMATION ABOUT THE MAIN EDITORS

Editorial Director: Alaa Hussein Bashir, MD, FRCS, Professor in Cosmetic and Plastic Surgery, United Kingdom and UAE.

Email: ala_bashir@hotmail.com; Phone number: 0044779644469 Editor_in_Chief: Abdulghani M. Ali, MD, MGUM, Ph D (UK),

Professor in Infectious Diseases and Medical Education, Iraq.

E mail: galsamarrai@yahoo.com; momoghsa@gmail.com; Abdulghani.mohamed@tu.ed.iq

Mobile: +9647701831295 Editor for Basic Medical Sciences: Nemah Hasony, MD, Ph D, Professor

of Pathology, Iraq. E mail: Nemahsalih@gmail.com Mobile: +9647800096786 Editor for Clinical Sciences: Abdul-Jabbar Abdulabas Alqureishi, MD,

M Sc, Consultant Epidemiologist, WHO Email: jabbar1946@yahoo.com Editor for Dentistry: Nada Jafar AlBasam, BDS, Ph D, Consultant

Dentist, Denmark. Editor for Pharmacy: Amina H. Ahmed, B Sc, M Sc, Ph D, Assistant Professor in Clinical Chemistry, Iraq. E mail: aminahamed2006@gmail.com Mobile: +9647702399175 Editor for Nursing: Jenan Akbar Shakoor, B Sc, Ph D, Assistant Professor in Nursing, Iraq. Email: jinanshukur@uokirkuk.edu.iq;

jinanshukur69@gmail.com Mobile: +9647714950008 Managing Editor: Radhi Alshaibani, MD, ABMS, Board Internal

Medicine. Email:radhifarhodx6@gmail.com Mobile: +9647801135298 Linguistic Editors: Omed Almuhandis, Ph D, UK, Assistant Professor in Chemistry,

Canada. E mail: Omeed27@gmail.com Mobile: +9647709244537

f

Hamdi H. Yousif, BA, Ph D, Professor of English Language, Iraq. E mail: hyousif@tu.ed.iq Mobile: +9647701715071 Ansam AlMaaroof, BA, Ph D, Assistant Professor of English Language,

Sudan. E mail: sbc.su@yahoo.com Mobile: +9647710648193 Biostatic Editor: Younis Saeed Albug, Ph D, Assistant Professor in

Biostatistics, Iraq. E mail: dryounisalbugg@gmail.com Mobile: +9647702011066 Technical Editor: Suhiar Mohammed Zeki, Ph D, Computer Sciences, Email: 110121@uotechnology.edu.iq Mobile: +9647823549971

g

Advisory Editorial Board Hikmat Shaarbaf, MD, MRCP, Professor Internal Medicine,

Jordan. Hisham M. Aldoori, MD, FRCS, Professor of General Surgery,

USA. Najem Uldean Alroznamji, MD, American Board Pediatrics,

Professor of Pediatrics Diseases, Iraq. Dawood Althamery, MD, American Board Pediatrics, Professor in

Pediatrics Diseases. Australia. Wagdi Talaat Yousif, MD, Ph D, Professor of Medical Education,

Egypt. Nawal Alash, MD, MRCPath, Professor of Pathology, UK. Dhiaa Aldoory, BDS, FRCS, Professor of Dental Surgery, Iraq. Manal Mohamed Adil , B Sc, Ph D, Professor of Nanotechnology,

Egypt. Amira H. Shubar, MD, MRCP, Professor of Internal Medicine,

Jordan. Zuhair Al Shsarook, B Sc, Ph D, Professor of Physiology, Bahrain. Abdul- Wahab Al-Khayat, B Sc, Ph D, Professor of Bacteriology,

Iraq. Najim H. Hirmiz, MD, FRCS, Professor of Cardiovascular

Surgery, UK. Amal Fatohi, MD, FRCOG, Professor of Gynaecology, UK. Aydin Byrakdar, MD, FRCS, Consultant in Orthopedics, Turkey. Asal Ezaldean , MD, FRCS, Professor of General Surgery, UK Abbas Al-Chaderchi, MD, Ph D, Professor of Community

Medicine, Iraq. Saad Al- Sabti, MD, Ph D, Professor in Anatomy, New Zealand. Fadhila Alrawi, MD, MRCP, Professor in Pediatrics Diseases,

Canada. Usama Nihad Refaat, MD, FRCS, Professor in Urologic Surgery,

Jordan. Dina Metwally, MD, MRCP, Professor in Pediatrics Diseases and

Medical Education, USA. Khalid Abdulla, MD, MRCP, Professor of Cardiology, UK.

h

Editorial Board Lamia M. Al Naema, B Sc, Ph D, Professor of Biochemistry, Iraq, Hamad Jundari Juma, Professor of Histology, Iraq. Fawzi Al- Ajeeli, MD, Consultant Physician, UAE. Kaydar Al-Chalabi, MD, M Sc, Consultant in Rheumatology, UAE. Nahla Al-Gaban, MD, MRCP, Consultant in Pediatrics Diseases,

UK. Kamal Al Husseiny, MD, FRCS, Consultant in Cosmetic Surgery,

Canada. Adnan Al-Jubori, MD, MRCP, Professor of Internal Medicine, Iraq Huda Alkhateeb, MD, Ph D, Professor in Histology,Iraq Ali Al-Mishhadani, BDS, MSc, Professor Pediatrics Dental

Surgery, Yemen. Laith Alsaadon, MD, FIBMS, Professor in Anesthesia, Iraq. Imad Oda Alsadoon, MD, MRCP, Professor in Pediatric

Cardiology, UAE. Emad Rashid Alsadoon, MD, MRCP, Professor in Pediatric

Infectious Diseases, Iraq. Thekra Al-wattar, MD, MRCP, Professor in Internal Medicine,

UK. Shehab Al Yaseen, B Sc, Ph D, Professor in Microbiology, Iraq. Sundus Bakr, B Sc, Ph D, Professor in Bacteriology, Iraq. Hamid Ghaffoori, B Sc , Ph D, Professor in Biochemistry, Iraq. Mohamed Kamil Hamawendi, Professor in General Surgery, Iraq Radwan Hussein Ibrahim, Professor in Nursing, Iraq Hosam Uldean Salim, Professor in Pharmacology Salwa Hazim, Professor in Nursing, Iraq Seham Koura, B Sc, Ph D, Assistant Professor in Virology, Egypt. Ali Hafed Kudair, MD, ABMS, Assistant Professor in Orthopedics,

Australia. Hamid Hindi Sarhan, MD, FIMS, ABGS, Professor of Breast

Surgery, Iraq. Sawsan Sorchi, B Sc, Ph D, Assistant Professor Molecular Biology,

Iraq. Shahbaa Moslem Ismail Alkhazraji, Assistant Professor in

Pharmacology, Iraq. Rifaie Yaseen Hameed, Assistant Professor in Nursing Community

Medicine. Hazima Mossa Alabassi, Assistant Professor in Immunogenetic.

AAJMS [Formerly IJMS], August 2020;3(3):1-19;ISSNe 2522-7386

1

LEADING ARTICLE Coronavirus-2019 (COVID-19): A Novel Pandemic Disease with Global Health Care Burden

Abdulghani Mohamed Alsamarai, Aalborg Academy College of Medicine [AACOM], Denmark. Tikrit University College of Medicine, [TUCOM], Tikrit, Iraq. Email: galsamarrai@yahoo.com; abdulghani.Mohamed@tu.edu.iq; Mobile: +9647701831295, ORCID: http://orcid.org/0000-0002-7872-6691 DOI: https://doi.org/10.32441/aajms.3.3.1

Coronavirus is an ancient virus with a worldwide distribution [1]. This virus group is the second common cause of common cold after Rhinoviruses [2]. Both human and animals are infected by Coronaviruses and induced mild respiratory infections with rare case severity. Bats, cats and camels are the reservoirs of coronaviruses and the viruses may be transmitted from animals to human and thus included in zoonotic infectious diseases. During the period from the 1st human coronavirus isolation, the virus without medical interest as they mostly induced mild upper respiratory infections [3]. Coronaviruses are present for at least 500-800 years in human and all originated in bats [4,5]. Additionally, this virus group is responsible for infections induction in mammals and birds [6]. In medical history, only 3 global pandemics were reported, plague pandemic in 1720, Cholera pandemic in 1820, and Spanish influenza pandemic in 1920 [7]. However, the COVID-19 pandemic differs from the previous 3 pandemics in its transmission in an exponential manner (Exponential equation). COVID-19 caused by SARS-CoV-2 which was naturally evolutes in animal and transmitted to human [7]. Before the outbreak of COVID-19, only six coronaviruses reported that are with the ability to infect human: MERS-CoV, SARS-CoV, HCoV-HKU1, HCV-229E, HCoVNL63, HCoV-OC43 [8-10].

AAJMS [Formerly IJMS], August 2020;3(3):1-19;ISSNe 2522-7386

2

The last four are endemic locally and associated mainly with the mild, self-limiting disease, while the first two can cause severe illness [11-13].Genetic diversity of Coronaviruses, genome frequent recombination, high prevalence rate, unavailability of an effective vaccine and antiviral agents, and high prevalence rate and animal-human interface increasing activity form a continuous threat to human health [14,15]. The health threat became obvious in December 2019 and early 2020 as the novel coronavirus (SARS-CoV-2) was identified as the aetiology of rabidly and large outbreaks of respiratory disease, including potentially fatal pneumonia, in Wuhan, China [16]. In a short period the COVID-19 transmitted from China to about all worlds. COVID-19 mortality was lower than that of Severe Acute Respiratory Syndrome Coronavirus (SARS-CoV), and Middle East Respiratory Syndrome Coronavirus (MERS-CoV) [17,18]. Both SARS and MERS were spread between people with close contact. MERS outbreak still occurring and spread outside the Middle East region such as South Korea [19]. The respiratory viral diseases are the common viral infections that are spread frequently among people through droplets of coughing, sneezing and maybe talking [2]. In the last two decades, three coronavirus strains that induced respiratory diseases outbreaks [20]. SARS-CoV-2 was different from SARS-CoV and MERS-CoV as it leads to pandemics, while the other two were epidemic . The sequence databases indicated that all human coronaviruses were of animal origin [21,22]. Previous studies documented the spillover of coronaviruses from animal to animal and from animal to human [23-58]. The natural course of the disease indicated that immune and inflammatory responses form the effective arm that controls the outcome of the infection. However, the disease severity and mortality may be a side effect to both immune and inflammatory responses [2]. In literature, the virus-host interaction was studied and multiple scenarios were proposed for the effectiveness of immune responses in disease control and outcome and immunity- inflammatory influence on disease mortality [59-137]. Although there are a global research works that evaluate the effectiveness of drugs/compound as a therapeutic approach for COVID-19, however, to date none found to be with promising effect. The Russian researcher formulated an effective antiviral agent

AAJMS [Formerly IJMS], August 2020;3(3):1-19;ISSNe 2522-7386

3

(Favipiravir] against SARS-CoV-2 and introduced to the market for their use. Additionally, the vaccine evaluation takes a long period until the development of the novel potential vaccine. The research efforts to find effective antiviral agents panel and effective vaccines take a long time to introduce promising results. The best approach to find an effective drug against SARS-CoV-2 infection is to test new compounds, not to rely on the testing of that used in another virus's treatment. The novel drugs are that which prevent viral attachment with the host cell to get rid of immune and inflammatory harmful responses [138]. COVID-19 is the first disease that takes the attention of WHO; national, regional and global health authorities; all worldwide political directors; non-governmental organization; human rights organization, and social leaders. The COVID-19 pandemic illustrated the following outcomes: 1. Globally there is no perfect health care system that deals

effectively with COVID-19 pandemic in both developed and developing countries.

2. To date, the only antiviral agent that assumed to be effective in the treatment of COVID-19 is Avifavir (Favipiravir) and may be Remdesivir.

3. The main common methods of disease transmission are through droplets of coughing, sneezing or maybe talking.

4. The most effective preventive measures are social distancing, mask-wearing, personal hygiene (frequent hand washing), wandering prevention, quarantine of contact and isolation of the infected individual.

5. Area isolation is essential for disease control. 6. Social and personal compliance with orders of wandering

prevention, social distancing, personal hygiene and none attendance to crowded places for the risk factors that leads to the exponential increase in COVID-19 cases.

7. Forman et al [139] addressed key lessons which include: Transparency, solidarity, coordination, decisiveness, clarity, accountability, refocusing and increased funding to ensure the WHO is capable of coordinating global responses to major health challenges, Existing global insurance institutions and policies are inadequate, and these require significant changes and improvements, Efforts to develop COVID-19 vaccines and

AAJMS [Formerly IJMS], August 2020;3(3):1-19;ISSNe 2522-7386

4

treatments are commendable, but there is still much more to do, We need to test the responsiveness and resilience of health systems and make changes and improvements based on the results, Effective communication must occur at the highest political levels, and There are opportunities to introduce novel approaches, such as using robots and artificial intelligence (AI), in this – and in future – pandemic response .

8. Attention for human rights and health education are needed globally.

9. We noticed the spread of SARS-CoV-2 to individuals working in the hospital management department, operation theatre, X-ray section, and the wards that are away from those dealing in the management of COVID-19 patients. This suggests that mechanical ventilation and air conditioning system may play a role in virus transmission. Thus this must be taken into consideration at the time of hospital building design or to go back to our previous infectious disease hospitals.

10. The infrastructure of the ministry of health needs urgent SWOT evaluation and actions must be taken to improve the health care system and MOH budget reform.

11. The disease pandemic not led efficiently as there is misconduct and conflict or opposition between the political leaders and healthcare leader's actions. In the current situation, the leadership must be operated by healthcare personnel.

12. The pandemics uncontrolled and characterized by a steady increase in cases with time due to political orders not to close border as early as possible. i. e. the disease focus is from Iran.

13. A contradictory opinion released from WHO. 14. The government did not cover the needs of the self-employed

workers and thus they forced not to comply with orders of wandering movement with subsequent exposure to disease focuses.

15. Lack of infection control measures in MOH hospitals and primary care centers.

16. Lack of health care personnel training on the control of infections. 17. No role for an epidemiologist, virologist and immunologist in the

control and preventive measures.

AAJMS [Formerly IJMS], August 2020;3(3):1-19;ISSNe 2522-7386

5

18. The pandemic clarifies the importance of medical colleges, Health technical colleges and laboratory technical college's curriculum reform.

19. The cases mainly managed by a physician specialized in internal medicine, which is not the sound approach. Thus sub-specialty post-graduate establishment in Iraqi Board of Medical Specialization and Arab Board of Medical Specialization or medical colleges is required urgently .

20. MOH financial support from the central government is not enough to provide 15% of health care services.

21. There is no global agreement on the origin of the virus. Is the virus mutated naturally in its animal host or is it a human-induced strain? No dogmatic answer yet, the future will explore that fact.

22. Herd immunity approach would not solve the COVID-19 problem.

23. MOH not provided enough personal protective equipment for all health care workers.

24. There are non-ethical research working as reported by retraction of two large scale research works by Lancet and New England Journal.

25. To date, the most effective treatment as antiviral agent is the use of plasma from previously infected individuals. However, the reduction if IgG and neutralizing antibody levels in the early convalescent phase might have implications for immunity strategy and serological survey [140].

26. Vaccine production trials may be promising. 27. There is a wide gap between expected incidence and MOH daily

cases reporting and this mostly due to low screening coverage [1.33% of total Iraqi population, 29/6/2020].

28. Although the Iraqi Health Care System is with many deficits, the health care providers working properly and influence pandemic outcomes.

29. Recent study [141] indicated a 3p21.31 gene cluster as genetic susceptibility locus in patients with COVID-19 with respiratory failure. Additionally, ABO blood group system also involved in the influence of individual susceptibility to COVID-19 infections. Blood group A was with higher risk, while group O was with lower risk for SARS-CoV-2 infection.

AAJMS [Formerly IJMS], August 2020;3(3):1-19;ISSNe 2522-7386

6

30. One social problem that challenges COVID-19 management in Iraqi community is the believe that the disease is STIGMA.

31. The disease mortality rate was 4.766% (28/7/2020) and the prevalence rate was 0.287% for Iraqi population (115332/40138387). The recovery rate was 70.3%.

32. The cases incidence increased dramatically during the period from 5/6/2020 to 28/7/2020 (54 days) as compared to the period of 98 days from 24/2/2020 to 4/6/2020. The cases at 28/7/2020 12 times (106492) that that at 4/6/2020 (8840). This cases incidence increase may indicate that COVID-19 may be out of control. The increase in COVID-19 incidence was mostly attributed to the personal behavior as they not apply the recommendation of WHO and national and local crises committees. Nosocomial infection especially in healthcare providers increased due to none availability of protection equipments and this may play another was for disease transmission. Disease stigma in community prevent many of infected individuals from healthcare consultation and thus play a focus of infection in their communities. Recently, the heresy of typhoid fever classification of moderate number of cases provide another focus for infection in the community.

In conclusion, SARS-CoV-2 pandemic infection indicated the needs for global health care systems reform. In addition, the pandemic illustrated the need for health education and establishment of infectious disease subspecialty in medical institutes and warranted building of infectious disease isolated hospitals with a special design that overcome nosocomial infections. References 1. Beaudette FR, Hudson CB. Cultivation of the virus of infectious

bronchitis. Journal of the American Veterinary Medical Association, 1937; 90: 51-6.

2. Alsamarai AGM, Alobaidi AHA, Alsamarai MAM. Coronavirus 2019 (COVID-19): A Novel Pandemic Disease. Aalborg Academy J Med Sci 2020;3(2):151-184.

3. Almeida JD, Tyrrell D. The morphology of three previously uncharacterized human respiratory viruses that grow in organ culture. J Gen Virol 1967;1:175-8.

4. Chan PK, Chan MC. Tracing the SARS-coronavirus. J Thorac Dis 2013, 5(Suppl. 2):S118.

AAJMS [Formerly IJMS], August 2020;3(3):1-19;ISSNe 2522-7386

7

5. Berry M, Gamieldien J, Fielding BC. Identification of new respiratory viruses in the new millennium. Viruses 2015, 7(3): 996.

6. Cavanagh D. Coronaviridae: a review of coronaviruses and toroviruses. Coronaviruses with Special Emphasis on First Insights Concerning SARS. 2005:1–54.

7. Aljubory NH. Corona: The Century Pandemic. Aalborg Academy J Med Sci 2020;3(2):1-45.

8. Bonilla-Aldana DK, Holguin-Rivera Y, Cortes-Bonilla I, Cardona-Trujillo MC, García-Barco A, Bedoya-Arias HA, Rabaan AA, Sah R, Rodriguez-Morales AJ. Coronavirus infections reported by ProMED, February 2000-January 2020. Travel Med Infect Dis. 2020 Feb 6:101575. doi: 10.1016/j.tmaid.2020.101575. Epub ahead of print. PMID: 32036011; PMCID: PMC7102564.

9. Skariyachan S, Challapilli SB, Packirisamy S, Kumargowda ST, Sridhar VS. Recent aspects on the pathogenesis mechanism, animal models and novel therapeutic interventions for Middle East respiratory syndrome coronavirus infections. Front Microbiol 2019;10: 569.

10. Aleanizy FS, Mohmed N, Alqahtani FY, El Hadi Mohamed RA. Outbreak of Middle East respiratory syndrome coronavirus in Saudi Arabia: a retrospective study. BMC infectious Dis 2017;17;23.

11. WHO 2003 https://www.who.int/ith/diseases/sars/en/ 12. Song Z, Xu Y, Bao L, Zhang L, Yu P, Qu Y, Zhu H, Zhao W,

Han Y, Qin C. From SARS to MERS, Thrusting Coronaviruses into the Spotlight. Viruses. 2019;11(1):59.

13. Paules CI, Marston HD, Fauci AS. Coronavirus infections-More than just the common cold. JAMA (J Am Med Assoc) 2020;323(8):707-708.

14. Hui DS, Azhar E, Madani TA. The continuing 2019-nCoV epidemic threat of novel coronaviruses to global health - The latest 2019 novel coronavirus outbreak in Wuhan, China. Int J Infect Dis 2020;91: 264-266.

15. Zhu N, Zhang D, Wang W, Xingwang Li, M.D., Bo Yang, M.S., Jingdong Song, et al. A novel coronavirus from patients with pneumonia in China, 2019. N Engl J Med 2020;382(8):727-733.

AAJMS [Formerly IJMS], August 2020;3(3):1-19;ISSNe 2522-7386

8

16. WHO. WHO statement regarding cluster of pneumonia cases in Wuhan, China (World Health Organization, January 9, 2020); Emergencies: Novel coronavirus 2019, WHO.

17. WHO. Summary of probable SARS cases with onset of illness from 1 November 2002 to 31 July 2003. Dec 31, 2003. https://www. who.int/csr/sars/country/table2004_04_21/en/ .

18. WHO. Middle East Respiratory Syndrome Coronavirus (MERS-CoV). November, 2019. http://www.who.int/emergencies/mers-cov/en/].

19. Fauci AS. COVID-19 is an emerging, rapidly evolving situation. National Institute of Allergy and Infectious Diseases. https://www.niaid. nih. Gov /about/director.

20. Guarner J. Three Emerging Coronaviruses in Two Decades: The Story of SARS, MERS, and Now COVID-19, Am J Clin Pathol 2020;153(4):420–421.

21. Su S, Wong G, Shi W, Liu J, Lai ACK, Zhou J, et al. Epidemiology, genetic recombination, and pathogenesis of coronaviruses. Trends Microbiol.2016;24: 490–502.

22. Forni D, Cagliani R, Clerici M, Sironi M. Molecular evolution of human coronavirus genomes. Trends Microbiol. 2017;25:35–48.

23. Huang, YW, Dickerman AW, Piñeyro P, Li L, Fang L, Kiehne R, et al. Origin, evolution, and genotyping of emergent porcine epidemic diarrhea virus strains in the United States. MBio 2013;4:e00737–00713.

24. Liu C, Tang J, Ma Y, Liang X, Yang Y, Peng G, et al. Receptor usage and cell entry of porcine epidemic diarrhea coronavirus. J. Virol.2015;89:6121–6125.

25. Simas PV, Barnabé AC, Durães-Carvalho R, Neto DF, Caserta LC, Artacho L, et al. Bat coronavirus in Brazil related to appalachian ridge and porcine epidemic diarrhea viruses. Emerg. Infect. Dis. 2015;21:729–731.

26. Lacroix A, Duong V, Hul V, San S, Davun H, Omaliss K, et al. Genetic diversity of coronaviruses in bats in Lao PDR and Cambodia. Infect. Genet. Evol.2017;48: 10–18.

27. Song HD, Tu CC, Zhang GW, Wang SY, Zheng K, Lei LC, et al. Cross- host evolution of severe acute respiratory syndrome coronavirus in palm civet and human. Proc. Natl Acad. Sci. USA 2005;102:2430–2435.

AAJMS [Formerly IJMS], August 2020;3(3):1-19;ISSNe 2522-7386

9

28. Paden CR, Yusof MFBM, Al Hammadi ZM, Queen K, Tao Y, Eltahir YM, et al. Zoonotic origin and transmission of Middle East respiratory syndrome coronavirus in the UAE. Zoo Pub Health 2018;65:322–333.

29. Haagmans BL, Al Dhahiry SH, Reusken CB, Raj VS, Galiano M, Myers R, Godeke GJ, et al. Middle East respiratory syndrome coronavirus in dromedary camels: an outbreak investigation. Lancet Infect Dis 2014;14:140–145.

30. Azhar EI, El-Kafrawy SA, Farraj SA, Hassan AM, Al-Saeed MS, Hashem AM, et al. Evidence for camel- to-human transmission of MERS coronavirus. N Eng J Med 2014; 370:2499–2505.

31. Raj VS, Farag EABA, Reusken CBEM, Lamers MM, Pas SD, Voermans J, et al. Isolation of MERS coronavirus from a dromedary camel, Qatar, 2014. Emerg Infect Dis 2014;20:1339–

1342. 32. Sabir JS, Lam TT, Ahmed MM, Li L, Shen Y, Abo-Aba SE, et

al. Co- circulation of three camel coronavirus species and recombination of MERS- CoVs in Saudi Arabia. Science 2016;351:81–84.

33. Chu DKW, Hui KPY, Perera RAPM, Miguel E, Niemeyer D, Zhao J, et al. MERS coronaviruses from camels in Africa exhibit region- dependent genetic diversity. Proc Natl Acad Sci.,USA 2018;115:3144–3149.

34. Lau SK, Li KS, Tsang AK, Lam CS, Ahmed S, Chen H, et al. Genetic characterization of Betacoronavirus lineage C viruses in bats reveals marked sequence divergence in the spike protein of pipistrellus bat coronavirus HKU5 in Japanese pipistrelle: implications for the origin of the novel Middle East respiratory syndrome coronavirus. J Virol 2013;87:8638–8650.

35. Cui J, Li F, Shi ZL. Origin and evolution of pathogenic coronaviruses. Nature Review Microbiology 2019;17:181-192.

36. Montecino-Latorre D, Goldstein T, Gilardi K, Wolking D, Wormer EV, Kazwala R, et al. Reproduction of East-African bats may guide risk mitigation for coronavirus Spillover. One Health Outlook 2020;2:2.

37. Yin Y, Wunderink RG. MERS, SARS and other coronaviruses as causes of pneumonia. Respirology. 2018;23(2):130–7.

38. Guo YR, Cao QD, Hong ZS, Tan YY, Chen SD, Jin HJ, et al. The origin, transmission and clinical therapies on coronavirus disease

AAJMS [Formerly IJMS], August 2020;3(3):1-19;ISSNe 2522-7386

10

2019 (COVID-19) outbreak – an update on the status. Military Medical Research 2020;7:11

39. Zhou P, Yang XL, Wang XG, Hu B, Zhang L, Zhang W, et al. A pneumonia outbreak associated with a new coronavirus of probable bat origin. Nature. 2020; https://doi.org/10.1038/s41586-020-2012-7.

40. Angeletti S, Benvenuto D, Bianchi M, Giovanetti M, Pascarella S, Ciccozzi M. COVID-2019: the role of the nsp2 and nsp3 in its pathogenesis. J Med Virol. 2020;92(6).https://doi.org/ 10.1002/jmv.25719.

41. Zhang L, Shen FM, Chen F, Lin Z. Origin and evolution of the 2019 novel coronavirus. Clin Infect Dis. 2020. https://doi.org/10.1093/cid/ciaa112 [Epub ahead of print].

42. Wu D, Zou S, Bai T, Li J, Zhao X, Yang L, et al. Poultry farms as a source of avian influenza a (H7N9) virus re-assortment and human infection. Sci Rep. 2015;5:7630.

43. Tang X, Wu C, Li X, Song Y, Yao X, Wu X, et al. On the origin and continuing evolution of SARS-CoV-2. Natl Sci Rev. 2020. https://doi.org/10. 1093/nsr/nwaa036.

44. Jia HP, Look DC, Shi L, Hickey M, Pewe L, Netland J, et al. ACE2 receptor expression and severe acute respiratory syndrome coronavirus infection depend on differentiation of human airway epithelia. J Virol. 2005;79(23):14614–21.

45. Wan Y, Shang J, Graham R, Baric RS, Li F. Receptor recognition by novel coronavirus from Wuhan: an analysis based on decade-long structural studies of SARS. J Virol. 2020. https://doi.org/10.1128/JVI.00127-20 [Epub ahead of print].

46. Tortorici MA, Veesler D. Structural insights into coronavirus entry. Adv Virus Res. 2019;105:93–116.

47. Zhang N, Jiang S, Du L. Current advancements and potential strategies in the development of MERS-CoV vaccines. Expert Rev Vaccines. 2014;13(6):761–74.

48. Xia S, Zhu Y, Liu M, Lan Q, Xu W, Wu Y, et al. Fusion mechanism of 2019-nCoV and fusion inhibitors targeting HR1 domain in spike protein. Cell Mol Immunol. 2020. https://doi.org/10.1038/s41423-020-0374-2.

49. Yu F, Du L, Ojcius DM, Pan C, Jiang S. Measures for diagnosing and treating infections by a novel coronavirus responsible for a pneumonia outbreak originating in Wuhan, China. Microbes

AAJMS [Formerly IJMS], August 2020;3(3):1-19;ISSNe 2522-7386

11

Infect. 2020. https://doi.org/10.1016/j.micinf.2020.01.003 [Epub ahead of print].

50. de Wilde AH, Snijder EJ, Kikkert M, van Hemert MJ. Host factors in coronavirus replication. Curr Top Microbiol Immunol. 2018;419:1–42.

51. Sawicki SG, Sawicki DL. Coronavirus transcription: a perspective. Curr Top Microbiol Immunol. 2005;287:31–55.

52. Hussain S, Pan J, Chen Y, Yang Y, Xu J, Peng Y, et al. Identification of novel subgenomic RNAs and noncanonical transcription initiation signals of severe acute respiratory syndrome coronavirus. J Virol. 2005;79(9):5288–95.

53. Perrier A, Bonnin A, Desmarets L, Danneels A, Goffard A, Rouille Y, et al. The C-terminal domain of the MERS coronavirus M protein contains a trans-Golgi network localization signal. J Biol Chem. 2019;294(39):14406–21.

54. Letko M, Marzi A, Munster V. Functional assessment of cell entry and receptor usage for SARS-CoV-2 and other lineage B betacoronaviruses. Nat Microbiol. 2020. https://doi.org/ 10.1038/s41564-020-0688-y.

55. Song W, Gui M, Wang X, Xiang Y. Cryo-EM structure of the SARS coronavirus spike glycoprotein in complex with its host cell receptor ACE2. PLoS Pathog. 2018;14(8):e1007236.

56. Millet JK, Whittaker GR. Host cell proteases: critical determinants of coronavirus tropism and pathogenesis. Virus Res. 2015;202:120–34.

57. Simmons G, Gosalia DN, Rennekamp AJ, Reeves JD, Diamond SL, Bates P. Inhibitors of cathepsin L prevent severe acute respiratory syndrome coronavirus entry. P Natl Acad Sci USA. 2005;102(33):11876–81.

58. Andersen KG, Rambaut A, Lipkin WI, Holmes EC, Garry RF. The proximal origin of SARS-CoV-2. Nature Medicine www.nature.com/naturemedicine.

59. Ryzhakov G, Randow F. SINTBAD, a novel component of innate antiviral immunity, shares a TBK1-binding domain with NAP1 and TANK. EMBO J 2007;26:3180–3190.

60. Ramasamy, S, Saez B, Mukhopadhyay S, Ding D, Ahmed AA, Chen X, et al. Tle1 tumor suppressor negatively regulates inflammation in vivo and modulates NF-κB inflammatory

pathway. Proc Natl Acad Sci. USA. 2016;113:1871–1876.

AAJMS [Formerly IJMS], August 2020;3(3):1-19;ISSNe 2522-7386

12

61. Zhang X, Li X, Ning F, Shang Y, Hu, X. TLE4 acts as a corepressor of Hes1 to inhibit inflammatory responses in macrophages. Protein Cell 2019;10:300–305.

62. Tetsuka T, Uranishi H, Imani H, Ono T, Sonta S, Takahasi N, et al. Inhibition of nuclear factor-kappaB-mediated transcription by association with the aminoterminal enhancer of split, a Groucho-related protein lacking WD40 repeats. J Biol Chem 2000; 275: 4383–4390.

63. Wang C, Chen T, Zhang J, Yang M, Li N, Xu X, Cao X. et al. The E3 ubiquitin ligase Nrdp1 ‘preferentially’ promotes TLR-mediated production of type I interferon. Nat Immunol 2009;10:744–752.

64. Kondo, T., Watanabe, M. & Hatakeyama, S. TRIM59 interacts with ECSIT and negatively regulates NF-κB and IRF-3/7-mediated signal pathways. Biochem Biophys Res Commun.2012; 422:501–507.

65. Li S, Wang L, Berman M, Kong YY, Dorf ME. Mapping a dynamic innate immunity protein interaction network regulating type I interferon production. Immunity 2011;35:426–440.

66. Xia X, Cui J, Wang HY, Zhu L, Matsueda S, Wang Q, et al. NLRX1 negatively regulates TLR-induced NF-κB signaling by

targeting TRAF6 and IKK. Immunity 2011;34:843–853. 67. Kanke T, MacFarlane SR, Seatter MJ, Davenport EL, Paul A,

McKenzie RC, Plevin RJ. et al. Proteinase-activated receptor-2-mediated activation of stress-activated protein kinases and inhibitory kappa B kinases in NCTC 2544 keratinocytes. J Biol Chem2001; 276:31657–31666.

68. Matsuda A, Suzuki Y, Honda G, Muramatsu S, Matsuzaki O, Nagano Y, et al. Large-scale identification and characterization of human genes that activate NF-kappaB and MAPK signaling pathways. Oncogene 2003;22:3307–3318.

69. Liu, XY, Wei B, Shi HX, Shan YF, Wang C. Tom70 mediates activation of interferon regulatory factor 3 on mitochondria. Cell Res. 2010;20:994–1011.

70. Reineke LC, Lloyd RE. The stress granule protein G3BP1 recruits protein kinase R to promote multiple innate immune antiviral responses. J Virol. 2015;89:2575–2589.

AAJMS [Formerly IJMS], August 2020;3(3):1-19;ISSNe 2522-7386

13

71. Yang W, Yang W, Ru Y, Ren J, Bai J, Wei J, et al. G3BP1 inhibits RNA virus replication by positively regulating RIG-I-mediated cellular antiviral response. Cell Death Dis. 2019;10:946.

72. Kim SSY, Sze L, Liu C, Lam KP. The stress granule protein G3BP1 binds viral dsRNA and RIG-I to enhance interferon-β

response. J. Biol. Chem.2019; 294: 6430–6438. 73. Raaben M, Groot Koerkamp MJA, Rottier PJM, de Haan CAM.

Mouse hepatitis coronavirus replication induces host translational shutoff and mRNA decay, with concomitant formation of stress granules and processing bodies. Cell Microbiol. 2007;9:2218–

2229. 74. Nakagawa K, Narayanan K, Wada M, Makino S. Inhibition of

Stress Granule Formation by Middle East Respiratory Syndrome Coronavirus 4a Accessory Protein Facilitates Viral Translation, Leading to Efficient Virus Replication. J Virol.2018; 92 (20). pii: e00902-18.

75. Ivanov P, Kedersha N, Anderson P. Stress Granules and Processing Bodies in Translational Control. Cold Spring Harb Perspect Biol.2019; 11 (5). pii: a032813.

76. Slaine PD, Kleer M, Smith NK, Khaperskyy DA, McCormick C. Stress Granule-Inducing Eukaryotic Translation Initiation Factor 4A Inhibitors Block Influenza A Virus Replication. Viruses2017; 9 (12). pii: E388.

77. Thompson P, Eam A, NP Young, Fish S, Chen J, Barrera M, et al. Abstract 2698: eFT226, a potent and selective inhibitor of eIF4A, is efficacious in preclinical models of lymphoma. Experimental and Molecular Therapeutics 2019.

78. Reineke LC, Tsai WC, Jain A, Kaelber JT, Jung SY, Lloyd RE, et al. Casein Kinase 2 Is Linked to Stress Granule Dynamics through Phosphorylation of the Stress Granule Nucleating Protein G3BP1. Mol Cell Biol 2017;37 (4). pii: e00596-16.

79. Fonseca BD, Jia JJ, Hollensen AK, Pointet R, Hoang HD, Niklaus MR, et al. LARP1 is a major phosphorylation substrate of mTORC1. BioRxiv, 2018; 491274.

80. Kindrachuk J, Ork B, Hart BJ, Mazur S, Holbrook MR, Frieman MB, et al. Antiviral potential of ERK/MAPK and PI3K/AKT/mTOR signaling modulation for Middle East respiratory syndrome coronavirus infection as identified by

AAJMS [Formerly IJMS], August 2020;3(3):1-19;ISSNe 2522-7386

14

temporal kinome analysis. Antimicrob Agents Chemother. 2015;59(2):1088-99.

81. Frieman M, Yount B, Heise M, Kopecky-Bromberg SA, Palese P, Baric RS. Severe acute respiratory syndrome coronavirus ORF6 antagonizes STAT1 function by sequestering nuclear import factors on the rough endoplasmic reticulum/Golgi membrane. J Virol. 2007;81(18):9812-24.

82. Faria PA, Chakraborty P, Levay A, Barber GN, Ezelle HJ, Enninga J, et al. VSV disrupts the Rae1/mrnp41 mRNA nuclear export pathway. Mol Cell 2005;17:93–102.

83. Timms RT, Zhang Z, Rhee DY, Harper JW, Koren I, Elledge SJ. A glycine-specific N-degron pathway mediates the quality control of protein N-myristoylation. Science. 2019;365(6448):eaaw4912.

84. Quan B, Seo HS, Blobel G, Ren Y. Vesiculoviral matrix (M) protein occupies nucleic acid binding site at nucleoporin pair (Rae1 • Nup98). Proc Natl Acad Sci USA.2014; 111:9127–9132.

85. Li G, Fan Y, Lai Y, Han T, Li Z, Zhou P, et al. Coronavirus infections and immune responses. J Med Virol. 2020; 92 ( 4) : 424‐ 432.

86. Baruah V, Bose S. Immunoinformatics-aided identification of T cell and B cell epitopes in the surface glycoprotein of 2019-nCoV. J Med Virol 2020;92(5):495-500.

87. Zhang B, Zhou X, Qiu Y, Feng F, Feng J, Jia J, et al. Clinical characteristics of 82 death cases with COVID‐19. medRxiv. 2020. 02.26.20028191.

88. Wong CK, Lam CW, Wu AK, Ip WK, Lee NL, Chan IH, Lit LC, Hui DS, Chan MH, Chung SS, Sung JJ. Plasma inflammatory cytokines and chemokines in severe acute respiratory syndrome. Clin Exp Immunol. 2004;136(1):95-103.

89. Conti P, Ronconi G, Caraffa A, Gallenga CE, Ross R, Frydas I, et al. Induction of pro‐inflammatory cytokines (IL‐1 and IL‐6) and lung inflammation by COVID‐19: anti‐inflammatory strategies. J. Biol. Regul. Homeostatic Agents. 2020; 34( 2).

90. Jiang F, Deng L, Zhang L, Cai Y, Cheung CW, Xia Z. Review of the clinical characteristics of coronavirus disease 2019 (COVID‐19). J Gen Intern Med. 2020:1‐5.

AAJMS [Formerly IJMS], August 2020;3(3):1-19;ISSNe 2522-7386

15

91. de Wit E, van Doremalen N, Falzarano D, Munster VJ. SARS and MERS: recent insights into emerging coronaviruses. Nat Rev Microbiol. 2016; 14( 8): 523‐ 534.

92. Channappanavar R, Perlman S. Pathogenic human coronavirus infections: causes and consequences of cytokine storm and immunopathology. Semin Immunopathol. 2017; 39( 5): 529‐ 539.

93. Rokni M, Ghasemi V, Tavakoli Z. Immune responses and pathogenesis of SARS‐CoV‐2 during an outbreak in Iran: Comparison with SARS and MERS. Reviews Med Virol 2020;1-6.

94. Deng X, van Geelen A, Buckley AC, et al. Coronavirus Endoribonuclease activity in porcine epidemic diarrhea virus suppresses type I and type III interferon responses. J Virol. 2019; 93( 8):e02000‐18.

95. Yang CH, Li K, Pfeffer SR, Pfeffer LM. The type I IFN‐induced miRNA, miR‐21. Pharmaceuticals. 2015; 8( 4): 836‐ 847.

96. Prompetchara E, Ketloy C, Palaga T. Immune responses in COVID‐19 and potential vaccines: lessons learned from SARS and MERS epidemic. Asian Pac J Allergy Immunol. 2020; 38:1‐9.

97. Gorse GJ, Donovan MM, Patel GB. Antibodies to coronaviruses are higher in older compared with younger adults and binding antibodies are more sensitive than neutralizing antibodies in identifying coronavirus‐associated illnesses. J Med Virol. 2020; 92( 5): 512‐ 517.

98. Liu W, Fontanet A, Zhang PH, Zhan L, Xin ZT, Baril L, et al. Two‐year prospective study of the humoral immune response of patients with severe acute respiratory syndrome. J Infect Dis. 2006; 193( 6): 792‐ 795.

99. Hsueh PR, Huang LM, Chen PJ, Kao CL, Yang PC. Chronological evolution of IgM, IgA, IgG and neutralisation antibodies after infection with SARS‐associated coronavirus. Clin Microbiol Infect. 2004; 10( 12): 1062‐ 1066.

100. Tang F, Quan Y, Xin Z‐T, Wrammert J, Ma MJ, Lv H, et al. Lack of peripheral memory B cell responses in recovered patients with severe acute respiratory syndrome: a six‐year follow‐up study. J Immunol. 2011; 186( 12): 7264‐ 7268.

AAJMS [Formerly IJMS], August 2020;3(3):1-19;ISSNe 2522-7386

16

101. Zhou P, Yang XL, Wang XG, Hu B, Zhang L, Zhang W, et al. A pneumonia outbreak associated with a new coronavirus of probable bat origin. Nature. 2020; 579(7798):270‐273.

102. Gu J, Gong E, Zhang B, Zheng J, Gao Z, Zhong Y, et al. Multiple organ infection and the pathogenesis of SARS. J Exp Med. 2005;202(3):415-24.

103. Li CK, Wu H, Yan H, Ma S, Wang L, Zhang M, Tang X, et al. T cell responses to whole SARS coronavirus in humans. J Immunol. 2008; 181( 8): 5490‐ 5500.

104. Fan YY, Huang ZT, Li L, Wu MH, Yu T, Koup RA, et al. Characterization of SARS‐CoV‐specific memory T cells from recovered individuals 4 years after infection. Arch Virol. 2009; 154( 7): 1093‐ 1099.

105. Peng H, Yang LT, Wang LY, Li J, Huang J, Lu ZQ, et al. Long‐lived memory T lymphocyte responses against SARS coronavirus nucleocapsid protein in SARS‐recovered patients. Virology. 2006; 351( 2): 466‐ 475.

106. Guan WD, Mok CK, Chen ZL, Feng LQ, Li ZT, Huang JC, et al. Characteristics of traveler with Middle East respiratory syndrome, China, 2015. Emerg Infect Dis. 2015; 21( 12): 2278‐ 2280.

107. Ng OW, Chia A, Tan AT, Jadi RS, Leong HN, Bertoletti A, et al. Memory T cell responses targeting the SARS coronavirus persist up to 11 years post‐infection. Vaccine. 2016; 34( 17): 2008‐ 2014.

108. Oh HL, Chia A, Chang CX, Leong HN, Ling KL, Grotenbreg GM, et al. Engineering T cells specific for a dominant severe acute respiratory syndrome coronavirus CD8 T cell epitope. J Virol. 2011; 85( 20): 10464‐ 10471.

109. Wu F, Wang A, Liu M, Wang Q, Chen J, Xia S, et al. Neutralizing antibody responses to SARS-CoV-2 in a COVID-19 recovered patient cohort and their implications. https://doi.org/ 10.1101 /2020.03. 30.20047365

110. Shi Y, Wang Y, Shao C, Huang J, Gan J, Huang X, et al. COVID-19 infection: the perspectives on immune responses. Cell Death & Differentiation. 2020; https://doi.org/10.1038/s41418-020-0530-3

AAJMS [Formerly IJMS], August 2020;3(3):1-19;ISSNe 2522-7386

17

111. Qin C, Zhou L, Hu Z, Zhang S, Yang S, Tao y, et al. Dysregulation of immune response in patients with COVID-19 in Wuhan, China. Clin Infect Dis 2020; March, pii: ciaa248. doi: 10.1093/cid/ciaa248.

112. Min CK, Cheon S, Ha NY, Sohn KM, Kim Y, Aigerim A, et al. Comparative and kinetic analysis of viral shedding and immunological responses in MERS patients representing a broad spectrum of disease severity. Sci Rep 2016; 6: 25359.

113. Shaw AC, Goldstein DR, Montgomery RR. Age-dependent dysregulation of innate immunity. Nat Rev Immunol 2013; 13(12): 875-87.

114. Hotez PJ, Bottazzi ME, Corry D. The Potential Role of Th17 Immune Responses in Coronavirus Immunopathology and Vaccine-induced Immune Enhancement. Preprints 2020, 2020040159.

115. Wu D, Yang XO. TH17 responses in cytokine storm of COVID-19: An emerging target of JAK2 inhibitor Fedratinib. J Microbiol Immunol Infect 2020; pii: S1684-1182(20)30065-7.

116. Hoe E, Anderson J, Nathanielsz J, Toh ZQ, Marimla R, Balloch A, Licciardi PV. The contrasting roles of Th17 immunity in human health and disease. Microbiol Immunol 2017;61: 49-56

117. Murdock BJ, Falkowski NR, Shreiner AB, Sadighi Akha AA, McDonald RA, White ES, et al. Interleukin-17 drives pulmonary eosinophilia following repeated exposure to Aspergillus fumigatus conidia. Infect Imm 2012;80: 1424-36

118. Cheung PF, Wong CK, Lam CW. Molecular mechanisms of cytokine and chemokine release from eosinophils activated by IL-17A, IL-17F, and IL-23: implication for Th17 lymphocytes mediated allergic inflammation. J Immunol 2008;180: 5625-35

119. Al-Ramli W, Prefontaine D, Chouiali F, Martin JG, Olivenstein R, Lemiere C, Hamid Q. T(H)17-associated cytokines (IL-17A and IL-17F) in severe asthma. J Allergy Clin Immunol 2009;123: 1185-7

120. Zhang Y, Li J, Zhan Y, Wu L, Yu X, Zhang W, et al. Analysis of serum cytokines in patients with severe acute respiratory syndrome. Infect Imm 2004; 72: 4410-5

121. Kimura A, Kishimoto T. IL-6: regulator of Treg/Th17 balance. Eur J Immunol 2010; 40: 1830-5168.

AAJMS [Formerly IJMS], August 2020;3(3):1-19;ISSNe 2522-7386

18

122. Zhang X, Wu K, Wang D, Yue X, Song D, Zhu Y, Wu J. Nucleocapsid protein of SARS-CoV activates interleukin-6 expression through cellular transcription factor NF-kappaB. Virology 2007;365: 324-35.

123. Zhang X, Song K, Tong F, Fei M, Guo H, Lu Z, et al. First case of COVID-19 in a patient with multiple myeloma successfully treated with tocilizumab. Blood Adv 2020;4: 1307-10.

124. Gasch M, Goroll T, Bauer M, Hinz D, Schutze N, Polte T, et al. Generation of IL-8 and IL-9 producing CD4(+) T cells is affected by Th17 polarizing conditions and AHR ligands. Mediators Inflamm 2014: 182549.

125. Groeneveld ABJ. A Central Role of Interleukin-8 in the Pathogenesis of ARDS. In: Vincent JL. (eds) Yearbook of Intensive Care and Emergency Medicine 1998. Yearbook of Intensive Care and Emergency Medicine, Vol 1998. Springer, Berlin, Heidelberg.

126. Huang C, Wang Y, Li X, Ren L, Zhao J, Hu Y, et al. Clinical features of patients infected with 2019 novel coronavirus in Wuhan, China. Lancet. 2020;395(10223):497–506.

127. Chen C, Zhang XR, Ju ZY, He WF. Advances in the research of cytokine storm mechanism induced by Corona Virus Disease 2019 and the corresponding immunotherapies. Zhonghua Shaoshang Zazhi. 2020;36(0):E005.

128. Liu Y, Zhang C, Huang F, Yang Y, Wang F, Yuan J, et al. 2019-novel coronavirus (2019-nCoV) infections trigger an exaggerated cytokine response aggravating lung injury. 2020. http://www. chinaxiv.org/abs/202002.00018.

129. Lin L, Lu L, Cao W, Li T. Hypothesis for potential pathogenesis of SARS-CoV-2 infection–a review of immune changes in patients with viral pneumonia. Emerging Microbes Infections, 2020;9(1):727-732.

130. Guan WJ, Ni ZY, Hu Y, Liang WH, Ou CQ, He JX, et al. Clinical characteristics of 2019 novel coronavirus infection in China. N Engl J Med. 2020;undefined:undefined. doi:10.1056/ NEJMoa2002032.

131. Dan H, Maureen G, Richard B, Clark KL. Quantitative mRNA expression pro¢ling of ACE 2, a novel homologue of angiotensin converting enzyme. FEBS. 2002.

AAJMS [Formerly IJMS], August 2020;3(3):1-19;ISSNe 2522-7386

19

132. Wang D, Hu B, Hu C, Zhu F, Liu X, Zhang J, et al. Clinical characteristics of 138 hospitalized patients With 2019 novel coronavirus- infected pneumonia in Wuhan, China. JAMA. 2020; 323(11): 1061–1069.

133. Wan SX, Yi QJ, Fan SB, Lv G, Zhang X, Guo L, et al. Characteristics of lymphocyte subsets and cytokines in peripheral blood of 123 hospitalized patients with 2019 novel coronavirus pneumonia (NCP). medRxiv. 2020;undefined:undefined, doi:10.1101/2020.02.10.20021832.

134. Liu Q, Zhou YH, Yang ZQ. The cytokine storm of severe influenza and development of immunomodulatory therapy. Cell Mol Immunol. 2016;13 (1):3–10.

135. Ho J, Wu A, Lam B, Ooi GC, Khong PL, Ho PL, et al. Pentaglobin in steroid-resistant severe acute respiratory syndrome. Int J Tuberc Lung Dis. 2004;8(10):1173–1179.

136. Cui S, Chen S, Li X, Liu S, Wang F. Prevalence of venous thromboembolism in patients with severe novel coronavirus pneumonia. J Thromb Haemost. 2020;18(6):1421-1424.

137. Liu G, Li H. COVID-19: Attacks the 1-Beta Chain of Hemoglobin and Captures the Porphyrin to Inhibit Human Heme Metabolism. ChemRxiv. Preprint. 2020. https://doi.org/ 10.26434/chemrxiv.11938173.v7.

138. Alsamarai AGM, Alobaidi AHA, Alsamarai MAM. SARS-CoV-2: Treatment and Therapeutic Approaches. Aalborg Academy J Med Sci 2020;3(3):1-32: Online First.

139. Forman R, Atun R, McKee M, Mossialoss E. 12 Lessons learned from the management of the coronavirus pandemic. Health Policy (2020), https://doi.org/10.1016/j.healthpo

140. Long QX, Tang X, Shi Q, Li Q, Deng H, Yuan J, et al. Clinical and immunological assessment of asymptomatic SARS-CoV-2 infections. Letters, Nature Medicine 2020. www.nature.com/naturemedicine.

141. Ellinghaus D, Degenhardt F, Bujanda L, Buti M, Albillos A, Prati PI, et al. Genomewide association of severe COVID-19 with respiratory failure. New Eng J Med.org 2020.

AAJMS [Formerly IJMS], August 2020;3(3):20-63;ISSNe 2522-7386

21

REVIEW ARTICLES Association of Breast Cancer with Epstein- Bar Virus and Cytomegalovirus Infection: Histological Types and Risk Factors Sheylan Salah Abdulla, Erbil Polytechnic University, Health Technical College, Medical Laboratory Technique, Erbil, Iraq. Email: sheylan.salah@epu.edu.iq; sheylan2000@yahoo.com Mobile: +9647504244479 ORCID: http://orcid.org/0000-0001-8584-1391 Abdulghani Mohamed Alsamarai, Aalborg Academy College of Medicine [AACOM], Denmark. Tikrit University College of Medicine, [TUCOM], Tikrit, Iraq. Email:abdulghani.Mohamed@tu.edu.iq, galsamarrai@yahoo.com ; Mobile: +9647701831295, ORCID: http://orcid.org/0000-0002-7872-6691 Zainab Khalil Aljumaili, Kirkuk Health Authority, Kirkuk, Iraq Email: zkhzen@yahoo.com; Mobile: +9647730992311 ORCID: http://orcid.org/0000-0003-1723-1967 DOI: https://doi.org/10.32441/aajms.3.3.2

Correspondence author: Sheylan Salah Abdulla, Erbil Polytechnic University, Health Technical College, Medical Laboratory Technique, Erbil, Iraq. Email: sheylan.salah@epu.edu.iq; sheylan2000@yahoo.com Mobile: +9647504244479 ORCID: http://orcid.org/0000-0001-8584-1391 Received: 6/1/2020 Accepted: 13/6/2020 Published: 1st August, 2020 Abstract Cancer is one of the most important global health problems and it is the most common diagnosed cancer in women in developing and developed countries. Around two-thirds of new cases are in developed

AAJMS [Formerly IJMS], August 2020;3(3):20-63;ISSNe 2522-7386

22

countries. Breast cancer is also the most common cancer in females in developing countries with the age standardized incidence rate around 20 per 100,000. The factors that contribute to the international variation in incidence rates are largely due to the differences in reproductive and hormonal factors and the availability of early detection services, Incidence rates in some countries, including the United States, United Kingdom, France, and Australia, sharply decreased from the beginning of the millennium, partly due to lower use of combined postmenopausal hormone therapy. In all countries of the Arab world, breast cancer now occupies the number one position of all female malignancies. Cases tend to be young and almost half of patients are below 50, with a median age of 49-52 years as compared to 63 in industrialized nations. In recent years the higher increase in incidence of cancer worldwide is likely to be in the Eastern Mediterranean Region, where breast cancer is reported as the commonest type of female malignancy in almost all national cancer registries. Breast cancer ranks the first among cancers in Iraqi population and forms 16.28/100000. Additionally, breast cancer account for 34% of the reported cancer cases for the year 2018. The incidence of breast cancer in Iraqi women increased in the last two decades and forms one of the major threats to female health. Keywords: Breast cancer, Cytomegalovirus, Epstein-Barr virus, Eastern Mediterranean Region, Risk factor, Breast feeding, Parity, Menarche. I. Anatomy and physiology of the Breast Breasts develop as down growths from the epidermis along the milk line which runs obliquely from the axilla toward the groin on each side. The nipple and its simple system of ducts are present at birth, but full development does not occur until puberty, and then usually only in females. Continued estrogen secretion after onset of puberty leads to progressive enlargement and complexity of the breast [1], due initially to an increase in adipose tissue, and then the ductular system of the nipple becomes more complex, with branches extending into the adipose tissue [2]. Inside the breasts are located the mammary glands, modified sweat glands responsible for the production and secretion of milk, which are composed of 12-20 distinct lobes, with its own separate

AAJMS [Formerly IJMS], August 2020;3(3):20-63;ISSNe 2522-7386

23

opening at the nipple. Each lobe form of a branching ducts which penetrating deeply into the breast fibroadipose tissue. The branching duct system ends in a cluster of blind-ending terminal ductules, each cluster and its feeding duct comprising a mammary lobule. The terminal ducts and lobules are embedded in a loose fibrous support tissue, which is rich in capillaries and also contains a few lymphocytes, macrophages and mast cells [2,3]. The ducts are lined by cuboidal epithelium (luminal side) with an outer discontinuous layer of myoepithelial cells (basal surface). This polarity of cellular organization allows transport through the mammary epithelium in a single direction: secretion into the lumen. Contractile myoepithelial cells have the ability to generate a flow of milk through the ducts to the nipple [4]. Breast’s full functional activity is only reached under the

influence of pituitary (prolactin) and ovarian hormones (estrogen and progesterone), which are secreted in high concentrations during pregnancy and throughout breastfeeding. During the follicular phase of the menstrual cycle, cell proliferation is low and does not increase with the pre-ovulatory peak of estrogen. Following ovulation, progesterone stimulates up to three times the proliferation of the epithelial cells in the terminal ductules that become enlarged and begin to show evidence of early secretary activity. If fertilization does not occur, progesterone levels fall dramatically at the end of the menstrual cycle and the structure of the breast lobule reverts to normal along with some cell death. However, if fertilization occurs, increasing amounts of progesterone stimulate the continued proliferation and secretary activity in the terminal ductules of the lobule, in order to produce milk. When breastfeeding ceases, the breast returns to its normal state by gradual involution together with massive apoptosis leading to the loss of alveolar structures [2,5,6]. Throughout a woman’s lifetime the breast goes through a 450 cycles of growth and involution in response to hormones produced during the menstrual cycle and pregnancy [4]. As women age the amount of fibrocollagenous tissue in the breast increases, replacing some of the adipose tissue, and the mammary lobules become enclosed in dense collagen [2]. Knowledge of normal histological appearances is essential to recognize abnormal structures, and to

AAJMS [Formerly IJMS], August 2020;3(3):20-63;ISSNe 2522-7386

24

understand how the altered biochemical and physiological processes result in disease. II. Epidemiology Breast cancer is the most common form of malignancy affecting women worldwide [7,8] accounting for 23% of all cancers in women [9]. It is estimated that more than one million women are diagnosed with breast cancer every year worldwide [10]. Overall, one in ten women will develop breast cancer in their lifetime [11]. It is a leading killer in women. Its mortality is second to mortality from cancer of the lung and bronchus [11]. Despite significant developments seen in diagnostic as well as improvement in the early recognition and intensive treatment, every fourth women suffering from breast cancer dies because of progression of the illness [12]. Nowadays , breast cancer ranks as the fifth cause of death from cancer overall [13]. Around two-thirds of new cases are in developed countries. Breast cancer is also the most common cancer in females in developing countries with the age standardized incidence rate around 20 per 100,000 [9]. The factors that contribute to the international variation in incidence rates are largely due to the differences in reproductive and hormonal factors and the availability of early detection services, Incidence rates in some countries, including the United States, United Kingdom, France, and Australia, sharply decreased from the beginning of the millennium, partly due to lower use of combined postmenopausal hormone therapy [14]. In all countries of the Arab world, breast cancer now occupies the number one position of all female malignancies. Cases tend to be young and almost half of patients are below 50, with a median age of 49-52 years as compared to 63 in industrialized nations [15,16] . There is also a high rate of advanced or metastatic stage reaching 60 to 80% of cases, and high Mastectomy rates [10,15]. In recent years the higher increase in incidence of cancer worldwide is likely to be in the Eastern Mediterranean Region (EMR), where breast cancer is reported as the commonest type of female malignancy in almost all national cancer registries [17]. Breast cancer ranks the first among cancers in Iraqi population and forms 16.28/100000. Additionally, breast cancer account for 34% of the reported cancer cases for the year 2018 [18]. The incidence of

AAJMS [Formerly IJMS], August 2020;3(3):20-63;ISSNe 2522-7386

25

breast cancer in Iraqi women increased in the last two decades and forms one of the major threats to female health [19]. The age standardized incidence rate of breast cancer is 18.4/100000 for Iran, 22.4 for Saudi Arabia, 23.0 for Syria, 28.3 for Turkey, 31.1 for Iraq, 47.0 for Jordan, and 47.7 for Kuwait [20]. Al-Hashimi and Wang conducted incidence trends from 2000 to 2009 and included 23,792 cases reported that breast cancer in Iraqi women increased from 26.6 per 100000 in 2000 to 31.5 /100000 in 2009 [21], while it increased to 32/100000 in 2018 [18]. The incidence rate of breast cancer in Iraqi women is Iraqi National Programs for early detection of breast cancer were developed in order to decrease morbidity and mortality of breast cancer [22]. Age at which breast cancer diagnosed is with important implications since cancer in younger age group is more aggressive [23,24]. III. Histological Types of Breast Cancer 3.1. In Situ Breast Carcinoma Although the initiating steps and precise pathways of breast tumorigenesis remain poorly defined, it appears that nearly all invasive breast cancers arise from in situ carcinomas [25,26]. 3.1.1 Ductal Carcinoma in Situ (DCIS): Called intraductal carcinoma [26], accounts for approximately 20% of mammographically detected breast cancers [25]. Morphologically, DCIS resembles and often coincides with ductal and related (tubular, cribriform, mucinous) types of invasive breast cancer [27]. It can recur or progress to invasive breast cancer, but the ability to predict the outcome of patients with DCIS remains limited [25]. The pathological classification of ductal carcinoma in situ is based on the nuclear grade of the tumor cells (low, intermediate, or high), the architectural pattern of tumor growth (solid, papillary, micropapillary, cribriform, clinging, or cystic hypersecretory), and the presence or absence of comedonecrosis [25,26,28]. DCIS has no metastatic potential. Clinically, however, from 1% to 2% of patients with a diagnosis of pure DCIS subsequently develop metastases either because of occult invasion or the progression of unsuspected residual disease to Invasive breast cancer [25].

AAJMS [Formerly IJMS], August 2020;3(3):20-63;ISSNe 2522-7386

26

3.1.2 Lobular carcinoma in situ: The clinical significance of lobular carcinoma in situ has been debated since it was first described in 1941[29]. It is now considered a high-risk marker for the development of infiltrating breast carcinoma and not a premalignant lesion. Moreover, lobular carcinoma in situ is thought to be an incidental finding at breast pathology [30]. Intracytoplasmic vacuoles, pagetoid ductal involvement and loss of cohesion are characters of lobular carcinoma in situ; however, in ductal carcinoma in situ these three characters are absent. In contrast, microacini, absent in lobular carcinoma in situ, are present in ductal carcinoma in situ. In reality, the distinction is not always clear [29]. From the point of view of the differential diagnosis with DCIS, the two important immunohistochemical features of LCIS are the lack of reactivity for E-cadherin and ß-catenin [31]. The term “indeterminate in situ lesions” or “mixed type lesions” is used to

describe certain breast carcinomas in situ, in which the cytological or architectural properties and distribution deviated from the typical patterns, render it difficult, if not impossible, to determine whether the proliferation was lobular or ductal, based only on morphological criteria [32,33]. 3.2. Invasive breast carcinoma Invasive ductal (IDC) and lobular carcinomas (ILC) are the most common histological types of invasive breast cancer [34]. 3.2.1. Invasive ductal carcinoma not otherwise specified (IDC-NOS) This is the most common type, accounting for 75% of breast cancer cases. Microscopically, the tumor can grow in diffuse sheets, well-defined nests, cords, or as individual cells. Tubular/glandular differentiation may be well developed, hardly detectable, or altogether absent. The tumor cells vary in size and shape, but by definition they are larger and more pleomorphic than those of the classic form of invasive lobular carcinomas. There are more numerous figures of mitosis and more prominent nucleoli and nuclei. Areas of necrosis, foci of squamous metaplasia, apocrine metaplasia, or clear cell changes may be seen. The amount of stroma ranges from none to abundant, and its appearance from densely fibrotic to cellular (desmoplastic), with or without elastosis and calcifications [31].

AAJMS [Formerly IJMS], August 2020;3(3):20-63;ISSNe 2522-7386

27

3.2.1.1. Mucinous carcinoma: This type usually occurs in women after menopause and also named as colloid, gelatinous or mucoid carcinoma. Mucinous carcinoma is a rare histological type of breast cancer characterized by abundant production of extracellular and/or intracellular mucin [35]. Pure mucinous carcinomas (defined as tumors with more than 90% of mucinous component) account for up to 2% of all breast carcinomas, preferentially affect older women, and are usually associated with a good clinical outcome [36]..Such tumors are characterized by uniform neoplastic cells arranged in clusters floating in a large amount of mucin, nuclear atypia and mitotic figures are uncommon [35]. 3.2.1.2. Medullary carcinoma: It represents a rare breast cancer subtype [37], accounts for 1.1– 7% of all mammary carcinomas [38], and tends to affect patients of younger age [39]. Despite their aggressive morphology, with nuclear atypia and high mitotic indices [37]. 3.2.1.3. Tubular carcinoma: It is an uncommon histologic subtype, accounting for 1% to 4% of invasive breast cancer [40]. It has been shown to have a favorable prognosis as manifested by a low incidence of metastases and recurrences and an excellent overall survival [41]. 3.2.1.4. Inflammatory carcinoma (IC): Inflammatory breast carcinoma is a rare, aggressive tumor associated with poor outcome owing to early metastases [42]. The diagnosis depends on clinical (erythema, edema and breast heat without any pain) and/or histological findings (any subtype of breast carcinoma with tumor emboli in the dermal lymphatics or/and tumor emboli in the vessels) [43]. Recent studies have demonstrated that E-cadherin is always over-expressed in inflammatory breast cancer specimen and cell lines [44]. 3.2.1.5. Paget Disease: It is accompanied in nearly all instances by an underlying breast carcinoma of in situ ductal type, with or without associated stromal invasion. Specifically, it is characterized by a red, oozing, crusted lesion which is often unresponsive to topical steroid and antibiotics [45]. Microscopically, large clear cells with atypical nuclei are seen within the epidermis, usually concentrated along the basal layer but

AAJMS [Formerly IJMS], August 2020;3(3):20-63;ISSNe 2522-7386

28

also permeating the Malpighian layer. The cells can be isolated or in clusters, and sometimes they form small glandular structures [31]. 3.2.2. Invasive lobular carcinoma (ILC): (Classic Type) Also known as infiltrating lobular carcinoma is a type of breast cancer that starts in a lobule and spreads to surrounding breast tissue. ILC comprises approximately 10-15% of breast cancers and appears to have a distinct biology [46]. Data from a recent epidemiologic study indicate that for unknown causes the incidence of this type of breast cancer is increasing, especially among postmenopausal women [47]. Replacement hormonal therapy may be implicated as the underlying cause [48]. Microscopically, classical ILC is characterized by the presence of small and relatively uniform tumor cells growing singly, in Indian file, and in a concentric (pagetoid) fashion around lobules involved by in situ lobular neoplasia [31], less well appreciated is a group of variant forms of ILC, which includes solid, alveolar, mixed, apocrine, signet-ring, histiocytoid, and tubulolobular variants [49,50]. Lobular carcinomas are more likely to be ER and PR positive and to have normal p53 status and low to absent HER-2 [46], with loss of expression of E-cadherin and β-catenin [51] as Inactivation of E-cadherin by mutation, loss of heterozygosity, or methylation is considered a characteristic of ILC [52]. ILC has a tendency to spread diffusely or between the collagen fibers of the breast and produces little desmoplastic response with a substantially increased propensity for multifocal and multicentric distribution and for bilaterality [53]. Metastatic IDC commonly involves the lung, bones and liver, whereas ILC can spread on the surfaces of the leptomeninges and peritoneum; permeate through the walls of the gastrointestinal tract organs, uterus, and ovaries; and diffusely infiltrate through the retroperitoneal soft tissues [48,54,55]. Now, it seems reasonable to conclude that at least four groups of women are at increased risk for lobular breast cancer: women with lobular breast cancer and a family history of breast cancer, women with a known CDH1 mutation, women from families with diffuse gastric cancer in whom no CDH1 mutation has yet been identified; and women with a germline BRCA2 mutation [56].

AAJMS [Formerly IJMS], August 2020;3(3):20-63;ISSNe 2522-7386

29

3.2.2.1. Mixed Ductal and Lobular Breast Carcinomas Biphasic carcinomas which are composed in part of a component with definite features of invasive ductal carcinoma and in part of a component with definite features of invasive lobular carcinoma do occur, but they are very rare. These tumors, of course, should be distinguished from the cases in which two separate neoplasms of different microscopic appearances are present in the same breast [31]. IV. Prognosis Despite the huge number of discovered prognostic and predictive factors for breast cancer, the American Society of Clinical Oncology has concluded that most of them are not satisfactory yet to be recommended for general clinical use. The factors that are currently used include: staging (size of the tumor), lymph node involvement and distant metastasis, grading, ER, progesterone receptor (PR) and human epidermal receptor-2 neu (HER2/neu) expression [57-59]. Patients with breast cancer grouped according to disease extent and these groups referred to as tumor staging. The first clinical staging system was the Columbia Clinical Classification, which was developed in the 1940-50's. In 2002, a new system was introduced adopted by the International Union against Cancer and the American Joint Committee on Cancer. This system is the one currently in use and is based on the principle of the tumor size (T), nodes involvement (N) and metastases (M) known as TNM [60]. These factors are only prognostic for breast cancer death regardless of other tumor characteristics but do not predict response to therapy. Lymph node involvement is another important independent prognostic factor. Women with lymph node involvement and increasing number of affected lymph nodes are associated with poorer prognosis [61]. Finally, metastasis is a third factor of clinical importance. In general, women with distant metastasis have a median overall survival time of only 2 years [62]. Tumor grade is the classification of the differentiation of the tumor into three groups: low, high and moderate. High grade cancers may be faster growing and more likely to spread. Grading was first introduced by Greenough in 1925 and modified by Bloom and Richardson in 1957, using three criteria; glandular formation, cell size and shape and proliferation. Currently the most commonly used

AAJMS [Formerly IJMS], August 2020;3(3):20-63;ISSNe 2522-7386

30

grading system is the Nottingham histological grade [63]. Grade is moderately reproducible [64] but is nevertheless a prognostic factor used after adjustment for tumor size and lymph node involvement. The most important predictive markers is the expression of two members of the steroid hormone receptor group, ER and PR. Expression of ER and PR is associated with better survival and higher response rate to hormonal therapy. Women expressing both receptors have 80% better response, women expressing only ER have 30% and women who do not express either of the two receptors do not respond to estrogen receptor modulators [65]. The last few years a huge effort has been given to discover expression profiles that could eventually prove useful to predict the likelihood of breast cancer recurrence and response to treatment. The following four gene expression assays Oncotype DX (evaluates the likelihood of breast cancer recurrence and assesses the benefit of adjuvant chemotherapy), Mamma Print test (to predict the likelihood of breast cancer recurrence within five to 10 years), Rotterdam Signature (predict risk of breast cancer recurrence), and the Breast Cancer Gene Expression Ratio (to help predict recurrence of breast cancer) are under investigation and for the first two expression profiles trials are underway to confirm their clinical value [66]. V. Invasion and Metastasis One of the most lethal aspects of breast tumors is their ability to invade the surrounding normal mammary tissue and re-locate to other sites in the body distal to the primary tumor, whereby tumor growth begins anew (metastasis). While the process by which cancer cells lose adherence to the primary tumor and develop migratory and invasive capacities has been well-described at the cellular level, the progression of invasion is still poorly understood at the molecular level [67,68]. Cancer cells from a primary tumor enter lymphatic and blood vessels, circulate through the bloodstream, and settle down to grow within normal tissues elsewhere in the body. Malignant tumors mostly metastatised to other sites if not treated. In contrast, some tumors are with very low potential for metastasis such basal cell carcinoma and glioma. When tumor cells metastasize, the new tumor is known as a secondary or metastatic tumor, and often displays properties of the original (primary) tumor. Metastasis can occur long after the apparent elimination of the primary tumor. In breast cancer,

AAJMS [Formerly IJMS], August 2020;3(3):20-63;ISSNe 2522-7386

31

metastases have been known to occur decades after the primary treatment [68]. Cancer cells can exist in three separate states in a secondary site, solitary cells in quiescence, active pre-angiogenic micro metastases, in which proliferation is balanced with apoptosis and no net increase in tumor size occurs, and vascularize metastases, either small and clinically undetectable, or large and detectable by current technology [69]. The spread of cancer cells may occur via the blood or the lymphatic system or through both routes. Some tumors metastised to particular organs [70]. Successful formation of metastases requires angiogenesis at the primary tumor, down regulation of cohesive molecules, increased motility of tumor cells, invasion into neo-vessels, tumor cell embolism, arrest and attachment in capillary beds of distant organs, extravasations and proliferation in the organ parenchyma and re-establishment of angiogenesis when the tumor reaches > 1-2 mm in size [67]. VI. Risk Factors of Breast Cancer A wide variety of factors have been incremented in the aetiology of breast cancer. Some of these factors have been causatively related to the disease and are called “established” risk

factors; other has a suspected association with breast cancer and is called “speculated” risk factors. While the rest are still have little or

no scientific support and are called unsupported risk factors [71]. 6.1 Gender Simply being female is the most important risk factor for breast cancer. Although men can do develop breast cancer, the disease is 100 times more likely to occur in women than in men. Women are at higher risk of breast cancer because they have much more breast tissue than men do. In addition, the female hormone estrogen promotes the development of breast cancer [72]. 6.2 Age The incidence of breast cancer increases with age, doubling about every 10 years until menopause, when the trend of increase slows dramatically [73]. The peak of breast cancer incidence around menopause might be due to the physiological hormonal changes [74]. Breast cancer is uncommon in younger women. Several studies have shown that women who develop breast cancer in their 20s and 30s have a poorer prognosis and worse survival with more biologically

AAJMS [Formerly IJMS], August 2020;3(3):20-63;ISSNe 2522-7386

32

aggressive cancers and higher rates of proliferation and lymphovascular invasion than older patients with cancers of the same stage [75]. In developed countries about 0.3%, 4% and 19% of breast cancer cases are younger than 30, in their 30s and in their 40s respectively [76]. Patients under 30 year age form about 5% while about 75% of cases occurred in women older than 40 years of age [77]. In Iraq there has been a sharp increase in the incidence of this tumor in younger age groups. Recent study in Iraq indicated a shift of breast cancer development toward younger age group [78]. Age distribution indicated that 52.7% of breast cancer cases were in women with age of < 30 years and odd ratio confirmed a significant association between age and breast cancer development. Women with age of 21 to 30 years show the higher frequency of breast cancer as compared to other age groups. 6.3 Benign Breast Disease A history of benign breast disease has been shown to confer a 2 to 3 fold increase in risk for the subsequent occurrence of breast cancer. Moreover, only 5% of breast cancer patients reported earlier benign breast disease [79]. The various types of benign breast disease are not all associated with the same degree of risk; some types have little or no effect on the risk. While others may represent early stages in the progression to breast cancer. Women with severe atypical epithelial hyperplasia have 4 to 5 times higher risk of developing breast cancer than women who do not have any proliferate changes in their breast. Women with this change and a family history of breast cancer (first degree relative) have nine folds increase in risk [73, 80,81]. Women whose earlier breast biopsies detected proliferative breast disease without atypical or usual hyperplasia have a slightly higher risk of breast cancer (1.5 to 2 times greater than other women). Furthermore, fibrocystic changes without proliferative breast disease do not affect breast cancer risk [82,83]. Several studies have also assessed the relation between palpable breast cyst and breast cancer, studies that have followed up groups of women with cysts diagnosed mainly or exclusively by aspiration have all suggested that patient with palpable breast cysts are at an increased

AAJMS [Formerly IJMS], August 2020;3(3):20-63;ISSNe 2522-7386

33

risk of breast cancer, which range from 1.7 to 7.5 times that expected [84]. 6.4 Previous Breast Cancer A woman who has previously had breast cancer has a three to four times increased risk of developing a new cancer in the other breast. Such a new or second cancer arises from a completely different location and should not be confused with a cancer that has recurred or metastasized from another site [80]. The likelihood of a new cancer increases by 0.5% to 0.7% each year after the original diagnosis. After 20 years, a woman has a 20% to 15% chance of developing a new breast cancer [71]. 6.5 Family History/Genetic Factors The most important risk factor for breast cancer, besides advanced age, is a family history of breast cancer [85]. Development of breast cancer increased in women with family history of breast cancer and the risk increased in those with history in the first degree family relatives. The risk is even higher if more than one first-degree relative had breast cancer, or if the relative developed breast cancer at an early age, or in both breasts [86-88]. Approximately 5% to 10% of breast cancer cases result from inherited mutations in breast cancer susceptibility genes, such as BRCA 1 and BRCA 2 [89,90]. The absolute risk of breast cancer mutation carriers has not been estimated precisely, but seems to be at least 50% by age 50 years with little increase in risk after the menopause [91]. The inheritable type of breast cancer is characterized by an early age onset, bilaterality, an autosomal dominant mode of inheritance and associated with other cancer. Susceptibility to breast cancer is inherited as an autosomal dominant trait, whereas the allele generally behaves as a recessive allele in somatic cells. On average, half of the off spring of a parent with BRCA 1 or BRCA 2 mutation will inherit the same mutation and the females will be at high risk of breast cancer [92]. There is increasing evidence that BRCA1 and BRCA2 are classic tumor suppressor genes and not oncogenes creating a protein that repairs DNA and prevents carcinogenesis. Every cell in mutation carriers has been demonstrated to lack one functional allele (i.e. the tumor-suppressor function of that gene is lost); a situation that favors cancer development [93-95].

AAJMS [Formerly IJMS], August 2020;3(3):20-63;ISSNe 2522-7386

34

The BRCA1 is a large gene, encoding a messenger RNA (mRNA) of 1865 amino acids. It is expressed during cellular proliferation and its function is necessary for cell proliferation and tissue differentiation. Recent research has suggested that BRCA 1 protein may also have more specific roles in controlling the rate of cellular proliferation, ensuring the fidelity of DNA duplication, maintaining genome integrity and/or preventing the replication of damaged DNA [96]. At the present time over 250 different disease causing mutations, scattered throughout the genes, have been discovered [97]. It has been estimated that between 1 in 2000 and 1 in 500 in the general population carry high risk mutations in BRCA 1, Mutations in BRCA1 account for breast cancer in about 50% of families with three or more cases of early onset breast cancer [98]. The lifetime risk of breast cancer in women with BRCA 1 mutations was estimated to be 87%. Recent studies of women who develop breast cancer at a very young age indicate that 13% of those who are diagnosed with breast cancer under the age of 30 years, and 7% of women who are diagnosed with breast cancer under the age of 35 years, have gremlin BRCA 1 alterations [99]. The cumulative risk of developing a second breast cancer was estimated to be 60-80% of affected mutation carriers who live to the age of 70 years [100]. The BRCA 2 is almost twice as large as BRCA 1 and so even more complex to screen fully for mutations. It encodes a protein of 3418 amino acids [101]. Over 100 mutations have been described in BRCA 2 [102]. Women with BRCA 2 mutations appear to have a breast cancer risk similar to that of women with BRCA 1 mutations (about 70% by age 70 years) [100]. Many studies were done in many Arab and Asian countries and all of them concluded that BRCA1 and BRCA2 mutations are likely to contribute to the pathogenesis of familial breast cancer [92,103,104]. Another gene associated with breast cancer is the human P53 gene. This gene is known to be a tumor suppressor gene that can be inactivated by point mutations. The risk of breast cancer is increased in women of families suffering from Li-Fraumeni syndrome, which is an autosomal dominant cancer syndrome [105]. The onset of breast cancer is often at a very early age (20-30 years) [106]. Rarely, people suffering from cowden disease, which is a rare autosomal dominant

AAJMS [Formerly IJMS], August 2020;3(3):20-63;ISSNe 2522-7386

35

syndrome, are more liable to develop breast cancer due to the presence of PTEN gene [107,108]. The risk breast cancer in women with cowden disease is 30-50% by age 50 years [109]. It is often bilateral and typically is diagnosed at a younger than average age [110]. In our recent study in Iraq, P53 mean serum level was significantly higher in women with breast cancer as compared to control [111]. Another gene, encoded by sequences on chromosome 2, named BARD 1 (BRCA 1-associated RING-domain 1) has recently been identified [112]. The role of BARD1 in the development of both sporadic and familial breast and ovarian cancer is currently under investigation. Many other cancer related genes, such as myc, erb B2, cyclin D1, M dhi and Tsg 101, have been shown to be involved in the tumorigenesis of breast cancer [113]. 6.6 Reproductive Factors Several studies have suggested that reproductive factors influence breast cancer risk through their effect on cell proliferation and DNA damage, as well as promotion of cancer growth [114,115]. Women who reach menarche at a relatively early age (12 or younger) and these who reach menopause at a relatively late age (55 or older) are more likely than other women to develop breast cancer [111] . Those relationships are believed to be mediated through the effect of estrogen, and the risk of breast cancer is associated with the period of exposure of breast tissue to the hormone [71,116,117]. Estrogen action is mediated by a nuclear receptor, the estrogen receptor [118]. Two studies performed in Iraq reported increased mean serum levels of estrogen and progesterone receptors in women with breast cancer [78,119]. The increase in breast cancer risk, associated with a five-year increase in age at menopause, is about 17%. Similarly, the decrease in breast cancer risk associated with a two-year delay in menarche is about 10% [71]. Women who have a natural menopause after the age of 55 are twice as likely to develop breast cancer as women who experience the menopause before the age of 45. Furthermore, women who undergo bilateral oophorectomy before the age of 35 have only 40% of the risk breast cancer of women who have a natural menopause [73].

AAJMS [Formerly IJMS], August 2020;3(3):20-63;ISSNe 2522-7386

36

Another important reproductive factor is age at first full term pregnancy [111]. Nulliparity and late age at first full term birth both increase the life time incidence of breast cancer [120]. The risk of breast cancer in women who have their first full term baby after age of 30 is about twice that of women who have their first child before the age of 21 year [73]. Several studies have been done in different developed countries, as in Northern Italy, a case control study was conducted at 2000 by Vecchia [121]. This study confirms that age at first full term birth is the major determinant of subsequent breast cancer risk while the age at subsequent birth has independent effect. Similar results have been reported from different studies conducted in developed and developing countries. In a case control study carried out in Spain, it was found that breast cancer risk decreased with increasing number of full term pregnancies and also it indicates that parity is an independent risk factor associated to breast cancer [122]. Pregnancy may reduce breast cancer risk by bringing about persistent changes in the mammary gland that make the breast less susceptible to carcinogenic factors[123]. Recent study in Kirkuk, Iraq, indicated that serum mean value of prolactin, progesterone receptor, estrogen receptor, glucose, HbA1C and calcium were significantly higher in women with breast cancer than in controls [119]. However, circulating estrogen, progesterone, IGF-1, parathyroid hormone, and vitamin D mean values were significantly higher in controls as compared to that in women with breast cancer [124]. In addition, another study performed in Erbil, Iraq, indicated nulliparity and non married women are risk factors for development of breast cancer [111]. However, they found that increased parity and pregnancy are with protective effect against development of breast cancer. 6.7 Obesity and Physical Inactivity Breast cancer risk increased in obese postmenopausal women [125]. Fat cells liberate some estrogen and obese postmenopausal women, therefore, tend to have higher blood estrogen levels than lean women do. Obesity does not seem to be a risk factor for breast cancer in premenopausal women [71,126]. However, most studies indicated that overweight is a risk factor for breast cancer development in postmenopausal women. Some studies have found that timing of weight gain and body fat distribution could be more significant

AAJMS [Formerly IJMS], August 2020;3(3):20-63;ISSNe 2522-7386

37

factors of an increased risk. Obesity and central fat distribution are believed to act through endocrine intermediates such as hyper insulinaemia and steroid hormones. Since obesity is one of the few breast cancer risk factors that can be modified. The influence of weight loss, particularly in women at high risk, deserves to be further investigated [127]. The degree of obesity, age at onset of obesity, weight gain (peri to post menopausal) and possibly body fat distribution are the major determinants of post menopausal estrogen levels which might be the key risk factors for post menopausal breast cancer [128]. Physical activity has been thought to be associated with a reduction in breast cancer risk. In a review article conducted by Gammon [129], covered 16 published studies on recreational physical activity. Ten were case-control studies, and a risk reduction was found in 8 of them which ranged from 26% to 60%. The other six were cohort studies, where the results observed ranging from 50% reduction in risk to a 20% increase in risk. There is some evidence that exercise delays age at menarche associated with an earlier age at menopause, with a reduction in life time estrogen exposure and this may be the causal link observed. A recent scientific workshop concluded that available evidence supports a small inverse (protective) association between physical activity and breast cancer. The protective effects may be greater among lean women, women who have carried children to term, and premenopausal women. The underlying mechanism of this potential protection are not well understood, although it has been hypothesized that the benefit may be due to the effects of physical activity on hormones, energy balance, and the immune system [130]. 6.8 Exposure to High Doses of Radiation Women who were exposed to high doses of radiation, especially association has been observed both among atomic bomb survivors and among women who received high-dose radiation for medical purposes. Doubling of the risk together with a dose response relationship was observed in some studies [131,132]. The risk has been found to be increased among medical diagnostic X-ray workers, especially in those who have been worked more than 25 years and those who are exposed before the age of 30 years [133,134].The low dose radiation exposures involved in modern X-ray (including chest

AAJMS [Formerly IJMS], August 2020;3(3):20-63;ISSNe 2522-7386

38

X-ray and mammograms) have not been associated with any measurable increase in breast cancer risk [71]. 6.9 Alcohol Consumption Alcohol is the dietary factor most consistently associated with an increased breast cancer risk. A meta-analysis of more than 50 epidemiologic investigations suggested that the equivalent of two drinks a day may increase breast cancer risk by approximately 25%. This increased risk is dose-dependant, and exists regardless of the type of alcoholic beverage consumed. [135]. A recent pooled analysis of cohort studies also concluded that alcohol consumption is associated with a linear increase in breast cancer incidence, and that reducing alcohol intake may be a useful strategy for reducing breast cancer risk for regular consumers of alcohol [136]. A case-control study conducted by Levi [137] in Switzerland concluded that alcohol is a correlate of breast cancer risk in the European population and alcohol could explain 25% of breast cancer cases of this population. The same association was consistent for wine, beer and spirits. 6.10 Breast-feeding Breast-feeding may modestly reduce the risk of developing breast cancer and may play as protective factor [111]. Many studies, reported that women who breast-fed had a decreased risk of developing breast cancer (ranging from 10%-64%) compared to women who never breast-fed [138,139]. The others reported that breast-feeding had no influence on the risk of developing breast cancer [140]. Additionally, women age at first birth and number of children influence breast-feeding and thus these may be risk factors for breast cancer. Finally, it is also possible that breast-feeding has different effects on the risk of developing premenopausal breast cancer compared to postmenopausal breast cancer [141]. Compared with parous women who never breast fed, women who had breastfed for 25 months or more had a lower relative risk. If women who do not breastfed or who breastfed for less than 3 months were to do so for 4 to 12 months , breast cancer among parous premenopausal women could be reduce by 11% , if all women with children lactated for 24 months or longer , the incidence might be reduced by nearly 25[142]. Women who were breastfed as infants , even if only for a short time , showed an approximate 25% lower risk of developing premenopausal

AAJMS [Formerly IJMS], August 2020;3(3):20-63;ISSNe 2522-7386

39

or postmenopausal breast cancer ,compared to women who were bottle-fed as an infant, Lactation provides a hypo estrogenic effect with less stimulation of the endometrial lining . This event may offer a protective effect from endometrial cancer [143] 6.11 Diet There are conflicting results concerning the relationship between dietary fat and breast cancer. Many U.S. studies have found no association between the two; however, international findings suggest that breast cancer rates are minimal in countries where the standard diet is low in fat [144]. Food pattern consumption is associated with breast cancer risk [145]. The effect of diet on the risk of breast cancer is probably exerted via its influence on hormone metabolism. Epidemiological evidence indicates that the nutrition determines the levels of circulating estrogen, and may affect the risk of breast cancer [146]. The ideal condition to determine the risk of breast cancer associated with a dietary exposure is to compare an intervention group with a control group which is restricted from related exposures (null contamination). In the Women's Health Initiative Dietary Modification trial, a randomized, controlled, primary prevention trial with over forty-eight thousand participants, Rohan and colleagues [147] showed that a benign proliferative breast disease not influence by modest reduction in increase in vegetable, grain and fruit intake with low consumption of fat. 6.12 Smoking of Tobacco There is some evidence that a small increase in breast cancer risk may be associated with cigarette smoking. . Also smoker women may carry a poor prognosis. In a case-control study conducted in Switzerland, between 1992 and 1993, active and passive exposure to tobacco smoke found to increase the risk of breast cancer [148]. In a cohort study conducted in USA, current smoking was significantly related to fatal breast cancer risk. This association was also increased with the increasing number of cigarettes smoked per day and with total number of years of smoking. [149]. On the other hand, many studies showed no association between tobacco smoking and breast cancer risk. In a well designed case-control study conducted in USA, showed no association between breast cancer risk and tobacco

AAJMS [Formerly IJMS], August 2020;3(3):20-63;ISSNe 2522-7386

40

smoking, nor were any apparent relationship, with more detailed exposure measures [150]. 6.13 Duration of Pregnancy and Risk of Breast Cancer Women who have had a pregnancy interruption might be at increased risk of breast cancer, compared with women have delivered at term, in incomplete pregnancy, the breast is exposed only to the high estrogen levels of early pregnancy and thus may be responsible for the increased risk seen in these women. However, some other studies have found no association between abortions and increased risk of breast cancer [151]. Epidemiological studies of the relation between abortions that occur during the first trimester of pregnancy and risk of breast cancer have yielded conflicting results [152]. Hsieh and colleagues [153], shows a possible link between delivery during third trimester of pregnancy and breast cancer risk. They report a significantly increased risk of breast cancer among women aged 40 years and older who have a premature delivery, compared with women who delivered at term. Another study conducted by Ekbom and colleagues [154], they concluded that the risk of breast cancer increased two-fold in women whose babies were born before 33 weeks of gestation (OR=3.96), compared with women who delivered before 37 weeks (OR=1.17). About induced abortion as a risk of breast cancer many studies have been conducted. Daling et al. [155] concluded that women with history of induced abortion have a 20% increased risk of breast cancer than those who had not. The increase risk appeared to be confirmed to nulliparous women. He also concluded that there was no excess risk of breast cancer associated with induced abortion among parous women. Another study concluded that induced abortion among significant independent risk factors for breast cancer, regardless of parity or timing of abortion relative to the first full term pregnancy [156]. 6.14 Hormones associated with breast cancer Hormonal factors associated with breast cancer development in women include endogenous and exogenous oestrogens, progesterone and prolactin.

AAJMS [Formerly IJMS], August 2020;3(3):20-63;ISSNe 2522-7386

41

6.14.1 Exogenous Hormone Use 6.14.1.1 Oral Contraceptives Most oral contraceptive formulations are a combination of ethinyl estradiol or mestranol and a progestin. Initial concern focused on the possibility that the hormones in an oral contraceptive would provide higher levels of estrogen and progestin during an oral contraceptive cycle than the woman would have produced during a normal ovulatory cycle [157]. The Collaborative Group on Hormonal Factors published a reanalysis of data from 54 epidemiological studies which specifically collected detailed information on oral contraceptive use [158]. The results showed that ever use of oral contraceptives was associated with a very small increase in risk (relative risk 1.07). The greatest risk was observed among current users, with the risk decreasing after stopping use. There was no increased risk in women who had discontinued use 10 or more years ago. Odd ratio and AUC not confirmed a positive association between oral contraceptive and breast cancer development in one of our study [111], while other study shows a positive association [119]. 6.14. 1.2 Hormone Replacement Therapy The increase in breast cancer risk associated with hormone replacement therapy depends on the duration of exposure and whether estrogen is used alone or in combination with progestin's. A reanalysis of data from 51 studies reported that current or recent use of hormone replacement therapy increases the relative risk of breast cancer by 2.3% for each year of use [159]. Long-term use for five years or more among current or recent users appears to be associated with a 30 – 50% increase in breast cancer risk [160]. Current evidence suggests that use of estrogen alone increases breast cancer risk more modestly than combination hormone use (estrogen plus progesterone). In these combined regimens, progestins may enhance the proliferative effects of estrogen [161]. Several large scale population-based epidemiologic studies have shown that adding a progestin to estrogen regimens increases breast cancer risk after five years of use from 10% (estrogen alone) to 30% (combined estrogen and progestin) [161]. Data from Women’s

Health Initiative Randomized Controlled Trial showed a 27% increase

AAJMS [Formerly IJMS], August 2020;3(3):20-63;ISSNe 2522-7386

42

in breast cancer risk in the estrogen plus progesterone treatment [162]. 6.14. 2. Endogenous Hormone 6.14. 2.1. Estrogen The steroid hormone group of estrogens induces responses in the reproductive tract, mammary tissue, and pituitary gland during the reproductive process, as well as playing roles in non-reproductive processes, such as bone formation and cardiovascular health [163]. The ovary is the main source of estrogen during most of the reproductive period, except during pregnancy, when the placenta is the main source. In premenopausal women, the serum levels of estrogens, mainly in the form of estradiol (E2), is 100 pg/ml during the follicular phase and approximately 600 pg/ml at the time of ovulation, but levels of estrogen, mainly estriol (E3) elevates to nearly 20,000 pg/ml during pregnancy. The level of estrogen falls to less than 20 pg/ml after menopuase, when estrone (E1) becomes the dominant forms. The growth and differentiation of ductal cells in breast tissue are stimulated by estrogens, which also plays an indirect role in the development of the mammary glands [164]. Estrogen normally binds to SHBG (Sex- hormone binding globulin) (approximately 37%). “Non-SHBG-bound hormone”

(approximately 2% free estrogen) and estrogen bound to albumin (approximately 61%) are referred to as bioavailable [165] and affect target cells, including both normal and malignant breast cells. The serum concentration of bioavailable estradiol is thought to be more strongly associated with the risk of breast cancer than the total level of estradiol [165,166]. Estrogen bound to SHBG is also available to responsive tissues, where it reduces cell proliferation, so that a reduction in the binding capacity of SHBG results in more rapid proliferation in steroid-sensitive tissue such as breast cells [165]. In premenopausal women, the bibding capacity of SHBG is higher than that in postmenopausal women and an association between the levels of SHBG and ER has been detected in connection with postmenopausal, but not premenopausal breast cancer [167]. From conception until the 30th week of pregnancy, the level of SHBG is 6 to 10-fold higher in pregnant women than in those who are not pregnant [168].

AAJMS [Formerly IJMS], August 2020;3(3):20-63;ISSNe 2522-7386

43

A number of investigations on the difference in serum estrogen levels between pregnant compared and non-pregnant women and its association with the risk of breast cancer have been published. One review [169] concluded that the mean estrogen level in premenopausal women is 12% higher in those diagnosed with breast cancer, while another similar review on postmenopausal women arrive at a 15% higher value for those with breast cancer [170]. A meta-analysis on 9 prospective studies revealed that high levels of serum estrogen are associated with higher risk of postmenopausal breast cancer [171]. It has also been reported that the elevated level of estrogen during the first trimester of pregnancy is positively associated with the risk of developing breast cancer before 40 years of age, but that this association becomes negative at more advanced age [172]. Moreover, a European study observed that the estrogen levels in women diagnosed with breast cancer is higher than in control subjects three year prior to diagnosis [170]. The association between estrogen and breast cancer risk appears to be independent of family history [172]. Women with breast cancer show increased mean serum levels of ER in Iraqi community. [111,119]. 6.14. 2.2 Progesterone Progesterone is secreted by the ovary during most of the reproductive period, but primarily by the corpus luteum and placenta during pregnancy [173]. The main responsibilities of progesterone are to prepare the uterine muscles for implementation of the fertilized ovum and then support the pregnancy by inducing the proliferation and differentiation of uterine muscles to protect early embryonic development [174]. Whereas, Progesterone acts through its own receptor, and its levels may be important in breast carcinogenesis. Breast epithelial cell growth is related to progesterone levels [175]. The cell growth of the breast is greatest during the luteal phase of the menstrual cycle when levels of progesterone are highest, suggesting that progesterone may enhance breast cell growth [176]. Progesterone is expressed in the majority of breast carcinoma tissues and considered an important mediator of hormonal additive therapy in human breast tumors [177]. A possible association between the level of progesterone and risk of breast cancer remains unclear: certain reports have shown a negative association with premenopausal women [178], while no

AAJMS [Formerly IJMS], August 2020;3(3):20-63;ISSNe 2522-7386

44

association was found for postmenopausal women [179] or all cases of breast cancer [179,180]. However, estrogen and progesterone might interact to elevate the risk of breast cancer; the so-called (estrogen plus progesterone hypothesis) [178]. In Iraqi women with breast cancer, two studies demonstrated increased serum levels of PR as compared to controls [111,119]. 6.14. 2.3 Prolactin Prolactin was first determined as a hormone that plays an important role in the breast cancer initiation and development in rodents, and later partly in humans. In the culture there is evidence of a direct stimulatory role of prolactin on mammary epithelial cells and the breast cancer cells. Prolactin may play active roles in tumor development by stimulating angiogenesis and activating pathways involved in cellular adhesion and motility [181]. Serum prolactin concentrations in some breast cancer patients and women at risk of developing familial breast cancer may be increased [182]. Prolactin is generated by tumors and by a variety of normal tissues, placenta being the richest source of the extra pituitary prolactin and responsible for high levels in human amniotic fluid. The immune system, uterus, brain, dermal fibroblasts [182], human breast tissues and cells also produce prolactin. Prolactin levels decrease with each additional pregnancy [182,183] and concentrations are higher in nulliparous than porous women and among women using certain types of oral contraceptive [183]. VII. ABO Blood Group Polymorphism and Breast Cancer Although the relation between ABO blood group and cancer was the subject of intensive research in the mid 1900’s, there has been

renewed interest after the recent publication of reports establishing associations between ABO blood groups and different types of malignancies [184,185]. Usually older studies reject the association, but recent studies confirm the association between ABO blood groups and specific subtypes of breast cancer like ductal or familial [186]. ABO blood group system as risk factor for breast cancer were studied [187]. Group A is more predominant in women with breast cancer and in these women the treatment response are not satisfactory and with high recurrence rate [186,188]. In contrast, women with blood group O are with resistance for the development of breast cancer and if they developed the cancer, their survival will be

AAJMS [Formerly IJMS], August 2020;3(3):20-63;ISSNe 2522-7386

45

more than the other women with different blood groups. The cause of these findings is not definite, but it seems that genetic products of this genetic position allele can have antigenic role [186,187]. ABO blood groups are erythrocyte-surface antigens coded for by a gene locus mapped at 9q34.2 region, and represented by three alleles (I*A, I*B and I*O). Alleles I*A and I*B are co-dominantly inherited, but both of them are dominant over the allele I*O [189]. Antigens of blood group has an important biologic role in the immunological system and effect on some tumors development like breast cancer [190]. The ABO antigen expressed on the surface of malignant cells appears to be different from the antigen expressed on normal tissue [191]. The different expression of antigens on the surface of cancer cells might alter motility, apoptosis and immune escape [192]. Thus cancer initiation and metastasis may be influenced by these mechanisms. The loss or presence of blood group antigens can increase cellular motility or facilitate the interaction between tumor cells and endothelial cells of distant organs [193]. The deficiency of B or A epitope has been reported in many cancer type and this is associated with accumulation of their precursor, which causes enhanced malignancy. Blood group carbohydrate antigens on the surface of cancer cells can be regarded as an end product of tumor progression that can be used as useful prognostic and diagnostic markers [194].Many studies documented the susceptibility to cancer development and blood groups [187]. With respect to breast cancers, some investigators suggested that blood groups may possess a predictive value independent of other known prognostic factors, and augmented further that a degree of the susceptibility to breast cancer, from a gene perspective, might be a result of a breast cancer-susceptibility locus linked to the ABO locus [190]. In this regard, it has been observed that blood group A women have a generalized tendency to worse outcomes and a more rapid progression with this cancer, and they have poorer outcomes. In contrast, blood group O has been shown to infer a slight degree of resistance against breast cancer, and a significantly lower risk of death [186]. Breast cancer was more predominant in women with blood group A in a study performed in Erbil, Iraq [111].

AAJMS [Formerly IJMS], August 2020;3(3):20-63;ISSNe 2522-7386

46

VIII. Viruses and Breast Cancer A viral a etiology is one recently evocated theory behind the physiopathology of breast cancer [195-197]. Viruses may induce cancers through multiple mechanisms which related to the virus direct bor indirect oncogens or induction of immunosprresion [198-200]. Among the putative viruses observed in BC tissue, the presences of HCMV and EBV of the Herpesviridae family have been implicated as a cause of breast cancer. There was significance of EBV expression in breast tissue of young patients with breast cancer[201] and this finding confirmed by polymerase chain reaction (PCR)-based studies, positive correlation was shown [202], and the presence of EBV DNA was associated with more severe forms of breast cancer [203]. Human Cytomegalovirus had be shown to be involved in many cancers including malignant glioma, and prostate, skin, and colorectal cancers [204]. Increasing evidence in the last 10 years suggests that HCMV is associated with several human malignancies, and that HCMV gene products can modulate oncogenic properties of cells in vitro [205]. Since persistent of HCMV infection of breast epithelium could, in theory, promote malignant transformation of infected breast epithelium, that sought to determine the HCMV gene products in normal and neoplastic breast [206]. The risk factors for development of breast cancer is the high seroprevalence of CMV in Iraqi community [207-210]. References 1.Nelson CM, Bissell MJ. Of extracellular matrix, scaffolds, and

signaling: tissue architecture regulates development, homeostasis, and cancer. Ann Rev Cell Dev Biol 2006; 22: 287-309.

2. Stevens A, Lowe JS. Human Histology 2005; 3rd ed., Mosby, Spain.

3. Seeley RR, Stephens TD, Tate P. Anatomia & Fisiologia 2007; 6ª ed., Lusociência, Loures.

4. Hinck L, Näthke I. Changes in cell and tissue organization in cancer of the breast and colon. Curr Opin Cell Biol 2014; 26: 87-95.

5. Brisken C. Progesterone signalling in breast cancer: a neglected hormone coming into the limelight. Nat Rev Cancer 2013; 13(6): 385–96.

AAJMS [Formerly IJMS], August 2020;3(3):20-63;ISSNe 2522-7386

47

6. Vogel VG. Breast Cancer Prevention: A Review of Current Evidence. CA Cancer J Clin 2000; 50(3): 156-170.

7. Mettlin C. Global breast cancer mortality statistic. CA Cancer J Clin 1999; 49:138-44.

8. Khair R, Musa M. Evaluation of cytopathology in diagnosing breast cancer in Khartoum. KMJ 2009; 02:169-71.

9. Anothaisintawee T. Risk prediction models of breast cancer: a systematic review of model performances. Breast Cancer Res Treat 2012; 133:1–10.

10. Tfayli A, Temraz S, AbouMrad R. Breast Cancer in Low-and Middle-Income Countries: An Emerging and Challenging Epidemic. Hindawi Publishing Corporation Jo 2010; 1:5 pages.

11. DeSantis C, Siegel R, Priti B, Jemal A. Breast Cancer Statistics 2011. CA CANCER J CLIN 2011; 61:409–18.

12. Brzozowska A, Sodolski T, Duma D, Mazurkiewicz T, Mazurkiewicz M. Evaluation of prognostic parameters of E-cadherin status in breast cancer treatment. Ann Agric Environ Med 2012; 19:541-546.

13. Parkin M, Pisani P, Ferlay J. Global Cancer Statistics. CA Cancer J Clin 1999; 49:33-64.

14. Jemal A, Bray F, Center M, Ferlay J, Ward E, Forman D. Global Cancer Statistics 2011. CA Cancer J Clin 2011; 61:69–90.

15. El Saghir NS, Khalil MK, Eid T. Trends in epidemiology and management of breast cancer in developing Arab countries: a literature and registry analysis. Int J Surg 2007; 5:225-33.

16. Salim E, Moore M, Al-Lawati J, Al-Sayyad J, Bawazir A , Bazarbashi S, et al. Cancer Epidemiology and Control in the Arab World -Past, Present and Future. Asian Pac J Cancer Prev 2009; 10:3-16.

17. International Agency for Research on Cancer. Globocan 2008. Lyon, IARC Press, 2010. http://globocan.iarc.fr/

18. Ministry of Health. Iraqi Cancer Registry, 2018. 19. Alwan N. Iraqi initiative of a regional comparative breast cancer

research project in the Middle East. J Cancer Biol Res 2014;2:1016.

20.Globocan. Breast cancer incidence and mortality worldwide, 2008. International Agency for Research on Cancer; 2010.

AAJMS [Formerly IJMS], August 2020;3(3):20-63;ISSNe 2522-7386

48

21.Al-Hashimi MM, Wang XJ. Breast cancer in Iraq, incidence trends from 2000-2009. Asian Pacific J Cancer Prev 2014;15:281-286.

22.WHO. National Cancer Control Programs. Policies and managerial guidelines, 2 nd. Ed.Geneva, World Health Organization,2002.

23. Najjar H, Easson A. Age at diagnosis of breast cancer in Arab nations. Int J Surg 2010; 8:448-452.

24. Swanson GM, Lin CS. Survival patterns among younger women with breast cancer: the effect of age, race, stage, and treatment. J Natl Cancer Inst Monogr 1994;16:69-77.

25. Wiechmann L, Kuerer M. Molecular Journey from Ductal Carcinoma in Situ to Invasive Breast Cancer. Cancer 2008;112:2130-42.

26. Burstein HJ, Polyak K, Wong JS, Lester SC, Kaelin CM. Ductal Carcinoma in Situ of the Breast. N Engl J Med 2004; 350:1430-41.

27. Buerger H, Simon R, Schäfer K-L, Diallo R, Littmann R, Poremba C, et al. Genetic relation of lobular carcinoma in situ, ductal carcinoma in situ, and associated invasive carcinoma of the breast. J Clin Pathol Mol Pathol 2000; 53:118–21.

28. Virnig BA, Tuttle TM, Shamliyan T, Kane RL. Ductal Carcinoma in Situ of the Breast: A Systematic Review of Incidence, Treatment, and Outcomes. J Natl Cancer Inst 2010; 102:170–78.

29. Georgian-Smith D, Lawton TJ. Calcifications of Lobular Carcinoma in Situ of the Breast: Radiologic–Pathologic Correlation. AJR 2001;176:1255–59.

30. Rosen PP. Rosen's breast pathology. Philadelphia: Lippincott-Raven 1997:507–544.

31. Rosai JR. Breast: In: Rosai and Ackerman's Surgical Pathology, 10th edition. Mosby Elsevier Incorporation, China 2011; 2(chapter20):1660-1733.

32. Gomes DS, Balabram D, Porto SS, Gobbi H. Lobular neoplasia: frequency and association with other breast lesions. Diagnostic Pathology 2011; 6:74.

33. Jacobs TW, Pliss N, Kouria G, Schnitt SJ. Carcinomas in situ of the breast with indeterminate features: role of E-cadherin staining in categorization. Am J Surg Pathol 2001; 25:229-36.

34. Gokalp G, Topal U. A typical invasive ductal carcinoma: Two cases. EJR 2009; 71:e19–e22.

AAJMS [Formerly IJMS], August 2020;3(3):20-63;ISSNe 2522-7386

49

35. Lacroix M, Suarez PH, MacKay A, Lambros MB, Natrajan R, Savage K. Mucinous carcinoma of the breast is genomically distinct from invasive ductal carcinomas of no special type. J Pathol 2010; 222:282–98.

36. Barkley CR, Ligibel JA, Wong JS. Mucinous breast carcinoma: a large contemporary series. Am J Surg 2008; 196:549–51.

37. Flucke U, Flucke T, Hoy L, Breuer E, Goebbels R, Rhiem K. Distinguishing medullary carcinoma of the breast from high-grade hormone receptor-negative invasive ductal carcinoma: an immunohistochemical approach. Histopathology 2010; 56:852–59.

38. Rakha EA, Putti TC, Abd El-Rehim DM. Morphological and immunophenotypic analysis of breast carcinomas with basal and myoepithelial differentiation. J. Pathol 2006; 208:495–506.

39. Anderson WF, Chu KC, Chang S. Comparison of age-specific incidence rate patterns for different histopathologic types of breast cancer. Cancer Epidemiol. Biomarkers Prev. 2004; 13:1128–35.

40. Diab SG, Clark GM, Osborne CK. Tumor characteristics and clinical outcome of tubular and mucinous breast carcinomas. J Clin Oncol 1999; 17:1442-48.

41. Rakha EA, Lee AH, Evans AJ, Menon S, Assad NY, Hodi Z, et al. Tubular Carcinoma of the Breast: Further Evidence to Support Its Excellent Prognosis. JCO 2010; 28:99-104.

42. Robertson FM, Bondy M, Yang W, Yamauchi H, Wiggins S, Kamrudin S, et al. Inflammatory Breast Cancer: The Disease, the Biology, the Treatment. Cancer J Clin 2010; 60:351–75.

43. Caumo F, Manfrin E, Bonetti F, Pinali L, Procacci C. Radiologic pathologic correlation of the mammographic findings retrospectively detected in inflammatory breast cancer: usefulness in clinical practice. Radiol Oncol 2002; 36:275-80.

44. Dong HM, Liu G, Hou YF, Wu J, Lu JS, Luo JM, et al. Dominant-negative E-cadherin inhibits the invasiveness of inflammatory breast cancer cells in vitro. J Cancer Res Clin Oncol 2007; 133:83–92.

45. Kollmorgen DR, Varanasi JS, Edge SB, Carson WE. Paget's disease of the breast: a 33-year experience. J Am Coll Surg 1998;187:171-77.

AAJMS [Formerly IJMS], August 2020;3(3):20-63;ISSNe 2522-7386

50

46. Arpino G, Bardou VJ, Clark GM. Infiltrating lobular carcinoma of the breast: tumor characteristics and clinical outcome. Breast Cancer Res 2004; 6:R149-R156.

47. Okada N, Hasebe T, Iwasaki M, Tamura N, Tanaka S. carcinoma among older women. Hum Pathol 2010; 41:960–70.

48. Carcoforo P, Raiji MT, Langan RC, Lanzara S, Portinari M, Maestroni U, et al. Infiltrating Lobular Carcinoma of the Breast Presenting as Gastrointestinal Obstruction: A Mini Review. BJC 2012; 3:328-32.

49. Dusmez D, Egilmez R, Aydin O, Polat A. Pleomorphic lobular carcinoma of the breast: Brief communication Li CI, Anderson BO, Porter P. Changing incidence rate of invasive lobular. T J Cancer 2001; 31:158-61.

50. Hanby AM, Hughes TA. In situ and invasive lobular neoplasia of the breast. Histopathology 2008; 52:58–66.

51. Dabbs DJ, Bhargava R, Chivukula M. Lobular versus ductal breast neoplasms: the diagnostic utility of p120 catenin. Am J Surg Pathol 2007; 31:427-37.

52. Cristofanilli M, Gonzalez-Angulo A, Sneige N, Kau SW, Broglio K, Theriault RL, et al. Invasive Lobular Carcinoma Classic Type: Response to Primary Chemotherapy and Survival Outcomes. J Clin Oncol 2005; 23:41-48.

53. Gümüş H, Mills P, Jones S, Jones P, Fish D, Gümüş M, et al.

Invasive lobular carcinoma: The concordance of pathologic tumor size with magnetic resonance imaging. J Breast Health 2012; 8:81-85.

54. Ferlicot S, Salomon A. Wide metastatic spreading in infiltrating lobular carcinoma of the breast. Eur J Cancer 2004; 40:336-41.

55. Winston C, Hadar O. Metastatic lobular carcinoma: patterns of spread in the chest, abdomen, and pelvis on CT. AJR Am J Roentgenol 2000; 175:795-800.

56. Schrader KA, Masciari S, Boyd N, Wiyrick S, Kaurah P, Senz J, et al. Hereditary diffuse gastric cancer: association with lobular breast cancer. Familial Cancer 2008; 7:73–82.

57. Bast RC, Ravdin P, Hayes DF, Bates S, Fritsche H, Jessup JM, et al. 2000 update of recommendations for the use of tumor markers in breast and colorectal cancer: clinical practice guidelines of the

AAJMS [Formerly IJMS], August 2020;3(3):20-63;ISSNe 2522-7386

51

American Society of Clinical Oncology. J Clin Oncol. 2001; 19(6):1865-78.

58. Weigel MT, Dowsett M: Current and emerging biomarkers in breast cancer: prognosis and prediction. Endocr Relat Cancer 2010; 17:R245-R262.

59. Ly A, Lester SC, Dillon D: Prognostic factors for patients with breast cancer: traditional and new. Surg Pathol 2012; 5:775-785.

60. Singletary SE, Allred C, Ashley P, Bassett LW, Berry D, Bland KI, et al. Revision of the American Joint Committee on Cancer staging system for breast cancer. J Clin Oncol 2002; 20(17):3628-36.

61. Cianfrocca M, Goldstein LJ. Prognostic and predictive factors in early-stage breast cancer. Oncologist. 2004; 9(6):606-16.

62. Giordano SH, Buzdar AU, Smith TL, Kau SW, Yang Y, Hortobagyi GN. Is breast cancer survival improving? Cancer. 2004 ; 100(1): 44-52.

63. Elston CW, Ellis IO. Pathological prognostic factors in breast cancer. I. The value of histological grade in breast cancer: experience from a large study with long-term follow-up. Histopathology 1991;19(5):403-10.

64. Meyer JS, Alvarez C, Milikowski C, Olson N, Russo I, Russo J, et al. Breast carcinoma malignancy grading by Bloom-Richardson system vs. proliferation index: reproducibility of grade and advantages of proliferation index. Mod Pathol 2005;18(8):1067-78.

65. Lapidus RG, Nass SJ, Davidson NE. The loss of estrogen and progesterone receptor gene expression in human breast cancer. J Mammary Gland Biol Neoplasia 1998;3(1):85-94.

66. Harris L, Fritsche H, Mennel R, Norton L, Ravdin P, Taube S, et al. American Society of Clinical Oncology 2007 update of ecommendations for the use of tumor markers in breast cancer. J Clin Oncol 2007; 25(33):5287-312.

67. Li CY, Shan S, Cao Y, Dewhirst MW. Role of incipient angiogenesis in cancer metastasis. Cancer Metastasis Rev 2000; 19(1): 7-11.

68. Karrison TG, Ferguson DJ, Meier P. Dormancy of mammary carcinoma after mastectomy. Journal of the National Cancer Institute 1999; 91 (1): 80-85.

AAJMS [Formerly IJMS], August 2020;3(3):20-63;ISSNe 2522-7386

52

69. Demicheli R, Retsky MW, Swartzendruber DE, Bonadonna G. New model of breast cancer metastatic development. Annals of Oncology: Official Journal of the European Society for Medical Oncology / ESMO 1997; 8 (11):1075-1080.

70. Chambers AF, Groom AC, MacDonald IC. Dissemination and growth of cancer cells in metastatic sites. Nature reviews. Cancer 2002; 2 (8): 563-572.

71. Meister K, Morgan J . Risk factors of breast cancer: A report by the American Council on Science and Health (ACSH) 2000; 25p. http:/www.acsh.org.

72. Greenlee RT, Hill-Harmon MB, Murray T, et al. Cancer statistics 2001. CA-A Cancer Journal for Clinicians 2001; 15: 15-36.

73. McPherson K, Steel GM, Dixon JM. Breast cancer-epidemiology, risk factors, and genetics. In: ABC of Breast Disease. Dixon M (Ed), 2nd ed, BMJ Books is an imprint of the BMJ publishing group 2000; pp. 26-36.

74. WHO. Cancer of the cervix uteri and breast: Changes in incidence rates in Bombay over the last two decades. Bull WHO 1986; 64(3): 431-434.

75. Winchester DP, Osteen RT, Menck HR. The national cancer data base report on breast carcinoma characteristics and outcome in relation to age. Cancer 1996; 78: 1838-1843.

76. Ries LAG, Eisner MP, Kosary CG, Hankey BF, Miller BA, Clegg L, et al. SEER cancer statistics review, 1973-1998. National Cancer Institute. Bethesda, MD; 2001.

77. El-Zaemey S, Nagib N, Fritschic L, Heyworth J. Breast cancer among Yemeni women using the National Oncology Centre Registry 2004–2010. Cancer Epidemiol 2012; 36: 249-253.

78. Alsamarai AGM, Abdulla SS. Breast cancer frequency rate shift toward younger age in Iraq. Int J Scint Res Sci Eng Tech 2015;1(5):407-414.

79. Hutchinson WP, Thomas DB, Hamlin W, Roth GJ, Peterson AV, Williams B. Risk of breast cancer in women with benign and malignant breast disease. J Nat Cancer Inst 1999; 65(1): 21.

80. Hartmann LC, Sellers TA, Frost MH, Lingle WL, Degnim AC, Ghosh K, et al. Benign breast disease and the risk of breast cancer. N Engl J Med 2005; 353(3):229-37.

AAJMS [Formerly IJMS], August 2020;3(3):20-63;ISSNe 2522-7386

53

81. Goldacre M, Abisgold J, Yeates D. Benign breast disease and subsequent breast cancer: English record linkage studies. J Pub Health 2010; 32:565–71

82. Dupont WD, Page DL. Risk factors for breast cancer in women with proliferative breast disease. N Eng J Med 2000; 312: 146.

83. Bodian CA. Benign breast diseases, carcinoma in situ, and breast cancer risk. Epidemiol Rev 1993; 15:177-87

84. Bruzzi P, Dogliotti L, Naldoni C, et al. Cohort study of association of risk of breast cancer with cyst type in women with grass cystic disease of the breast. BMJ 1997; 314: 925-928.

85. Geertruida HD, Christi JA, Josephine MD, et al. How women with a family history of breast cancer and their general practitioners act on genetic advice in general practice: prospective longitudinal study. BMJ 2001; 322: 26-28.

86. Hulka BS, Stark AT. Breast cancer: cause and prevention. Lancet 1995; 346: 883-887.

87. Claus EB, Stowe M, Carter D .Family history of breast and ovarian cancer and the risk of breast carcinoma in situ. Breast Cancer Res Treat 2003; 78 (1): 7-15.

88. Saxena S, Rekhi B, Bansal A, Bagga A, Murthy NS. Clinicomorphological patterns of breast cancer including family history in a New Delhi hospital, India-A cross-sectional study. World J Surg. Oncol 2005; 3: 67-74.

89. Burke W, Daly M, Garber J, Botkin J, Ellis Kahn MJ. Recommendations for follow-up care of individuals with an inherited predisposition to cancer. II. BRCA1 and BRCA2. JAMA 1997; 277: 997-1003.

90. Domchek SM, Friebel TM, Singer CF. Association of risk reducing surgery in BRCA1 or BRCA2 mutation carriers with cancer risk and mortality. JAMA 2010; 304: 967-975.

91. Li FP, Fraumeni JF, Mulvihill JJ, et al. A cancer family syndrome in twenty-four kindreds. Cancer Res 1998; 48: 5358-5362.

92. El-Harith AE, Abdel-Hadi MS, Doerk T, Badr AN, Schmidtke J. The potential benefits of genetic testing in breast and ovarian cancer. Saudi Medical J. 1999; 20(9): 663-670.

93. Blanco A, Graña B, Fachal L, Santamariña M, Cameselle-Teijeiro J, Ruíz- Ponte C, Carracedo A, Vega A. Beyond BRCA1 and

AAJMS [Formerly IJMS], August 2020;3(3):20-63;ISSNe 2522-7386

54

BRCA2 wild-type breast and/or ovarian cancer families: germline mutations in TP53 and PTEN. Clin Genet 2010; 77: 193-196

94. Holt JT, Thompson ME, Szabo C, Robinson-Benion C, Arteaga CL, King MC, et al. Growth retardation and tumor inhibition by BRCA1. Nat Genet 1996; 12: 298-302.

95. Turnbull C, Rahman N. Genetic predisposition to breast cancer: past, present, and future. Ann Rev Genomics Hum Genet 2008; 9:321–345

96. Bertwistle D, Ashworth A. Functions of the BRCA1 and BRCA2 genes. Curr Opin Genet Devel 1998; 8: 14-20.

97. Couch FJ, Weber BL. Mutations and polymorphism in the familial early onset breast cancer (BRCA1) gene. Breast cancer information care. Hum Mut 1996; 8: 8-18.

98. Easton DF, Narod SA, Ford D, Steel M. The genetic epidemiology of BRCA1. Lancet 1994; 344: 761.

99. Langston AA, Malone KE, Thompson JD, et al. (1996). BRCA1 mutations in a population based sample of young women with breast cancer. N Engl J Med 1994; 334: 137-142.

100. Ford D, Easton DF, Bishop DT, Narod SA, Goldgar, DE. Risk of cancer in BRCA1 mutation carriers. Breast cancer linkage consortium. Lancet 1994; 343: 692-705.

101. Kinzler KW, Vogelstein B. Cancer-susceptibility genes. Gatekeepers and Caretakers. Nature 1997; 386: 761-763.

102. Sakorafas GH, Glinatsis MT. Oncogenes and cancer. the genetic basis of cancer. Latriki 1994; 65: 36-51.

103. Stuckey A. Breast cancer: epidemiology and risk factors. Clinical Obstetrics Gynecology. 2011;54(1):96-102

104. Alobaidi AHA, Jalaly A, Alsamarai AM. Biomarkers in women with breast cancer: I:CEA, CA 15.3, CA 27-29, BRCA1, and BRCA2 predictive value. Int J Scint Res Sci Eng Tech 2015;1(4):342-349.

105. Malkin D, Li FP, Strong LC, et al. Germline p53 mutations in a familial syndrome of breast cancer, sarcomas and other neoplasms. Science 1990; 250: 1233-1238.

106. Eeles RA. Predictive testing for germline mutation in the p53 gene: are all the questions answered? Eur J Cancer 1993; 29A: 1361-1385.

AAJMS [Formerly IJMS], August 2020;3(3):20-63;ISSNe 2522-7386

55

107. Hanseen AMN, Fryns JP. Cowden syndrome. J Med Genet 1995; 32: 117-119.

108. Freihoff D, Kempe A, Beste A, Wappenschmidt B, Kreyer E, Hayashi, et al. Exclusion of a major role for the PTEN tumor-suppressor gene in breast carcinomas. Br J Cancer 1999; 79: 754-758.

109. Rhei E, Kang L, Bogomolniy F, Federici MG, Borgen PI, Boyd J .Mutation analysis of the putative tumor suppressor gene PTEN/MMAC1 in primary breast carcinomas. Cancer Res 1997; 57: 3657-3659.

110. Sakorafas GH, Tsiotou AG. Genetic predisposition to breast cancer: a surgical perspective. BJS 2000; 87: 149-162.

111. Abdulla SS. Risk Assessment for Epestin-Barr and Cytomegalo Viruses Infection in Women with Breast Cancer. Ph D Thesis, Tikrit University College of Science, 2016, Iraq.

112. Wu LC, Wang ZW, Tsan JT, Spillman MA, Phung A, Xu XL, et al. Identification of a RING protein that interacts in vivo with the BRCA1 gene product. Nat Genet 1996; 14: 430-440.

113. Itoh H, Houlston R, Harocopos C, Slack J. Risk of cancer death in first-degree relatives of patients with heriditary non-polyposis cancer syndrome (lynch type II): a study of 139 kindreds in the United Kindom. Br J Surg 1990; 77: 1367-1370.

114. Colditz GA. Relationship between estrogen levels, use of hormone replacement therapy, and breast cancer. J Nat Cancer Inst 1998; 90: 814-822.

115. American Cancer Society. Breast cancer facts and figures 2011–

2012. American Cancer Society, Atlanta; 2011. 116. Clavel-Chapelon F, Gerber M. Reproductive factors and breast

cancer risk. Do they differ according to age at diagnosis? Breast Cancer Res Treatment. 2002; 72(2):107-15.

117. Russo J, Moral R, Balogh GA, Mailo D, Russo IH. The protective role of pregnancy in breast cancer. Breast Cancer Res 2005; 7:131–142

118. Speirs V, Kerin MJ. Prognostic significance of estrogen receptor B in breast cancer. B J of Surgery 2000, 87: 405-409.

119. Alobaidi AH, Jalaly A, Alsamarai AGM, Sarhan HH. Biomarkers in women with breast cancer:II: Hormones, calcium,

AAJMS [Formerly IJMS], August 2020;3(3):20-63;ISSNe 2522-7386

56

vit D, glucose, and IGF predictive value. World J Pharmacy Pharmacet Sci 2015;4(7):74-100.

120. Jatoi I, Anderson WF. Qualitative age interactions in breast cancer studies: a minireview.Future Oncol 2010; 6:1781–1788.

121. Vacchia CL, Decarli A, Parazzain F, et al. General epidemiology of breast cancer in Northern Italy. Int J Epidemiol 2002; 16(3): 347-355.

122. Roman JM, Escriba JM, Casas I, et al. Age at first full-term pregnancy, lactation and parity and risk of breast cancer: a case control study in Spain. Eur J Epidemiol 1996; 12(5): 449-453.

123. Opdahl S, Alsaker MD, Jansky I, Romundstad PR, Vatten LJ. Joint effects of nulliparity and other breast cancer risk factors. Br J Cancer 2011; 105:731–736

124. Antonsson A, Bialasiewicz S, Rockett RJ, Jacob K, Bennett IC, Sloots TP. Exploring the prevalence of ten polyomaviruses and two herpes viruses in breast cancer. PLoS One 2012, 7:e39842. doi:10.1371/journal.pone.0039842

125. Harris HR, Tamimi RM, Willett WC, Hankinson SE, Michels KB. Body size across the life course, mammographic density, and risk of breast cancer. Am J Epidemiol 2011; 174:909–918

126. Boyd NF, Martin LJ, Yaffe MJ, Minkin S . Mammographic density and breast cancer risk: current understanding and future prospects. Breast Cancer Res 2011, 13:223.

127. Pujol P, Galtier DF, Bringer J. Obesity and breast cancer risk Hum. Br J Cancer 1997; 12(1): 116-125.

128. Kuller LH. The etiology of breast cancer, from epidemiology to prevention. Public Health Rev 1995; 23(2): 157-213.

129. Gammon MD, John EM, Britton JA. Recreational occupational physical activities and risk of breast cancer. J Natl Cancer Inst 1998; 90: 100-117.

130. Friedenreich CM, Neilson HK, Lynch BM. State of the epidemiological evidence on physical activity and cancer prevention. Eur J Cancer 2010; 46:2593–2604.

131. Land CE. Studies of cancer and radiation dose among atomic bomb survivors: the example of breast cancer. JAMA 1995; 274:402–407

AAJMS [Formerly IJMS], August 2020;3(3):20-63;ISSNe 2522-7386

57

132. Cordero A, Sánchez MJ, López CA, Pimentel ML, García RA, et al. Risk factors in the development of breast cancer, state of Mexico. Nutr Hosp 2012; 27: 1631-1636.

133. Wang JX, Jia WH, Li BX. Risk and influential factors of female breast cancer among medical diagnostic X-ray workers in China. Chug-Hua Lin Hsing Ping Hsuech Tsa 1996; 17(6): 325-327.

134. Celmon M, Lojiens L, Goss P. Breast cancer risk following irradiation for Hodgkin's disease. Cancer treats Rev 2000; 26:291.

135. Chen WY, Rosner B, Hankinson SE, Colditz GA, Willett WC Moderate alcohol consumption during adult life, drinking patterns, and breast cancer risk. JAMA 2011; 306:1884–1890.

136. Tjonneland A, Christensen J, Olsen A et al. Alcohol intake and breast cancer risk: the European prospective investigation into cancer and nutrition (EPIC). Cancer Causes Control 2007; 18:361–

373. 137. Levi F, Pasche C, Lucchini F, et al. Alcohol and breast cancer in

the Swiss canton of Vaud. Eur J Cancer 1996; 32(12): 2108-2113. 138. Lord SJ, Bernstein L, Johnson KA, Malone KE, McDonald JA,

Marchbanks PA, Simon MS, Strom BL, Press MF, Folger SG, Burkman RT, Deapen D, Spirtas R, Ursin G. Breast cancer risk and hormone receptor status in older women by parity, age of first birth, and breastfeeding: a case-control study. Cancer Epidemiol Biomarkers Prev. 2008; 17(7): 1723-30

139. Ramon JM, Escriba JM, Casas I, Benet J, Iglesias C, Gavalda L, Torras G, Oromi J. Age at first full term pregnancy, lactation and parity and risk of breast cancer .Eur J Epidemiol 1996; 12:449-53.

140. Martin RM, Middlton N, Gunnell D, Owen CG, Smith GD. Breast feeding and cancer :the Boyd Orr cohort and a systematic review with meta- analysis. J Nat Cancer Inst 2005; 97:1446-57.

141. Clarke CA, Purdie DM, Glaser SL. Population attributable risk of breast cancer in white women associated with immediately modifiable risks factors .BMC Cancer .2006; 6:170.

142. Siskind V. Breast cancer and breastfeeding .American J Epidemiology 1998; 130:229-236.

143. Freudenheim J. Exposure to breast milk in infancy and the risk of breast cancer. Epidemiology 1994; 5:324-331.

144. Schulz M, Hoffmann K, Weikert C, Nöthlings U, Schulze MB, Boeing H. Identification of a dietary pattern characterized by high-

AAJMS [Formerly IJMS], August 2020;3(3):20-63;ISSNe 2522-7386

58

fat food choices associated with increased risk of breast cancer: the European Prospective Investigation into Cancer and Nutrition (EPIC)-Potsdam Study. Br J Nutr 2008; 100(5):942-6.

145. Brennan SF, Cantwell MM, Cardwell CR, Velentzis LS, Woodside JV Dietary patterns and breast cancer risk: a systematic review and meta-analysis. Am J Clin Nutr 2010; 91: 1294-1302.

146. Wu AH, Pike MC, Stram DO. Meta-analysis: dietary fat intake, serum estrogen levels, and the risk of breast cancer. J Natl Cancer Inst1999; 91: 529-534.

147. Rohan TE, Negassa A, Chlebowski RT, Ceria-Ulep CD, Cochrane BB, Lane DS, Ginsberg M, Wassertheil-Smoller S, Page DL. A randomized controlled trial of calcium plus vitamin D supplementation and risk of benign proliferative breast disease. Breast Cancer Res Treat 2009; 116 : 339-350.

148. Morbia A, Bernstein M, Heritier S, Khatchatrian N. Relation of breast cancer with passive and active exposure to tobacco. Am J Epidemid 1996; 143(9): 918-928.

149. Calle EE, Miracle McMahill HL, Thun MJ, Heath CW. Cigarette smoking and risk of fetal breast cancer. Am J Epidemiol 2005; 139(10): 1001-1005.

150. Brinton LA, Schairer C, Stanford JL, Hoover RV. Cigarette smoking and breast cancer. Am J Epidemiol 2003; 123(4): 614-620.

151. Erlandsson G, Montgomery SM, Cnattingius S, Ekbom A. Abortions and breast cancer: record-based case-control study. Int J Cancer 2003; 103(5): 676-679.

152. Melbye M, Wohlfahrt J, Olsen JH. Induced abortion and the risk of breast cancer. N Engl J Med 1997; 336: 81-81.

153. Hsieh CC, Lambe M, Trichopoulos D, Adami HO, Ekbom A. A delivery of premature newborns and maternal breast cancer risk. Lancet 1999; 353: 1239.

154. Ekbom A, Hsieh CC, Lipworth L, Adami HQ, Trichopoulos D. Intrauterine environment and breast cancer risk in women: a population based study. J Nat Cancer Inst 1997; 89: 71-76.

155. Daling JR, Brinton LA, Voigt LF. Risk of breast cancer among white women following induced abortion. Am J Epidemiol 1996; 144(4): 373-380.

AAJMS [Formerly IJMS], August 2020;3(3):20-63;ISSNe 2522-7386

59

156. Brind J, Chinchill VM, Severs WB, Summy-Long J. Induced abortion as an independent risk factor for breast cancer: a comprehensive review and meta-analysis. J Epidemiol Community Health 1996; 50(5) : 81-496.

157. Bernstein L. Epidemiology of endocrine-related risk factors for breast cancer. J Mammary Gland Biol Neoplasia 2002; 7:3-15.

158. Collaborative Group on Hormonal Factors in Breast Cancer. Breast cancer and hormonal contraceptives: collaborative reanalysis of individual data on 53 297 women with breast cancer and 100 239 women without breast cancer from 54 epidemiological studies. Lancet 1999; 347:1713-27.

159. Collaborative Group on Hormonal Factors in Breast Cancer. Breast cancer and hormone replacement therapy: collaborative reanalysis of data from 51epidemiological studies of 52,705 women with breast cancer and 108,411women without breast cancer. Lancet 1997; 350:1047-59.

160. Hulka BS, Moorman PG. Breast cancer: hormones and other risk factors. Maturitas 2001; 38:103-13.

161. Bernstein L. Epidemiology of endocrine-related risk factors for breast cancer. J Mammary Gland Biol Neoplasia 2002; 7:3-15.

162. Heiss G, Wallace R, Anderson GL, et al. Health risks and benefits 3 years after stopping randomized treatment with estrogen and progestin. JAMA 2008; 299:1036-45.

163. Hewitt SC, Korach KS. Estrogen receptors: structure, mechanisms and function. Reviews Endocrine Metabolic Disorders 2002; 3 (3) : 193-200.

164. Gargett CE, Rogers P. Human endometrial angiogenesis. Reproduction. 2001;121(2):6-181.

165. Nachtigall LE. Sex hormone-binding globulin and breast cancer risk. Primary Care Update Ob/Gyns. 1999;6(2):39-45

166. Hankinson SE. Endogenous hormones and risk of breast cancer in postmenopausal women. Breast Disease 2006; 24(1):3-15.

167. Fortunati N, Catalano M, Boccuzzi G, Frairia R. Sex Hormone-Binding Globulin (SHBG), estradiol and breast cancer. Molecular Cellular Endocrinology 2010; 316(1):86-92.

168. Kelly JA, Vankrieken L, Eng E. Sex hormone binding globulin and the assessment of androgen status. Eur Eng Diagnostic Products Corporation 1997.

AAJMS [Formerly IJMS], August 2020;3(3):20-63;ISSNe 2522-7386

60

169. Innes KE, Byers TE. Preeclampsia and breast cancer risk. Epidemiology 1999:32-722.

170. Thomas HV, Reeves GK, Key TJ. Endogenous estrogen and postmenopausal breast cancer: a quantitative review. Cancer Causes & Control. 1997; 8(6):8-922.

171. Key T, Appleby P, Barnes I, Reeves G. Endogenous sex hormones and breast cancer in postmenopausal women: reanalysis of nine prospective studies. J Natl Cancer Inst 2002; 94(8):16-606.

172. Lukanova A, Surcel HM, Lundin E, Kaasila M, Lakso HA, Schock H, et al. Circulating estrogens and progesterone during primiparous pregnancies and risk of maternal breast cancer. Int J Cancer 2012; 130(4):20-910.

173. Peck JD, Hulka BS, Savitz DA, Baird D, Poole C, Richardson BE. Accuracy of fetal growth indicators as surrogate measures of steroid hormone levels during pregnancy. Am J Epidemiol 2003;157(3):66-258.

174. Micheli A, Muti P, Secreto G, Krogh V, Meneghini E, Venturelli E, et al. Endogenous sex hormones and subsequent breast cancer in premenopausal women. Int J Cancer 2004;112(2):8-312.

175. Woolcott CG, SenGupta SK, Hanna WM, and Aronson KJ. Estrogen and progesterone receptor levels in nonneoplastic breast epithelium of breast cancer cases versus benign breast biopsy control. BMC Cancer 2008; 8(130):1471-2407.

176. Lu L-JW, Anderson KE, Grady JJ, Kohen F, and Nagamani M. Decreased ovarian hormones during a soya diet: Implications for breast cancer prevention. Cancer Research 2000; 60(15):4112-4117.

177.Suzuki T, Darnel AD, Akahira J-I, Ariga N, Ogawa S, Kaneko C, Takeyama J, Moriya T, and Sasano H. 5 ά-reductases in human breast carcinoma: possible modulator of in situ androgenic actions. J Clin Endocrinol Metab 2001; 86(5):2250-2257.

178. Kaaks R, Rinaldi S, Key T, Berrino F, Peeters P, Biessy C, et al. Postmenopausal serum androgens, oestrogens and breast cancer risk: the European prospective investigation into cancer and nutrition. Endocrine-Related Cancer 2005; 12(4):82-1071.

179. Missmer SA, Eliassen AH, Barbieri RL, Hankinson SE. Endogenous estrogen, androgen, and progesterone concentrations

AAJMS [Formerly IJMS], August 2020;3(3):20-63;ISSNe 2522-7386

61

and breast cancer risk among postmenopausal women. Journal of the National Cancer Institute. 2004; 96(24): 65-1856.

180. Lukanova A, Surcel HM, Lundin E, Kaasila M, Lakso HA, Schock H, et al. Circulating estrogens and progesterone during primiparous pregnancies and risk of maternal breast cancer. Int J Cancer. 2012;130(4):20-910.

181. Levina VV, Nolen B, Su YY, Godwin A, Fishman D, Liu J, Mor G, Maxwell LG, Herberman RB, Szcepanski MJ, Szajnik ME, Gorelik E, and Lokshin AE. Biological significance of prolactin in gynecologic cancers. Cancer Research 2009; 69(12):236-249.

182. Mujagic Z, Srabovic N, and Mujagic H. The role of prolactin in human breast cancer. The Journal of Croatian Society of Medical Biochemists 2009; 19(3): 236-249

183. Travis RC and Key T J. Oestrogen exposure and breast cancer risk. Breast Cancer Research 2003; 5(5):239-47.

184.Iodice S, Maisonneuve P, Botteri E, Sandri MT, Lowenfels AB. ABO blood group and cancer. Eur J Cancer 2010 46: 3345-3350.

185.Yu J, Gao F, Klimberg VS, Margenthaler JA. ABO blood type/Rh factor and the incidence and outcomes for patients with triplenegative breast cancer. Ann Surg Oncol 2012; 19: 3159-3164.

186. Gates MA, Xu M, Chen WY, Kraft P, Hankinson SE, Wolpin BM. ABO blood group and breast cancer incidence and survival. Int J Cancer. 2012; 130(9):2129–37.

187. Sharma G, Choudhary R, Bharti D. Studies showing the relationship between ABO blood groups and major types of cancers. Asian J Exp Sci. 2007; 20(1):129–32.

188.Saxena S, Chawla AS, Vinod K , Kamal K, Gaur, KL (2015). Association of ABO blood group and breast cancer in Jodhpur. Idian J Physiol Pharmacol 2015; 59(1):63-68.

189. Daniels G. The molecular genetics of blood group polymorphism. Hum. Genet 2009; 126: 729-742.

190. Stamatakos M, Kontzoglou K, Safioleas P, Safioleas C, Manti C, Safioleas M. Breast cancer incidence in Greek women in relation to ABO blood groups and Rh factor. Int Semin Surg Oncol 2009; 6:14.

191. Strauchen JA, Bergman SM, Hanson TA. Expression of A and B tissue isoantigens in benign and malignant lesions of the breast. Cancer 2001; 45: 2149–2155.

AAJMS [Formerly IJMS], August 2020;3(3):20-63;ISSNe 2522-7386

62

192.Pendu Le, Marionneau S, Cailleau- Thomas A, Rocher J, Moullac- Vaidye Le, Clement M. ABH and Lewis Histoblood group antigens in cancer. APMIS 2001; 109: 9–31.

193. Pack SD, Karkera JD, Zhuang Z, Pak ED, Balan KV. Molecular cytogenetic fingerprinting of esophageal squamous cell carcinoma by comparative genomic hybridization reveals a consistent pattern of chromosomal alterations. Genes Chrom Cancer 1999; 25: 160–

168. 194. Ichikawa D, Handa K, Hakomori S. Histo-blood group A/ B

antigen deletion/reduction vs. continuous expression in human tumor cells as correlated with their malignancy. Int J Cancer 1998; 76: 284–289.

195. Alsamarai AM, Alobaidi AHA.Association of human Cytomegalovirus and Epstein-Barr virus with breast cancer. Int J Med Sci [Aalborg Academy J Med Sci] 2018;1(2):1-8.

196. Alsamarai AGM, Abdulla SS, Alobaidi MA. Association of Breast Cancer with Epstein- Bar Virus and Cytomegalovirus Infection. Aalborg Academy J Med Sci 2020;3(2):12-27.

197. Alsamarai AGM, Abdulla SS, Alkhiat ZA. Role of Cytomegalovirus and Epstein-Barr virus in breast cancer. World J Pharmacy Pharmace Sci 2015;4(11):115-142.

198. Zur Hausen H. The search for infectious causes of human cancers: where and why. Virology 2009; 392: 1–10

199. Alsamarai AGM, Aljumaily ZK, Alobaidi AH. Co-infections Increase the Risk of Pregnancy Outcomes. Virology Immunology J 2018;2(11):00201. DOI: 10.23880/vij-16000201.

200. Alsamarai AGM, Hassan HM, Alsalihi FG, Alobaidi AH,Aljumaili ZK. Toxoplasma gondii, rubella, cytomegalovirus co-infection as a risk factors for abnormal pregnancy outcome. Middle East J Family Med 2014;12:15-23.

201. Hanna BJ, Habib MA, Al-Mousawi HA. The expression of Epstein-Barr virus in breast cancer in relation to age. Al-Kindy College Med J 2011; 7:78-83.

202. Amarante MK, Watanabe MAE. The possible involvement of virus in breast cancer. J Cancer Res Clin Oncol 2009; 135(3):329 37.

AAJMS [Formerly IJMS], August 2020;3(3):20-63;ISSNe 2522-7386

63

203. Joshi D, Quadri M, Gangane N, Joshi R, Gangane N. Association of Epstein Barr virus infection (EBV) with breast cancer in rural Indian women. PLoS One 2009; 4, 8180.

204. Alibek K, Kakpenova A, Mussabekova A, Sypabekova M, Karatayeva N. Role of viruses in the development of breast cancer. Infect Agent Cancer. 2013; 8(1):32-37.

205. Harkins LE, Matlaf LA, Soroceanu L, Klemm K, Britt WJ, Wang W, et al. Detection of human cytomegalovirus in normal and neoplastic breast epithelium. Herpesviridae 2010; 1:8. doi: 10.1186/2042-4280-1-8.

206. Cox B, Richardson A, Graham P, Gislefoss RE, Jellum E, Rollag H. Breast cancer, cytomegalovirus and Epstein-Barr virus: a nested case-control study. Br J Cancer 2010; 102:1665–9.

207. Hala Hassan MM, Alsamarai AGM, Aljumaili ZKM, Alobaidi AH. Association Between Cytomegalovirus Infection and Bad Obstetric Outcomes in Women from Kirkuk . International Journal of Public Health Science (IJPHS) 2014;3:29-42.

208. Aljumaili ZK, Alsamarai AGM, Najem WS. Seroepidemiological Study of Toxoplasma, Rubella, Cytomegalovirus and Herpes Simplex in Women with Bad Obstetric History. Midl East J Intern Med 2013;6:21-33.

209. Aljumaili ZK, Alsamarai AM, Najem WS. Cytomegalovirus seroprevalence in women with bad obstetric history in Kirkuk, Iraq. J Infect Public Health 2014; 7(4):277-88.

210. Alsamarai AGM, Aljumaili ZK. Seroepidemiology of Toxoplasma, Rubella, Cytomegalovirus and Herpes Simplex Virus -2 in women with bad obstetric history. PART II. Cytomegalovirus and Herpes Simplex Virus Infections, Our Dermatology 2013; 4:536-544.

AAJMS [Formerly IJMS] August 2020;3(3):64-69; ISSNe 2522-7386

64

MINI REVIEW E-Health and Big Data Analyzing Suhiar Mohammed Zeki, University of Technology / Computer Science Department. Email: 110121@uotechnology.edu.iq Mobile: +9647823549971 ORCID: http://orcid.org/0000-0001-8337-4013 Publons: 1630103 URL: //suhairmohammed1.academia.edu DOI: https://doi.org/10.32441/aajms.3.3.3

Received: 11/5/2020 Accepted: 19/6/2020 Published: 1st August, 2020 Abstract E- technology use in health education and healthcare delivery expanded in recent years. The E-health is with positive effect on professional health education and healthcare providing for community. E-health mean the use of information and communication technologies (ICT) for improvement of population health. WHO established E-health unit that collaborate with country, regional and global levels to strengthen and promote the use of ICT in health systems design and care providing to community. Big data in healthcare mean collection, analysis, consumer benefit, patient physical and clinical data that it is difficult to dealt with using traditional tools for data processing. Thus technology adoption is vital to face the healthcare data challenges which include soundness, volume, variety, and velocity in order to collect, store and analyse information to produce outcomes that improve healthcare systems and education. Now globally healthcare is influenced by the increase in healthcare data volume, healthcare costs growing and the desire for healthcare personalization. Keywords: E-health, Big data, electronic system, security, cryptography, coding.

AAJMS [Formerly IJMS] August 2020;3(3):64-69; ISSNe 2522-7386

65

Background Many definitions describe big data, which is characterized by the v3 (Volume, variety and velocity) are called big data and sometimes in some sources we see properties v5 that are being added to v3 (veridicality+ value) [1] But few of these sources focused on big data in health, medicine and e-health Big data in the medical and health field refer to big data in the form of groups that are routinely or traditionally automatically collected, captured or collected and stored electronically and can be entered into the health field quality system and electronic health system.[2] Purpose When collecting big data in the health field, it is classified and analyzed, stored according to databases, it is divided according to interrelated relationships using digital electronic analysis tools for the purpose of improving the healthcare system and the performance of the medical system [3] These operations need large logistical efforts and computer power used in the field of application in the health field, including generation the data is collected, then stored and processed. Coding system is needed to code information in order to maintain complete confidentiality of the information, or there may be future monitoring of the data, or for example, the data is analyzed retroactively.[4] Methodology This decade has witnessed a significant increase in the amount of information that we believe is produced routinely, collected and stored, and this is what we call big data. World now live in the age of information technology and most of what practiced is related to access to huge amounts of data and this buzzword that we describe this huge amount of data is big data.[2] In the field of healthcare, not far from it, the increased technological development allowed the possibility of dealing with this huge amount of data and with a deeper issue of profits and expenses is its contribution to the prediction of epidemics, treatment and disease diagnosis, increase the efficiency and accuracy of the medical decision and avoid errors that can be made by providers.[2] Health and medical care. Information technology has become an integral part of the concept of health management, as the use of massive information technology works to promote development and development in the

AAJMS [Formerly IJMS] August 2020;3(3):64-69; ISSNe 2522-7386

66

health field and improve health services. Which will have an impact in reducing health care costs and provide high-quality services with attention to consideration of the topic of medical rights and professional ethics. The great challenges in healthcare delivery that facing physician, patients, healthcare providers and community need proper legislation of laws to control the confidentiality of data, privacy, access to this private information, and activating the principle of legal accountability.[5]

Better healthcare = Better technology Better technology = Big data management

Fig.1. Better healthcare

So the need to process big data in the field of healthcare began so that the results when analyzing these data will become positive and life-saving results by digitizing everything that is combined and analyzed by specific techniques, especially in the field of health care such as health data for a specific population or individual that may help prevent epidemics, treatment of some diseases, and lowering costs.[2] Therefore, collecting huge amounts of data for medical use for long time and with today's techniques that help in development and improvement so that this data turns into critical visions related to providing better healthcare. The purpose of analyzing big data is to use the results to predict the problem and its solution before it is too late, especially in crises of health disasters and epidemics. The use of treatments faster, so the need to digitalize health institutions for the purpose of helping to collect huge health data and develop the infrastructure to provide health data. Medical Big data:

AAJMS [Formerly IJMS] August 2020;3(3):64-69; ISSNe 2522-7386

67

Collection of data sets that are large and complex in nature, they consist both structured and unstructured data, that grow large so fast that they are not manageable by traditional relational data base systems or statistic tools. Big data analyzing tools [2] 1- Hadoop and distributed file system: divided the data in smaller

parts and distributed in across various nods. 2- SQL: allows posts can be downloaded and in to hadoop. 3- Map reduces: process that transforms data loaded in to hadoop in to

format that can be used for analysis. 4- Hive: run time Hadoop support Structure Queries Language with

Hadoop platform. 5- Jaql: converts high-level queries in to low level queries. 6- Zoo keeper: coordinate parallel processing across big clusters. 7- HBase: is a column _oriented data base management system that sites on top (HDFS) by using SQL approach.

Fig.2. Pig healthcare data

Technological development Software solutions are developed to facilitate the smooth and easy collection of data and also how to link and analyze this data and make it relevant data by supporting digital solutions that simplify the sharing of this data within health institutions in order to facilitate data and retrieve it quickly and add software solutions to process health

AAJMS [Formerly IJMS] August 2020;3(3):64-69; ISSNe 2522-7386

68

records taking into consideration data merging into databases with big data. Application areas[3]

Analysis

Coordination

Surveillance

Monitoring

Research

Fig.3. Big data application

The most prominent challenges in big data in the medical field: [6] 1- Lack of awareness of the importance of big data in the health field 2- Data quality and integrity 3-High cost 4-Data security 5- Digital informational privacy 6-Legal aspects 7-Administrative aspects. References 1. Zhao JC, Guo JX. Big data analysis technology application in

agricultural intelligence decision system. IEEE 3rd International

AAJMS [Formerly IJMS] August 2020;3(3):64-69; ISSNe 2522-7386

69

Conference on Cloud Computing and Big Data Analysis (ICCCBDA). 2018.

2. Manikandan SG, Ravi S. Data Analysis Using Apache Hadoop. International Conference on IT Convergence and Security (ICITCS) – 2014.

3. Hpries K, Dunnigan R. Big data practical Guide for managers. CRC Press. 2013.

4. Strang KD, Sun Z. Meta-analysis of big data security and privacy: Scholarly literature gaps. IEEE International Conference on Big Data (Big Data), Year: 2016.

5. Londhe A, Rao PP. The survey on approaches to efficient clustering and classification analysis of big data. In: Bhagyashri S. Gandhi ; Leena A. Deshpande. Platforms for big data analytics: Trend towards hybrid era 2017 International Conference on Energy, Communication, Data Analytics and Soft Computing (ICECDS).

7. Jose B, Abraham S. Exploring the merits of NoSQL: A study based on mongo dB. International Conference on Networks & Advances in Computational Technologies (NetAct),Y. 2017.

AAJMS [Formerly IJMS], August 2020;3(3):70-81;ISSNe 2522-7386

70

ORIGINAL ARTICLES Biotyping of Acinetobacter baumannii Iraqi Isolates Nadira S. Mohamed, Forensic DNA Research and Training Center, Al –Nahrain University, Baghdad, Iraq. Email: nadmohamed2000@yahoo.com. Mobile:+9647700862829 ORCID: http://orcid.org/0000-0002-8759-2699 Mayyahi M. Jabber, Forensic DNA Research and Training Center, Al –Nahrain University, Baghdad, Iraq. Email: m_jaber@mail.ru. ORCID: http://orcid.org/-0000-0002-9173-993X Ali M. Abdulmohsen, ALnokhba International Laboratory, Baghdad, Iraq. Email: alibio1982@gmail.com ORCID: http://orcid.org/0000-0002-8772-4115 Zahraa M. Al-Jumaa, Department of Internal and Preventive Medicine, College of Veterinary Medicine. University of Mosul. Email: sandy285@uomosul.edu.iq, ORCID:http://orcid.org/0000-0001-5071-4296 Correspondence author: Dr. Nadira S. Mohamed, Forensic DNA Research and Training Center, Al –Nahrain University, Baghdad, Iraq. Email: nadmohamed2000@yahoo.com. Mobile: +9647700862829; ORCID: http://orcid.org/0000-0002-8759-2699 Received: 12/06/2020 Accepted: 21/07/2020 Published: 1st August, 2020 DOI: https://doi.org/10.32441/aajms.3.3.4

Abstract Background: Acinetobacter baumannii is an opportunistic bacterium associated with many nosocomial infections as Acinetobacter calcoaceticus, Acinetobacter nosocomialis, and Acinetobacter pittii. Aim: To determine the Biotyping of Acinebactor baumannii Iraqi Isolates. Materials and Methods: One hundred Acinetobacter species samples were collected from wound and burns in hospitalized patients in Al-yarmook Teaching Hospital in Baghdad province. Twenty isolates of Acinetobacter baumannii were identified by conventional and molecular methods, the highest rate of the bacterial isolates were 12%

AAJMS [Formerly IJMS], August 2020;3(3):70-81;ISSNe 2522-7386

71

from wounds and 8% from burns. All isolates were detected phenotypical, microscopical and biochemical tests and confirmed by ViTEK2 device. Results: Most of bacterial isolates showed resistant to the antibiotic Cephalexin (CL) (100%), Piperacillin (PRL) (65%), Ceftazidime (CAZ) (60%), Ticarcillin-Clavanic acid (TIM) (75%), Ampicillin-Sulbactum (SAM) (65%), Ceftriaxone (CRO) (60%), Imipenem (IMP) (50%). In contrast, all isolates were found sensitive to Cefotaxime (CTX) (100%). About 90% of Acinetobacter baumannii isolates were positive to biofilm formation, 70% were own efflux Pump, 100% have ability to adhere to the epithelial cells, 60% could extended spectrum β- Lactamase. Molecular subtyping of ITS region or 16S rRNA gene got through RNA 16 amplified the target gene and sequences of PCR products; sequenced data was blasted in NCBI and analysis to construction of rooted phylogenetic tree. Conclusion: ITS region or 16S rRNA gene was more discriminative than the other gene especially in closely related bacterial isolates, identification and categorization using PCR and sequence technique for 16S rRNA gene is dependable and provides epidemiological importance of Acenetobacter baumannii. Keywords: Acinetobacter baumannii, ITS region, 16S rRNA Introduction The Acinetobacter species are widespread in environment, they have been found in soil, air, water, and specimens of animal and human. Before 1970s the genus of Acinetobacter was considered safe for humanity. Later, this attitude changed when the scientists were noted that the bacteria of Acinetobacter have become epidemic, and multi-drug resistant (MRD). In addition, the Acinetobacter species were increasingly isolated from hospitalized patients [1]. Opportunistic infections by Acinetobacter baumannii in particular have become collaborate with hospital-acquired infections. It has a clinical notoriety in incidence associated with infected military conflict troops reverting from conflict regions such as desert conflicts, and Operation Iraqi freedom (OIF), the moniker “Iraqi bacter” that

was earned it in this period [2]. Acinetobacter baumannii have major factors that able to be pathogenic bacteria include adhesion with epithelial cells, biofilms formation, resistance of antimicrobial agents and acquire genetic

AAJMS [Formerly IJMS], August 2020;3(3):70-81;ISSNe 2522-7386

72

characteristics another genera that have led to difficult control on its [3]. A. baumannii is a causative agent to emergence of nosocomial infections particularly in Intensive Care Unit (ICU). For example, infections of primary and secondary meningitis, blood stream infections (bacteremia), infections of urinary tract is associated with antibiotic therapy or catheterization, infective keratitis, peritonitis, endocarditis, infections of traumatic injuries, postsurgical wounds, and infections of burns [4,5]. The main reason of A. baumannii is opportunistic bacterium associated with nosocomial phenomena that have ability to multi-drug resistant strains of this species, adhesion and invasion of host epithelial cell. However, this genus is ability to persist in the environmental hospital by spread in the middle of ill patients and it is difficult to eradication [6]. A. baumannii bacterium is characterized by their ability to change pathogenic features constantly [7,8]. Generally, the approaches of traditional investigations those known as “culturing,

phenotyping and biochemical tests” to identify pathogenic bacteria are

unwieldy and time-intensive because of difficult to differentiate the species. Sequencing rely on amplification of ITS region or 16S rRNA gene that the best methods to differentiation and identification among species especially in a taxonomic studies so the amplification of 16S rRNA gene (target sequence) matching with loci 10-1,507 of the numbering system for Escherichia coli is compared to database of species in closely related to it. In addition, this region (16S rRNA gene or ITS region) is featured to universality, conserved nature [9, 10]. Materials and methods Bacterial isolation and cultivation One hundred wounds and burns samples were collected from hospitalized patients at Al-yarmook Teaching Hospital in Baghdad province during period from15January-15 July 2016. All samples were sub cultured on Congo- red agar, Simmon citrate, Urea agar medium, and blood agar and incubated aerobically at 37°C for 24 h. The isolates were identified by traditional biochemical tests including , Gram stain, Oxidase, Catalase test, Indol test, Triple – Sugar iron, Urease production test, Methyl – Red test, Voges-proskauer test, Motility test, and by VITEK2 system (bio-Mérieux, France), and the growth test at 44° C to confirm this species A. baumannii [11-13].

AAJMS [Formerly IJMS], August 2020;3(3):70-81;ISSNe 2522-7386

73

Antimicrobial sensitivity assay Antimicrobial susceptibility of isolates was estimated using Kirby-Bauer’s single disk diffusion technique in Mueller Hinton Agar

[17, 19]. The test was performed using eight antibiotics includes Cephalexin (CL 30 mg), Piperacillin (PRL 100 mg), Ceftazidime (CAZ 30 mg), Ticarcillin-Clavanic acid (TIM 5 mg), Ampicillin-Sulbactum (SAM 20 mg), Ceftriaxone (CRO 30 mg), Imipenem (IMP10 Mg), and Cefotaxime (CTX 30%). Suspension of bacterial isolates as a turbidity compared to a 0.5 McFarland standard was inoculated on the media plates, there after Minimum inhibitory concentrations (MIC) were estimated by the E-test strips, and to investigate of metallo-beta lactamase MBL enzymes using the Imipenem (IPM) –EDTA [14]. Virulence factors of A. baumannii Biofilm formation was detected using tissue culture plate method (TCP) as described previously [13]. Bacterial isolates efflux activity was evaluated using Efflux Pump substrates such as Ethidium bromide (EB). The test was performed using EB agar cartwheel method as described before [15], adhesion with epithelial cells [16]. The Extended Spectrum β- Lactamase (ESβLs) activity of the isolates

was determined using double-disk synergy test [17]. DNA extraction Extraction of genomic DNA from twenty bacterial isolates using genomic DNA kit Geneaid (Bioneer Company, Korea) and the test was performed according to manufacturer’s instructions.

Concentrations and purity of genomic extract determined using Nanodrope Instrument. 16S rRNA amplification and sequencing Amplification of gene 16S rRNA was performed using primer set: Forward primer F27: AGA GTTTGATCMTGGCTCAG, and reverse primer R 1492: CGGTTACCTTGTTACGACTT, in conventional PCR (Apindroofe, Germany) using the run program (1cycle 95C for 10min, 40 Cycles: 95C 20s, 59C 30s, 72C 40s,I cycle 72 for 10 min). Amplified fragments PCR products were cleanup by (microClean,), and submitted to the sequence using genetic analyzer 3100 (Applied Biosystems, USA) in forensic DNA research and training center. Data were analyzed using Sequencing Analysis 5.2. Evolutionary analyses were conducted in MEGA X [18]. Its inferred using the UPGMA method [19], and the evolutionary distances were

AAJMS [Formerly IJMS], August 2020;3(3):70-81;ISSNe 2522-7386

74

computed using the Maximum Composite Likelihood method (MCL) [20]. Results and discussion The recent study included isolation, and identification of 20 isolates of Acinetobacter baumannii out of 100 samples collected from wound and burns from hospitalized patients. The phenotypic characterization, microscopical, and biochemical tests, confirmed by ViTEK2 device have shown Table1. A. baumannii the ability to grow at 440C was used in addition to molecular detection and sequencing of 16sRNA was used to confirm that isolates belong to A. baumannii. Three isolates were submitted to NCBI GenBank, and published under GenBank accession numbers KY000691.1, KY000691.2, KY000691.3. The phylogenetic analysis involved 20 nucleotide sequences with a total of 682 positions in the final dataset. The optimal tree with the sum of branch length = branch length =22.17501921 (Figure1). ITS region or 16S rRNA gene was more discriminative than other gene especially in closely related bacterial isolates, identification and categorization using PCR and sequence technique for 16S rRNA gene is dependable and provides epidemiological importance of A. baumannii [21]. The tree was drawn to scale includes two clusters, as the Iraqi isolates fall within the second cluster including 4 sub cluster ,the second cluster including other Iraqi isolates with the isolates from USA, China, India, Australia and Egypt. The investigation of virulence factors for A. baumannii isolates results showed that 18(90%) of the isolates have the ability to produce biofilm, Table 2. The possession of bacteria biofilm increases the difficulty of penetrating the antibiotic for this membrane, and developing resistance to many antibiotics, resistance palatability, opsonisation, phagocytosis, and different environmental factors [22, 23]. Previous study [24] reported that Biofilm formation and hemolytic activity, may occur significantly, and more frequently in virulent isolates as compared with none virulent. The present study was higher than that reported by others [25], with a percentage of (80%) of the biofilm production, and did not agree with the findings of others [26] that indicated the percentage of isolates producing biofilm was (17.6%). Perhaps the reason for the biofilm formation varies between studies may be due to several environmental factors that affect the formation of the bacterial biofilm

AAJMS [Formerly IJMS], August 2020;3(3):70-81;ISSNe 2522-7386

75

and give variable results including temperature, humidity, oxygen and others factors [27]. Fourteen (70%) of the isolates had possessed highly efficient efflux pumps which was consistent finding of others [28]. All isolates [20 (100%)] have the ability to adhere to surfaces of epithelial cells of humans. Bacterial cell surface play a crucial role for her pathogenicity in fumble to the environment and host interaction [29, 30]. In addition the process of adhesion is associated with the presence of pilli in the bacterial cells may lead to pelvic infections [31]. This explains the ability of A. baumannii to adhere to the surfaces of epithelial cells as an initial and fundamental stage of colonization and infection. Although the overall pathogenicity of these bacteria is low, colonization may cause severe consequences for people with pneumonia when the balance between the host and the bacterium is disturbed, leading to outbreaks of nosocomial infections in the hospital [32]. The results of extended spectrum β- lactamase indicated that 12(60%) of isolates producing extended spectrum β- lactamase enzymes and metallo β- lactamase. The investigation of the sensitivity of the isolates for ten antibiotics is shown in Table 3. All the isolates 20 (100%) were resistant to cephalexin (100%), followed by Tetracycline (75%), the other antibiotics resistance ratios ranged between 50% -65%. In contrast, all the isolates were found sensitive (100%) to Cefotaxime. Fully resistance to Cephalexin was consistent with the findings of other studies [11,25]. The A. baumannii resistance to tetracycline was found variable according to different studies finding. Our finding is comparable with those of Iran [19] as they reported that 89% of their bacterial isolates were resistant to tetracycline. However, other study [22] reported resistance rate of 49% to tetracycline. Chiang et al [22] found that MDR of A. baumannii strains with biofilm-formation ability may be more sever in nosocomial infection because of significantly higher desiccation and ethanol resistances than their planktonic type. The results showed that the resistance of A. baumannii isolates to Imipenem was 50%, and this result was consistent with others [13]. Additionally, the present study shows resistance rate of 50% to Meropenem which was agreed to that reported before [33] as their isolates were resistant to Imipenem (49%). However, other studies indicated higher sensitivity rate of A. baumannii to Meropenem (100%) [34, 35] and Imipenem [36]. The ability of A. baumannii to induce resistance to antibiotic has evolved over time. The A. baumannii became resistant to

AAJMS [Formerly IJMS], August 2020;3(3):70-81;ISSNe 2522-7386

76

antibiotics through multiple mechanisms of which the production of beta lactamase enzymes such as Carbapenemases, reduce the permeability of the cell membrane of the antibiotics change the proteins of this membrane, reduce the affinity to the enzyme Penicillin-Binding Proteins, and the possession of flow pumps that act to extrude Extracellularly. Most of A. baumannii isolates (75%) were multiple antibiotics resistant for eight antibiotics tested in this study. To prevent further spread of MDR A. baumannii strains require antimicrobial stewardship programs that enforce infection control measures in order to achieve a successful therapy against these resistance strains in Iraq. In conclusion, ITS region or 16S rRNA gene was more discriminative than the other gene especially in closely related bacterial isolates, identification and categorization using PCR and sequence technique for 16S rRNA gene is dependable and provides epidemiological importance of Acenetobacter baumannii.

Table.1. Microscopical and biochemical characterization of A .baumannii Isolates

Results Tests No - Gram Stain 1 - Hemolysis Production 2 + Growth in 44C° 3 - Lactose fermentation 4 - Oxidase 5 + Catalase 6 + Urease 7 - Indol 8 - Methyl red 9 - Voges_ proskaure 10 + Simmon citrate 11 Alkaline/ not change TSI 12 - Motility 13 - H2S Production 14 + Ability to grow in 44⁰C 15

AAJMS [Formerly IJMS], August 2020;3(3):70-81;ISSNe 2522-7386

77

Fig.1. Evolutionary relationships of A. baumannii 16sRNA partial gene compared with the related NCBI strains. Table. 2. The virulence factors of A. baumannii

Extended Spectrum β- Lactamase

Adhesion with Epithelial Cells

Efflex Pump

Biofilm formation

12(60%) 20(100%) 14(70%) 18(90%)

Positive

8(40%)

0(0%) 6(30%) 2(10%) Negative

AAJMS [Formerly IJMS], August 2020;3(3):70-81;ISSNe 2522-7386

78

Table. 3. The antibiotic susceptibility test results

Percentage of susceptibility Antibiotics

Resistant Intermediate Sensitive 20(100%)

0(0%) 0(0%) CL

13(65%) 5(25%) 2(10%) PRL 12(60%) 6(30%) 2(10%) CAZ 15(75%) 2(10%) 3(15%) TIM 13(65%) 2(10%) 5(25%) SAM 12(60%) 2(10%) 6(30%) CRO 10(50%) 3(15%) 7(35%) IMP 0(0%) 0(0%) 20(100%) CTX

Antibiotics: CL= Cephalexin, PRL= Piperacillin, TIM = Ticarcillin - Clavanic acid, SAM = Ampicillin-Sulbactum, CTX = Cefotaxime , CAZ = Ceftazidime, CRO = Ceftriaxone, IMP = Imipenem. References 1. Rafei R, Hamze M, Pailhoriès H, Eveillard M, Marsollier L.

Extrahuman epidemiology of Acinetobacter baumannii in Lebanon. Appl Environ Microbiol. 2015; 81(7):2359–2367.

2. Howard A1, O'Donoghue M, Feeney A, Sleator RD. Acinetobacter baumannii: an emerging opportunistic pathogen Virulence. 2012;3(3):243-50. doi: 10.4161/viru. 19700. Epub .

3. Eze EC, Chenia HY, El Zowalaty ME. Acinetobacter baumannii biofilms: effects of physicochemical factors, virulence, antibiotic resistance determinants, gene regulation, and future antimicrobial treatments. Infect Drug Resist. 2018;11:2277–2299.

4. Anton Y. Peleg, Harald Seifert, David L. Paterson. Acinetobacter baumannii: Emergence of a Successful Pathogen clinical microbiology reviews, 2008;21(3):538–582.

AAJMS [Formerly IJMS], August 2020;3(3):70-81;ISSNe 2522-7386

79

5. Almasaudi SB. Acinetobacter spp. as nosocomial pathogens: Epidemiology and resistance features. Saudi J Biol Sci. 2018;25(3):586–596.

6. Asif M, Alvi I A, Rehman SU. Insight into Acinetobacter baumannii: pathogenesis, global resistance, mechanisms of resistance, treatment options, and alternative modalities. Infect Drug Resist. 2018;11:1249–1260.

7. Holt K , Kenyon J, Hamidian M , Scultz M B , Pickard D J , Dougan G , et al. Five decades of genome evolution in the globally distributed, extensively antibiotic-resistant Acinetobacter baumannii global clone 1. Open Microbiol. 2016; 2: 000052.

8. Piepenbrink K H , Lillehoj E , Harding C M , Labonte J W , Zuo X , Rapp, C A , et al. Structural Diversity in the Type IV Pili of Multidrug-resistant Acinetobacter. J. Biol. Chem. 2016;291: 22924–22935.

9. Clarridge JE. Impact of 16S rRNA gene sequence analysis for identification of bacteria on clinical microbiology and infectious diseases. Clin Microbiol Rev. 2004;17(4):840–862.

10. Bashir D, Thokar M A, Fomda B A, Bashir G, Zahoor D, Shabir A , and Toboli A S. Detection of Metallo-beta-lactamase ( MBL ) Producing Pseudomonas aeruginosa at a Tertiary Care Hospital in Kashmir . African Journal of Microbiology Research. 2011;5: 164-172

11. Brown A E. Microbiological Applications. Laboratory Manual in General Microbiology. McGraw-Hill. New York. Companies, Inc., 1221 Avenue of the Americas, 2005.pp:144-146.

12. Forbes B A, Sahm D F, and Wessifeld A S, Bailey and Scotts. Diagnostic microbiology. 12th ed . Mosby, Inc. Baltimore. 2002. 266-277.

13. Mathur T, Singhal S, Khan S, Upadhyay D J, Fatma T, and Rattan A. Detection of Biofilm Formation among The Clinical Isolates of Staphylococci An Evaluation of Three Different Screening Methods. Indian J. Med. Microbiol. . 2006;24(1): 25-29.

14. CLSI. Methods for Dilution Antimicrobial Susceptibility Tests for Bacteria That Grow Aerobically; Approved Standard—Ninth Edition M07-A9. CLSI. Clinical and Laboratory Standards Institute, Wayne, PA. 2012 . USA. 32(2): 1-88.

15. Martins M, Viveiros M, Couto I, Costa S, Pacheco T, Fanning S, Pagès J M, and Amaral L. Identification of efflux pump-

AAJMS [Formerly IJMS], August 2020;3(3):70-81;ISSNe 2522-7386

80

mediated multidrug-resistant bacteria by the Ethidium Bromide-agar Cartwheel Method. In Vivo. 2011;25: 171–178.

16. Iwahi T, Abs R, Nako M, and Imado A. Role of type-1 fimbriae in the pathogensis of ascending UTI by E.coli in mice . Infec. Immune. 1983;39:1307-1315.

17. CLSI Performance Standards for Antimicrobial Susceptibility Testing; Twenty-First Informational Supplement M100-S21. Clinical and Laboratory Standards Institute, Wayne, PA. USA. 2011;30(1): 1-115.

18. Kumar S, Stecher G, Li M, Knyaz C, Tamura K; MEGA X: Molecular Evolutionary Genetics Analysis across computing platforms; Molecular Biology and Evolution 2018;35:1547-1549.

19. Sneath P H A, and Sokal R. Numerical Taxonomy. Freeman, San Francisco. 1973.

20. Tamura K, Nei M, Kumar S. Prospects for inferring very large phylogenies by using the neighbor-joining method. Proceedings of the National Academy of Sciences. 2004;101:11030-11035

21. Artur JS, Evert van Zanten, and Anna M D. (Mirjam) Kooistra-Smid.Targeted next-generation sequencing of the 16S-23S rRNA region for culture-independent bacterial identification - increased discrimination of closely related species. Sci Rep. 2017;7:3434

22. Chiang S R, Jung F, Tang, H J, Chen C H, Chen C, Chou H Y, et al. Desiccation and ethanol resistances of multidrug resistant Acinetobacter baumannii embedded in biofilm: the favorable antiseptic efficacy of combination chlorhexidine gluconate and ethanol. J Microbiol Immunol Infect. 2017;151–156.

23. Harding C M, Hennon S W, and Feldman M F. Uncovering the mechanisms of Acinetobacter baumannii virulence. Nat Rev Microbiol. 2018;16, 91–102.

24. Ali H M , Salem M Z M , El-Shikh M S , Megeed A , Alogaibi Y A, and Talea I. AInvestigation of the virulence factors and molecular characterization of the clonal relations of multidrug-resistant Acinetobacter baumannii isolates. J AOAC Int. 2017;100:152–158.

25. Ibrahim H Y, Yıldırım S C, Koçak N. Molecular methods for bacterial genotyping and analyzed gene regions. J Microbiology and Infectious Diseases . 2011;1(1):1-5.

AAJMS [Formerly IJMS], August 2020;3(3):70-81;ISSNe 2522-7386

81

26. Absur R, Nako M. and Imado A. Role of type-1 fimbriae in the pathogensis of ascending UTI by E.coli in mice . Infect Immune. 1975;32:157-166.

27. MacFaddin, J. F. Biochemical test for identification of medical bacteria. 3 rd ed. The Williams and Wilkins. Baltimore, USA. 2000.

28. Srinivasan R, Karaoz U, Volegova M, MacKichan J, Kato–Maeda K, Miller,Rohan Nadarajan S, etal. Use of 16S rRNA Gene for Identification of a Broad Range of Clinically Relevant Bacterial Pathogens. PLoS ONE 2015;10(2): e0117617.

29. WeberB S, Harding C M, Feldman M F. Pathogenic Acinetobacter: from the Cell Surface to Infinity and Beyond. J. Bacteriol. 2016;198:880–887.

30. Lee C R , Lee J H, Park M, Park K S, Bae I K , KimY B, et al. Biology of Acinetobacter baumannii: pathogenesis, antibiotic resistance mechanisms, and prospective treatment options. Front Cell Infect Microbiol. 2017;7:55.

31. Mashhadani I J. Study of the effectiveness of bacteriocin produced by Lactobacillus plantarum in the virulence factors of Acinetobacter baumannii. Master Thesis, College of Science, Mustansiriya University. 2010.

32. Wong D, Nielsen TB, Bonomo RA, Pantapalangkoor P, Luna B, Spellberg B. Clinical and pathophysiological overview of Acinetobacter infections: a century of challenges. Clin Microbiol Rev. 2017;30(1):409–47.

33. Maslow J N, Glaze T, Adams P, and Lataillade M. Concurrent outbreak of multidrug-resistant and susceptible subclones of Acinetobacter baumannii affecting different wards of a single hospital . Infect. Control. Hosp Epidemiol. 2005;26: 69–75.

34. Abdul Karim F. Study of antibiotic resistance and some virulence factors of Acinetobacter baumannii isolated from diuresis. Master Thesis, College of Science, Mustansiriya University, 2008.

35. Khafaji S M S. Study on the capsule of Acinetobacter baumannii and its effect on the immune response. PhD thesis, College of Science, Mustansiriya University. 2006.

36. Heritier C, Poirel L, Lambert T, and Nordmann P. Contribution of acquired carbapenem-hydrolyzing oxacillinases to carbapenem resistance in Acinetobacter baumannii. Antimicrob. Agents Chemother. 2005;49:3198–3202.

AAJMS [Formerly IJMS], August 2020;3(3):82-92;ISSNe 2522-7386

82

Seroprevalence of Helicobacter Pylori among Human in Erbil and Rania City, Kurdistan Region, Iraq

Sawsan M. Sorchee, Department of Biology, Salahuldean University College of Education, Email: Sawsan.abdulla@su.edu.krd, Mobile: +09647504126341, ORCID: http://orcid.org/0000-0001-6254-2794

Shiba Rzgar Hassan, Akri College of Education, Duhok University, Email: rb217.shiba.rzgar@gmail.com. Ali Omar Ramadhan, Akri College of Education, Duhok University, Email: rb217.aliomar@gmail.com. Elham Edris Sleman, Akri College of Education, Duhok University, Email: rb218.elham.edris@gmail.com. DOI: https://doi.org/10.32441/aajms.3.3.5 Correspondence author: Sawsan M. Sorchee, Department of Biology, Salahuldean University College of Education, Email: Sawsan.abdulla@su.edu.krd, Mobile: +09647504126341, ORCID: http://orcid.org/0000-0001-6254-2794

Received: 17/5/2020 Accepted: 21/7/2020 Published: 1st August, 2020

Abstract Background: More than half of the world's population is influenced by Helicobacter pylori infection. The infection is commonly obtained during childhood but may stay asymptomatic, with long-term clinical consequences such as gastritis, peptic ulcer, and stomach cancer. Aim: To determine the prevalence rate of Helicobacter pylori infection and related variables such as gender, and seasonal variation in Erbil and Rania cities. Materials and methods: In a retrospective study the information was gathered by reviewing laboratory records of 1626 patients. Of the total 1126 records from Razgary hospital in Erbil and 500 records from Rania hospital. Antibodies to H. pylori were identified by rapid immunological examination.

AAJMS [Formerly IJMS], August 2020;3(3):82-92;ISSNe 2522-7386

83

Results: The overall seroprevalence rate of Helicobacter pylori infection was 42.19% (686/1626) in all samples tested from both cities. In addition, the H. pylori seroprevalence was 37.92% in Erbil and 51.8% in Rania and the difference was highly significant (X2 = 27.198; P=0.00001). The seroprevalence was higher in male in Erbil [Male (44.15%) and female (32.85%)], while in Rania the prevalence was higher in female (69% for female and 37.5% for male). The highest rate of prevalence of H. pylori antibodies was in April (43.75%) and November (43.22%), while the lowest rate was found in September (0%) in Erbil city. In Rania city the highest rate of prevalence of H. pylori antibodies was in June (69.2%) and May (67.7%) while the lowest rate was found in February (34.1%). Conclusion: The present study results warranted conduction of large scale study in order to confirm the local variation in H. pylori prevalence within Iraqi community. Keywords: H. Pylori, seroprevalence, Kurdistan region, Iraq Introduction Helicobacter pylori (H. pylori) is one of the most common chronic bacterial infections worldwide, which infects at least 50% of world’s human population. There is evidence that acquisition of H. pylori occurs mainly in early childhood. The infection is more prevalent in developing countries, and it is associated with poverty and social deprivation and main risk factors include overcrowded households, poor sanitation, and poor water supply [1]. The genus Helicobacter belongs to the family Helicobacteraceae, order Campylobacterales, subdivision of the Proteobacteria. This family also includes the genera Wolinella, Flexispira, Sulfurimonas, Thiomicrospira, and Thiovulum. To date, the genus Helicobacter comprises of 32 validly reported species. Helicobacter pylori are the type species. Members of this family are able to colonize various ecological niches in the gastrointestinal tract in both humans and a broad range of animal hosts [2]. Helicobacter pylori was implicated as underlying etiology for the development of gastritis, peptic ulcer and stomach carcinoma [3-5] in Iraqi community. Recent studies performed in Iraq indicated abnormalities in many biomarkers [3-6] and this may suggest that

AAJMS [Formerly IJMS], August 2020;3(3):82-92;ISSNe 2522-7386

84

these biomarkers abnormalities may play a role in the pathogenesis and initiation of stomach cancer. The relative risk of gastric carcinoma is 2.3–8.7 times greater in infected adults as compared to uninfected subjects. H. pylori is classified by the World Health Organization as a Group I carcinogen [7]. In Iraq, a new 3 variants were isolated and sequenced from gastritis, peptic ulcer and stomach carcinoma biopsies and thus the study indicated that genetic variation in H. pylori was correlated to gastritis severity and was more in gastric cancer cases as compared to gastritis and peptic ulcer. [5]. Helicobacter pylori cause's gastroduodenal infections in human and infection with H. pylori is highly prevalent globally and nearly half the population of the world is affected [8]. H. pylori is Gram-negative, helical-shaped, microaerophilic, oxidase, catalase, and urease-positive bacterium which usually colonize the human stomach [9]. The Production of ammonia by this bacteria and release of biochemicals such as proteases, vacuolating cytotoxin A and phospholipases contribute significantly to its inflammatory and carcinogenic potential [9]. Infections with H. pylori are believed to happen soon in life and the infection involves several medical circumstances including gastritis, gastric cancer, gastric adenocarcinoma, lymphoma and peptic ulcer [10]. Patients with H. pylori infection are generally asymptomatic and no particular clinical signs and symptoms were outlined. Common signs and symptoms, however, include nausea, vomiting, abdominal pain, heartburn, diarrhoea, evening starvation and bad breath [11]. The epidemiological evidence has shown that H.pylori infection rates ranging from 20- 50% in the adult populations of the developed world but the occurrence is much more in the developing countries with prevalence as high as 90% in some countries [9-11]. The socioeconomic status of the family during childhood appears to be the major marker of infection. Higher prevalence exists in regions of low socioeconomic and poor sanitary conditions, and in rural as contrasted to urban areas. Overcrowding is a risk factor for acquisition of H.pylori infection in children. Contaminated water and food also act as sources of infection [12]. There are several techniques for diagnosing H. pylori infection that are invasive or noninvasive. The invasive method includes

AAJMS [Formerly IJMS], August 2020;3(3):82-92;ISSNe 2522-7386

85

endoscopy and biopsy [histological examination, Rapid Urease Test], and Polymerase Chain Reaction. Non-invasive methods include the Urea Breath Test, stool antigen testing, and serological tests [13]. One of the serological techniques is an immunochromatographic technique which is commonly used for the diagnosis of H. pylori because of its low cost and easy availability at any laboratory [14]. Thus this study was conducted to determine the seroprevalence of H. pylori among patients with gastroduodenal disorders and its association with some of the epidemiological variables in Erbil and Rania cities in Kurdistan region, Iraq. Methodology A retrospective study and the information was gathered from laboratory records from Razgary hospital in Erbil city and Rania hospital in Sulaymanyia Governorate), including anti Helicobacter pylori antibodies. The study covered the period from 1st January, 2019 to 1st December, 2019. The data presented as frequency and percentages and X2 was used to determine the significance of differences. The study included 1626 laboratory records, of them 1126 records from Erbil and 500 records from Rania. The research protocol was approved by Akri College of Education Ethical Committee, Duhok University and Duhok Health Authority. Result and discussion The overall seroprevalence rate of Helicobacter pylori infection was 42.19% (686/1626) in all samples tested from Erbil and Rania cities. In addition, the seroprevalence rate of H. pylori antibodies was 37.92% (427/1126) in Erbil and 51.8% in Rania and the difference was highly significant (X2 = 27.198; P=0.00001), Tables 1 and 2. In Erbil, the seroprevalence was higher in male (44.15%) than in female (32.85%)], Table 1. While in Rania the seroprevalence was higher in female (69%) than in male (37.5%), Table 2. There was a significant difference (X2 = 10.03; P< 0.01) in H. pylori seroprevalence between two cities according to gender. AL-Mashhadani, et al., [15] in a study conducted in Iraq reported H. pylori seroprevalence of 39.4%, which is lower to that of the present study. The present study results indicated that H.pylori antibodies highest seroprevalence was in April (43.75%), November (43.22%), and December (41.17%), while the lowest rate was found in September (0%), March and January (32.78%) in tested samples from

AAJMS [Formerly IJMS], August 2020;3(3):82-92;ISSNe 2522-7386

86

Erbil, Table 3. However, the monthly seroprevalence differences were not significant (X2 = 6.7; P>0.05). In Rania the seroprevalence of H. pylori was 51.8% (259/500) and it was higher in female (69%; 156/226) than in male (37.5%; 103/274), Tables 2. The seroprevalence H. pylori was higher in June (69.2%), May (67.7%) and March (62.2%), while the lowest rate was found in February (34.1%) and January (34.78%), Table 4. The frequency distribution of positive seroprevalence was with significant differences when analysed according to months strata (X2 =25.98; P= 0.007). Serological tests are more universally used, and it is the most practical method available to confirm diagnosis. Helicobacter pylori antibodies rapid test is used to monitor human sera in different hospital and laboratory settings. This test is the easiest methods to apply and the most globally used for recognizing antibodies of infection with H. pylori [16]. The prevalence of H. pylori among patients in Rania city (51.8%) significantly higher (X2 = 27.198; P=0.00001) than in Erbil (37.92%) city. However, this finding needs to be confirmed in a large scale community-based and hospital-based comparative study. Previous study in Iraq [15] indicated that the seroprevalence of H. pylori was 39.4% for all tested samples, and the rate of infection among female was 40.7% and in male was 38.2%, a finding that was consistent with that of Rania in this study. As well as, the result of our study in Rania city (male 37.5% and female 69% ) were agreed with the finding of Mohamed et al.[17], which performed in Sulaymanyia. They reported an H. pylori infection rate of 42.3% in male and 57.7% in female. [17]. Mohialdeen et al., [18] indicated that history of H. pylori infection was observed in 63.2% of the patients with gastric cancer. Moreover, prevalence of gastric cancer was more among females (61.5%). The present study result was inconsistent with that reported by Salih [19] in Saudi Arabia who found the prevalence of H.pylori infection was 75%. The prevalence of H.pylori among humans in Erbil city showed a less rate compared with that reported from other studies in some developing countries [19-22]. Bani-Hani and Hammouri [20] in Jordan reported that the prevalence of H.pylori infection was 82 %. Perez-Perez et al. [21] mentioned that the prevalence of H.pylori infection among patients underwent upper

AAJMS [Formerly IJMS], August 2020;3(3):82-92;ISSNe 2522-7386

87

gastrointestinal endoscopy in Yemen, Sana‘a major hospital, was very

high (78%). Also Sasidharan et al. [22] in Malaysia reported high prevalence of H. pylori. Although the seroprevalence of H.pylori was lower than that reported for some geographical areas, however, it was higher than that reported for Australia 21.5% [23] and Oman (25%) [24]. In addition, a recent study conducted by Shu et al. [25] showed that the prevalence of H.pylori infection was 3.1 % and 18.6 % in Japan and China respectively. The variability in the occurrence rate of H.pylori infection could be due to poor social and economic development, differences in socioeconomic condition, poor hygiene practices during childhood; absence of a sewage disposal facility during childhood; standard of hygiene and source of drinking water, also low education level; crowded families; and improper food handling [15]. Higher incidence exists in regions of low socioeconomic and poor sanitary conditions, and in rural as contrasted to urban areas. The socioeconomic status of the family during childhood appears to be the major marker of infection [26,27]. The monthly variation in H. pylori seroprevalence during the study period may be due to climate influence on the bacteria growth. In conclusion, the present study indicated significant differences in seroprevalence of H. pylori between Erbil and Rania. The study results warranted conduction of a large scale study in order to confirm the local and seasonal variation in H. pylori prevalence within Iraqi community. Table.1. Prevalence of H. Pylori antibodies according to gender in Erbil city.

Gender

Number of samples tested

Positive Negative

Number Percent Number Percent Male 505 223 44.15 282 55.84 Female 621 204 32.85 417 67.14 Total 1126 427 37.92 699 62.07

AAJMS [Formerly IJMS], August 2020;3(3):82-92;ISSNe 2522-7386

88

Table.2. Prevalence of H. Pylori antibodies according to gender Rania city.

Gender Number of samples tested

Positive Negative

Number Percent Number Percent Male 274 103 37.5 171 62.4 Female 226 156 69 70 30.9 Total 500 259 51.8 241 48.2

Table. 3. Seroprevalence of H. Pylori antibodies according to month of the year in Erbil city.

Month

Number of samples

examined

Positive Negative

Number Percent Number Percent January 183 60 32.78 123 67.21 February 123 45 36.58 78 63.41 March 0 0 0 0 0 April 96 42 43.75 54 56.25 May 135 47 34.81 88 65.18 June 50 18 36 32 64 July 168 62 36.90 106 63.09 September 4 No No 4 100 October 127 51 40.15 76 59.84 November 155 67 43.22 88 56.77 December 85 35 41.17 50 58.82

AAJMS [Formerly IJMS], August 2020;3(3):82-92;ISSNe 2522-7386

89

Table.4. Seroprevalence of H. Pylori antibodies according to month of the year in Rania city.

Month

No. of samples

examined

Positive Negative

No. % No. % January 46 16 34.78 30 65.2 February 41 14 34.1 27 65.8 March 61 38 62.2 23 37.7 April 56 33 58.9 23 41 May 31 21 67.7 10 32.2 June 39 27 69.2 12 30.7 July 42 25 59.5 17 40.4 August 30 15 50 15 50 September 28 12 42.8 16 57.1 October 37 16 43.2 21 56.7 November 43 20 46.5 23 53.4 December 46 22 47.8 24 52.1

References 1. Lynch T, Lynch P. Helicobacter pylori infection: Not associated

with recurrent abdominal pain in children. Br J Gen Pract 2000;50:578

2. PHE (Public Health England).UK Standards for Microbiology Investigations, Identification of Helicobacter species 2015, (3):1-27.

3. Alsamarai AGM, Moutar FT, Mohammad FI. The significance of determination of pepsinogen A, pepsinogen C, gastrin, CD44 and interferon gamma in individuals with gastritis. World J Pharm Pharmaceut Sci 2016;5(7):44-73.

4. Alsamarai AGM, Fatima Thegeal, Amina Hamed Ahmed Alobaidi. Frequency of biomarkers positivity in Iraqi subjects with gastritis. Sci Int 2017;5:68-83.

AAJMS [Formerly IJMS], August 2020;3(3):82-92;ISSNe 2522-7386

90

5. Alsamarai AGM, Fatima T M A, Farooq I Md, Amina H A A, Mohamed Baquer A. Helicobacter Pylori Strains Isolated from Iraqi Subjects with Gastritis, Peptic Ulcer, and Carcinoma of Stomach Genetic Sequences: A New Variants. Adv Res Gastroenterol Hepatol. 2018; 11(5): 555821. DOI: 10.19080/ARGH.2018.11.555821

6. Moutar FT, Alsamarai AGM, Mohamed FI. Lipid profile in patients with gastritis. World J Pharm Pharmaceut Sci 2016;5(7):74-90.

7. Blanchard S. Peptic ulcer disease in children. In: Long S, Kleigman R, Stanton B, Geme J, Schor N, Behrman R, editors. Nelson Textbook of Pediatrics. 20th ed. Philadelphia: Elsevier Saunders; 2016. p. 1816-9.

8. Aminde JA, Dedino GA, Ngwasiri CA, Ombaku KS, Mahop Makon CA, Aminde LN. Helicobacter pylori infection among patients presenting with dyspepsia at a primary care setting in Cameroon: seroprevalence, five-year trend and predictors. B M C Infectious Diseases. 2019;(30):1-9.

9. Dhakal OP, Dhakal M. Prevalence of Helicobacter pylori infection & pattern of gastrointestinal involvement in patients undergoing upper gastrointestinal endoscopy in Sikkim. Indian J Med Res.2018;147(5): 517-520.

10. Aitila P, Mutyaba M, Okeny S, Ndawula Kasule M, Kasule R, Ssedyabane F, et al. Prevalence and Risk Factors of Helicobacter pylori Infection among Children Aged 1 to 15 Years at Holy Innocents Children’s Hospital, Mbarara, South Western Uganda. J

Trop Med. 2019;2019, 9303072:6 pages. 11. Ayodele MBO, Aaron UU, Oluwatayo GA, Wariso KT.

Prevalence of Helicobacter pylori infection among suspected peptic ulcer patients in Port Harcourt, South- South, Nigeria. Gazette of Medicine.2018;6(1):602-608.

12. Pereira, Abraham P, Nallapeta S, Shetty A. Gastric bacterial flora in patients Harboring Helicobacter pylori with or without chronic dyspepsia: analysis with matrix-assisted laser desorption ionization time-of-flight mass spectroscopy. Gastroenterology 2018;18 (20): 0744-8.

13. Hwaid AH, Hasan AS, Al-Duliami AA, Al-Marjani MF. Seroprevalence of Helicobacter pylori infection and its relation to Abo/ Rhesus Blood groups in Diyala, Iraq. Inter J Cur Res.2013; 5(12):4268-4271.

AAJMS [Formerly IJMS], August 2020;3(3):82-92;ISSNe 2522-7386

91

14. Majeed PD, Khoshnaw KJ. Seroprevalence of Helicobacter Pylori Infection among Patients with gastroduodenal disorders in Erbil city. Diyala J Med 2020;91(18):91-101.

15. AL-Mashhadani DA, Ismael LQ, Zaki AM.. Seroprevalence of Helicobacter Pylori among Human in Erbil Governorate, Kurdistan Region, Iraq. Res J Life Bioinform Pharm Chem Sci 2018;4(2): 268-280.

16. Abadi AT. Diagnosis of Helicobacter pylori Using Invasive and Noninvasive Approaches. J Pathog. 2018; 2018: 9064952

17. Mohammed OM, Arif DM, Mohammed MA. The evolution of triple, quadruple, and Levofloxacin-based therapy in the management of Helicobacter pylori infection among Dyspeptic patients. J Sulaimani College of Medicine 2020;9:45-51.

18. Mohialdeen A, Mohammed I, Hama-ghareeb KA, Ahmad A, Abdulrahim A, Mhmad A, et al. Distribution of Helicobacter pylori Infection among Gastric Cancer in Hiwa Hospital, Sulaimani City. J Res Medical Dental Sci 2019;7(2):194-196.

19. Salih BA. Helicobacter pylori infection in developing countries: the burden for how long?. Saudi J Gastroenterol 2009;15(3): 201- 207.

20. Bani – Hani KE, Hammouri SM. Prevalence of Helicobacter Pylori in northern Jordan. Saudi Med J. 2001;22 (10): 843-847.

21. Perez -Perez GI, Rothenbacher D and Brenner H. Epidemiology of Helicobacter pylori infection. Helicobacter 2004,9(1) :1-6. 36.

22. Sasidharan S, Ghayethry B, Ravichandran M, Latha LY, Lachumy SJ, Leng KM, Prevalence of Helicobacter pylori infection among patients referred for endoscopy: Gender and ethnic differences in Kedah, Malaysia. Asian Pacific J of Trop Dis 2012;2(1):55-59.

23. Abdul Rahim NR, Benson J, Grocke K, Vather D, Zimmerman J, Moody T, MwanriL. Prevalence of Helicobacter pylori infection in newly arrived refugees attending the Migrant Health Service, South Australia. Helicobacter 2016;22(2):1-5.

24. Al-Sinani S, Al-Mulaabed SW, Al-Naamani K and Al-Sharji H. Helicobacter Pylori infection in Omani children. Helicobacter 2017;22(2):306-311.

25. Shu X, Ping M, Yin G and Jiang M. Investigation of Helicobacter pylori infection among symptomatic children in Hangzhou from 2007 to 2014: a retrospective study with 12,796 cases. Peer J.2017; (5):e2937.

AAJMS [Formerly IJMS], August 2020;3(3):82-92;ISSNe 2522-7386

92

26. Vale FF, Vitor JMB. Transmission pathway of Helicobacter pylori: Does food play a role in rural and urban areas?. Int J Food Microbiol 2010;138:1–12.

27. Abbas M, Sharif FA, Osman SM, Osman AM, ElSanousiSM, Magzoub M, Ibrahim ME. Prevalence and Associated Symptoms of Helicobacter pylori Infection among Schoolchildren in Kassala State, East of Sudan. Hindawi Interdisciplinary Perspectives on Infectious Diseases 2018, Article ID 4325752, 5 pages. https://doi.org/10.1155/2018/4325752.

AAJMS [Formerly IJMS] August, 2020;3(3):93-110;ISSNe 2522-7386

93

INSR and PLIN Polymorphism in Women with Poly Cystic Ovary Syndrome (PCOS) and Its Correlation with Insulin Resistance. Mustafa Abd- almajeed Abd-alkareem, Biology Department, College of Science, Tikrit University. Email: Mustafa.majeed4444@gmail.com Mobile: +9647726066925 Hadeel Abdulhadi Omear, Biology Department, College of Science, Tikrit University. Email : hadeel.omear@tu.edu.iq Mobile: +9647726066925 Correspondence author: Dr. Hadeel Abdulhadi Omear, Biology Department, College of Science, Tikrit University. Email : hadeel.omear@tu.edu.iq Mobile: +9647726066925 Received: 20/4/2020 Accepted: 26/6/2020 Published: 1st August, 2020 DOI: https://doi.org/10.32441/aajms.3.3.6 Abstract Background: Polycystic ovary syndrome (PCOS) is one of the most common endocrine disorders that affect women of childbearing age. Several genes, in addition to environmental factors, are involved in PCOS events. Aim: To clarify the association between INSR and PLIN genes and PCOS development. Materials and methods: SNPs in INSR and PLIN was determined using RFLP- PCR and ARMS. Results: There was a significant increase in BMI, Triglyceride, VLDL and Sugar (29.22, 154.66, 30.01, 109.83, respectively) in the PCOS group as compared to the control group (25.19, 121.13, 25.2, 93..4). The frequency of the C allele for INSR in the PCOS group was 0.46, while it was 0.3 in control group.. TT genotype was associated with increased BMI, Triglyceride, HDL, VLDL and Sugar. The frequency of GG in the PCOS group was 0.3 compared to 0.17 in the control group. The increase in BMI, Triglyceride, VLDL and Sugar in PCOS

AAJMS [Formerly IJMS] August, 2020;3(3):93-110;ISSNe 2522-7386

94

group was associated with the CC genotype of the PLIN gene. However, the menarche age was not significantly different between PCOS and control groups. This study indicated association of SNPs in INSR and PLIN with insulin resistance and lipid metabolism disorders in women with PCOS Conclusion: An association of C/T polymorphism at Exon 17 of INSR with PCOS in women was observed. This indicates that the genotype CT may be a risk factor for developing PCOS. As for the PLIN gene, it was found that the group of healthy women who have the genotype CG (heterozygous asymmetric) is the genotype that is not responsible for the occurrence of the disease when compared with the group of women who have the genotype CC (homozygous symmetry). Keywords: Polycystic ovary syndrome, RFLP-PCR, ARMS-PCR, PCOS, INSR, PLIN. Introduction Polycystic ovary syndrome is one of the most common endocrine disorders that affect women of childbearing age. It also exhibits male characteristics such as acne, hirsutism, as well as insulin resistance, obesity, type 2 diabetes and high cholesterol levels. [1]. There is growing evidence to support the syndrome as hereditary pathological condition [2,3]. Women with PCOS have metabolic disorders and the risk of central obesity, hypertension, hyperglycemia, hyperinsulinemia, low high-density lipoprotein and high serum triglycerides. Type 2 diabetes mellitus (T2DM) and cardiovascular disease (CVD) are also evidence that suggest insulin resistance is a basic physiological disease associated with polycystic ovary syndrome.[4]. Type 2 diabetes was detected by insulin resistance in tissues. Insulin-dependent thus decreasing insulin secretion from beta cells in the pancreas [5,6]. The insulin receptor is a Heterotetrameric glycoprotein, a member of the Tyrosine kinase family consisting of two units α and beta linked by a

disulfide bond encoded by the INSR gene, which is located on the short arm of chromosome 19 at region 13.2 (19q13).[2]. This gene is composed of 22 exons and more than 120 kilo base pairs [7]. The encoding area between exon (17-21) encodes for the receptor protein tyrosine kinase and is essential for the transduce of the insulin signal, automatic phosphoration of tyrosine residue [8,9].

AAJMS [Formerly IJMS] August, 2020;3(3):93-110;ISSNe 2522-7386

95

Several types of polymorphisms have been identified within the encoded and non-coding region of the INSR gene for patients with PCOS syndrome. Most of these mutations are silent and the highest frequency of these single nucleotide polymorphism (SNPs) is located on the Exon17 of the INSR gene [10], where these mutations affect the phosphorylation of Tyrosine as well as signal transduction to insulin [11]. It has been suggested that the defect is in the beta chain. Among the exon SNPs 17 on the INSR gene, C / T at the His1058 site in the tyrosine kinase protein, which has an ATP binding site for insulin receptors, has been linked to the development of PCOS probably through the effects on spontaneous phosphorylation and INSR function in some women with the syndrome. [7,10,11]. Genes involved in type 2 diabetes are insulin resistance (PLS), a gene (rs4578621) that encodes Perilipin, one of the phosphorylated proteins that cover intracellular lipid droplets [12]. High Perilipin leads to lipolysis and increased fatty acids and Perilipin is necessary for controlling the level and transport of triglycerides in the blood, triglycerols [13]. This gene is located in humans on the long arm of chromosome 15 at site 26.1 (15q26.1) (NCBI). This site is already close to the site of obesity, diabetes and triglycerides. This protein is the target of protein kinase enzymes (PKA), no phosphorylated PLIN which can act as an obstacle to the hormone sensitive lipase (HSL) that is involved in the decomposition of triglycerides (TAGs) into intracellular lipid droplets [14,15]. In addition, phosphorylation of PLIN may stimulate the function of HSL [16]. This function may also play a role in causing obesity and fat metabolism within the body. Several studies have shown that the level of expression of PLIN is associated with obesity. In 2003, a study conducted by San Millan et al [17] revealed that obese individuals have a lower level of PLIN compared to normal individuals and slimming. In another study, the level of PLIN was high and the concentration of mRNA in obese individuals [18], while the study conducted by Seeley and Woods [19] in 2016 showed that the PLIN gene is linked to obesity and related diseases. Thus this study was conducted to clarify the association between INSR and PLIN genes polymorphism and development of PCOS.

AAJMS [Formerly IJMS] August, 2020;3(3):93-110;ISSNe 2522-7386

96

Materials and methods Study population and sample collection Women with PCOS were recruited from those attending Gynecology and Obstetrics Clinic in Samara General Hospital for the period from 1st July to 1st December 2018. Blood samples were collected from 70 women with polycystic ovary syndrome and 30 apparently healthy women as matched control for laboratory investigation. Their age range was 16 to 46 years. The demographic and clinical data gathered using a predesigned questionnaire. Each blood sample was divided in to two parts, the 1st one ml was placed in EDTA test tubes and to be used later for DNA extraction. The 2nd part of the sample used for separation of serum and determination of lipid profile and blood sugar. Lipid profile and blood sugar were determined using Biolabo kits, France. The study protocol was approved by the Ethical Committee of College of Science, Tikrit University. Verbal informed consent was taken from each women before their enrolment in the study. Molecular tests The molecular test was performed in Molecular Biology Laboratory, College of Science, Tikrit University. DNA extracted from white blood cells preserved in EDTA tubes using the previously reported extraction method [20]. Polymorphisms are detected using RFLP- PCR and ARMS. The Exon 17 polymorphism of the INSR gene was detected using PCR techniques and using aprimex kit from Bioneer Korea. The primers used in the test are shown in Table 1. Table.1. Sequence of primers used to detect(INSR, PLIN) polymorphisms

Method Sequence Gene RFLP-PCR

F-5´CCAAGGATGCTGTGTAG ATAAG-3´ R-5´ TCAGGAAAGCCAG CCCATGTC.-3´

INSR

ARMS R-wild- 5´TGGACATCTCACTGTATT GCTC-3´ R-Mutant-5´ TGGACATCTCACTGTATTGCTG-3´ F-common-5´ AAATGCAGGTAGCCATAAGA-3´

PLIN

AAJMS [Formerly IJMS] August, 2020;3(3):93-110;ISSNe 2522-7386

97

Following the program described previously [21], the 317bp PCR product was cut by (10 unit) Pmll (Biolab, England) for 4 hours and at 37 C0. The digested DNA electrophoresis performed over the 2% agarose gel and then detected using UV-trans-illuminator. The single band 317 bp mean TT homozygous genotype. The three bands (317, 274, 43) bp mean the Heterozygous CT genotype. The two bands (274, 43) bp mean the Homozygous CC Genotype, Fig. 1.

Fig.1.Restriction fragment length polymorphism analysis of the C/T polymorphism of exon 17 in the INSR gene. Agarose gel (2%) electrophoresis after PmlI digestion of the PCR

M: 50 bp DNA ladder; Samples 1,2, 3,5,6,8,9,10: CT genotype (317-bp, 274-bp and 43-bp); Samples 4 and 7:TT genotype (317-bp)

(rs4578621) SNPs was detected by applying ARMS-PCR technique using the primers listed in Table (1) and Primexkit and following the program instructions [22]. Two reactions were used for each sample, each reaction in a separate test tube. In the first tube, the Fcommon primer was used with RWild, while in the second tube, FCommon and RMutant were used. Electrophoresis then performed on the agarose gel and imaged in the E-graph device. If the band appears in the first tube only the genotype is CC, if a band appears in the two tubes means that the genotype is CG, but if a band appears in the second tube only, the genotype is a homozygous GG, Fig 2.

AAJMS [Formerly IJMS] August, 2020;3(3):93-110;ISSNe 2522-7386

98

Fig. 2. Electrophoresis on 2% concentration of agarose gel using ARMS-PCR for PLIN gene with 100bp volumetric index for infected group

M: 100 bp DNA ladder; Samples 1,2, 3,4: CC genotype; Sample 5 :CG genotype; Sample 6: GG

Statistical analysis The p and t value were calculated using SPSS version ( 21.0.). Alleles frequency of SNPs was calculated as described previously [23]. Results Amenorrhoea was the common symptom (77.14%) present in

women with PCOS, followed by hirsutism (72.8%), Table 2. Additionally, there was a significant differences in BMI value and mean serum concentration of Triglyceride, LDL, HDL, VLDL and Sugar in patients as compared to control group. However, there was no significant difference in the age of menarche and mean serum cholesterol between the two groups, Table 3 and Fig 1. Detected polymorphisms in the two studied genes are shown in Table.4 and 5. For INSR gene, there was a significant differences (X2

=8.43; P =0.015) in CC, CT, and TT genes between women with PCOS and control group. Additionally, the frequency rate of allele C was 0.46 in women with PCOS and 0.3 in control group and the difference was statistically significant (X2= 5.433; P=0.02). In

AAJMS [Formerly IJMS] August, 2020;3(3):93-110;ISSNe 2522-7386

99

addition, the T allele frequency in patients was 0.54 and 0.70 in control group. This finding indicated that CT genotype was a risk factor for developing ovarian cyst syndrome and may suggest that T allele was protective factor for PCOS development, while C allele was a risk factor for the development of PCOS, Table 4.

Table 2. Phenotypic characteristics of women with PCOS

Percent Phenotype 72.8 Hirsutism 55.7 Acne 32.8 Baldness 28.5 Infertility 77.14 Amenorrhea

Table 3. Comparison of variables in women with PCOS and control group.

p-value

Mean ± SD Parameters Control PCOS

0.37 14.33±0.02 14.39±0.01 Menarche age 0.00067 25.19±1.04 29.22±0.45 BMI 0.193 190±52.07 179.67±22.32 Cholesterol 0.024 121.13±99.09 154.66±85.32 Triglyceride 0.03 125.98±52.6 109.55±22.7 LDL

0.0007 42.03±1.53 37.19±0.65 HDL 0.007 24.23±7.53 30.93±3.23 VLDL 0.025 93.4±48.1 109.83±20.75 Sugar

AAJMS [Formerly IJMS] August, 2020;3(3):93-110;ISSNe 2522-7386

100

Fig. 3. Variables comparison between PCOS and control groups.

Table.4. Distribution of C/T Alleles of exon 17 of INSR in women with PCOS and control group.

Genotype

Group Control Patient

N % Freq. N % Freq.

CC 2 6.6 (0.06) 8 11.4 (0.11) CT 14 46.7 (0.47) 49 70.0 (0.70) TT 14 40.7 (0.47) 13 18.6 (0.19)

Total 30 100% 70 100%

X2 Chi-Square = 8.430 ; P= 0.015 Genotype N (%) N (%) C allele 0.30 0.46 T allele 0.70 0.54

X2 Chi-Square = 5.433 ; P= 0.02

0

20

40

60

80

100

120

140

160

180

200

PCOS(70)

Control(30)

AAJMS [Formerly IJMS] August, 2020;3(3):93-110;ISSNe 2522-7386

101

For PLIN gene, there was a non significant differences (X2

=2.8; P>0.05) in CC, CG, and GG genes between women with PCOS and control group. Additionally, the frequency rate of allele C was 0.50 in women with PCOS and 0.58 in control group and the difference was statistically not significant (X2 =1.288; P>0.05). In addition, the G allele frequency in patients was 0.50 and 0.42 in control group. This finding suggest that GG genotype may be a risk factor for the development of ovarian cyst syndrome and may suggest that C allele may play as a protective factor for PCOS development, while G allele may be a risk factor for the development of PCOS. However, this finding need to be confirmed in a large scale study. The analysis of C/G alleles of PLIN and C/T Alleles of exon 17 of INSR on the basis of age of menarche, BMI, sugar, and lipid profile strata not reveal any significant differences with the exception of BMI with INSR genotype, Table 6 and 7.

Table.5. Distribution of C/G Alleles of PLIN in women with PCOS and control group.

Genotype Groups

Control

Patient

N % Freq. N % Freq. CC 10 33.3 (0.33) 25 35.7 (0.36) CG 15 50.0 (0.50) 24 34.3 (0.34) GG 5 16.7 (0.17) 21 30.0 (0.30)

Total 30 100% 70 100% X2 Chi-Square = 2.800; P=0.247

Genotype N (%) N (%) C allele 0.58 0.5 G allele 0.42 0.5

X2 Chi-Square = 1.288; P=0.256

AAJMS [Formerly IJMS] August, 2020;3(3):93-110;ISSNe 2522-7386

102

Table.6. Correlation of INSR Genotypes with some biochemical parameters, BMI and Age of menarche.

Genotype parameters Number Mean ± SD P value Age of Menarche

CC 8 14.37±.51 14.40±.81 14.30±.75 14.38±.76

0.917 CT 49 TT 13 Total 70

BMI CC 8 24.29±4.75 28.86±6.33 33.58±5.77 29.21±6.51

0.004 CT 49 TT 13 Total 70

Cholesterol CC 8 171.62±24.30 182.40±37.23 174.30±33.04 179.67±35.10

0.607 CT 49 TT 13 Total 70

Triglyceride CC 8 139.25±85.75 146.48±69.70 194.92±125.02 154.65±84.99

0.163 CT 49 TT 13 Total 70

HDL CC 8 34.87±4.29 37.42±6.48 37.69±6.34 37.18±6.22

0.539 CT 49 TT 13 Total 70

VLDL CC 8 27.85±17.15 29.30±13.94 33.98±24.29 30.00±16.48

0.618 CT 49 TT 13 Total 70

LDL CC 8 112.27±19.01 112.16±37.45 98.01±43.89

109.54±37.12

0.469 CT 49 TT 13 Total 70

Sugar CC 8 88.37±15.43 105.32±51.35 104.61±40.63 103.25±46.634

.637 CT 49 TT 13 Total 70

AAJMS [Formerly IJMS] August, 2020;3(3):93-110;ISSNe 2522-7386

103

Table.7. Correlation of PLIN Genotypes, BMI, with BMI, biochemical, and Age of Menarche parameters.

Genotype parameters N Mean ± SD P value Age of Menarche CC 25 14.36±.81

14.37±.82 14.42±.67 14.38±.76

CG 24 GG 21

Total 70 0.953 BMI CC 25 29.48±7.79

30.89±5.36 27.24±5.53 29.29±6.46

CG 24 GG 21

Total 70 0.165 Cholesterol CC 25 178.2±35.42

172.25±25.47 190.61±42.45 179.90±35.09

CG 24 GG 21

Total 70 0.208 Triglyceride CC 25 175.96±104.30

138.16±76.79 150.71±65.60 155.42±85.20

CG 24 GG 21

Total 70 0.290 HDL CC 25 35.40±5.20

37.91±7.24 38.0476±6.24 37.05±6.30

CG 24 GG 21

Total 70 0.264 VLDL CC 25 32.60±20.09

27.6333±15.35 30.1429±13.12

30.16±16.53

CG 24 GG 21

Total 70 0.581 LDL CC 25 106.22±39.23

104.28±29.40 118.91±41.93 109.36±37.06

CG 24 GG 21

Total 70 0.369 Sugar CC 25 119.28±66.73

90.16±26.07 100.66±28.90 103.71±46.60

CG 24 GG 21

Total 70 0.085

AAJMS [Formerly IJMS] August, 2020;3(3):93-110;ISSNe 2522-7386

104

Discussion PCOS is one of the most widely studied endocrine diseases in women. Many patients with PCOS are more likely to develop T2DM and have symptoms such as glucose intolerance and insulin resistance [24]. Lipid metabolism disorders, central obesity, hypertension and high triglyceride level [25] were associated with PCOS. The current study shows a significant difference in BMI between the PCOS and the control group. It was also observed that there was a significant difference in triglycerides, VLDL, HDL, LDL and blood sugar levels in PCOS group compared with the control group. No difference was observed in the mean age of menarche. Cholesterol, LDL and HDL were significantly lower in the PCOS group as compared to the controls. Fat metabolism is one of the most common disorders in PCOS patients with an incidence of more than 70% [26]. It was suggested that genes related to insulin action and lipid metabolism with a particular focus on the INSR and PLIN gene may act as a cause of PCOS. In other words women with certain gene focus are more susceptible for the development of PCOS than those without such genes. The INSR receptor gene is composed of 22 exons located on a chromosome 19 extending over 120 kbp. Several single nucleotide polymorphisms of the INSR gene have been detected, the most important being the expression region exon 17 [27]. This region encodes the tyrosine kinase protein for insulin receptors and is therefore associated with severe insulin resistance and hyperinsulinism and is therefore highly associated with PCOS [28,29]. The present study findings reveals an association between a single nucleotide polymorphism in exon 17 of the INSR gene and PCOS development. The frequencies of the CC, CT and TT genotypes were significantly different between PCOS patients and the control group. Interestingly, the TT genotype was higher in control women than in patients while the CC genotype was higher in women with PCOS. This finding indicated that TT genotype was a protective gene while CC genotype was a risk factor for the development of PCOS. Moreover, obesity was associated with the genotype (TT) compared to the other genotype, the mean of BMI in women with TT type was

AAJMS [Formerly IJMS] August, 2020;3(3):93-110;ISSNe 2522-7386

105

higher and a significantly different in their frequency from that in women with CT and CC genotype [30]. The polymorphism of 1085 C / T in the encoded segment of the tyrosine kinase on the INSR gene indicated that women with the syndrome may be overweight or thin [10,29]. This study proved that women with PCOS were overweight and had higher BMI values than control group. This finding suggest that there was a clear effect of C / T polymorphism in exon 17 of the INSR gene on physiological and biochemical variables in women with PCOS. Women with genotype TT had higher mean level of glucose as compared to those with other genotypes. In other words there is insulin resistance predominance. In cases where mutations occur in exons 17-21, the region that encodes tyrosine kinase for insulin receptors is highly resistant to insulin and hyperinsulinemia [31]. Excessive phosphorylation of serine residues from INSR and signal transfer molecules is causing insulin resistance. This molecular imbalance reduces the activity of tyrosine kinase in INSR, thereby reducing the signal transmission pathway [31,32]. Studies of INSR function in some women with PCOS have found that changes in auto-phosphorylation that may be secondary to tyrosine kinase polymorphisms selectively affect metabolic pathways rather than dilution pathways in conventional insulin-targeted tissues and ovaries [33]. Insulin stimulates obesity by affecting the brain causing hunger. Recent evidence suggests that the brain processes information from fatty tissue signals such as insulin, which are spread in proportion to body fat mass, and integrates this input with nutrient signals such as fatty acids [34,35]. In response, the brain sends signals to control nutritional behavior and metabolism of essential substances in ways that promote balance in both energy stores and fuel metabolism, the liver works by making fat by converting extra calories into fat, and on fat cells in the muscle belly to be filled with fat by reducing mitochondrial function [36,37]. In the PLIN gene (rs4578621), the results showed that the frequency of homozygous mutant patterns (GG) was higher in women

AAJMS [Formerly IJMS] August, 2020;3(3):93-110;ISSNe 2522-7386

106

with the polycystic ovary syndrome (0.3) compared to the control group (0.17). The frequency of alleles C in patients was (0.5) while it was (0.58) in the control group, while alleles G was with frequency of (0.5) and (0.42) in patients and control groups respectively. From the equilibrium of the society and the stability of the allele frequency, the mutant allele frequency was higher in patients than in the control group [23]. This variation in genes and alleles may explain the prevalence and incidence rates differences between different social groups. Women with PCOS who show INSR polymorphism were with significant lower BMI mean value in those with CC genotype as compared to those with CT and TT genotypes. In addition, serum cholesterol, triglycerides, VLDL, HDL and blood sugar were lower in CC genotype as compared to CT and TT genotypes. However, the differences not reach a significant levels and thus warranted the need for conduction of large scale study to confirm or exclude this finding. The present study data showed that women with polycystic ovary syndrome carrying C alleles had a higher value of BMI than other alleles in women with PLIN polymorphism. Additionally, genotypes (CG and CC) showed a higher mean values of BMI than the genotype (GG). Blood glucose mean serum value was higher in women with CC genotypes as compared to those with CG and GG genotypes. PLIN protein is an important phosphorylated proteins in the process of controlling the level and transport of triglycerides [14]. This may play a role in the events of obesity and obstruction of fat metabolism within the body as previous studies have shown that individuals who are obese and related diseases they have a lower level of PLIN protein [16,19]. At the same time, the age of a menarche showed no difference between the three genotypes, while HDL and LDL cholesterol concentration was low in CC genotypes compared to other genotypes. This study is the first research on the relationship of the PLIN gene in Iraqi women with PCOS. Global previous studies had reported fewer links between the PLIN gene and PCOS. This is explained the current study finding concerning the genetic variation in the PLIN gene. It was not associated with the risk of PCOS. However, the

AAJMS [Formerly IJMS] August, 2020;3(3):93-110;ISSNe 2522-7386

107

present study sample size is small and this warranted the need for performance in a large scale study. In conclusion, an association of C/T polymorphism at Exon 17 of INSR with PCOS in women was observed. This indicates that the genotype CT may be a risk factor for developing PCOS. For the PLIN gene, it was found that the group of healthy women who have the genotype CG (heterozygous asymmetric) is the genotype that is not responsible for the occurrence of the disease when compared with the group of women who have the genotype CC (homozygous symmetry). References 1. Ding T, Hardiman PJ, Petersen I, Wang FF, Qu F, Baio G. The

prevalence of polycystic ovary syndrome in reproductive-aged women of different ethnicity: a systematic review and meta-analysis. Oncotarget. 2017;8(56):96351–58.

2. Tehrani RF, Behboudi-Gandevani S. Polycystic ovary syndrome . INTECH Open Science, Chapter (4). Cotemporary Gynecologic Practice: 81. 2015.

3. Bozdag G, Mumusoglu S, Zengin D, Karabulut E, Yildiz BO. The prevalence and phenotypic features of polycystic ovary syndrome: a systematic review and meta-analysis. Hum Reprod.2016;31:2841–55.

4. Santoro N, Eisenberg E, Trussell JC, Craig LB, Gracia C, Huang H, et al. Fertility-related quality of life from two RCT cohorts with infertility: unexplained infertility and polycystic ovary syndrome. Hum Reprod 2016;31: 2268–79.

5. Anwar S, Shikalgar N. Prevention of type 2 diabetes mellitus in polycystic ovary syndrome: A review. Diabetes and Metabolic Syndrome: Clin Res Rev 2017;11:913- 917.

6. Hallberg SJ, Mckenzine AL, Willamms PT, Bhanpuri NH, Peters NL, Campbell WW, et al. Effectiveness and Safety of a Novel Care Model for the Management of Type 2 Diabetes at 1 Year : An Open- Lael, Non-Randomized, Controlled Study.Diabetes Ther 2018;9:583-612.

7. Zhu JL, Luo XM, QianYQ, Jin FH, Uang HF. A novel SNP at exon 17 of INSR is associated with decreased insulin sensitivity in Chinese women with PCOS. Molecular Human Reproduction 2006; . 12:151–155.

8. Ward CW, Lawrence MC, Streltsov VA, Adams TE, McKeon NM. The insulin and EGF receptor structures: new insights into

AAJMS [Formerly IJMS] August, 2020;3(3):93-110;ISSNe 2522-7386

108

ligand–induced receptor activation. Trends in Biochemical Science. 2007; 32(3):129– 137.

9. Li M, Youngren JF, Dunaif A, Goldfine ID, Maddux BA, Zhang BB, et al. Decreased insulin receptor (IR) autophosphorylation in fibroblasts from patients with PCOS: effects of serine kinase inhibitors and IR activators. J Clin Endocrinol Metab 2002; 87: 4088-4093.

10. San Millán JL, Cortón M, Villuendas G, Sancho J, Peral B, Escobar-Morreale HF. Association of polycystic ovary syndrome with genomic variants related to insulin resistance, type 2 diabetes mellitus, and obesity. J Clin Endocrinol Metab 2004; 89: 2640-2646.

11. Diamanti-Kandarakis E, Papavassiliou AG. Molecular mechanisms of insulin resistance in polycystic ovary syndrome. Trends Mol Med 2006; 12: 324-332.

12. Sohn JH, Lee YK, Han JS, Jeon YG, Kim JI, Choe SS, Kim SJ, Yoo HJ, Kim JB. Perilipin 1 (Plin1) deficiency promotes inflammatory responses in lean adipose tissue through lipid dysregulation. J Biol Chem. 2018;293(36):13974-13988..

13. Tucci S, Futterweit W, Concepcion ES, Greenberg DA, Villanueva R, Davies TF, et al. Evidence for association of polycystic ovary syndrome in caucasian women with a marker at the insulin receptor gene locus. J Clin Endocrinol Metab 2001; 86: 446-449.

14. Bialesova L, Kulyté A, Petrus P, Sinha I, Laurencikiene J, Zhao C, et al. Epigenetic Regulation of PLIN 1 in Obese Women and its Relation to Lipolysis. Sci. Rep.2017; 7: 10-152.

15. Lee EJ, Yoo KJ, Kim SJ, Lee SH, Choi DH, Cha KU, et al. Relationship between the C/T single nucleotide polymorphysim in Exon 17 of the Insulin Receptor Gene and Polycystic Ovary Syndrome. J Biol Sci .2005; 5: 832-836.

16. Spritzer PM. Polycystic ovary syndrome: reviewing diagnosis and management of metabolic disturbances. Arq Bras Endocrinol Metabol 2014;58(2):182–187.

17. San Millán JL, Cortón M, Villuendas G, Sancho J, Peral B, Escobar-Morreale HF. Association of polycystic ovary syndrome with genomic variants related to insulin resistance, type 2 diabetes mellitus, and obesity. J Clin Endocrinol Metab 2004; 89: 2640-2646.

AAJMS [Formerly IJMS] August, 2020;3(3):93-110;ISSNe 2522-7386

109

18. Musso C, Cochran E, Moran SA, Skarulis MC, Oral EA, Taylor S, et al. Clinical course of genetic diseases of the insulin receptor (type A and Rabson-Mendenhall syndromes): a 30-year prospective. Medicine (Baltimore) .2004; 83: 209-222.

19. Seeley RJ, Woods SC. Monitoring of stored and available fuel by the CNS: Implications for obesity. Nat Rev Neurosci .2003; 4: 901-909.

20. Nicolaiou K, Isoldi KK, Ramer NJ, Sarcona A. The Role of Perilipins in the Development of Obesity and Obesity-Related Diseases. Topics Clin Nutr 2016;31(3): 248 -256 .

21. Bartlett J, Stirling D. PCR protocols: Method in Molecular Biology. 2nd ed. Springer, 2003..

22. Mutib MT, Hamdan FB, Al-Salihi AR. INSR gene variation is associated with decreased insulin sensitivity in Iraqi women with PCOS. Iran J Reproduct Med;2014;12(7): 499–506.

23. Noorzehi SR, Galavi N, Ranjbar HR, Lotfian M. Association of Perilipin and insulin receptor substrate-1 genes polymorphism with lipid profiles, central obesity , and type2 diabetes in a sample of an Iranian population. Iran Red. Crescent Med J 2017;19(6): 1-8.

24. Snustad DP, Simmons MJ. Genetics. 6th ed. John Wiley & Sons, Inc., 2012.

25. Bagheri M, Abdi-Rad I, Hosseini-Jazani N, Zarrin R, Nanbakhsh F, Mohammadzaie N. An association study between INSR/NsiI (rs2059806) and INSR/PmlI (rs1799817) SNPs in women with polycystic ovary syndrome from west Azerbaijan province. Iran J Reprod Infer 2015;16: 109–112.

26. Daghestani MH. RS1799817 in INSR associates with susceptibility to polycystic ovary syndrome. J Med Biochem 2019;38: 1–11.

27. Panz VR, Ruff P, Joffe BI, Kedda MA, Seftel HC. SSCP analysis of the tyrosine kinase domain of the insulin receptor gene: polymorphisms detected in South African black and white subjects. Hum Genet 1996; 97: 438-440.

28. AI-Jefout M, Alnawaiseh N, Al-Qtaitat A. Insulin resistance and obesity among infertile women with different polycystic ovary syndrome phenotypes. Scientific Reports 2017;.7: 39-53.

29. Takasawa K, Tsuji-Hosokawa A, Takihima S, Wada Y, Nagasaki K, Dateki S, et al. Clinical characteristics of adolescent cases with

AAJMS [Formerly IJMS] August, 2020;3(3):93-110;ISSNe 2522-7386

110

Type A insulin resistance syndrome caused by heterozygous mutations in the β-subunit of the insulin receptor (INSR) gene. J Diabetes 2019;11(1):46–54.

30. Lee EJ, Yoo KJ, Kim SJ, Lee SH, Choi DH, Cha KU, et al. Relationship between the C/T single nucleotide polymorphysim in Exon 17 of the Insulin Receptor Gene and Polycystic Ovary Syndrom. J Biol Sci. 2005;5: 832-836.

31. Chang AY, Lalia AZ, Jenkins GD, Dutta T, Carter RE, Singh RJ, et al. Combining a non targeted and targeted metabolomics approach to identify metabolic pathways significantly altered in polycystic ovary syndrome. Metabolism 2017;71:52–63.

32. Bremer AA, Miller WL. The serine phosphorylation hypothesis of polycystic ovary syndrome: a unifying mechanism for hyper androgenemia and insulin resistance. Fertil Steril, 2008;89(5):1039–1048.

33. Tsuji-Hosokawa A, Takasawa K, Nomura R, Miyakawa Y, Numakura C, Hijikata A, et al.. Molecular mechanisms of insulin resistance in 2 cases of primary insulin receptor defect-associated diseases. Pediatr Diabetes. 2017;18(9): 17–24.

34. Hubbard SR. Insulin receptor: both a prototypical and atypical receptor tyrosine kinase. Cold Spring Harb Perspect Bio. 2013;15 (3):46-89.

35. Pocai A, Lam TK, Obici S, Gutierrez-Juarez R, Muse ED, Arduini A, et al. Restoration of hypothalamic lipid sensing normalizes energy and glucose homeostasis in overfed rats. J Clin Invest 2006; 116: 1081-1091.

36. Murray RK, Granner DK, Mayes PA, Rodwell VW. Overview of Metabolism. In: Mayes P A and Bender D A (ed). Harper’s

Illustrated Biochemistry. 26th

Ed. New York, Lange Medical Books/McGraw-Hill; 2003: 125-128.

37. Hosoe J, Kadowaki H, Miya F, Aizu K, Kawamura T, Miyata I, et al. Structural basis and genotype–phenotype correlations of INSR mutations causing severe insulin resistance. Diabetes. 2017;66: 2713–2723.

AAJMS [Formerly IJMS]August, 2020;3(3): 111-131;ISSNe 2522-7386

111

CASE REPORT

Cough Variant Asthma: Case Report Suzan Khaled Mohammed Saraj, Kirkuk Health Authority, Kirkuk, Iraq. Email: suzansarag@yahoo.com Mobile:+9647731625525 ORCID: https://orcid.org/0000-0002-5512-716X Zainab Khalil Aljumaili, Kirkuk Health Authority, Kirkuk, Iraq Email: zkhzen@yahoo.com; Mobile: +9647730992311 ORCID: http://orcid.org/0000-0003-1723-1967 Correspondence author: Zainab Khalil Aljumaili, Kirkuk Health Authority, Kirkuk, Iraq Email: zkhzen@yahoo.com; Mobile: +9647730992311 ORCID: http://orcid.org/0000-0003-1723-1967 DOI: https://doi.org/10.32441/aajms.3.3.7 Received: 18/4/2020 Accepted: 25/6/2020 Published: 1st August, 2020 Abstract Chronic cough prevalence was with the range of 11-13% of the global community. Higher prevalence rate was reported for Oceania, while the lower prevalence was in Africa. Chronic cough is with social, physical and psychological impact and many approaches proposed for its complex management. Cough is an important and common symptom of respiratory tract health problem. Cough variant asthma forms the etiology of cough in 30-50% of those with chronic cough. Chronic nonproductive may be the only symptom of asthma. We report a 54 year old male with chronic cough of 8 years duration. The case diagnosed by consultant allergologist as cough variant asthma and kept on treatment protocol. Unfortunately, immunotherapy is difficult to be performed in this case because of the wide range of hypersensitivity to food and inhalant allergens. Keywords: Cough, Asthma, Cough variant asthma, Allergic rhinitis, Inhalant allergens, Food allergens, Refractory cough, Chronic cough, Allergic rhinitis.

AAJMS [Formerly IJMS]August, 2020;3(3): 111-131;ISSNe 2522-7386

112

Introduction Chronic cough is defined as a cough lasting more than 8 weeks [1,2]. The cough may be of pulmonary or extra-pulmonary etiology [3]. Chronic cough prevalence was with the range of 11-13% of the community [4,5]. Recent meta-analysis of 90 studies reported a prevalence of 18.1% in Oceania, 12.7% in Europe, 11% in America, 4.4% in Asia and 2.3 in Africa [6]. Chronic cough is with social, physical and psychological impact and many approaches proposed for its complex management [1,2,5,7-10]. Multiple guidelines were developed for different geographical areas [1,11-17]. Recent review [3Poiten] summarized these guidelines. There are variable success in the treatment of chronic cough according to such guidelines [18-21]. In literature many studies reported the etiology and aggravating factors of chronic cough [2,7,20,22-28]. Cough is an important and common symptom of respiratory tract health problem [29]. Nonproductive chronic cough is a symptom of chronic health problem and thus in most cases the cough relieved during treatment course and relapsed after cessation of treatment [2,3]. Asthma is a chronic respiratory disease with prevalence of 4.4% to 7.6% in the Middle East [30] that characterized by immunologic, inflammatory and metabolic changes [31-40]. Comorbid allergic rhinitis was common in patients with asthma (61.6%) as compared to non-asthmatic individuals (6%) (Odd Ratio [OR] = 25.5;P< 0.0001).[41]. Recent studies may suggest that asthma is a syndrome and it is with several different phenotypes [42- 44]. Cough variant asthma forms the etiology of cough in 30-50% of those with chronic cough [43]. Chronic nonproductive may be the only symptom of asthma [44-47]. Although many definition were proposed for cough variant asthma, both classical asthma and cough variant asthma were the same, however, CVA preceded classical phenotype [42,46,48,49]. The pathophysiology of asthma is complicated and involved many inflammatory, immunological, enzymatic responses and activities that associated with nervous system involvement [ 42,44, 48-61]. Case report A 56 years old Male presented to the clinic with prolonged dry cough with no history of wheezing. The cough was of 8 years duration. He consulted internist physician, ENT specialist,

AAJMS [Formerly IJMS]August, 2020;3(3): 111-131;ISSNe 2522-7386

113

Dermatologist, Allergologist, and General practioners. He received treatment that include antihistamine, Antibiotics, decongestant, and sore throat lozenges. Endoscopy of pharynx and larynx was normal, however, spirometry not performed. Ultrasonography of the thyroid gland was normal. Allergy test to determine IgE specific antibodies for food and inhalant allergens were performed using kit from MEDIWISS Analytic GmbH, Uerdinger Straße 3; D-47441, Moers, Germany and their results are shown in Table 1-3. There are high rate of hypersensitivity for both food and inhalant allergens. For food allergens, 16.7% (5/30) of the tested allergens show significant increase of IgE, while 30% (9/30) show slight increase, Table 1. For inhalant allergens, IgE significantly increased in 6.7% (2/30) of tested allergens, while slight increase demonstrated in 33.3% (10/30), Table 2. Unfortunately, immunotherapy is difficult to be performed in this case because of the wide range of hypersensitivity to food and inhalant allergens. The case was diagnosed as CVA according to the criteria previously reported [54]. And kept on treatment protocol that include leukotriene receptor antagonist (Montelukast), Fexon, and aminophylline hydrate (phyllocontin prolonged release tablet). Discussion Asthma may be recognized as a syndrome that involve multiple organ of the entire airway and subsequent metabolic abnormalities [41]. The pathophysiology of asthma involved complicated scenario of events which involve a cascade of immune responses, inflammatory processes, and neurotic disorders that may attributed to metabolic and haematologic changes with time [31-41]. Glauser in 1972 first described cough variant asthma [62] as a phenotype of asthma. Both CVA and classical asthma are sharing airway hyperresponsiveness (AHR) as the main underlying pathophysiological mechanism [44]. However, AHR and airway remodeling are milder in CVA subjects as compared to classical asthma [48,55-57,63]. Previous studies indicated that there was no significant difference between classical asthma and CVA for many biomarkers in blood and sputum such as increased percentage of eosinophils [64], interleukin 8 (IL-8), eosinophilic cationic protein, levels of exhaled nitric oxide (FeNO) [64,65-68]. CVA early diagnosis is important as the treatment prevent the progression of CVA to classical asthma [29]. Recent studies suggested many biomarkers for diagnosis and treatment and prognosis monitoring of patients with asthma [29,31-

AAJMS [Formerly IJMS]August, 2020;3(3): 111-131;ISSNe 2522-7386

114

41,65,66,68-75]. Eosinophils oxidative injury to respiratory system in asthmatic patients was more substantial than that induced by neutrophils [76]. Thus hydrogen peroxide that was induced by eosinophils increased in asthmatic patients exhaled condensate [74,77-80]. Patients with CVA presented mostly with chronic nonproductive cough responsive to bronchodilator treatment.[81] Recognition of cough variant asthma is clinically important because bronchodilator treatment is only effective in cough variant asthma and can be prevented from progression to classical asthma [29]. Alobaidi [29] reported that hydrogen peroxide in breath condensate was significantly higher in patients with classical and cough variant asthma groups as compared to those with chronic cough nonasthmatic individuals and healthy control groups. patients with cough variant asthma show high level of expired breath condensate H2O2 than that in patients with chronic cough nonasthmatic and healthy control. Additionally, expired breath condensate pH was lower in CVA than that in subjects with chronic cough nonasthmatic subjects and healthy controls. Both the expired breath condensate H2O2 and pH in CVA were without significant difference between classical asthma and CVA. The cough induction in CVA is not clear, however, previous study suggested that in CVA patients the inflammation was solely in large respiratory airway were cough receptors are abundant [82]. However, eosinophil tussive mediators may be responsible for the induction of cough in CVA [65,83]. Others suggested that local bronchoconstriction stimulated cough receptors and induced cough in subjects with asthma [67,69]. This explanation may be accepted since bronchodilators are effective in relieving cough in CVA [84]. However, previous studies reported normal pulmonary function test [85-87] or peripheral rather than central airway obstruction[88] at baseline. In CVA exercise [87] or methacholine challenge [85] revealed peripheral and central airways obstruction similar to classical asthma or predominant peripheral obstruction [87]. Baseline pulmonary function parameters did not show significant difference between CVA and classical asthma in the peripheral and central responsiveness [69]. Koh et al [89] suggest that CVA is without wheeze due to high wheezing threshold as compared to classical asthma. In addition, high

AAJMS [Formerly IJMS]August, 2020;3(3): 111-131;ISSNe 2522-7386

115

sensitivity of cough receptors in some individuals may be suggested as other mechanism for cough induction in CVA [90]. However, others not accept this explanation as mechanism for cough induction [84]. CVA is under-diagnosed in community [91] and thus CVA must be included in differential diagnosis of chronic cough [78,82,85,86] and this approach may prevent conversion of CVA to classical asthma. Appropriate diagnostic procedures, including detection of inflammatory markers in expired breath condensate should be considered [29] . The presence of elevated H2O2 and reduced pH of expired breath condensate, which may suggest eosinophilic airway inflammation and possible diagnosis of cough variant asthma, may be of some help in the initial assessment of patients with chronic cough.[29]. In none proper treatment of classical asthma may lead to irreversible pathological changes that was induced by persistent inflammation [92]. This pathological changes may present in CVA as previous study indicated [29]. Inhaled corticosteroids early use may lead to good prognosis in classical asthma [93] and this may be the same in CVA, however, this warranted further detailed investigation. About 1/3 of CVA develop classical asthma [85,94]. Early diagnosis of CVA and the use of the inhaled corticosteroids is of good prognosis in prevention of conversion from CVA to classical asthma [82,95]. Some investigators suggested the use of steroids in the diagnosis of CVA [96-99], however, this may misclassify atopic cough with CVA as steroids also effective in control of atopic cough [82]. The patients kept on treatment protocol that include leukotriene receptor antagonist (Montelukast), Antihistamine (Fexon), and bronchodilator [aminophylline hydrate (phyllocontin prolonged release tablet)]. After 48 hours, patients improved clinically, however, the cough not completely disappeared. Good outcome of the treatment may be suspected if the guideline followed thoroughly. The new concept of central and peripheral hypersensitivity and neurophenotypes attributed to understanding of the physiopathological mechanisms of chronic cough including CVA [3]. This new concept encourage researchers to develop new drugs for the treatment of chronic or refractory cough or CVA. In chronic cough management, asthma assessment must be performed [100,101]. In 14% to 41.3% of

AAJMS [Formerly IJMS]August, 2020;3(3): 111-131;ISSNe 2522-7386

116

chronic cough cases classical and CVA are the underlying etiology [102,103]. The chronic hypersensitivity syndrome (CHS) concept developed [104] and considered clinically relevant by the European Respiratory Society (ERS) Task Force [105]. Upper airways and larynx were with hypersensitivity in those with CHS. The sensory nerve of the airway is hypersensitive to the irritants due to mucosal cough receptors upregulation and afferent nerve activity triggered by cough receptor as a response to cough provoking stimuli such as acids, heat and arachidonic acid derivatives [106-108]. Hull Airway Reflux Questionnaire was developed for the diagnosis of chronic hypersensitivity syndrome [109] with high specificity and sensitivity. Three phenotypes of CHS were identified: [110]. a) Th2-cell dominant phenotype (cough variant asthma or non-

asthmatic eosinophilic bronchitis) b) predominant phenotype of rhinal symptoms (such as Upper airway

cough syndrome); and c) predominant phenotype characterized by acid reflux and heartburn

(gastroesophageal reflux cough). Additionally, refractory chronic cough is considered to be a phenotype of the cough hypersensitivity syndrome [10580].

Recent review [106] described the mechanisms that were involved in cough reflex hypersensibility. The mechanisms involve both peripheral sensitization (inflammatory-mediated sensitization of cough fiber afferent nerve with subsequent reduced threshold for cough in upper and lower airways) and central sensitization (increased excitability in central sensory pathways).[106]. In addition, Belvisi [111] postulated the concept of neurophenotype in respiratory disease. He suggested that there were airway nerve function specific changes in response to irritants in different respiratory diseases [111]. However, this concept warranted detailed analysis to clarify the involved underlying mechanisms [3]. Refractory and unexplained chronic cough treatment reviewed recently [112] and four therapeutic approaches were proposed, which include: Inhaled corticosteroids (Eosinophilic airway inflammation); non-pharmacologic therapy (Speech pathology therapy); Neuromodulatory therapy (targeting neural pathways and others (Macrolides, esomeprazole, ipratropium.

AAJMS [Formerly IJMS]August, 2020;3(3): 111-131;ISSNe 2522-7386

117

Previous studies reported that centrally acting neuromodulators (amitriptyline, gabapentin, pregabalin, baclofen, and morphine) may improve the quality of life in those with chronic cough [113-119]. In contrast, erythromycin or esomeprazole or azithromycin treatment was not effective in control of chronic cough [120-122]. Smith et al [123] in a randomized, double-blind, placebo-controlled, cross-over study reported that sodium-channel inhibitor not shows any effect on the control of cough. Brozmanova and Pavelkova [124], In their review suggested that vagal C-fibers activity inhibition form a sound approach for the development of effective antitussive drugs. The research not revealed effective antitussive drugs and centrally acting antitussive drugs were with unwanted side effects. However, they suggests that topical drug application may conserve the effective antitussive activity without centrally induced side effects [124]. Sodium-channel inhibitor (voltage gated) are an attractive chronic cough therapeutic approach as there are many parallels between chronic cough and chronic neuropathic pain [124] . Transient receptor potential vanilloid receptors that trigger afferent nerve activity in response to cough-provoking stimuli (heat, acid, arachidonic acid derivatives) [106-108] antagonists (XEN-D0501 and SB-705498) did not induce any improvement on cough frequency despite a clear pharmacological effect on cough reflex sensitivity to caspain.[125,126]. While P2X3 receptors antagonists (AF-219) found to be effective in treatment of chronic cough and 75% of cough frequency reduced as tested in a double-blind, placebo-controlled, 2-period, crossover study in the UK [127]. Refractory cough in asthmatic patients may be controlled with treatment with tiotropium by modulating cough reflex sensitivity [128]. The emergence of neurobiological role in chronic cough induction and control may suggest an additional approach for antitussive drug development. Introduction of the cough hypersensitivity syndrome concept may open a new era in the determination and treatment of chronic cough [129]. In mice, emodin regulate notch pathway and mitigate airway inflammation of cough variant asthma [130] In conclusion, cough variant asthma may treated with leukotriene receptor antagonist, Antihistamine and bronchodilator. However, the emergence of neurobiology concept in allergy induction and treatment

AAJMS [Formerly IJMS]August, 2020;3(3): 111-131;ISSNe 2522-7386

118

warranted performance of research for development of new safe drugs without central neural side effects. Inhaled lidocaine preceded by bronchodilator may be an alternative therapeutic protocol used in the treatment of CVA.

Table 1. IgE serum levels for Food Allergens

Allergen IgE IU/Ml Class Control [Ctrl] 53.5 5.0 Milk [F2] 0.00 0.0 Egg white [F1] 0.00 0.0 Sunflower seed [F114] 1.00 2.0 Egg yolk [F75] 0.02 0.0 Peach [F95] 2.50 2.0 Soy bean [F14] 0.00 0.0 Banana [F92] 0.00 0.0 Olive [F458] 0.30 0.0 Strawberry [F44] 0.07 0.0 Tomato [F25] 2.30 2.0 Carrot [F31] 3.70 3.0 Cacao [F93] 0.00 0.0 Kiwi [F84] 0.43 1.0 Fig [F328] 8.20 3.0 Broad bean [F500] 0.41 1.0 Orange [F33] 4.30 3.0 Hazelnut [F17] 1.20 2.0 Pistachio nut [F203] 1.10 2.0 Cod fish [F3] 0.00 0.0 Apricot [F237] 5.90 3.0 Meat mix [Fx23] 0.00 0.0 Gluten [F79] 0.00 0.0 Sesame seed [F10] 2.10 2.0 Potato [F35] 1.50 2.0 Garlic [F47] 0.00 0.0 Pepper [F263] 0.27 0.0 Aubergine [F267] 1.00 2.0 Walnut [F256] 0.75 2.0 Raspberry [F343] 4.00 3.0 Almond [F20] 0.02 0.0

AAJMS [Formerly IJMS]August, 2020;3(3): 111-131;ISSNe 2522-7386

119

Table 2. IgE serum levels for Inhalant Allergens

Allergen IgE IU/Ml Class Control [Ctrl] 35.2 4.0 D. Pteronyssinus [D1] 0.00 0.0 D. farinae [D2] 0.00 0.0 Cockroach [l6] 0.00 0.0 Camel hair [E17] 0.13 0.0 Absinthe [W5] 2.00 2.0 Oak, White [T7] 0.40 1.0 Olive [T9] 2.80 2.0 Cypress [T23] 0.66 1.0 Mulberry [T70] 3.10 2.0 Timothy grass [G6] 0.74 2.0 Mixed grasses [Gx] 0.96 2.0 Grain pollen MIX [Gx12] 6.70 3.0 Ragweed [W1] 3.80 3.0 Mugwort [W6] 0.64 1.0 Parietaria (Wall pellitory)[W21] 2.10 2.0 Sweet vernal grass [G1] 0.54 0.0 Nettle [W20] 0.97 2.0 Chenopodium album [W10] 1.70 2.0 Camomile [W206] 0.00 0.0 Cat epithel [E1] 0.00 0.0 Candida albicans [M5] 0.00 0.0 Dog epithel [E5] 0.00 0.0 Feather mix. [Ex70] 0.27 0.0 Parrot/Budgerigar/Hollandicus [Ex8]

0.23 0.0

Cow/Sheep [Ex9] 0.00 0.0 Chicken feather [E85] 0.00 0.0 Penicillium notatum [M1] 0.00 0.0 Aspergillus fumigatous [M3] 0.00 0.0 Cladosporium herbarum [M2] 1.10 2.0 Alternaria alternate [M6] 0.83 2.0

AAJMS [Formerly IJMS]August, 2020;3(3): 111-131;ISSNe 2522-7386

120

Table 3. Classes Categorization Criteria

Class IgE range IU/ml Interpretation 0 0.00 – 0.34 Not or hardly present 1 0.35 – 0.69 Low threshold 2 0.70 – 3.49 Slight increase 3 3.50 – 17.49 Significantly increased 4 17.50 – 49.90 High 5 50.00 – 100.00 Very high 6 100 Extremely high

References 1. Irwin RS, Baumann MH, Bolser DC, et al. Diagnosis and

management of cough executive summary: ACCP evidence-based clinical practice guidelines. Chest. 2006;129(1 Suppl):1S–23S.

2. Irwin RS, French CL, Chang AB, Altman KW; CHEST Expert Cough Panel. Classification of cough as a symptom in adults and management algorithms: CHEST guideline and expert panel report. Chest. 2018;153(1):196–209.

3. Perotin JM, Launois C, Dewolf M, Dumazet A, Dury S, Lebargy F, et al. Managing patients with chronic cough: challenges and solutions. Ther Clin Risk Manag. 2018;14:1041-1051

4. Chamberlain SA, Garrod R, Douiri A, et al. The impact of chronic cough: a cross-sectional European survey. Lung. 2015;193(3):401–408.

5. Birring SS, Kavanagh J, Lai K, Chang AB. Adult and paediatric cough guidelines: Ready for an overhaul? Pulm Pharmacol Ther. 2015;35:137–144.

6. Song WJ, Chang YS, Faruqi S, et al. The global epidemiology of chronic cough in adults: a systematic review and meta-analysis. Eur Respir J. 2015;45(5):1479–1481.

7. Pacheco A, de Diego A, Domingo C, et al. Chronic cough. Arch Bronconeumol. 2015;51(11):579–589.

8. Birring SS. Controversies in the evaluation and management of chronic cough. Am J Respir Crit Care Med. 2011;183(6):708–

715. 9. Dalal B, Geraci SA. Office management of the patient with chronic

cough. Am J Med. 2011;124(3):206–209.

AAJMS [Formerly IJMS]August, 2020;3(3): 111-131;ISSNe 2522-7386

121

10. Pavord ID, Chung KF. Management of chronic cough. Lancet. 2008;371(9621):1375–1384.

11. Gibson PG, Chang AB, Glasgow NJ, et al. CICADA: Cough in children and adults: diagnosis and assessment. Australian cough guidelines summary statement. Med J Aust. 2010;192(5):265–

271. 12. Morice AH, McGarvey L, Pavord I; British Thoracic Society

Cough Guideline Group. Recommendations for the management of cough in adults. Thorax. 2006;61 Suppl 1:i1–i24.

13. Kardos P, Berck H, Fuchs KH, et al. Guidelines of the German Respiratory Society for diagnosis and treatment of adults suffering from acute or chronic cough. Pneumologie. 2010;64(11):701–711.

14. Kohno S, Ishida T, Uchida Y, et al. The Japanese Respiratory Society guidelines for management of cough. Respirology. 2006;11 Suppl 4:S135–S186.

15. Asthma Workgroup, Chinese Society Respiratory Diseases (CSRD), Chinese Medical Association. The Chinese national guidelines on diagnosis and management of cough (December 2010). Chin Med J (Engl). 2011;124(20):3207–3219.

16. Irwin RS, French CT, Lewis SZ, Diekemper RL, Gold PM; CHEST Expert Cough Panel. Overview of the management of cough: CHEST guideline and expert panel report. Chest. 2014;146(4):885–889.

17. Jiang M, Guan WJ, Fang ZF, et al. A critical review of the quality of cough clinical practice guidelines. Chest. 2016;150(4):777–

788. 18. Wee B, Browning J, Adams A, et al. Management of chronic

cough in patients receiving palliative care: review of evidence and recommendations by a task group of the Association for Palliative Medicine of Great Britain and Ireland. Palliat Med. 2012;26(6):780–787.

19. Molassiotis A, Smith JA, Mazzone P, Blackhall F, Irwin RS; CHEST Expert Cough Panel. Symptomatic treatment of cough among adult patients with lung cancer: CHEST guideline and expert panel report. Chest. 2017;151(4):861–874.

20. Moscato G, Pala G, Cullinan P, et al. EAACI position paper on assessment of cough in the workplace. Allergy. 2014;69(3):292–

304.

AAJMS [Formerly IJMS]August, 2020;3(3): 111-131;ISSNe 2522-7386

122

21. French CT, Diekemper RL, Irwin RS, et al. Assessment of intervention fidelity and recommendations for researchers conducting studies on the diagnosis and treatment of chronic cough in the adult: CHEST guideline and expert panel report. Chest. 2015;148(1):32–54.

22. Gibson PG, Vertigan AE. Management of chronic refractory cough. BMJ. 2015;351:h5590.

23. Tarlo SM, Altman KW, French CT, Diekemper RL, Irwin RS. Evaluation of occupational and environmental factors in the assessment of chronic cough in adults: a systematic review. Chest. 2016;149(1):143–160.

24. Çolak Y, Nordestgaard BG, Laursen LC, Afzal S, Lange P, Dahl M. Risk factors for chronic cough among 14,669 individuals from the general population. Chest. 2017;152(3):563–573.

25. Anyenda EO, Higashi T, Kambayashi Y, et al. Associations of cough prevalence with ambient polycyclic aromatic hydrocarbons, nitrogen and sulphur dioxide: a longitudinal study. Int J Environ Res Public Health. 2016;13(8):pii:E800.

26. Nieminen P, Panychev D, Lyalyushkin S, et al. Environmental exposure as an independent risk factor of chronic bronchitis in northwest Russia. Int J Circumpolar Health. 2013;72.

27. Hu ZW, Zhao YN, Cheng Y, et al. Living near a major road in Beijing: association with lower lung function, airway acidification, and chronic cough. Chin Med J (Engl). 2016;129(18):2184–2190

28. Alobaidi RH, Alobaidi AHA, Alsamarai AGM. Risk factors for allergy in secondary school girls. Chapter Five, In: Celso Pereira. Allergic Diseases: New Insights. 1st Edition, INTECH, 2015: 99-124.

29. Alobaidi AHA. Expired breath condensate hydrogen peroxide concentration and pH for screening cough variant asthma among chronic cough. Ann Thoracic Med 2007;2(1):18-22.

30. Tarraf H, Aydin O, Mungan D, Albader M, Mahboub B, Doble A, et al. Prevalence of asthma among the adult general population of five Middle Eastern countries: results of the SNAPSHOT program. BMC Pulmonary Medicine 2018;18:68. 14 pages.

31. Amina Hamed Ahmad Al Obaidi, Abdul Ghani Mohamed Al Samarai, Abdul Karem Yahya Jawad, Jasim Mohamed Al Janabi.

AAJMS [Formerly IJMS]August, 2020;3(3): 111-131;ISSNe 2522-7386

123

Association between of C Reactive Protein and Asthma. Turkish Thoracic J 2010;11:98-104.

32. Abdulghani Mohamad Alsamarai, Amina Hamed Ahmad Alobaidi, Sami Mezher Alrefaiei and Amar Mohamed Alwan (June 29th 2012). House Dust Mite Immunotherapy in Iraqi Patients with Allergic Rhinitis and Asthma, Pharmacotherapy, Farid Badria, IntechOpen,

33. Adnan Hasan Alwan Amina Hamed Ahmed Alobaidi Abdulghani Mohamed Alsamarai. Leptin, Obesity and IgE in patients with Asthma and Allergic Rhinitis. Diyala J Med 2014;6(1):66-76.

34. Alobaidi AH, Alsamarai AGM, Aljanabi J, Yahya A. The Predictive Value of Eosinophil Cationic Protein and Lactate Dehydrogenase in Asthma: A Comparative Study of Serum Versus Sputum. (WAO Journal 2009; 2:144–149)

35. Ahmed Alobaidi AHA, Alsamarai MAG, Alsamarai Y, Aljanabi JM. The predictive value of IgE as biomarker in asthma. J Asthma 2008;45:654-663.

36. Al Obaidi AH, Al Samarai AM. Biochemical markers as a response guide for steroid therapy in asthma. J Asthma 2008;425-434.

37. Al Obaidi AHA, Alsamarai AM. The predictive value of eosinophil cationic protein in asthma as a marker of poorly controlled disease and response guide to treatment. Pak J Chest Med 2008;14:7-10.

38. Al Obaidi AHA, Jawad AKY, Alsamarai AGM, Al Janabi JM. Biochemical changes in patients with asthma J Clinical Diagnostic Research 2007; 5:396-403.

39. Al Obaidi AH, Mohamed A, Murbat MM, Jawad AK, Janabi J. Serum oxidant / antioxidants parameters in asthma. Tikrit Med J 2007, 13:44-54.

40. Al Obaidi AH, Mohamed A, Murbat MM, Jawad AK, Janabi J. Correlation among oxidant / antioxidant parameters in asthma. Tik Med J 2008;14:1-10.

41. Alsamarai AGM, Alwan AM, Ahmad AH, Salih MA, Salih JA, et al .The Relationship between Asthma and Allergic Rhinitis in the Iraqi Population Allergology International 2009;58;549-555.

42. Domuz S. Prevalence of asthma symptoms in children aged 6 to 15 years in the territory of Republic of Srpska [dissertation]. Novi Sad: Medical Faculty; 2016. 156 p

AAJMS [Formerly IJMS]August, 2020;3(3): 111-131;ISSNe 2522-7386

124

43. Morjaria BJ, Kastelik AJ. Unusual asthma syndromes and their management. Therapeutic Advances in Chronic Disease. 2011;2(4):249-264.

44. Liu M, Liu K, Zhu N, Xia J, Chen X. Inflammatory mediators in induced sputum and airway hyperresponsiveness in cough variant

asthma during long-term inhaled corticosteroid treatment. Mediators of Inflammation. 2012;2012:403868.

45. Ioan I, Poussel M, Coutier L, Plevkova J, Poliacek I, Bolser CD, et al. What is chronic cough in children? Frontiers in Physiology. 2014;5:322.

46. Corrao WM, Braman SS, Irwin RS. Chronic cough as the sole presenting manifestation of bronchial asthma. The New England Journal of Medicine. 1979;300:633-637

47. Magni C, Chellini E, Zanasi A. Cough variant asthma and atopic cough. Multidisciplinary Respirator Medicine. 2010;5(2):99-103.

48. Fujimura M, Hara J, Myou S. Change in bronchial responsiveness and cough reflex sensitivity in patients with cough variant asthma: Effect of inhaled corticosteroids. Cough. 2005;I:5.

49. Fujimura M, Ogawa H, Nishizawa Y, Nishi K. Comparison of atopic cough with cough variant asthma: Is atopic cough a precursor of asthma? Thorax. 2003;58:14-18.

50. Imai E, Enseki M, Nukaga M, Tabata H, Hirai K, Kato M, et al. A lung sound analysis in a child thought to have cough variant asthma: A case report. Allergology International. 2017;67(1):150-152.

51. Sridaran S, Gonzalez-Estrada A, Aronica AM. A case of cough variant asthma undiagnosed for 16 years. Operation and Maintenance Center – Radio. 2014;2014(2):29-30.

52. D’Urzo A, Jugovic P. Case Report: Cough variant asthma.

Canadian Family Physician. 2002;48:1323-1325 53. Niimi A. Cough and asthma. Curent Respiratory Medicine

Reviews. 2011;7(1):47-54. 54. Ichinose M, Sugiura H, Nagase H, Yamaguchi M, Inoue H, Sagara

H, et al. Japanese guidelines for adult asthma 2017. Allergology International. 2017;66(2):163-189.

55. Arakawa H, Hamasaki Y, Kohno Y, Ebisawa M, Kondo N, Nishima S, et al. Japanese guidelines for childhood asthma 2017. Allergology International. 2017;66(2):190-204.

AAJMS [Formerly IJMS]August, 2020;3(3): 111-131;ISSNe 2522-7386

125

56. Niimi A, Matsumoto H, Takemura M, Ueda T, Chin K, Mishima M. Relationship of airway wall thickness to airway sensitivity and airway reactivity in asthma. American Journal of Respiratory and Critical Care Medicine. 2003;168(8):983-988.

57. Mochizuki H, Arakawa H, Tokuyama K, Morikawa A. Bronchial sensitivity and bronchial reactivity in children with cough variant asthma. Chest. 2005;128(4):2427-2434.

58. De Diego A, Martinez E, Perpina M, Nieto L, Compte L, Macian V, et al. Airway inflammation and cough sensitivity in cough-variant asthma. Allergy. 2005;60(11):1407-1411.

59. Kanazawa H, Eguchi Y, Nomura N, Yoshikawa J. Analysis of vascular endothelial growth factor levels in induced sputum samples from patients with cough variant asthma. Annals of Allergy, Asthma & Immunology. 2005;95(3):266-271.

60. Birring SS, Parker D, Brightling CE, Bradding P, Wardlaw AJ, Pavord ID. Induced sputum inflammatory mediator concentrations in chronic cough. American Journal of Respiratory and Critical Care Medicine. 2004;169(1):15-19.

61. McGarvey LP, Heaney LG, Lawson JT, Johnston BT, Scally CM, Ennis M, et al. Evaluation and outcome of patients with chronic non-productive cough using a comprehensive diagnostic protocol. Thorax. 1998;53(9):738-743.

62. Glauser FL. Variant asthma. Ann Allergy. 1972;30:457–9. 63. Vujnovic SD, Domuz A, Petrovic S. Cough Variant Asthma as a

Phenotype of Classic Asthma. Chapter 12, In: Kuan-Hsiang Gary Huang and Chen Hsuan Sherry Tsai, Asthma Diagnosis and Management - Approach Based on Phenotype and Endotype, 2018, IntechOpen, P:195-205.

64. Morice AH, Kastelik JA. Cough 1: Chronic cough in adults. Thorax. 2003;58:901–7.

65. Bjornsdottir US, Quan SF, Busse WW. Eosinophils and asthma. In: Busse WW, Holgate ST, editors. Asthma and rhinitis. Boston: Blackwell Scientific Publications; 1995. pp. 328–46.

66. Niimi A, Amitani R, Kawai M. Sputum eosinophilia in cough variant asthma. Am Rev Respir Dis. 1991;143:A30.

67. Salem H, Aviado DM. Antitussive drugs. Am J Med Sci. 1964; 247:585–600. [PubMed: 14158494]

AAJMS [Formerly IJMS]August, 2020;3(3): 111-131;ISSNe 2522-7386

126

68. Ojoo JC, Mulrennan S, Kaselik JA, Morice AH, Redington AE. Expired breath condensate pH and expired nitric oxide in allergic asthma and in cystic fibrosis. Thorax. 2005;60:22–6.

69. Niimi A, Amitani R, Suzuki K, Tanak AE, Murayama T, Kuze F. Eosinophilic inflammation in cough variant asthma. Eur Respir J. 1998;11:1064–9.

70. Wardlaw AJ, Dunnette S, Gleich GJ, Collins JV, Kay AB. Eosinophils and mast cells in bronchoalveolar lavage in subjects with mild asthma. Am Rev Respir Dis. 1988;137:62–9.

71. Kirby JG, Hargreave FE, Gleich GJ, O' Byrne PM. Bronchoalveolar cell profiles of asthmatic and no asthmatic subjects. Am Rev Respir Dis. 1987;136:379–83.

72. Gibson PG, Girgis-Gabardo A, Morris MM, Mattoli S, Kay JM, Dolovich J, et al. Cellular characteristics of sputum from patients with asthma and chronic bronchitis. Thorax. 1989;44:693–9.

73. Bousquet J, Chanez P, Lacoste JY, Barneon G, Ghavanian N, Enander I, et al. Eosinophilic inflammation in asthma. N Eng J Med. 1990;323:1033–9.

74. Emelyanovo A, Fedoseev G, Abulimity A, Rudinski K, Fedoulov A, Karabanov A, et al. Elevated concentration of exhaled peroxide in asthmatic patients. Chest. 2001;120:1136–9.

75. Venge P. Serum measurement of eosinophil cationic protein in bronchial asthma. Clin Exp Allergy. 1993;23:3–7.

76. Slungaard A, Vercellotti GM, Walker G, Nelson RD, Jacob HS. Tumor necrosis factor alpha / cachectin stimulates eosinophil oxidant production and toxicity towards human endothelium. J Exp Med. 1990;171:2025–41.

77. Dohlman AW, Black HR, Royall JA. Expired breath hydrogen peroxide is a marker of acute airway inflammation in pediatric patients with asthma. Am Rev Respir Dis. 1993;148:955–60.

78. Antczak A, Nowak D, Shariati B, Krol M, Piasecka G, Kurmanowska Z. Increased hydrogen peroxide and thiobarbituric acid-reactive products in expired breath condensate of asthmatic patients. Eur Respir J. 1997;10:1235–41.

79. Jobsis Q, Raatgeep HC, Hermans PW, de Jongste JC. Hydrogen peroxide in exhaled air is increased in stable asthmatic children. Eur Respir J. 1997;10:519–21.

AAJMS [Formerly IJMS]August, 2020;3(3): 111-131;ISSNe 2522-7386

127

80. Horvath I, Donnely LE, Kiss A, Kharitonov SA, Lim S, Chung KF, et al. Combined use of exhaled hydrogen peroxide and nitric oxide in monitoring asthma. Am J Respire Crit Care Med. 1998;158:1042–6.

81. Irwin RS, Corrao WM, Pratter MR. Chronic persistent coughing in the adults: The spectrum and frequency of causes and successful outcome of specific therapy. Am Rev Respir Dis. 1981;123:413–

7. 82. O'Connel EJ, Rojas AR, Sachs MI. Cough type asthma: A

review. Ann Allergy. 1991;66:278–85. 83. Lallo UG, Barnes PJ, Chung KF. Pathophysiology and clinical

presentation of cough. J Allergy Clin Immunol. 1996;98:S91–7.

84. Fujimura M, Kamio Y, Hashimoto T, Matsuda T. Cough receptor sensitivity and bronchial responsiveness in patients with only chronic non productive cough: In view of effect of bronchodilator therapy. J Asthma. 1994;31:463–72.

85. Corrao WM, Braman SS, Irwin RS. Chronic cough as the sole presenting manifestation of bronchial asthma. N Eng J Med. 1979;300:633–7.

86. Hannaway PJ, Hopper GD. Cough variant asthma in children. JAMA. 1982;247:206–8.

87. Cloutier MM, Loughlin GM. Chronic cough in children: A manifestation of airway hyperactivity. Pediatrics. 1981;67:6–12.

88. Niimi A, Amitani R, Matsui Y, Sugita T, Suzuki Y, Nishiyama H, et al. Clinical study on cough variant asthma. Nihon Kyobu Shikkan Gakkai Zasshi. 1992;30:1077–84.

89. Koh YY, Chae SA, Min KU. Cough variant asthma is associated with a higher wheezing threshold than classic asthma. Clin Exp Allergy. 1993;23:696–701.

90. Lallo UG, Barnes PJ, Chung KF. Pathophysiology and clinical presentation of cough. J Allergy Clin Immunol. 1996;98:S91–7.

91. Burney PG. Current questions in the epidemiology of asthma. In: Holgate ST, editor. Asthma: Physiology, Immuno pharmacology and Treatment. London: Academic Press; 1993. pp. 3–25.

92. Bousquet J, Chanez P, Lacoste JY, White R, Vic P, Godard P, Michel FB. Asthma: A disease remodeling the airways. Allergy. 1992;47:3–11.

AAJMS [Formerly IJMS]August, 2020;3(3): 111-131;ISSNe 2522-7386

128

93. Selroos O, Pietinnalho A, Lofroos AB, Riska H. Effect of early vs late intervention with inhaled corticosteroids in asthma. Chest. 1995;108:1228–34.

94. Johnson D, Osborn LM. Cough variant asthma: A review of the clinical literature. J Asthma. 1991;28:85–90.

95. NHLBI / WHO workshop report 2. National Institutes of Health. Bethesda: National Heart, Lung and Blood Institute; 1997. Global strategy for asthma management and prevention. Publication No 97–4051A.

96. Cockcroft DW, Ruffin RE, Dolovich J, Hargreave FE. Allergen induced increase in non allergic bronchial reactivity. Clin Allergy. 1977;7:503–13.

97. Doan T, Patterson R, Greenberger PA. Cough variant asthma: Usefulness of a diagnostic therapeutic trial with prednisone. Ann Allergy. 1992;69:505–9.

98. Parks DP, Ahrens RC, Humphries CT, Weinberger MM. Chronic cough in childhood: Approach to diagnosis and treatment. J pediatric. 1989;115:856–62.

99. Cheriyan S, Greenberger PA, Patterson R. Outcome of cough variant asthma treated with inhaled steroids. Ann Allergy. 1994;73:478–80.

100. Irwin RS, French CL, Chang AB, Altman KW; CHEST Expert Cough Panel. Classification of cough as a symptom in adults and management algorithms: CHEST guideline and expert panel report. Chest. 2018;153(1):196–209.

101. Pacheco A, de Diego A, Domingo C, Lamas A, Gutierrez R, Naberan K, et al. Chronic cough. Arch Bronconeumol. 2015;51(11):579–589.

102.Lai K, Chen R, Lin J, Nilsson M; Johnsen R; Ye W; Hveem K; Lagergren J. et al. A prospective, multicenter survey on causes of chronic cough in China. Chest. 2013;143(3):613–620.

103. Dicpinigaitis PV. Chronic cough due to asthma: ACCP evidence-based clinical practice guidelines. Chest. 2006;129(1 Suppl):75S–

79S. 104. Morice AH, Faruqi S, Wright CE, Thompson R, Bland JM.

Cough hypersensitivity syndrome: a distinct clinical entity. Lung. 2011;189(1):73–79.

AAJMS [Formerly IJMS]August, 2020;3(3): 111-131;ISSNe 2522-7386

129

105. Morice AH, Millqvist E, Belvisi MG, Bieksiene K, Birring SS, Fan K, et al. Expert opinion on the cough hypersensitivity syndrome in respiratory medicine. Eur Respir J. 2014;44(5):1132–1148.

106. Gibson PG, Vertigan AE. Management of chronic refractory cough. BMJ. 2015;351:h5590.

107. Chung KF. Approach to chronic cough: the neuropathic basis for cough hypersensitivity syndrome. J Thorac Dis. 2014;6(Suppl 7):S699–S707.

108. Patberg KW. The female preponderance to cough hypersensitivity syndrome: another clue pointing to the role of TRPV1 in cough. Lung. 2011;189(3):257–258.

109. Morice AH. Chronic cough hypersensitivity syndrome. Cough. 2013;9(1):14.

110. Yu L, Xu X, Lv H, Qiu Z. Advances in upper airway cough syndrome. Kaohsiung J Med Sci. 2015;31(5):223–228.

111. Belvisi MG, Birrell MA, Khalid S, et al. Neurophenotypes in airway diseases. insights from translational cough studies. Am J Respir Crit Care Med. 2016;193(12):1364–1372.

112. Gibson P, Wang G, McGarvey L, Vertigan AE, Altman KW, Birring SS, et al. Treatment of unexplained chronic cough: CHEST guideline and expert panel report. Chest. 2016;149(1):27–44.

113. Jeyakumar A, Brickman TM, Haben M. Effectiveness of amitriptyline versus cough suppressants in the treatment of chronic cough resulting from postviral vagal neuropathy. Laryngoscope. 2006;116(12):2108–2112.

114. Ryan NM, Birring SS, Gibson PG. Gabapentin for refractory chronic cough: a randomised, double-blind, placebo-controlled trial. Lancet. 2012;380(9853):1583–1589.

115. Morice AH, Menon MS, Mulrennan SA, Everett CF, Wright C, Jackson J, et al. Opiate therapy in chronic cough. Am J Respir Crit Care Med. 2007;175(4):312–315.

116. Dion GR, Teng SE, Achlatis E, Fang Y, Amin MR. Treatment of neurogenic cough with tramadol: a pilot study. Otolaryngol Head Neck Surg. 2017;157(1):77–79.

117. Cohen SM, Misono S. Use of specific neuromodulators in the treatment of chronic, idiopathic cough: a systematic review. Otolaryngol Head Neck Surg. 2013;148(3):374–382.

AAJMS [Formerly IJMS]August, 2020;3(3): 111-131;ISSNe 2522-7386

130

118. Wei W, Liu R, ZhangTong Y, Qiu Z. The efficacy of specific neuromodulators on human refractory chronic cough: a systematic review and meta-analysis. J Thorac Dis. 2016;8(10):2942–2951.

119. Vertigan AE, Kapela SL, Ryan NM, Birring SS, McElduff P, Gibson PG. Pregabalin and speech pathology combination therapy for refractory chronic cough: a randomized controlled trial. Chest. 2016;149(3):639–648.

120. Shaheen NJ, Crockett SD, Bright SD, Buckmire R, Couch M, Dellon ES, et al. Randomised clinical trial: high-dose acid suppression for chronic cough – a double-blind, placebo-controlled study. Aliment Pharmacol Ther. 2011;33(2):225–234.

121. Yousaf N, Monteiro W, Parker D, Matos S, Birring S, Pavord ID. Long-term low-dose erythromycin in patients with unexplained chronic cough: a double-blind placebo controlled trial. Thorax. 2010;65(12):1107–1110.

122. Hodgson D, Anderson J, Reynolds C, Oborne J, Meakin G, Baily H, et al. The effects of azithromycin in treatment-resistant cough: a randomized, double-blind, placebo-controlled trial. Chest. 2016;149(4):1052–1060.

123. Smith JA, McGarvey LPA, Badri H, Satia I, Warren F, Siederer S, et al. Effects of a novel sodium channel blocker, GSK2339345, in patients with refractory chronic cough. Int J Clin Pharmacol Ther. 2017;55(9):712–719.

124. Brozmanova M, Pavelkova N. The Prospect for Potent Sodium Voltage-Gated Channel Blockers to Relieve an Excessive cough. Physiol. Res 2020;69 (Suppl. 1): S7-S18.

125. Belvisi MG, Birrell MA, Khaled S, Wortley MA, Dockry R, Coote J, et al. XEN-D0501, a novel transient receptor potential vanilloid 1 antagonist, does not reduce cough in patients with refractory cough. Am J Respir Crit Care Med. 2017;196(10):1255–1263.

126. Khalid S, Murdoch R, Newlands A, Smart K, Kelsall A, Holt K, et al. Transient receptor potential vanilloid 1 (TRPV1) antagonism in patients with refractory chronic cough: a double-blind randomized controlled trial. J Allergy Clin Immunol. 2014;134(1):56–62.

127. Abdulqawi R, Dockry R, Holt K, Layton G, McCarthy BG, Ford AP, et al. P2X3 receptor antagonist (AF-219) in refractory

AAJMS [Formerly IJMS]August, 2020;3(3): 111-131;ISSNe 2522-7386

131

chronic cough: a randomised, double-blind, placebo-controlled phase 2 study. Lancet. 2015;385(9974):1198–1205.

128. Fukumitsu K, Kanemitsu Y, Asano T, Nakamura M, Takemura M, Niimi A. Tiotropium attenuates refractory cough and capsaicin cough reflex sensitivity in patients with asthma. J Allergy Clin Immunology; 2018:6(5): 1613-1620.

129. Song JA, McGarvey I. Recent progress in the management of chronic cough. Korean J Intern Med 2020;35:811-822.

130. Hau S, Liu F, Wang M. Emodin alleviates the airway inflammation of cough variant asthma Med Sci Monit, 2019; 25: 5621-5629.

AAJMS [Formerly IJMS] August, 2020;3(3): 131-135;ISSNe 2522-7386

132

THESIS ABSTRACT

Non Chlorophyll Accessory Pigments in Cyanobacteria: Simultaneous Extraction, Seperation and Maximization

Mohammed Fadhil Hameed Hadad, Northern Technology University, Mousel, IRAQ.

A Ph D thesis conducted in Yildiz Technical University, Graduate School of Natural and Applied Sciences, Turkey, under the supervision of Prof. Dr. Barbaros NALBANTOĞLU and

Assoc. Prof. Dr. Turgay ÇAKMAK, 2020. DOI: https://doi.org/10.32441/aajms.3.3.8 Aim of the thesis The impartial objective of this study is to characterize, using the same criteria mentioned above, the cyanobacteria species located in areas around Ankara hot-springs. Then, morphology studies have been applied to identify cyanobacteria strains. After the specific identification, other measurements took place to specifically characterize these species according to some recent studies. After this characterization, we identified which ones were recorded in gene bank and which ones were not. The non-recorded species were further investigated and recorded to the gene bank as they are considered novel.

Hypothesis of the thesis Cyanobacteria get energy through prokaryotes that receive sunlight as a source of energy using chlorophyll and various dyes. The presence of essential elements such as oxygen, nitrogen and carbon play a crucial role in aquatic environments. Until today, the picture remains unclear about the emergence of microbes like cyanobacteria

AAJMS [Formerly IJMS] August, 2020;3(3): 131-135;ISSNe 2522-7386

133

on Earth, and many researchers verified their current diversity more than two billion years ago. Cyanobacteria are the new revolution in modern science and caught the attention of a lot of scientists in the fields such as biotechnology, pharmacology, food industry. This attention was due to the unusual and specific conditions of living that these species were shown. Also, most of them are not yet reported in the literature. In this study, the idea is to collect some of these algae species from the some hot-spring areas in Ankara province/Turkey and characterize them specifically using methods obtained from other studies. This characterization will give us information about specific conditions. This study will also contribute development to the using of cyanobacteria in the areas mentioned above. Materials and methods Cyanobacteria are considered as a sustainable feedstock for the production of biochemically active compounds such as phycobiliproteins (PBPs). In this study, 12 different cyanobacteria isolated from hot-spring water resources in Ankara province were evaluated for their PBP production efficiency. Morphological analysis and Sanger sequencing revealed that 5 of the strains belong to Nostoc genus, 3 of them belong to Anabaena, and others belong to genus Trichormus, Nodularia, Chlorogloeopsis, and Nodosilinea. Isolated strains have been maintained in nitrogen lacking BG-11 growth medium during the thesis study. Total PBP content of Trichormus sp. IMU26 and Anabaena variabilis IMU8 were found as 23.2% and 17.3% while it was lower than 15% in all other strains studied.

Kits Used in the Experiment Tools and Devices The Sampling Resources Types of Media DNA Experiment DNA Extraction Gel Electrophoresis Polymerase Chain Reaction (PCR) Sequence Information of Cyanobacteria Species Extraction and Estimation of Phycobiliproteins Extraction of Carotenoids and Chlorophyll a Harvesting Biomass

AAJMS [Formerly IJMS] August, 2020;3(3): 131-135;ISSNe 2522-7386

134

Extraction of Carotenoids and Chlorophyll a Measurement of Carotenoids and Chlorophyll a Fourier Transform Infrared Spectroscopy (FT-IR) Analysis Growth Measurements Content Harvesting Culturing Biomass Measurement of Total Protein Content Extraction of Total Protein Protein Determination Measurement of Total Saccharide Harvesting Biomass. Extracting of Saccharide from the Samples Measurement of Total Saccharide Glucose Calibration Analysis in High-Performance Liquid Chromatography (HPLC) Carotenoid Analysis by HPLC Vitamin Analysis B2 by HPLC Fluorescence Imaging of Cyanobacterial lipids (Nile Red)

Results The following studies were carried out to see the impact of nitrogen and phosphorus availability on PBP production on diazotrophic cyanobacteria isolated from hot-spring water resources. For this aim, the strains Trichormus sp. IMU26 and Anabaena variabilis IMU8 were incubated in N-replete, N-lacking, and N-P-lacking BG-11 growth medium. Results showed that nitrogen supply resulted in higher soluble protein and saccharide content but a lower growth rate and PBP production in Trichormus sp. IMU26 and Anabaena variabilis IMU8. Short term (6 days) N-P-deprivation induced PBP production with no clear change in growth while growth and PBP content decreased in the longer incubation period (12 days). Fourier transforms infrared spectroscopy results refer that membrane-bound oligosaccharides may have regulatory roles for PBP production in A.variabilis IMU8 during long term diazotrophic cultivation. Moreover, rapid induction of zeaxanthin and β-carotene production and a slight reduction of echinenone and canthaxanthin levels might be associated with increased PBP levels in short term N-P-deprivation of Trichormus sp. IMU26.

AAJMS [Formerly IJMS] August, 2020;3(3): 131-135;ISSNe 2522-7386

135

Conclusion The thermal diazotrophic cyanobacteria Trichormus sp. IMU26 and Anabaena variabilis IMU8 were introduced to the literature as potential candidates for pilot scale PBP production. Isolated from hot-spring water resources, which differ from sea and spring waters with their unique mineralization and temperature levels, these two cyanobacteria grow well in N-lacking growth medium under room temperature and the contamination risk is fairly low.

AAJMS [Formerly IJMS]August,2020;3(3):136-138;ISSNe 2522-7386

136

Immunological and Molecular Study of IL-33 and ST2 Receptor in a Sample of Iraqi Patients with Breast Cancer

Zainab Jalil Abdulkareem, College of Education for Pure Sciences (Ibn Al-Haitham), Baghdad University, Baghdad, Iraq.

An M Sc thesis conducted in Department of Biology, College of Education for Pure Sciences (Ibn Al-Haitham), Baghdad University, Baghdad, Iraq, under the supervision of Assistant Professor Dr. Hazima Mossa Alabassi, 2018. DOI: https://doi.org/10.32441/aajms.3.3.9 Background: Breast cancer is the main cause of cancer-related deaths in developing countries and the most frequently diagnosed cancer among women worldwide. In Iraq, Breast cancer considered the most common cancer compared to other types of cancer. Aim: The study aimed to investigate the serological and polymorphism of Interleukin-33 (IL-33) and its receptor growth Stimulation (ST2), as well as to evaluate the serum level of Nitric Oxide (NO) and its relationship with the development of breast cancer in Iraqi women. Methodology: A total of 100 samples were included in this study, 66 Iraqi women diagnosed as cases of breast cancer with an age of 21-55 years, including two groups; pre-treatment (PT) and under treatment with chemotherapy (UTC) patients and 34 of the apparently healthy women from different area of Baghdad as a control. ELISA technique had been used to determine the serum level of IL-33, sST2 and (NO). Molecular study was performed using PCR techniques. PCR-RFLP was performed to determine IL-33 gene polymorphisms at SNP (rs1929992). PCR-Sequencing was performed to determine the genetic variation in the distal promoter region of ST2 gene. Results: The results of serological study demonstrated that the IL-33 serum level of PT patients was (182.22 ± 29.86 pg/ml)

AAJMS [Formerly IJMS]August,2020;3(3):136-138;ISSNe 2522-7386

137

followed by UTC patients (129.87 ± 45.11pg/ml) as compared to the high level in control group (258.08 ± 39.54 pg/ml), there was a significant difference (P<0.05). sST2 serum levels were with highly significant difference in PT and UTC patients (12722.45 ± 464.42, 11884.23 ± 479.78 pg/ml, respectively), as compared to control group (9259.24 ± 724.87 pg/ml) p<0.01. Nitric oxide serum level was significant higher in PT and UTC patients (4.68 ± 0.06, 5.11 ± 0.13nmol/ml, respectively), as compared to the control (4.36 ± 0.05 nmol/ml) p <0.01. Molecular study on IL-33 SNP (rs1929992) revealed three genotypes (AA, AG, and GG). AG genotype shows higher frequency in control (76.47%) than in patients (58.46%) compared to other genotypes AA, GG with no significant difference according to Fisher’s exact probability.

Serum level of IL-33 in patients with genotypes AA and AG was lowest and significantly different as compared with control and patients with GG genotype. Sequencing revealed six different polymorphisms identified in the distal promoter region of ST2 gene. SNP (-27609A/T) which was observed in two genotypes (TT and AT) were with equal frequency (50%) in patients, while in control the genotype AT frequency was (60%) while genotype TT was with (40%) frequency. However, the differences were not significant. The allele T was a common allele in all the studied groups and it may represent a factor that influenced the development of breast cancer.

SNP (-27607 A/G), the homozygous genotype GG showed a high percentage (100%) in patients and control, while the other genotypes doesn’t observed in the studied groups. SNP (-27601A/T) which was observed in two genotypes (TT, AT), but the difference was not significant. The genotype TT showed a higher frequency in control (75%) than in patients (67.5%). The genotype AT was with a lower frequency in controls (25%) as compared to patients (32.5%). The homozygous genotype TT is common genotype in the Iraqi females and may play as protective factor from the development of breast cancer. SNP (-27595A/G) which was observed in two genotypes (GG and AG) not show significant differences. The genotype GG showed a high frequency in patients (80%) and control (85%). While the genotype AG showed a frequency of 20% in patients and 15% in control. The homozygous genotype GG was frequent in women

AAJMS [Formerly IJMS]August,2020;3(3):136-138;ISSNe 2522-7386

138

with breast cancer and controls and thus may not influence the susceptibility for the development of breast cancer in Iraqi women. SNP (-27208A/C) which was revealed two genotypes (AA, AC) not shows a significant difference. The homozygous genotype AA was with high frequency in patients (87.5%) and control (70%), while the heterozygous genotype AC was with higher frequency in controls (30%) than in patients (12.5%) groups. The homozygous genotype AA was common genotype in the Iraqi women and it may be a risk factor for breast cancer development. The most common allele was allele A and this may lead for females susceptibility for breast cancer development.

SNP (-27128C/T) which was observed in two genotypes (CC and CT), the homozygous genotype CC frequency was (100%) in patients and 85% in controls and the difference was significant (P<0.05). The genotype CT didn’t observed in patients while observed in frequency of (15%) in control with significant differences. The common CC genotype in the Iraqi female may be a risk factor for breast cancer development. The most common allele in study group was C allele and this may attribute to increase in susceptibility for breast cancer development. Conclusion: There was decreased IL-33 serum level after surgery performance in patients with breast cancer. Elevation of serum concentration of sST2 may be suggested as a biomarker for the monitoring of breast cancer prognosis. There was no association between breast cancer development and IL-33 SNP (rs1929992) was detected in the present study cohort. The heterozygous genotype AG was the common genotype in the Iraqi women. The allele G was associated with breast cancer and may play a role of risk factor, however, the allele A may be a preventive factor for the development of breast cancer. Allele A associated with the increase in serum IL-33 in women with AA and AG genotypes in control group. In contrast, GG genotype was associated with the increase in IL-33 serum level in women with breast cancer. Genotype GG and allele G were more frequent in women with breast cancer and thus may act as risk factor. There are some polymorphisms noticed in the distal promoter of ST2 gene, SNP (-27128C/T) and showed a significant differences between patients and control, and T allele may has a preventive role for breast cancer development in Iraqi women.

AAJMS [Formerly IJMS] August, 2020;3(3):139-158 ;ISSNe 2522-7386

139

EDUCATION Assessment of the Psychomotor Domain: Proposal of Innovative Methods Amina Hamed Alobaidi, Kirkuk University College of Veterinary Medicine, Kirkuk, Iraq [KUCOVM], Email: aminahamed2006@gmail.com, Mobile: +9647702399175, ORCID: http://orcid.org/0000-0002-8495-3452 DOI: https://doi.org/10.32441/aajms.3.3.10 Received: 11/5/2020 Accepted: 21/6/2019 Published: 1st August, 2020

To develop an innovative new method for assessment of student psychomotor domain in Tikrit University College of Medicine (TUCOM), I follow the following model: Step I. Outcomes formulation. Formulation of student learning outcomes for 3 rd year program. The list of these outcomes was presented in Table 1. Step II. Determination the method of assessment for each program outcome. There are two kinds of assessment: Direct assessment methods and Indirect assessment methods. Direct assessment methods require student to demonstrate knowledge and skills and provide data that directly measures achievement of expected outcomes. Indirect assessment methods require that faculty infer actual student skills, abilities, knowledge and values from sources other than observable direct evidence [1]. All assessment methods have strengths and intrinsic flaws, however, the use of multiple observations and several different assessment methods over time can partially compensate for flaws in any one method [2]. Van der Vleuten [3] describe five criteria for determining the usefulness of a particular method of assessment

AAJMS [Formerly IJMS] August, 2020;3(3):139-158 ;ISSNe 2522-7386

140

reliability (the degree to which the measurement is accurate and reproducible), Validity (whether the assessment measures what its claims to measure), impact on future learning and practice, acceptability to learners and faculty, and costs (to the individual trainee, the institution and society at large). The use of multiple methods of assessment can overcome many of the limitations of the individual assessment formats [4]. Longitudinal assessment avoids excessive testing at any one point in time and serves as the foundation for monitoring ongoing professional development. Considering the challenges that we face in TUCOM, current assessment practices would be enhanced if the principles summarized in Table 2 were kept clearly in mind [5]... The content, format, and frequency of assessment, as well as the timing and format feedback, should follow from the specific goals of the medical education program [5]. The various domains competence should be assessed in an integrated, coherent, and longitudinal fashion with the use of multiple methods and provision of frequent and constructive feedback [5]. The assessment can be formative (guiding future learning, providing reassurance, promoting reflection and shaping values) or summative (making an overall judgement about competence, fitness to practice, or qualification for advancement to higher leve3ls of responsibility). Formative assessment provides benchmarks to orient the learner who is approaching a relatively unstructured body of knowledge. They can reinforce student intrinsic motivation to learn and inspire them to set higher standards of themselves [6]. Although summative assessments are intended to provide professional self-regulation and accountability, they may also act as a barrier to future practice or training [7]. A distinction should be made between assessments that are suitable only for formative use and those that have sufficient psychometric rigor for summative use. For the 3 rd year assessment in TUCOM, I suggest a multi-methods assessment that might include: A. Simulation methods → Objective Structured Clinical

Examination [OSCE] as tool. B. Performance method → Objective Structured Practical

Examination [OSPE] as tool.

AAJMS [Formerly IJMS] August, 2020;3(3):139-158 ;ISSNe 2522-7386

141

C. Observation method → Mini-Clinical Evaluation Exercise (Mini-CEX) or Direct Observation of Procedural Skills (DOPS).

D. Product method→ D1. Product creation and special reports as a tool.

→ D2. Research – Community Research Project.

Tool design Each competency assessment tool comprises three major components [1, 8]: Criteria. Indicators. A graduated scale.

Criteria: Tool development usually begins with the identification of the essential skill items which combine to characterise the overall skill of performing a task or role. The items chosen are generally observable behaviours or minimal elements of clinical practice [9]. Authors (experts), focus group or panels of experts can be employed to devise the items lists. Alternatively, can be sourced from existing documents or standards [1]. Indicators: The literature supports the use of rubrics or indicators to assist with consistent assessment and evaluation of performance, precisely pinpointing what constituted the decision for grade / scale. Rubric provides specific descriptions of the response for each criteria and match proficiency levels and quality ratings [1]. Developmental learning theories can be used to inform the descriptions [9]. Graduated scale: The use of a scale facilitates the identification of the degree of the skill. Adaptation or combination of commonly used scales such as Bloom’s and the Bondy rating scale is frequent [10] (Table 3). A scale seeks to summarise the differences in the use of time, space, equipment and expenditure of energy across the development continuum. As I biochemist, I present the description of OSPE tool. Objective Structured Practical Examination (OSPE). Task Description Walk around stations-based and paper-based assessment, including identification and interpretation of specimens, charts, graphs, data,

AAJMS [Formerly IJMS] August, 2020;3(3):139-158 ;ISSNe 2522-7386

142

models, and any other materials encountered during practical tutorial and lecture sessions during the 3rd year course. Task length: 2 hours Task Content: The content of the task are shown in Table 4. Checklists: 1. Assessment tool checklist. This checklist used for choosing the right assessment tool selection. A version for such checklist is presented in Table 5. 2. Rating scale checklist. Table 6. Presented a form that can be used as checklist or rating scale according to Bondy’s score for station 3 in the exam. (Blood sample collection for serum calcium determination). 3. Rating scale rubric. Many experts believe that rubrics improve student’s end products and therefore increase learning [1,11]. A rating scale rubric for station 9 of the exam [Abdominal paracentesis] is presented in Table 7. 4. General Indicator Hierarchy. In developing the competency assessment tools, both Bloom’s

and Bondy’s learning theories and associated descriptions of

behavioural levels have been used to inform the descriptions of performance specified in the competency assessment tools. Indicators in the competency assessment tool are thus mapped against two vertical dimensions, representing relative difficulty and quality of performance according to both of the developmental learning theories. Table 8 shows the general hierarchy of indicators used in competency assessment tools. Step III: Conduct and document assessment activities: Conducting assessment activities is probably the most difficult and time consuming portion of the process. I should sure to select assessment techniques that are reasonable based on the resources (time, technology, and budget) available for our program and our College. After performing the assessment I list the results of each assessment methods in Row 3 of the Student Learning Outcomes [SLO] Assessment Form. (Appendix 1.).

AAJMS [Formerly IJMS] August, 2020;3(3):139-158 ;ISSNe 2522-7386

143

Step IV. Use the results of assessment for program or course improvement. Once the results of assessment have been collected, faculty in the program should meet to discuss what the results reveal about areas in which the program or course succeeds and about areas in which improvements can be made. Determinations will then be made on what action should be taken. In Row 4 of the SLO Assessment Form, I state exactly how and with whom the results are shared, the improvements that have been planned or implemented, and who is responsible for implementation and follow-up. The actions should generally be substantive and detailed ( I list, for example, the specific course number in which changes to the curriculum were made), although there are times when no action is necessary and this is stated as well. Step V. Conduct follow-up assessment to determine effectiveness of program or course improvement. The curricular changes inspired by the initial assessment may be followed up by a second identical assessment to verify their effectiveness. If our goal is to improve the student learning, then we must determine if our instructional changes had the positive impact that we desired. To do so, it is necessary that we should administer those same instruments in the same way to the same or an equivalent group of student. The findings of the follow-up assessment should be closely analyzed and widely discussed by the assessment project team members, other department members (instructors or instructional aided alike) and other concerned members of the college community. Outcomes assessment is an ongoing process. When I compile the findings of our follow-up assessment, I will of course want to compare them to the initial assessment. I must think about what worked and what can still be improved, in terms of the curriculum and of the creation and design of the assessment itself.

AAJMS [Formerly IJMS] August, 2020;3(3):139-158 ;ISSNe 2522-7386

144

Table 1. Learning outcomes of 3rd year program as presented by Amina Alobaidi

1. Recognize and describe the important anatomical / histological structures relevant to the systems in the 3rd year program.

2. Explain the biochemical, nutritional, microbiological and physiological principles of the normal functioning of the systems included in 3rd year program.

3. Describe the role of kidney in normal physiology and relate this to the pathophysiology of the respiratory and cardiovascular systems.

4. Describe the underlying pathophysiology, pathogenesis, and pathology of the common diseases of systems included in 3ed year program.

5. Describe the common clinical manifestation of these diseases. 6. Describe the appropriate collection of specimens, ordering of

pathology testing and the interpretation of pathology investigation relevant to these diseases.

7. Describe how the common imaging modalities can be used in investigations of these system diseases.

8. Demonstrate an ability to take an appropriate history and perform a competent examination of the systems included in the program.

9. Describe the pharmacological principles of hormones manipulation in contraception.

10. Improve knowledge, understanding and appreciation of reflective writing.

11. Gain an appreciation of reflective practice as it relates to undergraduate medical education.

12. Introduce students to concept and practices of critical analysis. 13. Review the ethical framework as it prepares students for

educational experience in community and hospital settings. 14. Introduce students to ethical dilemmas in community and

hospital programs. 15. Review medical student’s roles and responsibilities within the

context of community and hospital settings. 16. Review professional code of conduct. 17. Introduce students to the professional requirements of

understanding educational experiences in tertiary hospitals. 18. Prepare students for the sensitivities associated with engaging

with hospital patients. 19. Improve understandings of professional requirements for

AAJMS [Formerly IJMS] August, 2020;3(3):139-158 ;ISSNe 2522-7386

145

3rdyear. 20. Respect the needs, values and culture of patients involved in

medical education. 21. Understand role and responsibilities of a 3rd year medical

students. 22. Introduce students to the literature and evidence base for

safety and quality in Iraqi healthcare system. 23. Introduce students to the practice of safer health outcomes for

the Iraqi population. 24. Improve awareness and understanding of the quality and safety

issues. 25. Review the Iraqi healthcare system. 26. Identify integrated healthcare models. 27. Discuss the value, strength and weakness of integrated

healthcare. 28. Develop and demonstrate an understanding of the issues

surrounding the healthy and wellbeing of families and children living in Iraq.

29. Perform routine technical procedures related to systems included in the 3rd year program.

30. Interpret the results on commonly used diagnostic procedures. 31. Communicate effectively, both orally and in writing, with

patients and their families, colleagues, and others with whom physicians must exchange information in carrying out their responsibilities and knowledge.

AAJMS [Formerly IJMS] August, 2020;3(3):139-158 ;ISSNe 2522-7386

146

Table 2. Principles of Assessment [5]

Target Description Goals of assessment

Provide direction and motivation for future learning, including knowledge, skills and professionalism

Protect the public by upholding high professional standards and screening out trainees and physicians who are incompetent

Meet public expectations of self regulation. Choose among applicants for advanced training

What to assess

Habits of mind and behaviour Acquisition and application of knowledge and skills Communication Professionalism Clinical reasoning and judgement in uncertain

situations Teamwork Practice based learning and improvement Systems based practice

How to assess

Use multiple methods and a variety of environments and contexts to capture different aspects of performance

Organize assessments into repeated, ongoing, contextual, and developmental programs

Balance the use of complex, ambiguous real life situations requiring reasoning and judgement with structured, simplified, and focused assessments of knowledge, skills and behaviour

Include directly observed behaviour Use experts to test expert judgement Use pass – fail standards that reflect appropriate

developmental levels Provide timely feedback and mentoring

Cautions Be aware of the unintended effects of testing Avoid punishing expert physicians who use shortcuts Do not assume that quantitative data are more

reliable, valid, or useful than qualitative data

AAJMS [Formerly IJMS] August, 2020;3(3):139-158 ;ISSNe 2522-7386

147

Table 3. Bondy’s competency assessment tool [10]

Scale label

Score

Standard procedure Quality of performance Assistance

Independent 5

Safe Accurate Achieved intended outcome Behavior is appropriate to context

Proficient Confident Expedient

No supporting cues required

Supervised 4

Safe Accurate Achieved intended outcome Behavior is appropriate to context

Proficient Confident Reasonably expedient

Requires occasional supportive cues

Assisted 3

Safe Accurate Achieved most objectives for intended outcome Behavior generally appropriate to context

Proficient throughout most of performance when assisted

Required frequent verbal and occasional physical directives in addition to supportive cues

Marginal 2

Safe only with guidance Not completely accurate Incomplete achievement of intended outcome

Unskilled Inefficient

Required continuous verbal and Frequent physical directive cues

Dependant 1

Unsafe Unable to demonstrate behavior Lack of insight into behavior appropriate to context

Unskilled Unable to demonstrate behavior/ procedure

Required continuous verbal and continuous physical directive cues

X 0 Not observed

AAJMS [Formerly IJMS] August, 2020;3(3):139-158 ;ISSNe 2522-7386

148

Table 4. Task content of proposed 3rd year OSPE in biochemistry

Station Topic Weight %

Type

1 Asthma – case history 5 Written 2 Respiratory alkalosis- case history 5 Written 3 Blood sample collection for serum

calcium determination 5 Exposure

4 Drugs side effect 5 Written 5 Determination of serum uric acid 5 Exposed 6 Determination of random blood sugar 5 Exposed 7 Renal failure- case history 5 Written 8 Malabsorption – case history 5 Written 9 Ascites – Sampling and biochemical

examination of sample 5 Exposed

10 Determination of creatinine 5 Exposed 11 Determination of protein in urine 5 Exposed 12 Meningitis – case history 5 Written 13 Indicate the test you would undertake on

sample A to answer the question posed on the form

5 Written

14 Measurement of LDL 5 Exposed 15 Determination of TSB in serum 5 Exposed 16 Vitamin metabolism disorder- case

history 5 Written

17 Hepatic damage- case history 5 Written 18 Acute pancreatitis- case history 5 Written 19 Indicate how the concentrations of X and

Y can be determined by spectroscopy in a plasma extracts containing both X and Y and suggest other techniques which could possibly be used to assay X and Y.

5 Written

20 You are provided with the data for a batch of samples for which the growth hormone concentrations have been determined. The analyst for this patch wants to know which samples if any can be authorized. a. Indicate, giving your reason, which

samples if any can be authorized and how you would deal with the remaining samples.

b. What would you want to know to optimize quality control in this assay?

5 Written

AAJMS [Formerly IJMS] August, 2020;3(3):139-158 ;ISSNe 2522-7386

149

Table 5. Assessment Tool Checklist Validity Does the assessment adequately evaluate academic

performance relevant to the desired outcome?

Validity Does this assessment tool enable students with different learning styles or abilities to show you what they have learned and what they can do?

Content validity

Does the content examined by the assessment align with the content from the course?

Domain validity

Does this assessment method adequately address the knowledge, skills, abilities, behavior, and values associated with the intended outcome?

Bloom’s Will the assessment provide information at a level appropriate to the outcome?

Authentic Assessment

Will the data accurately represent what the student can do in an authentic or real life situation?

Reliability Is the grading scheme consistent; would a student receive the same grade for the same work on multiple evaluations?

Reliability Can multiple people use the scoring mechanism and come up with the same general score?

alignment with outcome

Does the assessment provide data that is specific enough for the desired outcomes?

Type Is the assessment summative or formative - if formative does it generate diagnostic feedback to improve learning?

AAHE Good practice

Is the assessment summative or formative - if summative, is the final evaluation built upon multiple sources of data?

Feedback If this is a summative assessment, have the students had ample opportunity for formative feedback and practice displaying what they know and can do?

Standards Is the assessment unbiased or value-neutral, minimizing an attempt to give desirable responses and reducing any cultural misinterpretations?

Grading, program review, both

Are the intended uses for the assessment clear?

Feedback Have other faculty provided feedback? Applicability Has the assessment been pilot-tested? Standards Has the evaluation instrument been normed? AAHE Good Practice

Will the information derive from the assessment help to improve teaching and learning?

Acceptability Will you provide the students with a copy of the rubric or assignment grading criteria?

Acceptability Will you provide the students examples of model work

AAJMS [Formerly IJMS] August, 2020;3(3):139-158 ;ISSNe 2522-7386

150

Table 6. Check list and /or rating scale for station 3 of the examination No Task Yes

or No

Bondy’s

Score

1 Educates the patient prior to and during the sampling procedure including clinical indications for sampling and possible side effects

2 Ensures that the indication(s) for the sampling fall within the Iraqi National Clinical Practice Guidelines regarding blood product sampling

3 Assembles equipment required for the sampling, including any specialized equipment required.

4 Prepares and handles equipment using non-touch aseptic technique e.g. wearing a glove

5 Proper exposure of sampling site 6 Candidate cleans and sterilize the site for sampling 7 Candidate apply tourniquet 8 Selects a proper syringe and needle size 9 Selects the proper anatomical site for sampling 10 Palpates the site of sampling searching for suitable

vein

11 Inserts the needle with proper angle 12 Get adequate sample volume 13 Places a cotton pad on the point of needle insertion

before its removal to prevent bleeding

14 Pulls out needle properly and gently press on the point of needle insertion

15 Flex the arm if the sampling is from the cubital area 16 Removes the needle from syringe before pouring the

blood sample into the container

17 Removes the needle from syringe properly 18 Pours the blood on the wall of the test tube 19 Puts test tube in rack 20 Discards syringe in the proper disposal site 21 Keeps for 10 minutes at room temperature 22 Puts the test tube in the centrifuge and spin for 10

minutes

23 Transfers the serum into another test tube

AAJMS [Formerly IJMS] August, 2020;3(3):139-158 ;ISSNe 2522-7386

151

Table 7. Rating Rubric Scale for station 9 of the exam [1, 11] Criteria/Dimension Characteristics of

highest level of performance

1 2 3 4 5 Score

Following instructions

Educates the patient prior to and during the sampling procedure including clinical indications for sampling and possible side effects such as : bleeding disorder, malnutrition, hernia, excess scar, pregnancy, severe intestinal inflammation or distension, bladder distension, enlarged spleen or liver, distended abdomen due to an obstruction.

Safety Ensures that the indication(s) for the sampling fall within the Iraqi National Clinical Practice Guidelines regarding blood

AAJMS [Formerly IJMS] August, 2020;3(3):139-158 ;ISSNe 2522-7386

152

product sampling. Physical examination performance.

Checking the case by inspecting one or more of the following [blood tests to make sure patient's blood clots normally, X ray, CT scan, Ultrasound, MRI scan].

Quality

Assembles equipment required for the sampling, including any specialized equipment required.

Intervention during procedure

Prepares IV fluids, anesthesia, anaphylactic shock treatment set, Blood for transfusion.

Patient posture Patient lay on back, with head 45 -900 elevation, or if there is only a small amount of fluid the patient position himself on

AAJMS [Formerly IJMS] August, 2020;3(3):139-158 ;ISSNe 2522-7386

153

his hands and knees,

Achievement of sampling outcome

If the procedure is scheduled rather than done in emergency, Does the candidates check whether the patients eat or drink in last 12 hours, Is the patient empty his bladder just before the procedure, if the entry area shaved.

Technique performance

Prepares and handles equipment using non-touch aseptic technique e.g. wearing a glove, Proper site, cleans the area for needle insertion with iodine and draped with sterile cloths, proper needle insertion angle, Does the candidate puts a small bandage over the area of needle insertion

Handling sample Discard needle properly; pour the sample in test tube labelled with

AAJMS [Formerly IJMS] August, 2020;3(3):139-158 ;ISSNe 2522-7386

154

patient name, proper dividing of the sample for different tests, proper syringe discard.

Sample volume For diagnosis, small amounts of fluid are removed.

For patients having trouble in breathing, 1 -4 litres of fluid may be removed

In case of malignant Ascites and when the goal of therapy is patient’s

comfort, a large amount of fluid, even 4-6 litres, can be removed at one time.

Length of procedure

Abdominal paracentesis can take as little as 10-15 minutes for diagnostic purposes.

Longer duration needed for therapeutic goal.

Candidates knowledge of possible

Bleeding. Persistent leakage of

AAJMS [Formerly IJMS] August, 2020;3(3):139-158 ;ISSNe 2522-7386

155

complications ascetic fluid. Hypotension. Peritonitis. Accidental piercing of other structure s in the abdomen such as intestine, liver, spleen, stomach, bladder, or blood vessels.

Complications management

Safe Accurate Achievement with the intended outcomes

Behaviour is appropriate to context

Candidate information regarding hospital stay

No hospital stay is needed, if the procedure is done for diagnosis.

But if the procedure is done for therapeutic goal, the patient needs hospital stay.

Postoperative care Patient stay in recovery room.

Checks blood pressure.

Checks for complications

AAJMS [Formerly IJMS] August, 2020;3(3):139-158 ;ISSNe 2522-7386

156

Laboratory test Biochemistry Cytology Microbiology

Total 5 = Excellent Uses procedures rapidly and skilfully Explains function of each step in procedure Modifies procedure to fit changing conditions, e. G. Development

of complications. 4= Good Uses procedure correctly but with some hesitation. Give general explanation of steps in procedure. Modifies procedure but needs some instructor guidance.

3= Satisfactory Uses procedure correctly but is slow and clumsy Explanation of procedure is limited Modifies procedures but only after demonstration by instructor

2= Marginally satisfactory Uses procedure correctly but is slow and unsafe for candidate Explanation of procedure is limited and unconfident. Modifies procedures but only after demonstration by instructor and

perform it’s slowly. 1= Inadequate Fails to use procedure correctly Explanation of procedure shows lack of understanding. Uses trial and error in adjusting procedure

AAJMS [Formerly IJMS] August, 2020;3(3):139-158 ;ISSNe 2522-7386

157

Table 8. General indicator hierarchy.

Score Indicators 0 Indicators describe in complete / unsafe practice using the

following stems: Does not able to Incomplete Not obtained Performed Inappropriate Inaccurate

1 Indicators describe a minimum level of safe practice Demonstration of the psychomotor elements of the skill are limited

to lower levels on a taxonomic scale and are described using the following stems.

Obtained Collected Checks Performs Slow

2 Indicators describe a level of proficient practice. Demonstration of the psychomotor elements of the skill reflect higher levels on a taxonomic scale and are described using the following stems: Efficient Accurate Appropriate Intended outcome

Appendix 1. Student Learning Outcome Assessment Form Department of Biochemistry Team Members: Date: Program / Course Step Target for assessment Score I Student Learning Outcome Statements

II Assessment Methods & Criteria for Success III Assessment Results IV Changes/ Improvements Implemented V Results of Follow-up Assessment

AAJMS [Formerly IJMS] August, 2020;3(3):139-158 ;ISSNe 2522-7386

158

References: 1. Gronlund NE. Assessment of Students Achievement. 8th Edition,

Pearson, USA, Chapter 9& 10, 2006.. 2. Wass V, Van der Vleuten C, Shatzer J, Jones R. Assessment of

clinical competence, Lancet 2004;357:945-949. 3. Van der Vleuten CPM. The assessment of professional

competence: developments, research and practical implications. Adv Health Sci Edu 1996;1:41-67.

4. Norman GR, Van der Vleuten CP, De Graaff E. Pitfalls in the pursuit of objectivity: issues of validity, efficiency and acceptability. Med Edu 1991;25:119-126.

5. Epstein RM. Assessment in medical education. N Eng J Med 2007;356:387-396.

6. Friedman BD. Standard setting in student assessment, AMEE Education Guide 18. Association for Medical Education in Europe, Dundee, UK, 2000.

7. Sullivan W. Work and integrity: the crises and promise of professionalism in America. 2nd ed. San Francisco: Jossey-Bass, 2005.

8. Amin Z, Seng C, Eng K. Practical Guide to Medical Student Assessment. World Scientific Publishing Co. Pte. Ltd, Singapore. Chapter 12-21, 2006.

9. Dent J, Harden RA. A Practical Guide for Medical Teachers. 2nd eds. Churchill Livingstone. 2005.

10. Bondy KN. Criterion-referenced definitions for rating scales in clinical evaluation. Journal of Nursing Education. 1983;22: 376-382.

11. Tierny R, Simon M. What's still wrong with rubrics: focusing on the consistency of performance criteria across scale levels. Practical Assessment, Research & Evaluation, Vol:9; Article (2). 2004. https://scholarworks.umass.edu/pare/vol9/iss1/2.

AAJMS [Formerly IJMS] August 2020;3(3):159-190:ISSNe 2522-7386

159

SARS-CoV-2: Treatment and Therapeutic Approaches Abdulghani Mohamed Alsamarai, Aalborg Academy College of Medicine [AACOM], Denmark. Tikrit University College of Medicine, [TUCOM], Tikrit, Iraq. Email: abdulghani.Mohamed@tu.edu.iq, galsamarrai@yahoo.com; Mobile: +9647701831295, ORCID: http://orcid.org/0000-0002-7872-6691 Amina Hamed Alobaidi, Kirkuk University College of Veterinary Medicine, Kirkuk, Iraq [KUCOVM], Email: aminahamed2006@gmail.com, Mobile: +9647702399175, ORCID: http://orcid.org/0000-0002-8495-3452 Mohamed Almoustafa Alsamarai, Laboratory Investigation Department, Samara University College of Applied Sciences (SUCOAS), Samara, Iraq. Email: mohamedalmoustafaa@gmail.com Mobile: +9647718814092 ORCID: http://orcid.org/0000-0002-3051-725X Correspondence author: Abdulghani Mohamed Alsamarai, Aalborg Academy College of Medicine [AACOM], Denmark. Tikrit University College of Medicine, [TUCOM], Tikrit, Iraq. Email: abdulghani.Mohamed@tu.edu.iq,galsamarrai@yahoo.com Mobile: +9647701831295, ORCID: http://orcid.org/0000-0002-7872-6691 DOI: https://doi.org/10.32441/aajms.3.3.11 Printed on line first. Received: 18/3/20 Accepted: 20/4/20 Published: Online first Abstract Actually there are no specific treatment approach for COVID-19 and most of the cases treated with supportive conventional treatment such rest; parenteral fluids, pain reliever, cough medication and cytokines storm treatment. Many drugs used on personal experience were used and there is no clinical trial for their evaluation. In Iraq, the Ministry of Health (IMH) recommended the use of the protocol that included combination of hydroxuchloroquine, azithromycin, Tamiflu (Oseltamivir), Kaletra (Lopinavir+Ritonavir)

AAJMS [Formerly IJMS] August 2020;3(3):159-190:ISSNe 2522-7386

160

and antibiotics according to patients need. Additionally, in other geographical areas some expert recommended the use of Remdesivir which may be of promising clinical outcome. Keywords: SARS-CoV-2, SARS-CoV, MERS-CoV, COVID-19, 2019-nCoV, Azithromycin, Coronaviruses, Pandemic COVID-19, Hydroxuchloroquine, Tamiflu (Oseltamivir), Remdesivir, Kaletra (Lopinavir+Ritonavir). Introduction Actually there are no specific treatment approach for COVID-19 and most of the cases were treated with supportive conventional treatment such rest, parenteral fluids, pain reliever, cough medication and cytokines storm treatment. Many drugs used on personal experience were used and there is no clinical trial results for their evaluation. In Iraq, the Ministry of Health (IMH) recommended the use of the protocol as shown in Table 1. Table .1. COVID-19 Treatment protocol in Iraqi hospital [1]. Drug Dose Indication Hydroxychloroquine 400 mg BID 1st

day and then 200 mg BID for 14 days

SARS-CoV-2 positive with pneumonia in ICU

Azithromycin 500 mg BID 1st day and then 250 mg BID for 14 days

Tamiflu (Oseltamivir) 75 mg twice daily for 5 days

Kaletra (Lopinavir+ Ritonavir; 200/50 mg)

2 tabs PO BID for 5 days

Antibiotics Accordingly In mild cases, there is no need to use antiviral agents, however in moderate cases IMH recommended the use of combination of Oseltamivir (Tamflu) with either Chloroquine or Hydroxychloroquine or Ribavirin. While in severe cases, the combination of Kaletra plus

AAJMS [Formerly IJMS] August 2020;3(3):159-190:ISSNe 2522-7386

161

Oseltamivir with either Chloroquine or Hydroxychloroquine or Ribavirin. In addition, in critical cases, course if combination of Kaletra + Oseltamivir + Ribavirin with either Chloroquine or Hydroxychloroquine. To date there are no data available that confirm their effectiveness in the treatment of COVID-19. Drugs under testing for their Anti-SARS-CoV-2 activity Globally, there are more than two hundreds (6 April, 2020) of clinical trials registered in the official sites of clinical trials [2] undergoing evaluation of their effectiveness as treatment approach for SARS-CoV-2 infection. COVID-19 is the first infectious health problem that takes the attention of WHO, world leaders, non-governmental organization, social media and whole world societies, even the children. The world is now desperate to find ways to slow the spread of the novel coronavirus and to find effective treatments. The drugs under evaluation included previous drugs that were used previously in the treatment of malaria, HIV, parasitic disease, and viral infections, Table 2 [3-7]. Tu et al [7]. Fortunately, the drugs and chemical agents listed in Table 2, which are under testing for their antiviral activity, are with varied mechanisms of antiviral activity. However, to early so suggest a novel antiviral agent against SARS-CoV-2 infection. COVID-19 treatment is the major challenge as the disease mortality is around 7% (estimated at 25th April 2020 cases). Gordon et al [3], in their study reported that human proteins interacted with SARS-CoV-2 proteins with multiple functions that include epigenetic and gene expression regulators (Nsp5, Nsp8, Nsp13, E), DNA replication (Nsp1), vesicle trafficking (Nsp6, Nsp7, Nsp10, Nsp13, Nsp15, Orf3a, E, M, Orf8), signaling (Nsp8, Nsp13, N, Orf9b), RNA processing and regulation (Nsp8, N), ubiquitin ligases (Orf10), lipid modification (Spike), nuclear transport machinery (Nsp9, Nsp15, Orf6), mitochondria (Nsp4, Nsp8, Orf9c), cytoskeleton (Nsp1, Nsp13) and extracellular matrix (Nsp9). These host virus interactome could be a novel target for drugs such as chloroquine [79,114]. However, the researcher not identified the mechanisms by which chloroquine acts in COVID-19 cases. One explanation is that chloroquine targeted Sigma 1 and Sigma 2 receptors [3]. Azithromycin, Tigecycline Linezolid and chloramphenicol antibiotics exerted their effects against human ribosomes, components of which interact with the Nsp8 protein of

AAJMS [Formerly IJMS] August 2020;3(3):159-190:ISSNe 2522-7386

162

SARS-CoV-2 [3,115,116]. ACE2 inhibitors and non-steroidal antiinflammatory drugs may be tested for their role as treatment approach of COVID-19. Table 2. Drugs and Chemical Substances that modulates SARS-CoV-2 interactors. Drug/ Compound Human gene Viral target Reference Haloperidol SIGMAR1;

TMEM97 Nsp6; Orf9c 8

JQ1 BRD2/4 Envelop 9 RVX BRD2/4 Envelop 9 Simitasertib CSNK2A2 Nucleocapsid 10,11 TMCB CSNK2A2 Nucleocapsid 12 Apicidin HDAC2 Nsp5 13 Valproic acid HDAC2 Nsp5 14,15,16 Bafilomycin A1 ATP6AP1

ATP6V1A Nsp6 Membrane

17

E-52862 SIGMAR1 Nsp6 18 PD-144418 SIGMAR1 Nsp6 19 RS-PPCC SIGMAR1 Nsp6 20 Pb28 SIGMAR1

TMEM97 Nsp6 Orf9c

21

Etacapone COMT Nsp7 22,23 Indomethacin PTGES2 Nsp7 24 Metformin NDUFs Nsp7, Orf9c 25 Ponatinib RIPK1 Nsp12 26 H-89 PRKACA Nsp13 27 Merimepodib IMPDH2 Nsp14 28 Migalastat GLA Nsp14 29 Mycophenolic acid IMPDH2 Nsp14 30 Ribavirin IMPDH2 Nsp14 31 XL413 DNMT1 Orf8 32 CCT365623 LOX Orf8 33 Midostaurin MARK2/3 Orf9b 34 Ruxolitinib MARK2/3 Orf9b 35 Zinc 1775962367 DCTPP1 Orf9b 36 Zinc 4326719 DCTPP1 Orf9b 37 Zinc 4511851 DCTPP1 Orf9b 38 Zinc 95559591 MARK3

TBK1 Orf9b Nsp13

39

AAJMS [Formerly IJMS] August 2020;3(3):159-190:ISSNe 2522-7386

163

AC55541 F2RL1 Orf9c 40 AZ8838 F2RL1 Orf9c 41 AZ3451 F2RL1 Orf9c 41 Daunorubicin ABCC1 Orf9c 42 GB110 F2RL1 Orf9c 43 S-Verapamil ABCC1 Orf9c 44 ABBV-744 BRD2/4 Envelop 45 dBET6 BRD2/4 Envelop 46 MZ1 BRD2/4 Envelop 47 CPI-0610 BRD2/4 Envelop 48 Sapanisertib LARP1 Nucleocapsid 49,50 Rapamycin LARP1

FKBP15 FKBP7/10

Nucleocapsid Nsp2 Orf8

50,51

Zotatifin EIF4E2/H Nsp2 52 Verdinexor NUPs

RAE1 Nsp4 Nsp9/Orf6

53

Chloroquine SIGMAR1 Nsp6 54 Dabrafenib NEK9 Nsp9 55 WDB002 CEP250 Nsp13 3 Sanglifehrin IMPDH2 Nsp14 56 FK-506 FKBP7

FKBP10 Orf8 57

Pevonedistat CUL2 Orf10 58 Ternatin4 Translation 59 4E2RCat Translation 60 Tomivosertib Translation 61,62 Compound 2 Viral

Transcription 63

Compound 10 Viral Transcription

64

PS3061 ER protein processing

65

IHVR-19029 ER protein processing

66,67

Captopril Cell entry 68 Lisinopril Cell entry 69 Camostat Cell entry 70,71 Nafamostat Cell entry 70,72 Chloramphenicol Mitochondria

l ribosome 73

AAJMS [Formerly IJMS] August 2020;3(3):159-190:ISSNe 2522-7386

164

Tigecycline Mitochondrial ribosome

74

Linezolid Mitochondrial ribosome

75

Emtricitabine/ Tenovir 2 Hydroxychloroquine Blocking

virus-cell membrane fusion

2

Remdesivir

RNA-dependent-RNA polymerase

76- 80

Favibiravir ChiCTR2000029600

RNA –dependent RNA polymerase

81

Ivermectin Viral protease 82-85 Lopinavir/ Ritonavir Viral protease 78,86 APNO1 [Recombinant Human ACE2]

Blocking virus-cell membrane fusion

87,88

Hydroxychloroquine Blocking virus-cell membrane fusion

89-92

Arbidol Hydrochloride [Umifenovir]

Blocking virus-cell membrane fusion

93,94

NK cells Enhancing innate immunity

95

Recombinant interferon I

96,97

Mesenchymal Stem Cells

Attenuating Inflammatory Response

98,99

Intravenous Immunoglobulin

Attenuating Inflammatory Response

100

AAJMS [Formerly IJMS] August 2020;3(3):159-190:ISSNe 2522-7386

165

SARS-CoV-2-Specific Neutralizing Ab

Attenuating Inflammatory Response

101,102

Anti-C5a Monoclonal Ab

Attenuating Inflammatory Response

103

Blocking Interleukin-6 pathway

Attenuating Inflammatory Response

104-108

Thalidomide Attenuating Inflammatory Response

109,110

Methyprednisoline Attenuating Inflammatory Response

7

Fingolimod Attenuating Inflammatory Response

111

Bevacizumab Symptomatic control

112

EIDD-2801 Nsp15, Orf1 113 Combination of oseltamivir, favipiravir, and chloroquine

Protease 2

ASC09F + oseltamivir vs Ritonavir + oseltamivir vs Oseltamivir

Protease 2

Abidol hydrochloride vs Oseltamivir vs Lopinavir/Ritonavir

Protease 2

Modified from Gordon et al [ 3 ], ChEMBL [4], ZINC [5] and IUPHAR/BPS Guide to pharmacology [6], Tu et al [7] In a recent study by Zhou et al.,[117] perform an integrative analysis of interactome networks associated with human coronaviruses and drugs targeting the components of these networks was applied to reveal 16 novel candidates for drug repurposing. Zhou et al [117], presented a network-based methodology for systematic identification of putative repurposable drugs and drug combinations for potential treatment of SARS-CoV-2/2019-nCoV.

AAJMS [Formerly IJMS] August 2020;3(3):159-190:ISSNe 2522-7386

166

Integration of drug–target networks, HCoV–host interactions, HCoV induced transcriptome in human cell lines, and human protein–protein interactome network are essential for such identification. They suggested three potential drug combinations and sixteen repurposable drugs [Table.3], for targeting SARS-CoV-2/2019-nCoV. Although there is evidence reported in literature that predict their antiviral activity [Table 3], however, these suggested combinations and drug must be tested against SARS-CoV-2 in vitro and in clinical trials in animal models before their use in human. Tu et al [7], in a review summarized the ongoing clinical trials of drugs against SARS-CoV-2 that are effective against other viruses. The drugs targets of action included: inhibition of the RNA-dependent RNA polymerase, inhibition of viral protease, blocking virus-cell fusion, enhancing the innate immunity, attenuating the inflammatory response, and symptomatic control. In addition, the evaluation of SARS-CoV-2 genome derived vaccines [Table 4]. These drugs either acting directly on virus replication, or as immunotherapy to potentiate innate immunity or by acting as inflammatory response dysregulator. Gordon et al [3] in an extensive study identified 67 human proteins in host pathways targeted by 69 existing compounds currently being investigated or FDA-approved drugs [Table 2]. According to their study findings they suggest that SARS-CoV-2 during its replication cycle inhibit host innate immune response. Additionally, ubiquitin system may be a novel target for antiviral agents that to be tested for their activity on SARS-CoV-2. They suggested that Bafilomycin A1, Valproic acid, Apicidin, Haloperidol, Chloroquine, Centriole (CEP250), mycophenolic acid, Ribavirin, Merimepodib, Sanglifehrin A, Sapanisertib, Rapamycin and Metformin may be of predictive value in treating COVID-19. Vaccine is the novel approach for control and prevention of viral infections including SARS-CoV-2, SARS-CoV, and MERS-CoV. However, the development of effective vaccine takes a long period. Vaccine development influenced by many factors such the safety, vaccine material antigenicity, coronaviruses diversity, and SARS-CoV-2 strains variation. At present (30th, April, 2020) there are more than 110 SARS-CoV-2 vaccines developed by universities and companies research groups under evaluation [118,125, Table 5]. In

AAJMS [Formerly IJMS] August 2020;3(3):159-190:ISSNe 2522-7386

167

order to induce an effective immune response that prevent infection or kill the virus after infection, 9 approaches were used in clinical trials or animal model. These approaches include: weakened virus vaccine, inactivated virus vaccine, replicating virus-vectors vaccine (weakened measles), non-replicating virus-vector vaccine (adenovirus), RNA vaccine, DNA vaccine, protein sub-unit vaccine, virus-like particles, and vaccines that used previously for other infectious diseases (BCG and polio vaccine) [118]. The vaccine activity map distribution of the active SARS-CoV-2 candidates at 9 th April, 2020, were in North America (36, 46%), in China (14, 18%), in Asia (excluding China, 14, 18%) and Australia, and in Europe (14, 18%) [119]. The vaccine development is a long lasting journey, difficult and expensive. ''WHO has repeatedly warned countries against relying on a vaccine to end the current situation'' [120]. However, we hope to develop an effective SARS-CoV02 to control or ameliorate the pandemic of the disease. Sheahan et al [113] reported that EIDD-2801, a ribonucleoside -d-N4 analog -hydroxycytidine has broad-spectrum antiviral activity against SARS-CoV, MERS-CoV, SARS-CoV-2, 2b or 2c bat-CoVs, and coronaviruses strains resistance to Remdesivir. The compound induced genetic mutations in viral RNA which attributed to inability of the virus to infect cells. In addition, to its broad-spectrum antiviral activity, the oral bioavilability of the drug addressed the suggestion of its potential antiviral activity against SARS-CoV-2 [113]. From the information mentioned in the above Tables, we concluded that the antiviral research concentrated on the drugs and compounds presented in Table 6. These compounds will induce the basic arms of the management of COVID-19 which include; antiviral activity, prevention of cytokines storm, attenuation of inflammatory responses, and enhancement of immune response. In conclusion, although there are a global research works that evaluate the effectiveness of drugs/compound as therapeutic approach for COVID-19, however, to date none found to be with promising effect. Additionally, the vaccine evaluation takes a long period until the development of novel potential vaccine. The best approach to find an effective drug against SARS-CoV-2 infection is to test new compounds, not to relay on the testing of that used in another virus's treatment. The novel drugs are that which prevent viral attachment

AAJMS [Formerly IJMS] August 2020;3(3):159-190:ISSNe 2522-7386

168

with the host cell to get rid of immune and inflammatory harmful responses. Table 3. Network-predicted repurposable drugs [118].

Drug name Clinical use Antiviral activity Irbesartan Antihypertensive HBV, HDV Toremifene Antineoplastic EBOV, MERS-CoV,

SARS-CoV Camphor Antipruritic, Anti-

infective H1N1

Equilin Estrogen ZEPOV-GP/HIV Mesalazine Anti-inflammatory EBV Mercaptopurine Antimetabolite,

Antineoplastic MERS-CoV, SARS-CoV

Paroxetine Selective serotonin reuptake inhibitor

EBOV

Sirolimus Immunosuppressant ANDV,HCV Carvedilol Beta-blocker EMCV Colchicine Anti-inflammatory EBV Dactinomycin Antineoplastic FECV Melatonin Hormone EBOV, RSV Quinacrine Antimalarial,

Antibiotic EV71, EBOV

Eplerenone Diuretic Viral myocarditis Emodin Anthraquinones HSV-1, HSV-2, HBV,

CB4, SARS-CoV Oxymetholone Anabolic steroid HIV Sirolimus plus Dactinomycin

Toremifene plus Emodin

Mercaptopurine plus Melatonin

CVB4 Coxsackievirus B4, HBV hepatitis B virus, HSV-1 and -2 herpes simplex viruses, HCV hepatitis C virus, EV71 enterovirus 71, HDV hepatitis delta virus, RSV respiratory syncytial virus, EBOV Ebola viruses, FECV feline enteric coronavirus, ZEBOV-GP Zaire Ebola virus glycoprotein, EMCV encephalomyocarditis

AAJMS [Formerly IJMS] August 2020;3(3):159-190:ISSNe 2522-7386

169

virus, HIV human immunodeficiency virus, ANDV Andes orthohantavirus, EBV Epstein-Barr virus.

Table 4. Targeted sites/ functions of the present clinical trials [7].

Target / Function Drug / Chemical substance Inhibiting the RNA-dependent RNA polymerase

Remdesivir Favipiravir

Inhibiting the viral protease

Ivermectin Lopinavir/Ritonavir

Blocking Virus–Cell Membrane Fusion

Recombinant Human Angiotensin-converting Enzyme 2 (APN01) Hydroxychloroquine Arbidol Hydrochloride (Umifenovir)

Enhancing the innate immune system

Natural Killer Cells Recombinant interferon

Attenuating the Inflammatory Response

Mesenchymal Stem Cells Intravenous Immunoglobulin SARS-CoV-2-Specific Neutralizing Antibodies Anti-C5a Monoclonal Antibody Blocking the Interleukin (IL)-6 Pathway Thalidomide Methylprednisolone Fingolimod

Symptomatic Control Bevacizumab Vaccine

mRNA-1273 INO-4800 ChAdOx1 nCoV-19 Stabilized Subunit Vaccines Nanoparticle-Based Vaccines Pathogen-Specific Artificial Antigen-Presenting Cells

AAJMS [Formerly IJMS] August 2020;3(3):159-190:ISSNe 2522-7386

170

Table 5. SARS-CoV-2 [COVID-19] vaccines ongoing trial Vaccine Clinical Trial Code Reference mRNA-1273 NCT04283461 7 INO-4800 7,97,98 ChAdOX1 nCoV-19 NCT04324606 7,125 Stablized- Subunit vaccine 7,121 Nanoparticle-Based vaccine 7,122 Pathogen-Specific-Artificial Antigen- Presenting Cells

NCT04299724 7, 123

CORVaX12 124 Ad5-nCoV NCT04313127 2 LV-SMENP-D NCT04276896 2 Adenovirus 5 vector ChiCTR2000031781;

ChiCTR2000030906 125

DNA plasmid vaccine with Electroporation

NCT04336410 125

Inactivated ChiCTR2000031809 125 Inactivated 125 mRNA 2020-001038-36 125 LNP - encapsulated mRNA NCT04283461 125 DNA with electroporation 125 DNA plasmid vaccine 125 DNA vaccine 125 DNA vaccine 125 DNA vaccine 125 Plasmid DNA, Needle-Free Delivery

125

DNA plasmid vaccine 125 Inactivated + alum NCT04352608 125 Inactivated 125 TBD 125 Inactivated + CpG 1018 125 Inactivated + CpG 1018 125 Codon deoptimized live attenuated vaccines

125

AAJMS [Formerly IJMS] August 2020;3(3):159-190:ISSNe 2522-7386

171

Codon deoptimized live attenuated vaccines

125

MVA encoded VLP 125 Replication defective Simian Adenovirus (GRAd) encoding SARS-CoV-2 S

125

Ad26 125 MVA-S encoded 125 Adenovirus-based NasoVAX expressing SARS2-CoV spike protein

125

Ad5 S (GREVAX™

platform) 125

Oral Ad5 S 125 Adenovirus-based + HLA matched peptides

125

Oral Vaccine platform 125 MVA expressing structural proteins

125

Dendritic cell-based vaccine 125 Parainfluenza virus 5 (PIV5) –based vaccine expressing the spike protein

125

Recombinant deactivated rabies virus containing S1

125

Capsid-like Particle 125 Drosophila S2 insect cell expression system VLPs

125

Peptide antigens formulated in lipid nanoparticle formulation

125

S protein 125 S protein +Adjuvant 125 VLP recombinant protein + Adjuvant

125

Native like Trimeric subunit Spike Protein vaccine

125

AAJMS [Formerly IJMS] August 2020;3(3):159-190:ISSNe 2522-7386

172

microneedle arrays S1 subunit

125

Peptide 125 Adjuvanted protein subunit (RBD)

125

Peptide 125 S protein 125 Ii-Key peptide 125 S protein 125 S protein (baculovirus production)

125

Full length recombinant SARS CoV -2 glycoprotein nanoparticle vaccine + Matrix M

125

gp-96 backbone 125 Molecular clamp stabilized Spike protein

125

Peptide vaccine 125 S1 or RBD protein 125 Subunit protein, plant produced

125

Recombinant protein, nanoparticles (based on S protein and other epitopes)

125

COVID-19 XWG-03 truncated S (spike) proteins

125

Adjuvanted microsphere peptide

125

Synthetic Long Peptide Vaccine candidate for S and M proteins

125

Oral E.coli-based protein expression system of S and N protein

125

Nanoparticle vaccine 125 Recombinant spike protein 125

AAJMS [Formerly IJMS] August 2020;3(3):159-190:ISSNe 2522-7386

173

with Advax adjuvant Spike –based 125 Recombinant S1-Fc fusion protein

125

Recombinant protein 125 Recombinant S protein in IC-BEVS

125

YF17D Vector 125 Measles Vector 125 Measles Vector 125 Measles Vector 125 Measles Virus (S, N targets) 125 Horsepox vector expressing S protein

125

Live viral vectored vaccine based on attenuated influenza virus backbone (intranasal)

125

Recombinant vaccine based on influenza A virus (intranasal)

125

Influenza vector expressing RBD

125

Replication- competent VSV chimeric virus technology (VSV∆G) delivering the

SARS-CoV-2 Spike (S) glycoprotein

125

VSV-S 125 VSV vector 125 M2-deficient single replication (M2SR) influenza vector

125

LNP encapsulated mRNA cocktail encoding VLP

125

LNP encapsulated mRNA encoding RBD

125

AAJMS [Formerly IJMS] August 2020;3(3):159-190:ISSNe 2522-7386

174

Replicating Defective SARSCoV-2 derived RNAs

125

LNP encapsulated mRNA 125 Liposome encapsulated mRNA

125

Several mRNA candidates 125 mRNA 125 mRNA 125 mRNA 125 SaRNA 125 mRNA 125 mRNA in an intranasal delivery system

125

Virus-like particle, based on RBD displayed on virus-like particles

125

Plant-derived VLP 125 ADDomerTM multiepitope display

125

Unknown 125 VLP 125 Evlp 125 Unknown 125 Unknown 125 Unknown 125

AAJMS [Formerly IJMS] August 2020;3(3):159-190:ISSNe 2522-7386

175

Table 6 . Suggested Antiviral agents for evaluation against SARS-CoV-2. Agent Target Reference Emodin ACE-2 126 α-Ketoamides Viral protease 127 Corticosteroids Attenuate

inflammation 128

Corticosteroid ciclesonide Nsp15 129 Remdesivir+ Hydroxychloroquine

RdRp/ Block Virus-Cell membrane fusion

7,130

Remdesivir + INFb RdRp 131 Remdesivir + Ivermectin RdRp/ Viral

protease 7,131

Remedsivir +ACE-2 inhibitors RdRp/ ACE-2 inhibition

132

Lamivudine RdRp 133 Tenofovir disoproxil RdRp 132 Emtricitabine, Alovudine, Apricitabine, Zidovudine, Stavudine and / or Zalcitabine

RdRp 132

Lopinavir/Ritonavir Protease 134-136 Nanoparticle Antiviral Agents Delivery

Multiple 137

SARS-Cov-2- specific human monoclonal antibody

RBD 138

Cyclosprin A Protein synthesis 139 D, L-lysine acetylsalicylate+glycine

Protein synthesis, RNA polymerase, Transcription

140

Saquinavir and Beclabuvir Protease 141 Soluble recombinant ACE-2 ACE-2 142 Plant lectin Entry 143 Zn RNA polymerase 144 Neutralizing Antibodies Targeting S protein

Entry 145

AAJMS [Formerly IJMS] August 2020;3(3):159-190:ISSNe 2522-7386

176

small interfering RNA (siRNA) or antisense oligonucleotides (ASO)

RNA genome 145

ACE2 Fc S protein 145 Flavonoids Protease

Enhance Immunity

146

IQ-SAM (1,2,3 and 4) Protease Spike protein

Favipiravir RdRp 147 Umifenovir (Arbidol) Membrane fusion 148 EIDD-2801 Genome

incorporation 113

References 1. Ministry of Health Document, Iraq. 2. ClinicalTrials.gov: Federally-funded clinical studies related to

COVID-19; WHO Trial Registry Network: COVID-19 studies from the ICTRP database; CDC: Information for Clinicians on Therapeutic Options for COVID-19 Patients.

3. Gordon DE, Jang GW, Bouhaddou M, Xu J, Obernier K, O'Meara MJ, Guo JZ, et al. A SARS-CoV-2-Human Protein-Protein Interaction Map Reveals Drug Targets and Potential Drug-Repurposing. bioRxiv preprint doi: https://doi.org/10.1101/2020.03.22.002386.

4. Gaulton A, Hersey A, Nowotka M, Bento AP, Chambers J, Mendez M, et al. The ChEMBL database in 2017. Nucleic Acids Res. 2017;45:D945–D954.

5. Sterling T, Irwin JJ. ZINC 15--Ligand Discovery for Everyone. J. Chem. Inf. Model. 2015;55:2324–2337.

6. Armstrong JF, Faccenda E, Harding SD, Pawson AJ, Southan C, Sharman JL, et al. The IUPHAR/BPS Guide to PHARMACOLOGY in 2020: extending immunopharmacology content and introducing the IUPHAR/MMV Guide to MALARIA PHARMACOLOGY. Nucleic Acids Res. 2020;48:D1006–D1021..

7. Tu YF, Chien CS, Yarrmshyn AA, Lin YY, Luo YH, Lin YT, et al. A review of SARS-CoV-2 and the ongoing clinical trials. Int J Mol Sci 2020;21(2657):1-19.

AAJMS [Formerly IJMS] August 2020;3(3):159-190:ISSNe 2522-7386

177

8. Hellewell SB, Bruce A, Feinstein G, Orringer J, Williams W, Bowen WD, et al. Rat liver and kidney contain high densities of sigma 1 and sigma 2 receptors: characterization by ligand binding and photoaffinity labeling. Eur J Pharmacol 1994;268:9–18.

9. McLure KG, Gesner EM, Tsujikawa L, Kharenko OA, Attwell S, Campeau E, et al. RVX-208, an inducer of ApoA-I in humans, is a BET bromodomain antagonist. PLoS One 2013;8:e83190.

10. Pierre F, Chua PC, O'Brien SE, Siddiqui-Jain A, Bourbon P, Haddach M, Michaux J, et al. Discovery and SAR of 5-(3-chlorophenylamino) benzo[c] [2,6] naphthyridine-8- carboxylic acid (CX-4945), the first clinical stage inhibitor of protein kinase CK2 for the treatment of cancer. J Med Chem. 2011;54:635–654.

11. Siddiqui-Jain A, Drygin D, Streiner N, Chua P, Pierre F, O'Brien SE, et al. CX-4945, an orally bioavailable selective inhibitor of protein kinase CK2, inhibits prosurvival and angiogenic signaling and exhibits antitumor efficacy. Cancer Res. 2010;70:10288–

10298. 12. Janeczko M, Orzeszko A, Kazimierczuk Z, Szyszka R, Baier A.

CK2α and CK2α’ subunits differ in their sensitivity to 4,5,6,7-tetrabromo- and 4,5,6,7-tetraiodo-1H-benzimidazole derivatives. Eur J Med Chem. 2012;47:345–350.

13. Khan N, Jeffers M, Kumar S, Hackett C, Boldog F, Khramtsov N, et al. Determination of the class and isoform selectivity of small-molecule histone deacetylase inhibitors. Biochem J 2008;409: 581–589.

14. Göttlicher M, Minucci S, Zhu P, Krämer OH, Schimpf A, Giavara S, et al. Valproic acid defines a novel class of HDAC inhibitors inducing differentiation of transformed cells. EMBO J 2001;20: 6969–6978.

15. Kramer OH, Zhu P, Ostendorff HP, Golebiewski M, Tiefenbach J, Peters MA, et al. The histone deacetylase inhibitor valproic acid selectively induces proteasomal degradation of HDAC2. EMBO J 2003; 22:3411–3420.

16. Fass DM, Shah R, Ghosh B, Hennig K, Norton S, Zhao WN, et al. Effect of Inhibiting Histone Deacetylase with Short-Chain Carboxylic Acids and Their Hydroxamic Acid Analogs on Vertebrate Development and Neuronal Chromatin. ACS Med. Chem Lett 2010;2:39–42.

AAJMS [Formerly IJMS] August 2020;3(3):159-190:ISSNe 2522-7386

178

17. Gagliardi S, Nadler G, Consolandi E, Parini C, Morvan M, Legave MN, et al. 5-(5,6-Dichloro-2-indolyl)-2-methoxy-2,4-pentadienamides: novel and selective inhibitors of the vacuolar H+-ATPase of osteoclasts with bone antiresorptive activity. J Med Chem 1998;41:1568–1573.

18. Diaz JL, Fernandez A, Luengo M, Bordas M, Enrech R, Carro M, et al. Synthesis and biological evaluation of the 1-arylpyrazole class of σ(1) receptor antagonists: identification of 4-{2-[5-methyl-1-(naphthalen-2-yl)-1H-pyrazol-3-loxy]ethyl}morpholine (S1RA, E-52862). J Med Chem. 201;55:8211–8224.

19. Akunne HC, Whetzel SZ, Wiley JN, Corbin AE, Ninteman FW, Tecle H, et al. The pharmacology of the novel and selective sigma ligand, PD 144418. Neuropharmacology 1997;36:51–62.

20. Prezzavento O, Campisi A, Ronsisvalle S, Li Volti G, Marrazzo A, Bramanti V, et al. Novel sigma receptor ligands: synthesis and biological profile. J Med Chem. 2007;50:951–961.

21. Azzariti A, Colabufo NA, Berardi F, Porcelli L, Nisco M, Simone GM, et al. Cyclohexylpiperazine derivative PB28, a sigma2 agonist and sigma1 antagonist receptor, inhibits cell growth, modulates P-glycoprotein, and synergizes with anthracyclines in breast cancer. Mol Cancer Ther. 2006;5:1807–

1816. 22. Nissinen E, Linden IB, Schultz E, Pohto P. Biochemical and

pharmacological properties of a peripherally acting catechol-O-methyltransferase inhibitor entacapone. Naunyn Schmiedebergs Arch Pharmacol. 1992;346:262–266.

23. De Santi C, Giulianotti PC, Pietrabissa A, Mosca F, Pacifici GM. Catechol-O-methyltransferase: variation in enzyme activity and inhibition by entacapone and tolcapone. Eur J Clin Pharmacol. 1998;54:215–219.

24.Vane JR. Inhibition of prostaglandin synthesis as a mechanism of action for aspirin-like drugs. Nat New Biol. 1971;231:232–235.

25. Wheaton WW, Weinberg SE, Hamanaka R, Soberanes S, Sullivan LB, Anso E, et al. Metformin inhibits mitochondrial complex I of cancer cells to reduce tumorigenesis. Elife 2014;3: e02242.

26. Najjar M, Suebsuwong C, Ray SS, Thapa RJ, Maki JL, Nogusa S, et al. Structure guided design of potent and selective ponatinib-based hybrid inhibitors for RIPK1. Cell Rep. 2015;10:1850–1860.

AAJMS [Formerly IJMS] August 2020;3(3):159-190:ISSNe 2522-7386

179

27. Chijiwa T, Mishima A, Haqiwara M, Sano M, Hayashi K, Inoue T, et al. Inhibition of forskolin-induced neurite outgrowth and protein phosphorylation by a newly synthesized selective inhibitor of cyclic AMP-dependent protein kinase, N-[2-(pbromocinnamylamino)ethyl]-5-isoquinolinesulfonamide (H-89), of PC12D pheochromocytoma cells. J Biol Chem. 1990;265:5267–5272.

28. Sintchak MD, Nimmesgern E. The structure of inosine 5’-monophosphate dehydrogenase and the design of novel inhibitors. Immunopharmacology 2000;47:163–184.

29. Asano N, Ishii S, Kizu H, Ikeda K, Yasuda K, Kato A, et al. In vitro inhibition and intracellular enhancement of lysosomal alpha-galactosidase A activity in Fabry lymphoblasts by 1-deoxygalactonojirimycin and its derivatives. Eur J Biochem. 2000; 267:4179–4186.

30. Carter SB, Franklin TJ, Jones DF, Leonard BJ, Mills SD, Turner RW, et al. Mycophenolic acid: an anti-cancer compound with unusual properties. Nature 1969;223:848–850.

31. Wittine K, Stipkovic BM, Makuc D, PLavec J, Kraljevic S, Sedic M, et al. Novel 1,2,4-triazole and imidazole derivatives of L-ascorbic and imino-ascorbic acid: synthesis, anti-HCV and antitumor activity evaluations. Bioorg Med Chem. 2012;20:3675–

3685. 32. Koltun ES, Tsuhako AL, Brown DS, Aay N, Arcalas A, Chan

V, et al. Discovery of XL413, a potent and selective CDC7 inhibitor. Bioorg Med Chem Lett. 2012;22:3727–3731.

33. Leung L, Niculescu-Duvaz D, Smithen D, Lopes F, Callens C, McLeary R, et al. Anti-metastatic Inhibitors of Lysyl Oxidase (LOX): Design and Structure-Activity Relationships. J Med Chem 2019;62:5863–5884.

34. Karaman MW, Herrgard S, Treiber DK, Gallant P, Atteridge CE, Campbell BT, et al. A quantitative analysis of kinase inhibitor selectivity. Nat Biotechnol. 2008;26:127–132.

35. Davis MI, Hunt JP, Herrgard S, Ciceri P, Wodicka LM, Pallares G, et al. Comprehensive analysis of kinase inhibitor selectivity. Nat Biotechnol. 2011;29:1046–1051.

36. Llona-Minguez S, Höglund A, Jacques SA, Johansson L, Calderón-Montaño JM, Claesson M, et al. Discovery of the First

AAJMS [Formerly IJMS] August 2020;3(3):159-190:ISSNe 2522-7386

180

Potent and Selective Inhibitors of Human dCTP Pyrophosphatase 1. J Med Chem. 2016;59:1140–1148.

37. Llona-Minguez, S, Höglund A, Wiita E, Almlöf I, Mateus A, Calderón-Montaño JM, et al. Identification of Triazolothiadiazoles as Potent Inhibitors of the dCTP Pyrophosphatase 1. J Med Chem. 2017;60:2148–2154.

38. Llona-Minguez S, Haggblad M, Martens U, Johansson L, Sigmundsson K, Lundback T, et al. Diverse heterocyclic scaffolds as dCTP pyrophosphatase 1 inhibitors. Part 2:Pyridone- and pyrimidinone-derived systems. Bioorg Med Chem Lett. 2017;27: 3219–3225.

39. McIver EG, Bryans J, Birchall K, Chugh J, Drake T, Lewis SJ, et al. Synthesis and structure-activity relationships of a novel series of pyrimidines as potent inhibitors of TBK1/IKKε kinases. Bioorg

Med Chem Lett. 2012;22:7169–7173. 40. Seitzberg JG, Knapp AE, Lund BW, Mandrup Bertozzi S, Currier

EA, Ma JN, et al. Discovery of potent and selective small-molecule PAR-2 agonists. J Med Chem. 2008;51:5490–5493.

41. Cheng RKY, Fiez-Vandal C, Schlenker O, Edman K, Aggeler B, Brown DG, et al. Structural insight into allosteric modulation of protease-activated receptor 2. Nature 2017;545:112–115.

42. Priebe W, Marta Krawczyk M, Kuo T, Yamane M, Savaraj N, Ishikawa T. Doxorubicin- and Daunorubicin-Glutathione Conjugates, but Not Unconjugated Drugs, Competitively Inhibit Leukotriene C4Transport Mediated byMRP/GS-XPump. Biochemical Biophysical Res Communications 1998;247:859–

863. 43. Barry GD, Suen JY, Le GT, Cotterell A, Reid RC, Fairlie DP, et

al. Novel agonists and antagonists for human protease activated receptor 2. J Med Chem. 2010;53:7428–7440.

44. Perrotton T, Trompier D, Chang XB, Di Pietro A, Baubichon-Cortay H. (R)- and (S)-verapamil differentially modulate the multidrug-resistant protein MRP1. J Biol Chem. 2007;282: 31542–31548.

45. Faivre EJ, McDaniel KF, Albert DH, Mantena SR, Plotnik JP, Wilcox D, et al. Selective inhibition of the BD2 bromodomain of BET proteins in prostate cancer. Nature 578;306–310.

46. Xu L, Chen Y, Mayakonda A, Koh L, Chong YK, Buckley DL, et al. Targetable BET proteins- and E2F1-dependent

AAJMS [Formerly IJMS] August 2020;3(3):159-190:ISSNe 2522-7386

181

transcriptional program maintains the malignancy of glioblastoma. Proc Natl Acad Sci. USA. 2018;115:E5086–

E5095. 47. Zengerle M, Chan KH, Ciulli A. Selective Small Molecule

Induced Degradation of the BET Bromodomain Protein BRD4. ACS Chem Biol 2015;10:1770–1777.

48. Albrecht BK, Gehling VS, Hewitt MC, Vaswani RG, Côté A, Leblanc Y, et al. Identification of a Benzoisoxazoloazepine Inhibitor (CPI-0610) of the Bromodomain and Extra-Terminal (BET) Family as a Candidate for Human Clinical Trials. J Med Chem. 2016; 59:1330–1339.

49. Schenone S, Brullo C, Musumeci F, Radi M, Botta M. ATP-competitive inhibitors of mTOR: an update. Curr Med Chem. 2011;18:2995–3014.

50. Fonseca BD, Jia JJ, Hollensen AK, Pointet R. LARP1 is a major phosphorylation substrate of mTORC1. bioRxiv (2018).

51. Toral-Barza L, Zhang WG, Lamison C, Larocque J, Gibbons J, Yu K, et al. Characterization of the cloned full-length and a truncated human target of rapamycin:activity, specificity, and enzyme inhibition as studied by a high capacity assay. Biochem Biophys Res Commun. 2005;332:304–310.

52. Thompson PA, Ernst JT, Eam B, Young NP, Fish S, Chen J, Barrera M, et al. Abstract 2698: eFT226, a potent and selective inhibitor of eIF4A, is efficacious in preclinical models of lymphoma. in Experimental and Molecular Therapeutics 2698–

2698 (American Association for Cancer Research, 2019). 53. Jorquera PA, Mathew C, Pickens J, Williams C, Luczo JM,

Tamir S, et al. Verdinexor (KPT-335), a Selective Inhibitor of Nuclear Export, Reduces Respiratory Syncytial Virus Replication In Vitro. J Virol. 2019;93(4): e01684-18.

54. Tesei A, Tesei A, Cortesi M, Zamagni A, Arienti C, Pignatta S, Zanoni M, Paolillo M, et al. Sigma Receptors as Endoplasmic Reticulum Stress ‘Gatekeepers’ and their Modulators as

Emerging New Weapons in the Fight Against Cancer. Front Pharmacol. 2018;9:711.

55. Phadke M, Remsing Rix LL, Smalley I, Bryant AT, Luo Y, Lawrence HR, et al. Dabrafenib inhibits the growth of BRAF-WT cancers through CDK16 and NEK9 inhibition. Mol Oncol. 2018;12:74–88.

AAJMS [Formerly IJMS] August 2020;3(3):159-190:ISSNe 2522-7386

182

56. Pua KH, Stiles DT, Sowa ME, Verdine GL. IMPDH2 Is an Intracellular Target of the Cyclophilin A and Sanglifehrin A Complex. Cell Rep. 18, 432–442 (2017).

57. Nakamura T, Yabe D, Kanazawa N, Tashiro K, Sasayama S, Honjo, T. Molecular cloning, characterization, and chromosomal localization of FKBP23, a novel FK506-binding protein with Ca2+-binding ability. Genomics 1998;54:89–98.

58. Soucy TA, Smith PG, Milhollen MA, Berger AJ, Gavin JM, Adhikari S, Brownell JE, et al. An inhibitor of NEDD8-activating enzyme as a new approach to treat cancer. Nature 2009;458:732–

736. 59. Carelli JD, Sethofer SG, Smith GA, Miller HR, Simard JL,

Merrick WC, et al. Ternatin and improved synthetic variants kill cancer cells by targeting the elongation factor-1A ternary complex. Elife 2015;4: e10222.

60. Cencic R, Desforges M, Hall DR, Kozakov D, Du Y, Min J, et al. Blocking eIF4E-eIF4G interaction as a strategy to impair coronavirus replication. J. Virol. 85, 6381–6389 (2011).

Reich SH, Sprengeler PA, Chiang GG, Appleman JR, Chen J, Clarine J, et al. Structure-based Design of Pyridone-Aminal eFT508 Targeting Dysregulated Translation by Selective Mitogen-activated Protein Kinase Interacting Kinases 1 and 2 (MNK1/2) Inhibition. J Med Chem. 2018;61:3516–3540.

62. Xu Y, Poggio M, Jin HY, Shi Z, Forester CM, Wang Y, et al. Translation control of the immune checkpoint in cancer and its therapeutic targeting. Nat Med. 2019;25:301–311.

63. Mackman RL, Steadman VA, Dean DK, Jansa P, Poullennec KG, Appleby T, et al. Discovery of a Potent and Orally Bioavailable Cyclophilin Inhibitor Derived from the Sanglifehrin Macrocycle. J Med Chem. 2018;61:9473–9499.

64. Rutaganira FU, Fowler ML, McPhail JA, Gelman MA, Nguyen K, Xiong A, et al. Design and Structural Characterization of Potent and Selective Inhibitors of Phosphatidylinositol 4 Kinase IIIβ. J

Med Chem. 2016;59:1830–1839. 65. Shah PS, Link N, Jang GM, Sharp PP, Zhu T, Swaney DL, et al.

Comparative Flavivirus-Host Protein Interaction Mapping Reveals Mechanisms of Dengue and Zika Virus Pathogenesis. Cell 2018;175:1931–1945.e18.

AAJMS [Formerly IJMS] August 2020;3(3):159-190:ISSNe 2522-7386

183

66. Ma J, Wu S, Zhang X, Guo F, Yang K, Guo J, et al. Ester Prodrugs of IHVR-19029 with Enhanced Oral Exposure and Prevention of Gastrointestinal Glucosidase Interaction. ACS Med. Chem. Lett. 2017;8:157–162.

67. Ma J, Zhang X, Soloveva V, Warren T, Guo F, Wu S, et al. Enhancing the antiviral potency of ER α-glucosidase inhibitor IHVR-19029 against hemorrhagic fever viruses in vitro and in vivo. Antiviral Res. 2018;150:112–122.

68. Michaud A, Williams TA, Chauvet MT, Corvol P. Substrate dependence of angiotensin Iconverting enzyme inhibition: captopril displays a partial selectivity for inhibition of N-acetyl-seryl-aspartyllysyl-proline hydrolysis compared with that of angiotensin I. Mol Pharmacol. 1997;51:1070–1076.

69. Natesh R, Schwager SLU, Sturrock ED, Acharya KR. Crystal structure of the human angiotensin-converting enzyme-lisinopril complex. Nature 2003;421:551–554.

70. Hoffmann M, Weber HK, Kruger N, Muller M, Drosten C, Pohlmann S. The novel coronavirus 2019 (2019-nCoV) uses the SARS-coronavirus receptor ACE2 and the cellular protease TMPRSS2 for entry into target cells. bioRxiv 2020.01.31.929042.

71. Kawase M, Shirato K, van der Hoek L, Taguchi F, Matsuyama S. Simultaneous treatment of human bronchial epithelial cells with serine and cysteine protease inhibitors prevents severe acute respiratory syndrome coronavirus entry. J Virol. 2012;86:6537–

6545. 72. Yamamoto M, Yamamoto M, Matsuyama S, Li X, Takeda M,

Kawaguchi Y, et al. Identification of Nafamostat as a Potent Inhibitor of Middle East Respiratory Syndrome Coronavirus S Protein-Mediated Membrane Fusion Using the Split-Protein-Based Cell-Cell Fusion Assay. Antimicrob. Agents Chemother. 2016;60:6532–6539.

73. Kandasamy J, Atia-Glikin D, Shulman E, Shapira K, Shavit M, Belakhov V, et al. Increased selectivity toward cytoplasmic versus mitochondrial ribosome confers improved efficiency of synthetic aminoglycosides in fixing damaged genes: a strategy for treatment of genetic diseases caused by nonsense mutations. J Med Chem. 2012;55:10630–10643.

AAJMS [Formerly IJMS] August 2020;3(3):159-190:ISSNe 2522-7386

184

74. Martin TD, Cook DR, Choi MY, Li MZ, Haigis KM, Elledge SJ, et al. A Role for Mitochondrial Translation in Promotion of Viability in K-Ras Mutant Cells. Cell Rep. 2017:20:427–438.

75. Nagiec EE, Wu L, Swaney SM, Chosay JG, Ross DE, Brieland JK, et al. Oxazolidinones inhibit cellular proliferation via inhibition of mitochondrial protein synthesis. Antimicrob Agents Chemother. 2005;49:3896–3902.

76. Mulangu S, Dodd LE, Davey RT, Tshiani Mbaya O, Proschan M, Mukadi D, et al. A randomized, controlled trial of Ebola virus disease therapeutics. N Engl J Med. 2019;381:2293–2303.

77. Sheahan TP, Sims AC, Graham RL, Menachery VD, Gralinski LE, Case JB, et al. Broad-spectrum antiviral GS-5734 inhibits both epidemic and zoonotic coronaviruses. Sci Trans Med. 2017; 9: eaal3653.

78. Agostini ML, Andres EL, Sims AC, Graham RL, Sheahan TP, Lu X, et al. Coronavirus Susceptibility to the Antiviral Remdesivir (GS-5734) Is Mediated by the Viral Polymerase and the Proofreading Exoribonuclease. mBio 2018;9(2): e00221-18.

79. Wang M, Cao R, Zhang L, Yang X, Liu J, Xu M, et al. Remdesivir and chloroquine effectively inhibit the recently emerged novel coronavirus (2019-nCoV) in vitro. Cell Res. 2020; 30:269–271.

80. Holshue ML, DeBolt C, Lindquist S, Lofy KH, Wiesman J, Bruce H, et al. First Case of 2019 Novel Coronavirus in the United States. New Engl J Med. 2020;382:929–936.

81. Furuta Y, Komeno T, Nakamura T. Favipiravir (T-705), a broad spectrum inhibitor of viral RNA polymerase. Proc Jpn Acad Ser. B 2017;93:449–463.

82. Wagstaff KM, Sivakumaran H, Heaton SM, Harrich D, Jans DA. Ivermectin is a specific inhibitor of importin alpha/beta-mediated nuclear import able to inhibit replication of HIV-1 and dengue virus. Biochem J. 2012;443:851–856.

83. Yang SNY, Atkinson SC, Wang C, Lee A, Bogoyevitch MA, Borg NA, Jans DA. The broad spectrum antiviral ivermectin targets the host nuclear transport importin alpha/beta1 heterodimer. Antiviral Res 2020;104760.

84. Caly L, Wagstaff K, Jans DA. Nuclear trafficking of proteins from RNA viruses: Potential target for antivirals? Antivir Res. 2012;95:202–206.

AAJMS [Formerly IJMS] August 2020;3(3):159-190:ISSNe 2522-7386

185

85. Caly L, Druce JD, Catton MG, Jans DA, Wagstaff KM. The FDA-approved Drug Ivermectin inhibits the replication of SARS-CoV-2 in vitro. Antivir. Res. 2020;104787.

86. Cao B, Wang Y, Wen D, Liu W, Wang J, Fan G, et al. A Trial of Lopinavir–Ritonavir in Adults Hospitalized with Severe Covid-19. New Engl J Med. 2020. NEJM.org.

87. Vanessa Monteil HK, Patricia P, Astrid H, Reiner A, Wimmer MS, Alexandra L, et al. Inhibition of SARS-CoV-2 infections in engineered human tissues using clinical-grade soluble human ACE2. Cell Press 2020.

88. Khan A, Benthin C, Zeno B, Albertson TE, Boyd J, Christie JD, et al. A pilot clinical trial of recombinant human angiotensin-converting enzyme 2 in acute respiratory distress syndrome. Crit Care 2017;21(1):234.

89. Savarino A, Boelaert JR, Cassone A, Majori G, Cauda R. Effects of chloroquine on viral infections: An old drug against today’s

diseases. Lancet Infect Dis. 2003;3:722–727. 90. Vincent MJ, Bergeron É, Benjannet S, Erickson BR, Rollin P,

Ksiazek TG, et al. Chloroquine is a potent inhibitor of SARS coronavirus infection and spread. Virol J 2005;2:69.

91. Gautret P, Lagier JC, Parola P, Hoang VT, Meddeb L, Mailhe M, et al. Hydroxychloroquine and azithromycin as a treatment of COVID-19: Results of an open-label non-randomized clinical trial. Int. J. Antimicrob. Agents 2020;105949.

92. Molina JM, Delaugerre C, Goff JL, Mela-Lima B, Ponscarme D, Goldwirt L, de Castro N. No benefit of hydroxychloroquine and azithromycin in people hospitalised with COVID-19. Med Mal Infect. 2020. pii: S0399-077X(20)30085-8.

93. Kadam RU, Wilson IA. Structural basis of influenza virus fusion inhibition by the antiviral drug Arbidol. Proc Natl Acad Sci. USA 2016;114:206–214.

94. Chen C, Huang J, Cheng Z, Wu J, Chen S, Zhang Y, et al. Favipiravir versus Arbidol for COVID-19: A Randomized Clinical Trial. medRxiv 2020.

95. Chen J, Lau YF, Lamirande EW, Paddock CD, Bartlett JH, Zaki SR, et al. Cellular Immune Responses to Severe Acute Respiratory Syndrome Coronavirus (SARS-CoV) Infection in Senescent BALB/c Mice: CD4+ T Cells Are Important in Control of SARS-CoV Infection. J Virol. 2009;84:1289–1301.

AAJMS [Formerly IJMS] August 2020;3(3):159-190:ISSNe 2522-7386

186

96. Cinatl J, Morgenstern B, Bauer G, Chandra P, Rabenau H, Doerr HW. Treatment of SARS with human interferons. Lancet 2003; 362:293–294.

97. Sheahan TP, Sims AC, Leist SR, Schäfer A, Won J, Brown AJ, et al. Comparative therapeutic efficacy of remdesivir and combination lopinavir, ritonavir, and interferon beta against MERS-CoV. Nat Commun. 2020;11:1–14.

98. Lee JW, Gupta N, Serikov V, Matthay MA. Potential application of mesenchymal stem cells in acute lung injury. Expert Opin Boil. 2009;9:1259–1270.

99. Li Y, Xu J, Shi W, Chen C, Shao Y, Zhu L, et al. Mesenchymal stromal cell treatment prevents H9N2 avian influenza virus-induced acute lung injury in mice. Stem Cell Res. 2016;7:159.

100. Jolles S, Sewell WAC, Misbah SA. Clinical uses of intravenous immunoglobulin. Clin Exp Immunol. 2005;142:1–11.

101. Zhou G, Zhao Q. Perspectives on therapeutic neutralizing antibodies against the Novel Coronavirus SARS-CoV-2. Int J Boil Sci. 2020;16:1718–1723.

102. Love JC, Gupta NT, Ogunniyi AO, Zimnisky RM, Qian F, Yao Y, et al. Neutralizing antibodies against West Nile virus identified directly from human B cells by single-cell analysis and next generation sequencing. Integr Boil. 2015;7:1587–1597.

103.Guo RF, Ward PA. Role of c5a in inflammatory responses. Ann Rev Immunol. 2005;23:821–852.

104. Voiriot G, Razazi K, Amsellem V, Van Nhieu JT, Abid S, Adnot S, et al. Interleukin-6 displays lung anti-inflammatory properties and exerts protective hemodynamic effects in a double-hit murine acute lung injury. Respir Res. 2017:18:64.

105. Herold T, Jurinovic V, Arnreich C, Hellmuth JC, Bergwelt-Baildon M, Klein M, et al. Level of IL-6 predicts respiratory failure in hospitalized symptomatic COVID-19 patients. medRxiv 2020.

106. Rose-John S, Waetzig GH, Scheller J, Grotzinger J, Seegert D. The IL-6/sIL-6R complex as a novel target for therapeutic approaches. Expert Opin. Ther Targets 2007;11:613–624.

107. Rose-John S. IL-6 Trans-Signaling via the Soluble IL-6 Receptor: Importance for the Pro-Inflammatory Activities of IL-6. Int J Boil Sci. 2012;8:1237–1247.

AAJMS [Formerly IJMS] August 2020;3(3):159-190:ISSNe 2522-7386

187

108. Shirley M, Deeks ED. Sarilumab: A Review in Moderate to Severe Rheumatoid Arthritis. Drugs 2018;78:929–940.

109. Vargesson, N. Thalidomide-induced teratogenesis: History and mechanisms. Birth Defects Res. Part C. Embryo Today Rev. 2015;105:140–156.

110. Zhu H, Shi X, Ju D, Huang H, Wei W, Dong, X. Anti-Inflammatory Effect of Thalidomide on H1N1 Influenza Virus-Induced Pulmonary Injury in Mice. Inflamm. 2014;37:2091–

2098. 111. Pelletier D, Hafler DA. Fingolimod for Multiple Sclerosis. New

Engl J Med. 2012;366:339–347. 112. Thickett D, Armstrong L, Christie SJ, Millar AB. Vascular

Endothelial Growth Factor May Contribute to Increased Vascular Permeability in Acute Respiratory Distress Syndrome. Am J Respir Crit Care Med. 2001;164:1601–1605.

113. Sheahan TP, Sims AC, Zhou S, Graham RL, Pruijssers AJ, Agostini ML, et al. An orally bioavailable broad-spectrum antiviral inhibits SARS-CoV-2 in human airway epithelial cell cultures and multiple coronaviruses in mice. Science Translational Medicine 2020:12(541): eabb5883.

114. Gao J, Tian Z, Yang X. Breakthrough: Chloroquine phosphate has shown apparent efficacy in treatment of COVID-19 associated pneumonia in clinical studies. Biosci Trends 2020;14: 72–73.

115.McKee EE, Ferguson M, Bentley AT, Marks TA. Inhibition of mammalian mitochondrial protein synthesis by oxazolidinones. Antimicrob Agents Chemother.2006; 50:2042–2049.

116. Skrtić M, Sriskanthadevan S, Jhas B, Gebbia M, Wang X, Wang Z, et al. Inhibition of mitochondrial translation as a therapeutic strategy for human acute myeloid leukemia. Cancer Cell 2011;20:674–688.

117. Zhou Y, Hou Y, Shen J, Huang Y, Martin W, Cheng F. Network-based drug repurposing for novel coronavirus 2019-nCoV/SARS-CoV-2. Cell Discov 2020;6:14–18.

118. Gallawy E. The race for coronavirus vaccines: a graphical guide. Nature 2020;580:576-577.

119. Le TT, Andreadakis Z, Kumar A, Roman RG, Tollfsen S, Saville M, et al. The COVID-19 vaccine development landscape. Nature

AAJMS [Formerly IJMS] August 2020;3(3):159-190:ISSNe 2522-7386

188

Review Drug Discovery, 9 April, 2020. https://www.nature.com/articles/d41573-020-00073-5

120. Mahase E. Covid-19: What do we know so far about a vaccine? BMJ 2020;369:m1679 doi: 10.1136/bmj.m1679.

121. Chappell K, Watterson D, Young P. Rapid response pipeline for stabilized subunit vaccines. In Proceedings of the Vaccine Technology VII, Mont Tremblant, QC, Canada, 17–22 June 2018.

122. Al-Halifa S, Gauthier L, Arpin D, Bourgault S, Archambault D. Nanoparticle-Based Vaccines Against Respiratory Viruses. Front Immunol. 2019;10:22.

123. Lan L, Xu D, Ye G, Xia C, Wang S, Li Y, Xu H. Positive RT-PCR Test Results in Patients Recovered From COVID-19. JAMA 2020.

124. https://thefly.com/landingPageNews.php?id=3065899&headline =ONCS-OncoSec-jumps-as-traders-circulate-CORVax-vaccine-fact-sheet. https://www.who.int/blueprint/priority-diseases/key-action/Novel_Coronavirus_Landscape_nCoV_11April2020.PDF

125. WHO. DRAFT landscape of COVID-19 candidate vaccines – 30 April 2020. https://www.who.int/who-documents-detail/draft-landscape-of-covid-19-candidate-vaccines (Accessed 2/5/2020).

126. Schwarz S, Wang K, Yu W, Sun B, Schwarz W. Emodin inhibits current through SARS-associated coronavirus 3a protein. Antiviral Res. 2011 Apr;90(1):64-9. doi: 10.1016/j.antiviral.2011.02.008. Epub 2011 Feb 26. PMID: 21356245; PMCID: PMC7114100.

127. Zhang L, Lin D, Kusov Y, Nian Y, Ma Q, Wang J, et al. α-Ketoamides as Broad-Spectrum Inhibitors of Coronavirus and Enterovirus Replication: Structure-Based Design, Synthesis, and Activity Assessment. J Medicinal Chemistry, 2020;acs. jmedchem. 9b01828.

128. Russell B, Moss C, George G, Santaolalla A, Cope A, Papa S, Van Hemelrijck M. Associations between immune-suppressive and stimulating drugs and novel Covid-19 – a systematic review of current evidence ecancer 14 1022 https://doi.org/10.3332/ ecancer.2020.1022.

129. Matsuyama S, Kawase M, Shimojima M, Fuku S, Ujike M, Kamitani W, et al. The inhaled corticosteroid ciclesonide blocks

AAJMS [Formerly IJMS] August 2020;3(3):159-190:ISSNe 2522-7386

189

coronavirus RNA replication by targeting viral NSP15. bioRxiv 2020:03.11.987016.

130. Sheahan TP, Sims AC, Graham RL, Menachery VD, Gralinski LE, Case JB, et al. Broad-spectrum antiviral GS-5734 inhibits both epidemic and zoonotic coronaviruses Sci Transl Med. 2017; 9(396): doi:10.1126/scitranslmed.aal3653.

131. Sheahan T, Sims A, Leist S, Schäfer A, Won J, Brown A, et al. Comparative therapeutic efficacy of remdesivir and combination lopinavir, ritonavir, and interferon beta against MERS-CoV. Nature Communications. 2020;11:222. 10.1038/s41467-019-13940-6.

132. Chhikara BS, Rathi B, Singh J, Poonam G. Corona virus SARS-CoV-2 disease COVID-19: Infection, prevention and clinical advances of the prospective chemical drug therapeutics. Chem Biol Lett. 2020;7(1):63‐72.

133. Chang Y, Tung Y, Lee K, Chen T, Hsiao Y, Chang H, et al. Potential Therapeutic Agents for COVID-19 Based on the Analysis of Protease and RNA Polymerase Docking. Preprints 2020, 2020020242. (doi: 10.20944/preprints202002.0242.v1).

134. Singh J, Chhikara BS. Comparative global epidemiology of HIV infections and status of current progress in treatment. Chem Biol

Lett 2014;1(1):14–32. 135. Yao TT, Qian JD, Zhu YZ, Wang Y, Wang GQ. A Systematic

Review of Lopinavir Therapy for SARS Coronavirus and MERS Coronavirus-A Possible Reference for Coronavirus Disease-19 Treatment Option. J Med Virol. 2020;10.1002 /jmv.25729.

136. Lim J, Jeon S, Shin HY, Kim MJ, Seong YM, Lee WJ, et al. Case of the index patient who caused tertiary transmission of coronavirus disease 2019 in Korea: The application of lopinavir/ritonavir for the treatment of COVID-19 pneumonia monitored by quantitative RT-PCR. J Korean Med. Sci.2020, 35 (6), e79–e79.

137. Chhikara BS, Varma RS. Nanochemistry and Nanocatalysis Science: Research advances and future perspective. J Mater Nanosci. 2019;6(1):1–6.

138. Tian X, Li C, Huang A, Xia S, Lu S, Shi Z, et al. Potent binding of 2019 novel coronavirus spike protein by a SARS coronavirus-

AAJMS [Formerly IJMS] August 2020;3(3):159-190:ISSNe 2522-7386

190

specific human monoclonal antibody. Emerg. Microbes Infect. 2020;9(1):382–385.

139. de Wilde AH, Zevenhoven-Dobbe , Meer Y, Thiel V, Narayanan K, Makino S, et al. Cyclosporin A inhibits the replication of diverse coronaviruses. J Gen Virol 2011;92:2542-8.

140. Muller C, Karl N, Ziebuhr J, Pleschka S. D. L-lysine acetyldsalicylate+glycine impairs coronavirus replication. J Antivir Antiretrovir 2016;8(4):142-50.

141. Talluri S. Virtual High Throughput Screening Based Prediction of Potential Drugs for COVID-19. Preprints 2020;2020020418 (doi: 10.20944/preprints202002.0418.v1).

142. Daniel Batlle, Jan Wysocki, Karla Satchell; Soluble angiotensin-converting enzyme 2: a potential approach for coronavirus infection therapy?. Clin Sci (Lond) 2020; 134 (5): 543–545.

143. Mitchell CA, Ramessar K, O'Keefe BR. Antiviral lectins: Selective inhibitors of viral entry. Antiviral Res. 2017;142:37-54.

144. te Velthuis AJ, van den Worm SH, Sims AC, Baric RS, Snijder EJ, van Hemert MJ. Zn(2+) inhibits coronavirus and arterivirus RNA polymerase activity in vitro and zinc ionophores block the replication of these viruses in cell culture. PLoS Pathog. 2010;6(11):e1001176.

145.Kruse RL. Therapeutic strategies in an outbreak scenario to treat the novel coronavirus originating in Wuhan, China. F1000Res. 2020 Jan 31;9:72. doi: 10.12688/f1000research.22211.2. PMID: 32117569; PMCID: PMC7029759.

146.Sawikowska A. Meta-analysis of flavonoids with antiviral potential against coronavirus. Biometrical Letters.2020; 10.2478/bile-2020-0002.

147. Bryner J. Flu drug used in Japan shows promise in treating COVID-19.live Science, 18/3/2020. https://www.livescience. com/flu-drug-could-treat-coronavirus.html

148.Chen C, Huang J, Cheng Z, Wu J, Chen S, Zhang Y, et al. Favipiravir versus Arbidol for COVID-19: A Randomized Clinical Trial.

https://www.medrxiv.org/content/10.1101/2020.03.17. 20037432 v1.full.pd

AAJMS [Formerly IJMS] August,2020;3(3):191-197;ISSNe 2522-7386

191

BOOK REVIEW Mohamed Almoustafa Alsamarai, Laboratory Investigation Department, Samara University College of Applied Sciences (SUCOAS), Samara, Iraq. Email: mohamedalmoustafaa@gmail.com Mobile: +9647718814092 ORCID: http://orcid.org/0000-0002-3051-725X DOI: https://doi.org/10.32441/aajms.3.3.12

Coronavirus Disease 2019 (COVID-19): Epidemiology, Pathogenesis, Diagnosis, and Therapeutics Editors: Saxena, Shailendra K. (Ed.) Publication year: 2020 ISBN: 978-981-15-4814-7 Publisher: Springer

Coronavirus Disease 2019 (COVID-19) book provides a comprehensive overview of recent novel coronavirus (SARS-CoV-2) infection, their biology and associated challenges for their treatment and prevention of novel Coronavirus Disease 2019 (COVID-19). Discussing various aspects of COVID-19 infection, including global epidemiology, genome organization, immunopathogenesis, transmission cycle, diagnosis, treatment, prevention, and control strategies, it highlights host-pathogen interactions, host immune

AAJMS [Formerly IJMS] August,2020;3(3):191-197;ISSNe 2522-7386

192

response, and pathogen immune invasion strategies toward developing an immune intervention or preventive vaccine for COVID-19. An understanding of the topics covered in the book is imperative in the context of designing strategies to protect the human race from further losses and harm due to SARS-CoV-2 infection causing COVID-19. The information presented in this book forms a standard knowledge for physicians, biologists, microbiologist, virologists, immunologists and students of medical, dentistry, nursing, and laboratory investigation colleges. This book: provides collated information on novel coronavirus (SARS-CoV-2)

biology, including replication, genetics, and pathogenesis. Discusses the pathogenesis of various emerging and re-emerging

SARS coronaviruses Summarizes prevention with potential therapeutics against novel

SARS-CoV-2 and COVID-19. Highlights prevention and control strategies for COVID-19 and

novel SARS-CoV-2 infection Reviews the host-pathogen interaction, host immune response and

clinical manifestation of the human Coronavirus disease COVID-19

Table of contents The book included 17 chapters. Chapter 1. Current Insight into the Novel Coronavirus Disease 2019 (COVID-19). Pages 1-8; Saxena, Shailendra K. et al. Chapter 2. Trends in Epidemiology of Coronavirus Disease 2019 (COVID-19). Pages 9-21; Srivastava Nishant et al. Chapter 3. Morphology, Genome Organization, Replication and Pathogenesis of Severe Acute Respiratory Syndrome Coronavirus 2 (SARS-CoV-2). Pages 23-32. Kumar, S et al. Chapter 4. Transmission Cycle of SARS-CoV and SARS-CoV-2. Pages 33-42. Yadav, T et al. Chapter 5. Host Immune Response and Immunobiology of Human SARS- CoV-2 Infection. Pages 43-53. Kumar, S et al. Chapter 6. Clinical Characteristics and Differential Clinical Diagnosis of Novel Coronavirus Disease 2019 (COVID-19). Pages 55-70. Sharma R et al. Chapter 7. Coronavirus Infection among Children and Adolescents. Pages 71-79.Kar SK et al.

AAJMS [Formerly IJMS] August,2020;3(3):191-197;ISSNe 2522-7386

193

Chapter 8.COVID-19: An Ophthalmological Update. Pages 81-93. Ankita, et al. Chapter 9. Laboratory Diagnosis of Novel Coronavirus Disease 2019 (COVID-19) Infection. Pages 95-107. Padhi A et al Chapter 10. Therapeutic Development and Drugs for the Treatment of

COVID-19. Pages 109-126. Maurya VK et al Chapter 11. Prevention and Control Strategies for SARS-CoV-2 Infection. Pages 127-140. Srivastava N, et al Chapter 12. Classical Coronaviruses. Pages 141-150. Jaiswal NK et al.

Chapter 13. Emergence and Reemergence of Severe Acute Respiratory Syndrome (SARS) Coronaviruses. Pages 151-163. Baxi P et al Chapter 14. Preparing for the Perpetual Challenges of Pandemics of Coronavirus Infections with Special Focus on SARS-CoV-2. Pages 165-186. Chawla S et al. Chapter 15. Preparing Children for Pandemics. Pages 187-198. Saxena R et al

Chapter 16. Coping with Mental Health Challenges during COVID-19. Pages 199-213. Kar SK et al. Chapter 17. Correction to: Transmission Cycle of SARS-CoV-2. Pages C1- C1. Yadav T et al.

AAJMS [Formerly IJMS] August,2020;3(3):191-197;ISSNe 2522-7386

194

Cytokine Storm Syndrome

Editors: Cron, Randy, Behrens, Edward M. (Eds.) Publisher: Springer Publication year: 2019 ISBN: 978-3-030-22094-5 The Cytokine Storm Syndrome (CSS) book provides the fundamental basic and applied clinical science at the cutting edge of CSS treatment First textbook devoted to Cytokine Storm Syndromes, covering all aspects of the disorder (clinical, genetics, pathophysiology, associations, therapy, and others). The contributor's authors are international experts in cytokine storm syndrome. The CSS (including HLH and MAS), are frequently fatal disorders, particularly if not recognized early and treated during presentation. The genetics of Cytokine Storm Syndromes are being defined with many of the risk alleles giving rise to mutations in the performing-mediated cytolytic pathway used by CD8 cytotoxic T cells and natural killer cells. These are being studied using murine models. Up to 10% of the general population may carry risk alleles for developing Cytokine Storm Syndromes, and Cytokine Storm Syndromes are being increasingly recognized around the world in pediatric and adult hospitals. A variety of infectious, rheumatic, and oncologic triggers are commonly associated with Cytokine Storm Syndromes, but understanding this

AAJMS [Formerly IJMS] August,2020;3(3):191-197;ISSNe 2522-7386

195

disorder is critical for all researchers and physicians to ensure timely and appropriate therapy. This textbook, the first of its kind, addresses all aspects of the disorder – from genetics, pathophysiology, and ongoing research, to clinical presentations, risk factors, and treatment. Recently COVID-19 infection is associated with fatal CSS and thus this text book provides information for all who deal with COVID-19 pandemic. Table of contents (35 chapters)

Chapter 1. History of Hemophagocytic Lymphohistiocytosis, Pages 3-16; Janka, Gritta E. Chapter 2. The History of Macrophage Activation Syndrome in Autoimmune Diseases. Pages 17-29. Silverman, Earl D Chapter 3. Clinical Features of Cytokine Storm Syndrome. Pages 31-41. Shimizu, Masaki Chapter 4. Laboratory Features and Pathology of the Cytokine Storm

Syndrome. Pages 43-59 Chapter 5. Criteria for Cytokine Storm Syndromes. Pages 61-79. Minoia, Francesca et al. Chapter 6. Genetics of Primary Hemophagocytic Lymphohistiocytosis. Pages 83-111.Karageorgos, Spyridon et al. Chapter 7. Genetic of Acquired Cytokine Storm Syndromes. Pages 113-129. Schulert Grant S. et al. Chapter 8. Genetics of Macrophage Activation Syndrome in Systemic

Juvenile Idiopathic Arthritis. Pages 131-138. Grom, Alexei A. Chapter 9. CD8+ T Cell Biology in Cytokine Storm. Syndromes. Pages 141-161. Sekine, Takuya et al. Chapter 10. Immunology of Cytokine Storm Syndromes: Natural Killer Cells. Pages 163-181. French, Anthony R. et al. Chapter 11. Myeloid Cells in the Immunopathogenesis of Cytokine Storm Syndromes. Pages 183-195. Weaver, Lehn K Chapter 12. Cytokines in Cytokine Storm Syndrome. Pages 197-207. Behrens, Edward M. Chapter 13. Primary Immunodeficiencies and Cytokine Storm Syndromes. Pages 209-232. Hill, David A, et al.

Chapter 14. Infectious Triggers of Cytokine Storm Syndrome: Herpes Virus Family (Non-EBV). Pages 235-252. Dulek, Daniel, et al.

AAJMS [Formerly IJMS] August,2020;3(3):191-197;ISSNe 2522-7386

196

Chapter 15. Cytokine Storm Syndromes Associated with Epstein-Barr Virus. Pages 253-276. Verbest, Katherine C. et al.

Chapter 16. Cytokine Storm Syndrome Associated with Hemorrhagic Fever and other Viruses. Page 277-297. Sen, Ethan S. et al.

Chapter 17. Cytokine Storm Syndrome as Manifestation of Primary HIV Infection. Pages 299-306. Erdmann, Nathan et al.

Chapter 18. Bacteria-Associated Cytokine Storm Syndrome. Pages 307-317. Eloseily, Esraa M. et al.

Chapter 19. Zoonotic Bacterial Infections Triggering Cytokine Storm Syndrome. Pages 319-330. Otrock, Zaher K, et al.

Chapter 20. Parasitic and Fungal Triggers. Pages 331-345. Sterba , Gary, et al.

Chapter 21. Cytokine Storm Syndrome Associated with Systemic Juvenile Idiopathic Arthritis. Pages 349-379. Schneider, Rayfal, et al.

Chapter 22. Systemic Lupus Erythematosus and Cytokine Storm. Pages 381-391. Caricchio, Roberto.

Chapter 23. Kawasaki Disease- Associated Cytokine Storm Syndrome. Pages 393-406. Ulloa-Gutierrez, Ronaldo.

Chapter 24. The Intersection of Autoinflammation and Cytokine Storm. Pages 407-421. Canna, Scott W.

Chapter 25. Macrophage Activation Syndrome in the Setting of Rheumatic Diseases. Pages 423-434. Chatham, WW.

Chapter 26. Hemophagocytic Lymphohistocytosis in the Context of Hematological Malignancies and Solid Tumors. Pages 437-449. Lehmberg, Kai.

Chapter 27. Cytokine Storm and Sepsis-Induced Multiple Organ Dysfunction Syndrome. Pages 451-464. Carcillo, Joseph A. et al.

Chapter 28. Murine Models of Familial Cytokine Storm Syndromes. Pages 467-489. Volkmer, Benjamin et al.

Chapter 29. Murine Models of Secondary Cytokine Storm Syndromes. Pages 491-518. Brisse, Ellen et al.

Chapter 30. Etoposide Therapy of Cytokine Storm Syndromes. Pages 521-547. Henter, Jan-Inge et al.

Chapter 31. IL-1 Family Blockade in Cytokine Storm Syndromes. Pages 549-559. Cron, Randy Q.

AAJMS [Formerly IJMS] August,2020;3(3):191-197;ISSNe 2522-7386

197

Chapter 32. IL-6 Blockade in Cytokine Storm Syndromes. Page 561-568.

Chapter 33. Anti-interferon-γ Therapy for Cytokine Storm

Syndromes. 569-580. De Benedetti, Fabrizio.

Chapter 34. Alternative Therapies for Cytokine Storm Syndromes. Pages 581-593. Ozen, Seza et al.

Chapter 35. Salvage Therapy and Allogenetic Hematopoietic Cell Transplantation for the severe Cytokine Storm Syndrome of Hemophagocytic Lymphohistiocytosis. Pages 595-606. Marsh, Rebecca A.

AAJMS [Formerly IJMS] August 2020;3(3):198-204;ISSNe 2522-7386

198

LETTER TO THE EDITOR

DOI: : https://doi.org/10.32441/aajms.3.3.13

Editor-in-Chief, AAJMS.

I should be grateful if you kindly publish this commenting letter in your esteemed journal, Aalborg Academy Journal of Medical Science, as a comment on the article entitled:

"الغدد الصم علم واسع وتسمية قاصرة.. تصريح اختصاصي", المنشور في

مجلة:

AAJMS [formerly IJMS] May, 2020;3(2):46-58. ISSNe 2522-7386

عند قراءة البحث أعلاه, الذي اتفق على مضمونه تسعة عشر

محترما, ذكروا أنهم يمثلون اثني عشر بلدا عربيا, طبيبا اختصاصيا

( والمملكة العربية 10ويعملون في الإمارات العربية المتحدة )

(, 1( والكويت )1( والبحرين )1( وعمان )2ا )( وسوري4السعودية )

وجدت أن خلاصة البحث أعلاه يمكن إيجازها فيما يأتي:

من المعاني اللغوية أو "الغدد الهرمونية ليست صماء بأي

وذكروا لرأيهم هذا عدة أسباب أذكر منها ",التشريحية أو الوظيفية

الآتي:

لأنها اكتفت بترجمة مقطع الترجمة الحرفية عن اليونانية قاصرة .1

واحد من الاسم المركب ولم تشر الى وجود الإفراز الداخلي.

هي ليست صماء بمعنى تشابهها مع فاقدي السمع فهي تتواصل .2 مع محيطها

هي ليست منعزلة عما حولها.... .3

AAJMS [Formerly IJMS] August 2020;3(3):198-204;ISSNe 2522-7386

199

ما يأتي:كمقالهم في وكانت توصياتهم الرائعة أو أنه إن وصف هذه الغدد بالصم يظهر عجزا في لغتنا

عجز في مجاراة تطورات العلم.

استخدام مصطلح "طب الغدد الهرمونية والاستقلاب" بديلا

منطقي لتسمية هذا الفرع من الاختصاص الباطني, يقصدون "علم الغدد الصم".

وفي الحقيقة أن زملاءنا المحترمين بالرغم من علو كعبهم في

ظموا المؤتمرات العالمية ودعونا إليها مهنهم وتخصصاتهم, وطالما ن

في سوريا )د. نبيل عسة وزملاؤه( وفي الإمارات )د. بشار الافندي

في هذا المبحث, وهو يقع في وزملاؤه(, إلا أن الخطأ كان جليا

موضعين رئيسين هما:

م( -1 فهم معنى كلمة )الص

(Endocrineترجمة كلمة ) -2

أولا: الخطأ في فهم كلمة الصم:م( هي جمع كلمة )أصم( التي تعني بالأساس إن كلمة )الص

)مغلق( أو )مسدود( ومنه )صمة القارورة أو صمامها(, تعني

ه صما( تعني )سده(, و)صمام )سدادها(, و)صم رأس القارورة يصم

القلب( يعني )سداده(. وفي العربية هناك ما يدعى بالاستعارة

, ولقد استعيرت كلمة )الأصم أو الصماء( كثيرا و صارت والمجاز

مجازا في مواضع عدة تدل جميعها على الانغلاق والانسداد ومنها

هذه الاستعارات والمجازات: الأصم )الذي لا يسمع لانسداد أذنيه

وهو الأطرش(, والأصم )الذي لا يهتدي من صمم العقل(, والأرض

بائنة الملامح(, والفتنة الصماء )التي لا سبيل الصماء )الغليظة غير

إلى تسكينها(. وكنا في مرحلة الدراسة المتوسطة يأتينا معلم التاريخ

الإسلامي بخرائط لم تكتب بها أية كلمة يسميها )الخرائط الصماء(

AAJMS [Formerly IJMS] August 2020;3(3):198-204;ISSNe 2522-7386

200

ويطلب منا في الامتحان أن نؤشر عليها اسماء المدن ومواقع المعارك

وبعض الأحداث.

للمعنى الأصلي م( بهذا الاسم وفقا ولقد سميت )الغدد الص

المعجمي لكلمة )أصم( وهو المغلق أو المسدود, فهي إذن )الغدد , ولم تسم كذلك لأنها طرش لا ductlessالمغلقة( لأنها لا قنوات لها

تسمع.

Endocrineثانيا: الخطأ في ترجمة المصطلح

يعني crine( من البحث أن المقطع 50) جاء في الصفحة

)منعزل( أو )متميز( وهذا خطأ ترجمي, وهو الخطأ الثاني في بحثهم.

crineيخبرنا بأن المقطع Etymology صحيح أن علم الإيتيمولجي

( أو )يتميز separateمتأت من الإغريقية ويعني )ينفصل

distinguish أخر مرادفا المترجمون أدركه(, لكن هناك لفظاينفرز( القريب من المعاني )ينفصل( و)ينعزل( ( وهو بدهاء العرب

و)يتميز( التي بنوا عليها نتائج البحث.

وعندما قام المترجمون العرب, وكلهم من أعضاء مجامع اللغة

إلى العربية Endocrine Glandsالعربية, بترجمة مصطلح

م(, أي Ductless)الغدد عديمة القنوات ترجموها إلى )الغدد الصGlands والحق أن هذه الترجمة موفقة وجميلة وعلمية وتنبئ .)

بشكل مباشر عن تشريح ووظيفة هذه الغدد, وهي أفضل من ترجمة

Endocrine Glands إلى )غدد الإفراز الداخلي( حيثEndo

تعني إفراز. crineتعني داخلي و

يعني إذن )إفراز( وليس )انعزال( أو crine إن المقطع اللاتيني

)تميز( ووراءه عشرات المصطلحات العلمية, وعلى سبيل المثال

( أي الإفراز الخارجي وهو ما يحدث في Exocrineالمصطلح )

التي تعني Eccrineالمفترز, و Apocrineالغدد ذات القنوات, و

و secreteالإفراز الخارجي أيضا. حتى الكلمتان الإنكليزيتان

excrete ( الاصل فيهما هو الجذرroot :)crine .

AAJMS [Formerly IJMS] August 2020;3(3):198-204;ISSNe 2522-7386

201

خلاصة تعقيبي هي:

م( Endocrineإن ترجمة مصطلح ) ( عربيا إلى )الغدد الص

م( يعني الغدد المسدودة ليست قاصرة, وإن مصطلح )الغدد الص

وليست )الفاقدة السمع(, وأن لغتنا "الرائعة" ليست بقاصرة بذاتها ولا

مجاراة تطورات العلم.في

أن الهرمونات لا تنفرز من الغدد لقد اكتشف الباحثون حديثا

الصم وحسب, بل إنها تنفرز أيضا من خلايا مفردة هنا وهناك في

, أو autocrineالجسم وتعمل الهرمونات التي تفرزها عليها ذاتها,

, ولكن ذلك لم paracrineأنها هرموناتها تعمل على خلايا قريبة منها

يدفعهم إلى تغيير مصطلح الغدد الصم بل جعلوا هذه المكتشفات

ذاته. Endocrinologyفرعية ضمن علم الغدد الصم

ختاما إذا كان لا بد من التغيير فلنستبدل مصطلح علم

, Endocrinologyبعلم الغدد الصم Hormonolgyالهرمونات

لية بتداول قليل. وهو اسم مستخدم في الشبكة الدو

Best regards Yours Sicerely Assistant Prof. Dr. Nabeel Najib Fadhil CABM, FRCP(London)

College of Medicine, Ninevah University Mosul, Iraq

AAJMS [Formerly IJMS] August 2020;3(3):198-204;ISSNe 2522-7386

202

رد من المؤلفينال السيد رئيس تحرير مجلة اكاديمية البورك للعلوم الطبية

ومتابعة المقالة المذكورة، ونشكر الدكتور نشكركم لنشر نبيل نجيب فاضل لاهتمامه ومراجعته العلمية الفاضل والصديق

واللغوية المتميزة التي أثرت الموضوع. وهنا ردي )باسم المجموعة(

.على ما تم ذكره في التعليق على المقالةة قرأنا باهتمام رد الأخ الكريم د. نبيل نجيب فاضل من كلي

الطب، جامعة نينوى في العراق الشقيق على مقالتنا المنشورة في

اكاديمية البورك للعلوم الطبية مجلة

AAJMS [formerly IJMS] May,2020;3(2):46-58. ISSNe .2522-7386

الغدد الصم "علم واسع وتسمية قاصرة" تصريح المعنونة:

.اختصاصي

المختصين بأمراض ونحن اذ نشكر له إطراءه على مجموعتنا من

الغدد الهرمونية والاستقلاب نود الرد بالتالي على ملاحظاته :الشخصية على المقال

لا شك أن اختيار كلمة )الصم( لوصف الغدد التي تفرز .١

الهرمونات كان إعجازا لغويا حيث لا ضرورة للإعجاز، ونحن

م بكل مازلنا نؤكد أن هذه الكلمة عاجزة، ولو جزئيا، عن الالماكنا قد راجعنا في مقالتنا المذكورة كل المعاني المحتملة التفاصيل.

لكلمة )صم( ومن مختلف المراجع المتوفرة، وذكرنا أن السبب

الأرجح لاستعمال هذه الصفة حصرا، هو كونها تشير إلى عدم وجود القنوات المفرزة، وذلك للتمييز بينها وبين الغدد التي تفرز عن طريق

.ت خاصةقنواأما بقية المعاني ومنها الانعزال والصلابة والكثافة وغيرها،

نوهنا أن صفة فكانت ضعيفة الحجة سهلة النقاش والدحض.

AAJMS [Formerly IJMS] August 2020;3(3):198-204;ISSNe 2522-7386

203

)الصمم( تستعمل لشرح المعنى حتى في بعض النوط لجامعة مازالت

تدرس باللغة العربية، مع وضوح عدد صحتها. هذا لا يعني باننا

الصم بانها صماء بمعني فاقدي السمع. ومن الممكن فهمنا معنى الغدد أن انتشار مدارس "الصم والبكم" هو أحد أسباب هذا الالتباس الشائع

في كل الأحوال، الغدد الهرمونية ليست مغلقة أبدا كما اعتقدنا سابقا،

وقد تكون على شكل خلايا متفرقة في الأمعاء والقلب والشرايين. وقد اصر على المستوى الجزيئي أن الهرمونات لا تنتقل أثبت الفهم المع

عن طريق الدم بالضرورة، وأنها قد تنتقل مباشرة إلى النسج

المجاورة عن طريق الامتصاص، وكذلك عن طريق معابر خاصة، .لتقوم بمفعول مباشر أو أنها تعمل في نفس الخلية التي تصنعها

ق بوجود معاني كثيرة مختلفة أما بالنسبة للترجمة عن اللاتينية، نتف .٢

ذكرت، وأخرى لم تذكر للمصدر اللاتيني. نوافق الدكتور فاضل بأن

وصف الغدد على أنها داخلية الإفراز كان أجدى من وصفها بالصم، ولكن يبدو أن الإصرار على استعمال كلمة )الصم( الغامضة والتي

تحتمل التأويلات لوصف الغدد التي تصنع وتفرز وتخزن

لهرمونات، كان أحد أسباب عدم الوضوح كنتيجة نهائية. في كل ا فقط، ولا هي مغلقة بمعنى الأحوال هذه الغدد لا تفرز داخليا

.الصمامة، كما أسلفت

ثم نعلم جميعا، وهذا ما ذكره الدكتور نبيل مشكورا، أن وجود .٣

كلمة هرمونات في التسمية قد يكون معبرا أكثر، فقد تسبب عدم ودها في زيادة غموض ماهية الاختصاص للمرضى الناطقين وج

واقترح الدكتور بالعربية، ولبعض الأطباء أيضا. وكما تفضل أيضا

نبيل أن يكون بديل التسمية لقب )علم الهرمونات( وهو مصطلح معقول جدا، وكان قد تم طرحه من قبل بعض أعضاء المجموعة،

غدد )الصم( الحالي يعالج أيضا ولكن المشكلة في ذلك أن اختصاص ال

لها علاقة بالغدة نفسها ولا يقتصر على تقييم وتصحيح أمراضا

AAJMS [Formerly IJMS] August 2020;3(3):198-204;ISSNe 2522-7386

204

الهرمونات فقط، كأورام الغدة النخامية والكظرية وكذلك أورام الغدة

.الدرقية وعقدها، وغير ذلك

نؤكد مجددا، ليس الهدف الأساسي هو تغيير التسمية، بل هو فتح .٤

موضوع لم يطرح مسبقا، ومراجعة المقترحات باب النقاش في المطروحة لإيجاد مسمى بسيط ومفهوم للتخصص، ينصف رسالته

بدقة وشمولية. وكان من دواعي سرورنا أن درجة التجاوب من

زملائنا في الاختصاص فاقت التوقع حسب استبيان خاص، سيتم .نشره قريبا

ب استعراضا نؤكد هنا أن تسمية اختصاص طبي لا تستوج .٥

لإعجاز اللغة العربية، بل الأصل هو إعطاء تسمية مفهومة للجمهور

كما الحال في كل التخصصات الطبية الأخرى؟

نحن لا ننادي بتقليد الغرب واتباعهم، بل على العكس تماما، نحن .٦ .نأمل بالتميز عنهم وربما سبقناهم في هذه، دون غيرها

نا ليست عاجزة أبدا، ولا أحد يعتقد ذلك. نعم صديقي العزيز، لغت

لكننا لسنا مع اعطاء ألقاب إعجازية تعجيزية، غير دقيقة، يصعب

.على الجماهير فهمها، ويسهل الالتباس معها

.ونؤكد لك بأن حوارنا لن يفسد أي ود واحترام بيننا دمتم بكل ود

عن المجموعة د. بشار الأفندي

هوبكنزمشفى توام/ جونز /العين كلية الطب/ جامعة الإمارات

٥/٥/٢٠٢٠

AAJMS [Formerly IJMS] August, 2020;3(3):205-212;ISSNe 2522-7386

205

International Union of Arab Academics Aalborg Academy of Sciences

Aalborg Academy Journal of Medical Sciences [Formerly, International Journal of Medical Sciences]

ISSNe 2522-7386 Email: Ijma.iuaa18@gmail.com

Face book: International Journal of Medical Sciences. IUAA DOI: https://doi.org/10.32441/ijms.

Instructions for Authors 1. Introduction

The Aalborg Academy Journal of Medical Sciences [AAJMS], ISSN 2522-7386, is a peer-reviewed, 3 issues published annually. Authors are invited to submit for publication articles with a wide spectrum of coverage reporting original work, in the fields of medicine, nursery, dentistry, and pharmacy sciences. Review articles are usually by invitation only. However, Review articles of current interest and high standard will be considered. Prospective work should not be back dated. There are also sections for Case Reports, Brief Communication, correspondence and medical news items. Authors should read the editorial policy and publication ethics before submitting their manuscripts. Authors should also use the appropriate reporting guidelines in preparing their manuscripts.

2. Research Ethics

Studies involving human subjects should be conducted according to the World Medical Association (WMA) Declaration of Helsinki - Ethical Principles for Medical Research Involving Human Subjects. Studies involving non human animals should follow appropriate ethical guidelines such as the Animal Welfare Act, The Animals (Scientific Procedures) Act (Amendment) Order 1993, The EU parliament directive on the protection of animals used for scientific purposes, ARRP policies and guidelines, etc. 3. Reporting guideline

Responsible reporting of research studies, which includes a complete, transparent, accurate and timely account of what was done and what was found during a research study, is an integral part of good research and publication practice and not an optional extra.

Guidelines for Reporting Health Research

Authors submitting manuscripts on health research are encouraged to follow the appropriate reporting guidelines as stated by the Equator-Network in preparing their manuscripts.

AAJMS [Formerly IJMS] August, 2020;3(3):205-212;ISSNe 2522-7386

206

CONSORT Randomized controlled trials Checklist Flow Diagram

STROBE Observational studies in epidemiology Checklist PRISMA Systematic reviews and meta-analyses Checklist Flow Diagram

STARD Studies of diagnostic accuracy Checklist Flow Diagram

COREQ Qualitative research

ENTREQ Synthesis of qualitative research

SQUIRE Quality improvement in health care Checklist

CHEERS Economic evaluations of health interventions Checklist

CARE Case reports Checklist

SAMPL Basic statistical reporting

Authors should endeavor to address all items recommended by the guidelines (as a minimum). Adherence to recommended reporting guidelines will increase the probability of manuscripts to be accepted for publication.

The EQUATOR website provides a central repository of up-to-date reporting guidelines and other resources that assist authors to prepare a good research manuscript.

4. Submission of Manuscripts: Manuscripts, or the essence of their content, must be previously unpublished and should not be under simultaneous consideration by another journal. The authors should also declare if any similar work has been submitted to or published by another journal. By virtue of the submitted manuscript, the corresponding author acknowledges that all the co-authors have seen and approved the final version of the manuscript. The corresponding author should provide all co-authors with information regarding the manuscript, and obtain their approval before submitting any revisions. Participation solely in the acquisition of funding or the collection of data does not justify authorship. Manuscripts are only accepted for publication on the understanding that the authors will permit editorial amendments, though proofs will always be submitted to the corresponding author before being sent finally to press. The authors should be able to provide upon request the raw material of any study or the quality assurance assessment of any study under publication. To avoid any delay in processing manuscripts, prior to submission, all authors should refer to the STARD checklist for reporting of diagnostic accuracy studies, and comply with the guidelines. Prior to the initial submission of a new manuscript, please carefully

AAJMS [Formerly IJMS] August, 2020;3(3):205-212;ISSNe 2522-7386

207

consider that all authors’ names are included as no change to author’s details will be permitted after the initial submission.

Electronic submission of Manuscripts: Manuscripts can now be submitted

electronically via email (ms@aaosjournal.com; ijms.iuaa18@gmail.com) Electronic submission saves time and postage costs, and allows the manuscript to be handled in electronic form throughout the review process. However, Figures and Illustrations should be provided in jpeg format or authors may be asked to submit the illustrations on glossy paper whenever necessary. Upon acceptance of the manuscript for publication, authors are required to provide the original copy of the assignment of copyright dully signed by all authors.

Manuscript Preparation:

The type of article should determine the manuscript structure. However, the general structure for articles should follow the IMRAD structure. Manuscripts including tables, references and figure legends, must be typewritten (double-spaced) on 17X 24 cm or size A4 paper, with margins of at least 1 inch (2.5 cm). Pages should be numbered consecutively, beginning with the title page and continuing through the last page of typewritten material. One original and three photocopies of the entire manuscript should be submitted along with four sets of photographs. Manuscripts and figures for review will not be returned to authors whether the editorial decision is to accept, revise, or reject. The only exception will occur when the Editor returns a manuscript with handwritten editorial suggestions to authors to aid them in making revisions. Manuscripts must be accompanied by a covering letter signed by the author and all co-authors. All Case Reports must include at least one figure.

Title Page: The title phrase should be brief. The title page must contain (1) title of the article in English, (2) correct first name, middle initial and family name of each author plus highest degrees, not more than 2, in that specific order (3) any disclaimers, and (4) a short running title of no more than 40 characters (count letters and spaces). The second page should include IN ENGLISH (1) name and address of the department(s) and institution(s) from where the research was carried out for each author; affiliation address should be a record of where an author is currently working. If the study was previously carried out at another institute this should appears as “formerly of ....” (2) Current position and affiliation address for the corresponding author and (3) name, address, telephone number, fax number and E-mail address of author to whom correspondence should be sent if it differs from the first author. Review articles should consist of one or 2 authors, only Clinical Review or Meta-analysis may include multiple authors. Case Reports should preferably not exceed 4 authors.

Abstracts: Abstracts in English for Review articles and Case reports should be unstructured of not more than 150 words. All original articles must contain a

AAJMS [Formerly IJMS] August, 2020;3(3):205-212;ISSNe 2522-7386

208

structured abstract of not more than 250 words. The following are typical headings: Objectives (background), Methods (settings, design), including where and when the study took place, Results, Conclusion.

Introduction: The introductory section of Case Reports should always include the objective and reason why the author is presenting this case.

Methods: In studies of diagnostic accuracy, the methods section should include the inclusion and exclusion criteria of patients involved in the study together with information on patient recruitment.

Tables: Tables should be double spaced on a separate sheet of paper. Do not submit tables as photographs. Number tables consecutively in the order of their first citation in the text and supply a brief title for each. Give each column a short or abbreviated heading. Place explanatory matter in footnotes, not in the heading. Explain in footnotes all non-standard abbreviations that are used in each table. For footnotes use the following symbols, in this sequence *, †, ‡, §, **, ††, ‡‡, §§ etc. Bar graphs and pie charts should only be used where absolutely indicated and should be provided in color; where possible the information should be presented in table format.

Acknowledgment: Acknowledgment should conform to the Uniform Requirements for Biomedical Journals which states: List all contributors who do not meet the criteria for authorship, such as a person who provided purely technical help, writing assistance, or a department chair who provided only general support. Financial and material support should also be acknowledged. Groups of persons who have contributed materially to the paper but whose contributions do not justify authorship may be listed under a heading such as “clinical investigators” or “participating investigators,” and their function or contribution should be described, for example, “served as scientific advisors,” “critically reviewed the study proposal,” “collected data,” or “provided and cared for study patients.” Because readers may infer their endorsement of the data and conclusions, all persons must have given written permission to be acknowledged.

References: References should be numbered consecutively in the order in which they are first mentioned in the text, not alphabetically. References must be highlighted in bold throughout the text of the manuscript. List all authors when there are six or fewer; when there are seven or more, list only the first six and add “et al”. All references must be cited in the text or tables. Where references are cited in tables only, the first reference number used in the table should follow on numerically from the last reference number used in the main text of the article. Where previous

Studies are mentioned in a table the author’s names should appear in Vancouver style, with the names and reference numbers appearing in one column, and any other necessary information appearing in a separate column. Unpublished data and

AAJMS [Formerly IJMS] August, 2020;3(3):205-212;ISSNe 2522-7386

209

personal communications will not be accepted as references. Please try to avoid using conference papers or abstracts as references, these can only be allowed if published by journals included in Index Medicus or a well-known publishing company and are within one year from the submission date of the manuscript. Only 1-2 up to date references should be used for each particular point in the text. References to journal articles should include, in this order: (1) authors, (2) title, (3) journal name (as abbreviated in Index Medicus, if not included in Index Medicus journal title should be given in full), (4) year, (5) volume, (6) page numbers. Volume and edition numbers and specific page numbers should be included when appropriate. Secondary references are not acceptable.

The author is responsible for the accuracy and completeness of the references and for their correct textual citation. When a citation is referred to in the text by name, the accompanying reference must be from the original source. Upon acceptance of a paper all authors must be able to provide the full paper for each reference cited upon request at any time up to publication. Failure to do so may result in the paper being withdrawn from the journal. References must be formatted in Vancouver style as follows:-

Journal: Al Obaidi AH, Alsamarai AGM. Effect of acetaminophen and N- acetylcystine on biochemical markers in asthma. MEJFM 2007;5: 8-14.

Book Chapter: Jarvis D, Burney P. Epidemiology of asthma. In: Busse WW, Holgate ST, editors. Asthma and rhinitis. London: Blackwell Science Ltd; 2000. p. 17-33.

Review Articles should include an extended bibliography. Original Articles and Case Reports should include up to date references, preferably not exceeding 15 for Case Reports. Brief communication should include a maximum of 5 references. A small number of older landmark references can be included where appropriate.

Illustrations: Four copies of all figures or photographs should be included with the submitted manuscript, together with an electronic version of the figure saved in Adobe Photoshop on CD-ROM. Photographs must be high contrast, glossy, black and white prints, unmounted and untrimmed, with preferred size between 4 x 5 inches and 5 x 7 inches (10 x 13 cm and 13 x 18 cm). Photographs will also be accepted at the discretion of the Editorial Board. Figure number, name of corresponding author, and an arrow indicating “top” should be typed on a gummed label and affixed to the back of each illustration. All lettering, arrows, or other artwork must be done by an artist or draftsman. If arrows are used please ensure they appear in a different color to the background color. If arrows distinguish different items on the figure then different arrow styles should be used i.e. long, short, fat, slim. Graphs and charts must also be prepared professionally by an artist or draftsman and submitted on glossy paper. Do not write on the back of figures or scratch or mark them by using paper clips. Do not bend figures or mount them on cardboard. Written permission must accompany any photograph in which the

AAJMS [Formerly IJMS] August, 2020;3(3):205-212;ISSNe 2522-7386

210

subject can be identified or any illustration that has been previously published. All illustrations (“figures”) must be numbered as cited in the text in consecutive numeric order. With color illustrations, the author must bear part of the expense for color reproduction. Titles and detailed explanations belong in the legends for illustrations (on a separate sheet), not on the illustrations themselves.

The Journal will assume that informed consent for publication has been obtained from all identifiable subjects.

Abbreviations and symbols. Use only accepted international abbreviations. If during the editing process. Avoid abbreviations in the title and abstract. The full term for which an abbreviation stands should precede its first use in the text unless it is a standard unit of measurement. The following is a list of abbreviations which may be used without expansion. CD; CD-ROM; DDT; DNA; DOS; EDTA; F; HLA; ISSN; Nd:YAG; OD; OS; OU; PaCO2; PaO2; PAO2; PCO2; pH; PO2; RAM; RNA; ROM; SD; SE; SEM; SSC; SSPE; TNM; ul; UV; UV-A; UV-B; UV-C; VDRL.

Ethical consent: All manuscripts reporting the results of experimental investigations involving human subjects should include a statement confirming the informed consent was obtained from each subject or subject’s guardian, after approval of the experimental protocol by a local human ethics committee.

Conflict of interest: Conflict of interest for a given manuscript exists when a participant in the peer review and publication process - author, reviewer, and editor - has ties to activities that could inappropriately influence his and her judgment, whether or not judgment is in fact affected. Financial relationships with industry (for example, through employment, consultancies, stock ownership, honoraria, expert testimony), either directly or through immediate family, are usually considered to be the most important conflicts of interest. However, conflicts can occur for other

reasons, such as personal relationships, academic competition, and intellectual passion. Public trust in the peer review process and the credibility of published articles depends in part on how well conflict of interest is handled during writing, peer review, and editorial decision making. Bias can often be identified and eliminated by careful attention to the scientific methods and conclusions of the work. Financial relationships and their efforts are less easily detected than other conflicts of interest. Participants in peer review and publication should disclose their conflicting interests, and the information should be made available so that others can judge their effects for themselves. Because readers may be less able to detect bias in review articles and editorials than in reports of original research, some journals do not accept reviews and editorials from authors with a conflict of interest.

Authors - When they submit a manuscript, whether an article or a letter, authors are responsible for recognizing and disclosing financial and other conflicts of

AAJMS [Formerly IJMS] August, 2020;3(3):205-212;ISSNe 2522-7386

211

interest that might bias their work. They should acknowledge in the manuscript all financial support for the work and other financial or personal connections to the work.

Reviewers - External peer reviewers should disclose to editors any conflicts of interest that could bias their opinions of the manuscript, and they should disqualify themselves from reviewing specific manuscripts if they believe it appropriate. The editors must be made aware of reviewers’ conflicts of interest to interpret the reviews and judge for themselves whether the reviewer should be disqualified. Reviewers should not use knowledge of the work, before its publication, to further their own interests.

Editors and staff - Editors who make final decisions about manuscripts should have no personal financial involvement in any of the issues they might judge. Other members of the editorial staff, if they participate in editorial decisions, should provide editors with a current description of their financial interests (as they might relate to editorial judgments) and disqualify themselves from any decisions where they have a conflict of interest that, in the editors’ judgment, readers should know about. Editorial staff should not use for private gain the information gained through working with manuscripts.

Corrections, retractions and expressions of concern about research findings - Editors must assume initially that authors are reporting work based on honest observations.

Permission to Reprint: Whenever a manuscript contains material (text, tables dosages, figures etc.) which is protected by copyright, it is the obligation of the author to secure written permission from the holder of the copyright.

Proofs: The research team of any study should assign one of the authors as the corresponding author. The Editorial Office will send proofs of the manuscript to the corresponding author for final proof reading and it will be the responsibility of the corresponding author to return the galley proof materials appropriately corrected within the stipulated time, proofs will not be accepted from any other of the authors without an accompanying authorization letter from the corresponding author. After the corresponding author has signed the galley proof, they will bear the burden of responsibility for any publication errors missed on the galley proof found after publication. No major changes such as deletion, shortening or expansion of sentences in the text will be accepted at this time. During the proofing process, no addition of information is allowed, however, if there new relevant information to be added to the manuscript, this can be included as an addendum to the article. The corresponding author(s) is required to sign on each page of the galley proof indicating their approval of any Editorial amendments and agree that the meaning of their article has not been altered. The author should review this carefully, as he is responsible for all changes in his work, including changes made by

AAJMS [Formerly IJMS] August, 2020;3(3):205-212;ISSNe 2522-7386

212

the copy editor. It is the duty of the corresponding author to respond promptly to any query from the Editing Department as failure to do so may result not only in delay of the article but also return of the article to the author without publication. Papers will be published only when they finally accepted manuscript signed by the corresponding author or designated corresponding author is received in the Editorial Office. If a manuscript is sent out for proofing and no response is received from the corresponding author, this manuscript will be deferred for one issue only. The proof will then be resent after one month and if there is still no response from the corresponding author at that time the paper may be withdrawn from the Journal. If the Editorial Office is able to proofread the article and answer any outstanding queries, it will be at the Editor’s discretion to proceed with the publishing of the paper including a statement that this has not been proofread by the corresponding author. If there are a substantial number of unresolved queries then the paper may be withdrawn from the Journal.

Reprints: Aalborg Academy Journal of Medical Sciences are copyright under the Berne Convention and the International Copyright Convention. All rights reserved. No part of this publication may be reproduced in any form or by any electronic or mechanical means, including information stored in a retrieval system or transmitted in any form or by any means without prior permission of the Editor.

Responsibility : Statements expressed in the International Journal of Medical Sciences reflect the views of and opinions of the authors and not the policies of the journal. The IJMS does not accept responsibility for statements made by contributors or advertisers. Advertisements, which are published in IJMS, are not endorsed by the journal.

Submit manuscripts to: Editor-in -Chief, Aalborg Academy Journal of Medical Sciences, Aalborg Academy of Sciences, Denmark.

E mail: ms@aaosjournal.com; ijms.iuaa18@gmail.com